SUJETS D'EXAMENS ~J!'-J'""~J'~~""~~J'""'I-~~ IMAITRIS~ 2ème CVCLE

Dimension: px
Commencer à balayer dès la page:

Download "SUJETS D'EXAMENS ~J!'-J'""~J'~~""~~J'""'I-~~ IMAITRIS~ 2ème CVCLE"

Transcription

1 SUJETS D'EXAMENS ~J!'-J'""~J'~~""~~J'""'I-~~ IMAITRIS~ 2ème CVCLE JUIN 2003

2 UNIVERSITE HENRI POINCARE-NANCY 1 FACULTE DES SCIENCES SUJET D'EXAMEN DIPLOME: MBCP Option Animale Durée du sujet: 2 heures Rédacteur: Professeur Thomton Epreuve de : UE 6 Physiologie et signalisation de la cellule Session de :juin 2003 Date: Horaire: 0 Documents autorisés IR]Documents non autorisés 0 Calculatrices autorisées IR]Calculatrices non autorisées Décrivez les différents types de modulation et communication présents au niveau des synapses (en comparant les neurotransmetteurs de faible poids moléculaireet les peptides neurotransmetteurs).

3 UNIVERSITE HENRI POINCARE-NANCY 1 FACUL TE DES SCIENCES SUJET D'EXAMEN DIPLOME: MBCP Option Animale Durée du sujet: 2 heures Rédacteur: Professeur Thomton Epreuve de : UE 6 Physiologiedes grandes fonctions Session de :juin 2003 Date: Horaire: 0 Documents autorisés 181Documents non autorisés 0 Calculatrices autorisées 181Calculatrices non autorisées Décrivez le fuseau neuromusculaire et sa fonction. Quels rôles jouent les différentes parties du cerveau impliquées dans le contrôle du mouvement?

4 UNIVERSITE DE NANCY 1 DIPLOME: cellulaire Epreuve d' Session de Date: Maîtrise de biologie et physiologie Immunologie Juin 2003 Durée du sujet: 2h Nom du rédacteur: A. Ropars Documents non autorisés 1 ) Expliquez le déroulement d'une allergie respiratoire (au sens large du terme) et les différents médicaments permettant de la soigner. Durée conseillée pour traiter la question: 30 mn. 2 ) Expliquez pourquoi la synthèse de cytokines et l'apoptose sont 2 phénomènes essentiels pour une réponse immunitaire efficace et contrôlée. Durée conseillée pour répondre à la question: Ih 30.

5 ~,,r t ;\. MAITRISE DE BIOLOGIE CELLULAIRE ET PHYSIOLOGIE OPTIONS«SCIENCES DE LA CELLULE ET DE L'ANIMAL» (MBCP A) ET «SCIENCESET TECHNOLOGIESDU VÉGÉTAL» (MBCPV) Epreuve de Génétique Moléculaire et Cellulaire Sujet rédigé par Elisabeth WEBER Durée: 2 heures - Sans documents IL N'EST PAS DEMANDE DE RECITER LE COURS MAIS D'UTILISER CERTAINES DONNEES POUR EXPLIQUER LES RESULTATS PRESENTES... IL N'EST PAS NON PLUS NECESSAIRE DE CONNAITRE LE NOM EXACT DES DIFFERENTS GENES ET PROTEINES IMPLIQUES DANS LES PHENOMENES DECRITS MAIS PLUTÔT DE JUSTIFIER LEUR MODE D'ACTION. Chez la levure Saccharomyces cerevisiae, 3 loci sont impliqués dans la détermination du signe conjugal, tous trois sont situés sur le chromosome III : le locus MA T, le locus HMR et le locus HML. Il existe deux formes alléliques possibles pour ces loci: la forme a qui est généralement présente au locus HMR, la forme a généralement présente au locus HML. Au locus MAT, les levures haploïdes (n) ont soit l'allèle a, soit l'allèle a. Pour pouvoir conjuguer, 2 levures n doivent porter des allèles MAT différents. Elles se reconnaissent alors par le biais de peptides spécifiques excrétés dans le milieu et de récepteurs de surface spécifiques. Les levures diploïdes qui possèdent à la fois MAT(a) et MAT(a) ne peuvent conjuguer avec aucun type de levures (phénotype«non mating»). La délétion du locus MAT(a) conduit, chez des levures n, à un phénotype «amating», c'est-à-dire que ces levures deviennent capables de conjuguer avec des levures n portant MAT(a) mais ne conjuguent plus avec des levures n MAT(a). Des levures n ayant subi la délétion de MAT(a) restent «a-mating». La délétion des loci HML et/ou HMR ne modifie pas la conjugaison des levures haploïdes, quel que soit l'allèle présent au locus MAT. Commenter et interprétez ces données. Des séquences d'environ 200 pb chacune, appelées ici AEB, ont été mises en évidence de part et d'autre des loci HMR et HML mais pas du locus MAT. Pour des levures n possédant l'allèle a au locus MAT, la délétion des séquences AEB de part et d'autre de HMR(a) conduit à un phénotype «non-mating». L'insertion de séquences AEB de part et d'autre du locus MAT conduit à un phénotype «a- mating» chez des levures n, quel que soit l'allèle au locus MAT.

6 t Comment pouvez-vous expliquer ces résultats? L'inactivation de gènes tels que SIR2, SIR3, SIR4, RAP 1 et ABFI dans des cellules haploïdesconduità un phénotype«non mating» alors que la séquencedes locimat, HMR et HML n'est pas modifiée dans ces mutants. Certaines mutations des gènes codantles histonesh4 et H3 donnentégalementun phénotype«nonmating». L'ADN génomique de souches haploïdes MAT(a), sauvages d'une part et mutantes sir d'autre part, a été utilisé pour des expériences d'hybridation ADN/ADN dans les conditions suivantes: digestion de l'adn par une enzyme ayant un seul site de coupure dans l'allèle a et hybridation avec une sonde interne à cet allèle. Les résultats suivants ont été obtenus: - si l'adn génomique a été déprotéinisé avant digestion enzymatique, l'hybridation permet de détecter 4 bandes pour l'adn de la souche sauvage comme pour l'adn des mutants sir. - Si l'adn génomique est extrait dans des conditions qui periï1et de préserver l'association spécifique de protéines à l'adn, 3 bandes majeures d'hybridation sont obtenues pour l'adn de la souche sauvage et 4 bandes majeures sont obtenues pour l'adn des mutants sir. Commentezet interprétez ces résultats. Les souches utilisées en laboratoire sont, pour la plupart, mutées dans le gène HO (génotype ho). Si par transformation, le gène HO fonctionnel est apporté dans des souches haploïdes ho, on observe au bout de quelques générations une majorité de cellules diploïdes. Comment pouvez-vous expliquer ce résultat?,- MATa +- a2 210aa _, a1 '75 aa 1 - n- - X 704 bp Ya 747 bp Z bp MATa +-. a2 119aa a1.1 I~ _12~_~a.. X 70~bp Ya 6~2 bp Z -i 328bp La protéine al est un activateur transcriptionnel ; la protéine a2 est un répresseur transcriptionnel La protéine al associée à la protéine a2 forme un répresseur transcriptionnel Isolément, les protéines al et a2 n'ont pas de rôle défini.

7 ,., ~ DaBCP Option Végétale. Biotechnologies JP Jacquot 'J/:1~ h. Pas de documents 1 les de calculette Sui te à de brillantes études à l'uni versi té Henri Poincaré, et titulaire d' illl diplôme de maîtrise BCP Option végétale, vous avez réussi à vous faire engager dans une société CE Biotechnologie dont nous tairons le nom. Votre directeur vous darande èe réaliser le proj et suivant: 1 suppr:im2r le site PvuI du plasmide pet-3d 10 pts 2 déléter le T7 tag présent entre les sites NcoI et B3IrriHI en insérant à la place un nouveau si te PvuI entre les deux si tes NcoI et B3IrriHI 10 pts Vous disposez dans les docurœnts suivants: èe la carte du plasmide et èe sa séquence en nucléotides de la séquence codante du gène arrpicilline avec la position du si te PvuI de la structure de plusieurs sites de restriction uniques. Proposez des stratégies de clonage et décrire les séquences correspondantes. Chacune des questions vaut 10 pts. A'ITENTION : LA SEX;:2UENCENUCLEDI'IDIQUE de PEI'- 3d EST CELLE DU BRIN REVERSE PAR RAPPORT A L'ENCADRE SOUS LA CARTE ID PLASMIDE PS1 Ce n'est pas pour vous embêter j1ai pris les données telles qu'elles sont présentées dans le catalcgue èe la société... PS2 Bon courage

8 .. SEQUEK::E NtJCL!DTJDJ:QUE le pet- 3d 1 TICICA'IGIT 'IGACAœITA 'l'ca'icgataagctitaa'igc OOI'AGI'ITAT 51 CN::N:JITAAATIGCI'AACGC~ CGroI'A'IGAA A'ICI'AACAAT 101 G:GCTCA'ICG 'ICA'ICCICG3 ~ CI'G3A'IœIG TNXJ::ATNr: 151 crrœrra'ig CCG3I'ACIGC CG3X.'CICIT GCG33ATA'IC GICCATICCG 201 ~ CAGICACI'ATGX:GIGCIGC TAGC.œI'ATA 'IŒ:GTIGA'IG 251 CAATI'ICI'AT œr:::r::x:œar 'l'ci'c:g3.ag:acigiccgacc G:TI'IGIXX ccœccpillc crœrcœit CGCrACI'IG3 AG:::.CJCrA'IC GN::rN:JXJ3A 351 'ICA'IG3CGACCK:N:.CCGIC CIGIOOATAT CCG3ATATAGTICCIœI'IT 401 CAG:::AAAAAAccccrcAAGA. CCCGI'1TAGA~ OOI'TA'IGCTA 451 GIT.ATIœTC ~ ~ CAGCI'ICCIT 'IC'G33:TITG 501 'ITAGCAGX'GG8.'Iœ.GACCCA'ITIGCTGIC CACCAGICAT œragc:ca'rg 551 GTATA'ICICC TICITMAGI' T~T TATI'ICTAGA ~ 601 'TGIœICICC cratagigag 'ICGI'A'ITAAT TJ:DX'G33AT CGAGA'ICICG 651 A'IœICI'ACG ~T CGIG3CCG3C A~ ~ 701 œrrgc'tg3::: OC'CI'ATA'ICG~ CGA'IG:D3AA ~ 751 G::CACI'ICG3 GCI'CA'IGAœ Gcl'lGl'l'lCG GCGIG33I'AT ~ 801 CCCGI'CDXX3aD3ACIGIT ~ 'ICCI'IœA'IG CACCATIœI' 851 'IGC:.'G:L'G3C GI'GCTCAACGOC'CICAACCI'FCr~ 'IGCI'ICCTAA 901 'TGCAG3AGICœATAPGJJA GAGCGICGACCGA'IGC.'CCITGAGAGCCI'IC 951 AN:œ:PGrCA GCI'CCTICCG GIG33C'G:.Œ mea'tgaci'a 'ICGTCGCCGC 1001 ACITA'IGACI' GICI'ICITI'A 'TCA'IGCAACI'CGr~ GJ:G:'CGGCAG c:œicig33r CATITICG3C ~ TIC.œIG3AG CGCGACGA'IG 1101 A'I'CGX.'CTGI'cœrIG::.'Cm' A~ TIGCACGCCC 'l'c'g2icaagc 1151 CI'IŒIC'ACr œrccx::gcx:::accaaacgi'it ~ CN:5:ITA'ITA 'IC'G:::CG3:AT~ ~ ACGICI'I'G:::T <D:GI'I'CG:.'G ~ G3A'IG:XX:TI' CCCCA'ITA'IG ATTCI'ICICG ~ CA'ICG33A'IG CCCG:GI'IGC ~ ~ GI'AGA'IGACG ~ N::NrITCAA G3A~ C'G32TCITAC CJ:>œcrNCr 1401 'l'cga'icaci GACC.œTGATCGTCACG:X.'GATTTA'I'GCCGCCICG3C.GAG 1451 ~ CD:IrI'G3CAT G3ATI'GI'Nr: ca::cgcccra TACCrIGI'CI' 1501 occr.cccax GI'I'G2GI'CGC œ:rœa'ig8a ~ CTCGACCIGA 1551 A~ ~ œr~t 'ICACCACICCAAGAA.TI.G3A œcaatc:aat 'ICI'I'G:G3AG AACIGIGAAT ~ ~ 1651 GAACATA'ICCA'I'CG2GICCG CCA'ICICCAG ~ ~ ~ 'IGXID:'CIG3 ~ GCA'IGA'ICGI' œrccigicg 1751 TIGAG3AœC ~ G:::ŒmITGC crtacid3it ~ 1801 A'ICACCGATA~ ~ CIGCIGCIGC AAAACGICIG 1851 CGACCIGAGCAN:AN:NlGA A'IG3ICI'ICG GITICCGIGI' TICGI'MAGI' ~ ~ cr.ccra::n::.catta'igi'tcc G3A'ICIœAT 1951 CG::J:G:lArr.r:r.'J:œI'G:rrAC CCIGIG3AAC ACCI'ACA'ICT GI'ATTAACGA 2001 ~ TIGACCC'IGA GIGATI'ITIC 'ICIG3ICCCG CCGCA'ICCAT N:.CœCN:JIT GrITACCC'TC N::AN:.GITCC IDrAAC.CG0:3 CA'IGI'ICA'IC 2101 KI.'ClGrNCC CGrA'IŒIGA GCA'ICCI'CTC 'ICGITI'CA'IC OOI'A'ICATTA 2151 c:ccc:x:a'igaacjgan:(iccc CC'ITACACG} NXJ::A'ICIDr GNx:AAN:AG 2201 GAAJ:.N.P.œG CCCITAACATm::cc.œ:rrr A~ AGN:::NITAPC 2251 GCI'I'CJ:'mAG AAlCICAACG ~ G3A~ œ.agn::arrcr 2301 GIGAA'ICœI' ~ GCIGA'IGAGC TTTACC.œAG cro:::.acg::x; 2351 C'GI'I'ICG3TGA'IGACG3TGAAACCICIGA~ 'TCXX:G3AGAC 2401 G3ICACAœI' 'IGICIGI'AAG CG3ATG:::.'CG3~ G:X:CGI'C'AG ~ G33I'GI'ID3C ~ ~T GN:.CC:PaICA

9 w ~~~~~~~~~~~~~wwwwwwwwwwwwwwwwwwww~~~~~~~~~~ ~. m~~~~ww~~~~oo~~oooo~~mm~~~~ww~~~~oo~~oooo~~mm~~ ~ o~o~o~o~o~o~o~o~o~o~o~o~o~o~o~o~o~o~o~o~o~o i illiiillliiüiliiili~liliillilii~lll i UlIlIUIIUrllllUllllIlUlIlIUUnUI t ; iluiiuiuliliuuulilliluiunul 1lililiiIIIIUUIUIIIIUIUIUIUIII

10 ~ Sites de restriction. AatII BamHI EgIII FcoRI MscI NcoI PvuI PvuII SalI ScaI Spb1 SspI gacg'ic gga'icc AgA1CT gaattc TggCCA CCATgg CgA'ICg CagCl'g g'icgac AçfrACr gcatgc AATA'IT

11 ~ SE(UEN:E TRAIDITE ID GENE b1a CODANT'RJJR LA RESISTAN:E AL' AMPICILI.JNE 1/1 31/11 A'IGlGrA'ITCMCATTICc:mGICG:CcrrATI'CCCTITTITCD3œATIT'Iœcrrœr ~~ili~~~~~~~~~~~~~~~~~ 61/21 91/31 GITTITœrCK:.CCAClN>.l>ŒCIGGIGA»..GrAA»..GATœI'GPAGATCAGTIGOOI'<rA ~~~~~~~~~~~~~~~~~~~~ 121/41 151/51 CGAGIGG3I'TACA'ICClN>.CIGGATCICNCJ:.œG3l'ANJrA'ICcrrG.ZIBlGrTITm::cœ ~~~~ili~~~~~~~~ili~~~~~~ 181/61 211/71 ClN>.GPA cm TIT CCA A'IG A'IG.Kr. K:r TIT A».. GIT CIG cm 'IGI'G3: CD3 GrA Tm 'ID: ~~~~~~~~~~~~~~~~~~~~ 241/81 271/91 CJ:TI.GITŒCG:CG33CMG.ZIBCMCICG3l'm::m::ATACK:.'mT'ICI'CAGl>KrŒCTIG ~~~~~~~~~~~~~~~~~~~~ 301/ /111 GITG.ZIBTAC'ICACCAGICJ:CAGPAAN.;CATcrrl>ŒGATG3:A'IGJ:CAGrANlAGPA'rIA ~~~~~~~~~~~~~~~~~~~~ 361/ /131 'IœlGrœrG:C~~A'IGlGrGATNCK:rCD3G:CNCTmcrrCIGJ:CA~~ ~~~~ili~~~~~~~~~~~~~~ili 421/ /151 ~~~AN.;G.Z\1}cm~œI'TITTIG~NC~~GATCATGrAK:rm::m ~~~~~~~~~~~~~~~~~~~~ 481/ /171 GATCGI"IG3GPA~G.Z\1}CIGl>KrClN>.G:CATACCANCGK:.G.ZIBc:mGK:.~l>ŒA'IG ~~~~~~~~~~ili~~~~~~~~~ 541/ /191 ccrœaœaa'igœaj:cal>œtigcg:a»..cmtmk:rg3:gpacmcrrk:rcmœr ~~~~~~~~~~~~~~~~~~~~ 601/ /211 'ICCœ;CMCM'ITA~GK:.'IG3A'IGG.ZIBCD3GATA»..GITœA~CCAcrrCIGcœ ~~~~~ili~~~~~~~~~~~~~~ 661/ /231 'IŒG:CmCCGœrcn::'IG3TITATI'œI'GATA»..'ICI'~G:CG3l'G.ZIBc:m~'ICI' ~~~~~~~~ili~~~~~~~~~~~ 721/ /251 cœooi'a'ica'itœaœacigg33ccagatooi'anjrccc'iccc:ma'icgragita'ictac ~~iliili~~~~~~~~~~~~~~ili~ 781/ /271 NJ:3NJ:3G33lGrCAGœAPCrA'IGGATGPACGAl>KrNlACAGA'ICœI'G.ZIBATAOOI'm:: ~~~~~~~~~~~~~~~~~ili~~ 841/281 'ICA CIG A'IT AN.; 00' 'IG3 TM ~ leu ile lys bis ~ stc:p

12 pet-3a-dvectors pet-3a pet-3b pet-3c pet-3d DNA DNA DNA DNA Cal.No TB026 12/98 The pet-3a-d veetors carry an N-terminal T7oTagœsequence and BamH 1cloning site. These veetors are the precursors to many pet family vectors; the pet-23a-d(+) series corresponds to pet-3a-d but incorporates several additional features. Unique sites are shown on the circle map. Note that the sequence is numbered by the pbr322 convention, so the T7 expression region is reversed on the circular map. The c1oninglexpression region of the coding strand transcribed by T7 RNA polymerase is shown below. pet-3asequencelandmarks T7 promoter T7 transcription start T7 otag coding sequence T7 terminator pbr322 origin bja coding sequence EcoR 1(4638) Apo 1(4638) Gia 1(24) Hind 111(29) The mars for pet-3b, pet-3c and pet-3d are the same as pet-3a (shown) with the following exceptions: pet-3b is a 4639bp plasmid; subtract Ibp from each site beyond BamH 1at 510. pet-3c is a 4638bp plasmid; subtract 2bp from each site beyond BamH 1 at 510. pet-3d is a 4637bp plasmid; the BamH 1site is in the same reading Crame as in pet-3c. An Nco 1site is substituted for the Nde 1site with a net 1bp deletion at position 550 of pet-3c. As a result, Nco 1 cuts pet-3d at 546. For the rest ofthe sites, subtract 3bp from each site beyond position 551 in pet-3a. Nde 1 does not eut pet-3d. pet-3a (4640bp) Sph 1(843) EcoN 1(903) Sall(928) PshA 1(993) Eag 1(1216) Nru 1(1251) ApaB 1(1329) BspM 1(1331) BspLU11 1(2752). Afllll(2752) Sap 1(2636) 6st11071(2523) 6saA 1(2504) Tth111 1(2497) 6sm6 1(2393) Pvu 11(2343) Bsm 1(1636) Ava 1(1702) Msc 1(1723) Bpu10 1(1858) BscG 1(1912) 17 promoter primer # ~ Bg/II 17promoter.. Xbal ~ AGA TCTCGA TCCCGCGAAA TT AA T ACGACTCACT ATAGGGAGACCACAACGGTTTCCCTCT AGAAA T AA TTTTGTTT AACTTT AAGAAGGAGA ~ 17oTag pet-30 BamH! Bpu11021 TA TACA T ATGGC TAGCA TGACTGGTGGACAGCAAA TGGGTCGCGGA TCCGGC TGCT AACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCAiiGCTGAGCAA TAAëTï::GëATÀA MetA 1oSerMetThrG 1yG 1yG 1nG 1nMetG 1yArgG 1ySerG 1yCysEnd 17 terminator Drimer # AACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAA T AAC TAGCA T pet -3b. GGTCGGGA TCCGGC TGCT A pet-3d Neo!. GI yargaspproaloa leasnlysai earglysg 1uA log 1uLeuA 1cA loa 1oThrAI cg lug InEnd TGGCT AGC. MetAleSer.. pet-3c.d. GGTCGGA TCCGGCTGC T AACAAAGCCCGAAAGGAAGCTGAGTTGGC TGC TGCCACCGCTGAGCAA T AACT AGCA T AA. G 1yAro!1 earoleuleuthrlysprog 1uArqLysLeuSerTroLeuLeuPrcProLeuSerAsnAsnEnd. T ACCA 17 termtnator CCCC TTGGGGCC TCT AAACGGGTCTTGAGGGGTTTTTTG pet-3a-dcloning/expression region

13 t pet.3arestrictionsites TB026 12/98 Enzyme 'Sites Locations E e ' Sites Locations E ' Sites Locations Aatll Cac81 32 Pvul Acel Cjel 18 Pvull Aeelll CjePI 22 Real Aeil 86 Cial 1 24 Rsal Mill CviJl 79 Sal! Alul 18 CviRI 21 Sapl Alwl 14 Odet Sau Alw Sau3AI Opnl 25 Seal Alw Oral SerFI 16 AlwNl Osai SlaNI 22 ApaBI Eael Stel Apol SgrAI Aval Eagl Sphl Aval! Eam Sspl Earl Styl BamHI Eeil Taql Bani Ee Eco Taqll BanI! EeoNI Bbsl EeoO1O Tfii Bbvl 24 EeoRI Becl EeoRII Thal Tsel 24 Bce EeoRV Tsp Faul Beell Fokl 12 Tsp Bcgl Fspl Gdill T!h Btal Hael Tth UbaJi 21 8g Haell 11 Vspl g Haelll 23 Xbal Bpml Hgal 11 Xmnl Bpu HgiEIi Bpu Hhal 31 Enzymes!hatdonetcutpET-3a: Bsal Hin MI! Agel Apal Ascl Avrl! BsaAI Hinell Bael Bcll Bmgl BsaXI BseRI BsaBI Hindlll 1 29 BsrGI BssHII BstEIi BstXl Bsu361 BsaHI Hinfi 11 Oralll Ordl! Fsel Hpal Kpnl 4564 Hphl 12 Mlul Muni Neol Notl Nsil BsaJl Maell NspV Pacl Pmel PmI! RleAl Rsrll Sael Saell SexAl Sfil BsaWI Maelll 17 Sgfi Smal Sna81 Spel Srtl 3936 Mboll 11 Sse83871Stul Sunl Swal Xeml Bsbl Mmel Xhol BscGI Mnl! 30 Bsil Mscl BsiEI Msel Msl! Bsl! Bsml Mspl 28 BsmAl MspA BsmBI BsmFI Mwol 37 B5OFI 45 Narl Bsp Neil Bsp Ndel NgoAIV BspEI Nhel BspGI Nlalll 27 BspLU NlalV 25 BspMI Nrul Bsrl 20 Nspl srBI P BsrOI PfiMI BsrFI Plel PshAl Bstll Psp BstYI Psp Pstl

14 Durée UNIVERSITE HENRI POINCARE, NANCY 1 FACULTE DES SCIENCES SUJET D'EXAMEN DIPLOME: Maîtrise de Biolologie 1 cellulaire et Physiologie - option Science et technologie du végétal 2 heures Epreuve de : Réponses l'environnement Session: Juin 2003 Date: Horaire: Traitez les questions suivantes: des plantes à 1 Nomdu rédacteur: P. Dizengremel DDocuments autorisés ŒJDocuments non autorisés ŒJCalculatrices autorisées DCalculatrices non autorisées 1) La Figure 1 présente la réponse de plusieurs paramètres hydriques et métaboliques de feuilles de plants de Tournesol soumis à un déficit hydrique progressif. Commentez les résultats obtenus. (a) g,~ ~- 2 -'- "E'"" : 1.5 ~ ~ 1.\1 ëe 0.5 ès 2.5 / -0- OsmotlC pressure Turgor (b) ci -; 0.6 ~ '" -g "E " <ii ùj Figllre -1.Theeffectofexpos<I"ta increasingwaterdeficit(leafwaterpotential, MPa)on water relations, gas exchangeand R<lBPcontentof s<lnflower(helianthus... c, c: 1500 annuus L) leaves with 0.35 mmol CO2 mor' air and 1200 mmol m-2,,' plloto syntheticaliy active radiation. (a) Osmotic presstlre and t<lrgo' (b) Stomatal " conductance (mol m-2,,') and intereeliular CO2 concentration (}.Lmolmar'). 300 (c) Photosynthetic rate (}.Lm01 m-2 s-i) and rib<llosebisphosphate (R<lBP, }.Lmolm-2) 0 " (after Cimenez et al., 1992; Gimenez and Lawlo <lnp<lblished) ffi 100 ïj " (c) 50 ~ 40 '" 16 ~ 30 ~ ~ 20 ~" A RuBP "- 75 cc cr: Water patential (MPa) 2) L'effet de l'ozone sur les végétaux supérieurs a fait l'objet de nombreuses expériences dont certaines, menées sur des espèces différentes, sont décrites ci-dessous: - de jeunes plants de pin loblolly (Pinus taeda) ont été placés pendant 3 ans dans des chambres à ciel ouvert soumises soit à de l'air filtré (CF), soit à de l'air ambiant (NF = non filtré), soit à de l'air enrichi 2 fois en ozone (2x) par rapport à l'air ambiant (ce qui correspond à 92 ppb ou nll-1 pendant 12h par jour au cours de la saison de croissance d'avril à Octobre). La Figure 2 présente l'activité photosynthétique (A) et l'activité de la Rubisco (B) mesurées chez des aiguilles du premier "flush" de l'année 1989 (89-1), du 3ème"flush" de l'année 1989 (89-3) ainsi que du premier "flush" de l'année 1990 (90-1). Les résultats sont exprimés par rapport à la dose cumulée d'ozone depuis le début de l'expérience. A

15 - la Figure 3 présente les résultats de quantités de protéines des 2 sous-unités de la rubisco:. la LSU dans des aiguilles de 1 an lors d'exposition de pins d'alep pendant 24 jours à 200 nll-1 d'ozone (fig. 3A, C: contrôle sans ozone, 03: exposition à l'ozone). la SSU, dans de jeunes feuilles, lors d'exposition pendant 3 semaines de haricots à une concentration en ozone dans l'air ambiant augmentée de 80 ppb (ou nll-1) (fig. 3B, NF = non filtré ou air ambiant; + 80, en présence d'ozone); l'expérience est répétée 3 fois (3 pistes). - la Figure 4 présente les résultats de l'effet de l'ozone sur les quantités de transcrits des 2 sous-unités de la rubisco:. les transcrits rbcl obtenus au jour 24 de traitement, dans des aiguilles âgées d'1 an de pins d'alep soumis pendant 24 jours à 200 nll-1 d'ozone (fig. 4A. C: contrôle sans ozone, 03 : exposition à l'ozone). les transcrits rbcs obtenus au jour 21 de traitement, dans des aiguilles âgées d'l an d'épicéas soumis pendant 24 jours à 200 nll-1 d'ozone (fig. 4B. C: contrôle sans ozone, 03: exposition à l'ozone) 120 ~ 100 * '-' <U.~ :> CIJ 80.~ ~ <U ::: ~ ~ 40 0 c A B 100 ïo!:p.. 80 ê. 60 ~ ~ >- g i:l Cumulative Ozone Exposure (ppm.h) () _. CIJ -. () :::.0 «20 ~ 0 ~ '-'. R 89-1 CF. R 89-1 NF c R 89-12x ~ R 89-3 CF. R 89-3 NF 0 R x Ji.. R 90-1 CF ~ R 90-1 NF + R x tr z /A'\ Proteins A. ~ LSU ~' c NF +80 " \1 \.~][fj ~, '..... Rubisco,~,..:,,,' 4E -ssu Transcripts rbcl c clay rbcs C 03 of=l ~~ 4-2.

16 - la Figure S présente les résultats d'activités enzymatiques déterminées soit:. sur les aiguilles des pins loblolly (Fig. SA, même traitement que Figure 2). sur les aiguilles d'épicéa (Fig. SB, même traitement que Figure 4B). sur les aiguilles de pin d'alep (Fig. SC, même traitement que Figures 3A et 4A). - la Figure 6 montre les résultats des effets de l'ozone sur les pins d'alep au niveau de la quantité de protéines et de transcrits de la phosphoénolpyruvate carboxylase (aujour 24 du traitement, identique à celui rencontré dans les figures 3A, 4A et SC) Commentez soigneusement l'ensemble des résultats et fournissez une hypothèse d'action de l'ozone sur le métabolisme carboné primaire foliaire. 2001,-.,, * '-' >.. -.::: <:J -< 100 Q,)... -.::: CIl a:; =- ~ Photosynthesis ~ Rubisco G6PDH = glucose 6 phosphate déshydrogénase Cumulative Ozone Exposure (ppm.h) PFK = phosphofructokinase PEPC = phosphoénolpyruvate PK = pyruvate kinase carboxylase NADP-ME = enzyme malique à NADP NAD-ME = enzyme malique à NAD ,.., ~ 0 'B 0 0\1...:: '; 0:; CI:: 0 PFK. Fumarrase 0 G6PDH. PEPC ~. :~ ụ i;.. o:i ~ 1 0-1)?~ 1 riu..j-~ '"' 1: Daysof Ireahnent ho t s ~f~';~ PEPe ~:y; ~;.. --_._-- c 03 pepe ~ r:- I\\~v'v'-- (; 7~~ V\,t:; c 03 3

17 UNIVERSITE HENRI POINCARÉ, NANCY 1 FACULTÉ DES SCIENCES et TECHNIQUES SUJET Diplôme: Maîtrise de Biologie Cellulaire et Physiologie Mention: Génétique Moléculaire et Cellulaire Epreuve de: Bioloqie du Développement Session de :juin 2003 Date: Horaire' D'EXAMEN Durée des sujets: Ih Nom du rédacteur: Professeur Michel DAUÇA [ ] Documents autorisés [X] Documents non autorisés [ ] Calculatrices autorisées [X] Calculatrices non autorisées Maîtrise de Biologie Cellulaire et Physiologie Génétique Moléculaire et Cellulaire Génétique du Développement Sujet de Monsieur le Professeur M. DAUÇA A partir de quelques exemples de votre choix, vous montrerez la diversité chez la drosophile des mécanismes régulant l'expression des gènes du développement et des fonctions exercées par les protéines codées par ces gènes. NB: Les sujets de Monsieur le Professeur Michel DAUÇA et de Monsieur Bertrand AIGLE sont à traiter sur des copies séparées. Il sera tenu compte de la qualité de la rédaction et de l'illustration ainsi que de la maîtrise de l'orthographe.

18 UNIVERSITE HENRI POINCARÉ, NANCY 1 FACULTÉ DES SCIENCES et TECHNIQUES SUJET D'EXAMEN Diplôme: Maîtrise de Biologie Cellulaire et Physiologie Mention: Génétique Moléculaire et Cellulaire Epreuve de : Bioloqiedu Développement Session de :juin 2003 Date: Horaire. Durée des sujets: Ih Nom du rédacteur: Bertrand AIGLE [ ] Documents autorisés [X] Documents non autorisés [ ] Calculatrices autorisées [X] Calculatrices non autorisées Maîtrise de Biologie Cellulaire et Physiologie Génétique Moléculaire et Cellulaire Génétique du Développement Voir sujet ci-joint Les sujets de Monsieur le Professeur Michel DAUÇA et de Monsieur Bertrand AIGLE sont à traiter sur des copies séparées.

19 Examen MGMC, juin 2003 Génétique du développement Sujet de cours proposé par B. Aigle Durée 1 heure, aucun document n'est autorisé Justifiez vos réponses et soyez clairs et concis! La sporulation chez la bactérie Bacillus subtilis est gouvernée par une série de facteurs de transcription qui sont soumis à des régulations spatiales et temporelles. La phase d'initiation est contrôlée par la protéine SpoOAqui est considérée comme le régulateur clé pour l'entrée dans la voie de sporulation. Des travaux ont été menés afin de déterminer si SpoOA pourrait avoir éventuellement d'autres rôles que ceux décrits jusqu'à présent. Dans un premier temps, le gène de la GFP ("green fluorescent protein") a été placé sous le contrôle des promoteurs PspoIlGet Pspacc. Pspaccest un promoteur constitutif alors que PspoIlG(promoteur de l'opéron spolie) est sous le contrôle de la forme active de SpoOA. Les cellules de B. subtilis ont été analysées pour la présence de fluorescence (Fig. 1) trois heures après l'entrée dans le processus de sporulation (stade d'engouffrement -"engulfment"- atteint). GFP Po;pollG-gfp P spac C-gfp Fig. 1 : Localisation subcellulaire de la GFP. La fluorescence apparaît ici sous forme blanche. La barre blanche = 1/lm. 11 Interprétez les résultats obtenus Fig. 1. SpoOA est-elle uniquement active pendant la phase d'initiation de la sporulation? Remarque: la transcription à partir des deux promoteurs est due à la même forme de l'arnpolymérase (celle contenant le facteur sigma principal, cra). Des anticorps anti-spooa ont été utilisés afin de rechercher la présence éventuelle postdivisionnel. Les résultats sont montrés Fig. 2. de SpoOA dans le sporangium 2/ Interprétez. Ces résultats sont-ils compatibles avec ceux présentés Fig. 1? Remarque: l'utilisation d'anticorps anti-cramontre des signaux d'intensité très similaire entre le compartiment «forespore» et le compartiment cellule-mère «<mother cell»). 2h Fig. 2 : Localisation subcellulaire de SpoOA. Les cellules sporulantes de la souche sauvage sont collectées à différents temps après le début de la sporulation et observées par microscopie. La protéine SpoOA est détectée par immunofluorescence à l'aide d'anticorps anti-spooaet d'un anticorps secondaire lié au FITC (fluorophore vert). Les cellules représentatives sont entourées par les rectangles et les flèches indiquent la localisation de la «forespore» au niveau de ces cellules. La barre blanche = l/lm 3h 4h

20 CI ~,/1,:t: )1...1,~; UNIVERSITE HENRI POINCARE, NANCY 1 FACULTE DES SCIENCES SUJET D'EXAMEN DIPLOME: Maîtrise de Biologie Cellulaire et Physiologie iopn'orf:sc..'c..~cj-tcùl"",ljj,,k d,... "'~~hsi Epreuve de :. Interactions Plantes Microorganismes Session: Date: Horaire: Durée du sujet: 2 heures Nom du rédacteur: B.BOITON DDocuments autorisés IIDDocumentsnon autorisés IIDCalcu1atricesautorisées DCalcu1atrices non autorisées Dans le but de comparer l'assunilationde l'ammonium chez les ectomycorlrizesde Hê1re(Fig. 1) et d'epicéa (Fig. 2 et 3), celles-ci ont été incubées dans un milieu de culture renfermant de l'ammoniummarqué à l'isotope l~, en présence ou en absence de Méthionine sulfoximine (MSX). A partir des cinétiques d'accnmul$on des composés dans la celluleet de l'enrichissementisotopique des acides aminés, déduire les voies métaboliques d'incorporation de l'ammonium dans les composés organiques et les enzymes impliquées, pour chacun des deux types de mycorhizes. (1'~ès 2. et 3 jointes)

21 ~ ).,? \,(c; t....- ~ ~ ~600 Z ~ ~ = 0.- ~ ~0 u ~ 501'.".'. ~ Z 800 ~.5 30 ~vi Time (h) 6 8 Figure 1 : Effect of anmonium feeding and 1 mm MSX on the levels on intracellularariunonium(inset:. ~). total tree aminoacids(ii.[j) and glutamine (8. 0) in ectomycorrhizas of Fagus sylvatica. Open symbols. without MSX; closed symbols. withmsx...'..

22 e =' 1: J : ~ ' ~ 1.4 -!: A ~ f";' '" t". ",0;1 ri) "0... g~l1 0" 12'~.~ ~ 10 e;)~-!: ~ : (Ü - 8 ~ 3 6 9' ' Incubation period (h), 18 Figure 2. Effect of ammoniumfeedd1gon the-leveis of the h1tracelluiarammonium (A) and the total free amino acid pool (B). The ~hed spruce-hebe1oma sp. ectomycorrbizas collected!rom a nursery were incubate4 in Pachlewski's medium conn.ining 5 mm ammonium sulphate (50 atom % excess,cea France), without enzymeb1hibitor~~wdh2smmmsx œ '" ':,' SOLA B 40 ~z Incubation period (h) 18 Figure 3. Tune course of lsn incoiporationin the amido-n of glutamine (0), the amino-n of glutamine(e), glutamate(8), y-aminobutyricacid (+) and alanine (A)of spmce ectomycorrhizas fed with 5 mm ls~2s04 (50 Item % excess, CEA France).The detachedspmce-hebeloma sp. ectomycorrhizascollected from a nursery were incubated in Pachlewski's medium, without enzymeinhibitor(a) or containing2.5 mmmsx (B).

23 Epreuve de 'P.~j).QLb. LE,.". UNIVERSITE DE NANCY l FACULTE DES SCIENCES ET TECHNIQUES DIPLOME (1:(~.t1: 1:.1:$ {;.'13,:tJ SUJET M.~..13.~...P..~..f:...f!!... (I?ii.f?...B İ.. L( Cf /JI (II oi e.f...f".~~~.5a;h1-~ S.' "/ <> ' 6J.p ri. 0. Vl....ni{.8.P.t=$.... Ii. T... E. ev.ry f., EI:t ~.. ti)iu~ f. T.l ~ Session de Ji..J.~M 2..~~.~... Date,... Horaire, '.'." '. D'EXAMEN J tf Durée du sujet 2.: ~ Nom du rédacteur r:e.l.(f.~.ky... Documents autorisés ~ 1 NON 1 (1) Calculatrices autorisées L OUI linon 1 (1) (lt Rayer la mention inutile 1.- Question principale (temps conseillé: 1 heure 30) Les transferts de D1atière dans les quatre processus fondamentaux de pédogenèse des principales zones bioclimatiques: facteurs, mécanismes et résultats questions à réponses brèves go minutes) : CD Dans quels sols se forme la Caractères essentiels d'un humus de type Qu'est-ce qu'une les trois caractéristiques d'une "structure Pourquoi les nitrates sont-il entraînés rapidement dans les eaux de drainage?

Cours de mathématiques - Alternance Gea

Cours de mathématiques - Alternance Gea Cours de mathématiques - Alternance Gea Anne Fredet 11 décembre 005 1 Calcul matriciel Une matrice n m est un tableau de nombres à n lignes( et m colonnes. 1 0 Par exemple, avec n = et m =, on peut considérer

Plus en détail

Calcul différentiel sur R n Première partie

Calcul différentiel sur R n Première partie Calcul différentiel sur R n Première partie Université De Metz 2006-2007 1 Définitions générales On note L(R n, R m ) l espace vectoriel des applications linéaires de R n dans R m. Définition 1.1 (différentiabilité

Plus en détail

Fonctions de plusieurs variables

Fonctions de plusieurs variables Module : Analyse 03 Chapitre 00 : Fonctions de plusieurs variables Généralités et Rappels des notions topologiques dans : Qu est- ce que?: Mathématiquement, n étant un entier non nul, on définit comme

Plus en détail

Université Joseph Fourier MAT231 2008-2009

Université Joseph Fourier MAT231 2008-2009 Université Joseph Fourier MAT231 2008-2009 mat231-exo-03.tex (29 septembre 2008) Feuille d exercices n o 3 Exercice 3.1 Soit K un corps commutatif et soit {P 0, P 1,... P n } une famille de polynômes de

Plus en détail

Calculs approchés d un point fixe

Calculs approchés d un point fixe M11 ÉPREUVE COMMUNE DE TIPE 2013 - Partie D TITRE : Calculs approchés d un point fixe Temps de préparation :.. 2 h 15 minutes Temps de présentation devant les examinateurs :.10 minutes Dialogue avec les

Plus en détail

1 ère partie : tous CAP sauf hôtellerie et alimentation CHIMIE ETRE CAPABLE DE. PROGRAMME - Atomes : structure, étude de quelques exemples.

1 ère partie : tous CAP sauf hôtellerie et alimentation CHIMIE ETRE CAPABLE DE. PROGRAMME - Atomes : structure, étude de quelques exemples. Référentiel CAP Sciences Physiques Page 1/9 SCIENCES PHYSIQUES CERTIFICATS D APTITUDES PROFESSIONNELLES Le référentiel de sciences donne pour les différentes parties du programme de formation la liste

Plus en détail

THEME 2. LE SPORT CHAP 1. MESURER LA MATIERE: LA MOLE

THEME 2. LE SPORT CHAP 1. MESURER LA MATIERE: LA MOLE THEME 2. LE SPORT CHAP 1. MESURER LA MATIERE: LA MOLE 1. RAPPEL: L ATOME CONSTITUANT DE LA MATIERE Toute la matière de l univers, toute substance, vivante ou inerte, est constituée à partir de particules

Plus en détail

CHAPITRE 3 LA SYNTHESE DES PROTEINES

CHAPITRE 3 LA SYNTHESE DES PROTEINES CHAITRE 3 LA SYNTHESE DES ROTEINES On sait qu un gène détient dans sa séquence nucléotidique, l information permettant la synthèse d un polypeptide. Ce dernier caractérisé par sa séquence d acides aminés

Plus en détail

Chapitre 1 Régime transitoire dans les systèmes physiques

Chapitre 1 Régime transitoire dans les systèmes physiques Chapitre 1 Régime transitoire dans les systèmes physiques Savoir-faire théoriques (T) : Écrire l équation différentielle associée à un système physique ; Faire apparaître la constante de temps ; Tracer

Plus en détail

Sujet proposé par Yves M. LEROY. Cet examen se compose d un exercice et de deux problèmes. Ces trois parties sont indépendantes.

Sujet proposé par Yves M. LEROY. Cet examen se compose d un exercice et de deux problèmes. Ces trois parties sont indépendantes. Promotion X 004 COURS D ANALYSE DES STRUCTURES MÉCANIQUES PAR LA MÉTHODE DES ELEMENTS FINIS (MEC 568) contrôle non classant (7 mars 007, heures) Documents autorisés : polycopié ; documents et notes de

Plus en détail

L'UTILISATION DU MICRO-ORDINATEUR EN TP

L'UTILISATION DU MICRO-ORDINATEUR EN TP 63 L'UTILISATION DU MICRO-ORDINATEUR EN TRAVAUX PRATIQUES DE SCIENCES NATURELLES Perspectives pour une Expérimentation Assistée par Ordinateur (EX.A.O.) Serge CESARANO, André VIDEAUD I- OBJECTIFS DE L'EXPÉRIMENTATION

Plus en détail

Théorème du point fixe - Théorème de l inversion locale

Théorème du point fixe - Théorème de l inversion locale Chapitre 7 Théorème du point fixe - Théorème de l inversion locale Dans ce chapitre et le suivant, on montre deux applications importantes de la notion de différentiabilité : le théorème de l inversion

Plus en détail

Programme de mathématiques TSI1

Programme de mathématiques TSI1 Programme de mathématiques TSI1 1. PROGRAMME DE DÉBUT D ANNÉE I. Nombres complexes et géométrie élémentaire 1. Nombres complexes 1 2. Géométrie élémentaire du plan 3 3. Géométrie élémentaire de l espace

Plus en détail

Optimisation non linéaire Irène Charon, Olivier Hudry École nationale supérieure des télécommunications

Optimisation non linéaire Irène Charon, Olivier Hudry École nationale supérieure des télécommunications Optimisation non linéaire Irène Charon, Olivier Hudry École nationale supérieure des télécommunications A. Optimisation sans contrainte.... Généralités.... Condition nécessaire et condition suffisante

Plus en détail

Perrothon Sandrine UV Visible. Spectrophotométrie d'absorption moléculaire Étude et dosage de la vitamine B 6

Perrothon Sandrine UV Visible. Spectrophotométrie d'absorption moléculaire Étude et dosage de la vitamine B 6 Spectrophotométrie d'absorption moléculaire Étude et dosage de la vitamine B 6 1 1.But et théorie: Le but de cette expérience est de comprendre l'intérêt de la spectrophotométrie d'absorption moléculaire

Plus en détail

Prévisions des eaux de drainage & programme d essai de lixiviation des métaux: pratiques actuelles

Prévisions des eaux de drainage & programme d essai de lixiviation des métaux: pratiques actuelles Février 2012 Prévisions des eaux de drainage & programme d essai de lixiviation des métaux: pratiques actuelles CONFIDENTIEL Sommaire Mise en contexte sur DMA / LM Objectifs du programme de DMA / LM Composantes

Plus en détail

G.P. DNS02 Septembre 2012. Réfraction...1 I.Préliminaires...1 II.Première partie...1 III.Deuxième partie...3. Réfraction

G.P. DNS02 Septembre 2012. Réfraction...1 I.Préliminaires...1 II.Première partie...1 III.Deuxième partie...3. Réfraction DNS Sujet Réfraction...1 I.Préliminaires...1 II.Première partie...1 III.Deuxième partie...3 Réfraction I. Préliminaires 1. Rappeler la valeur et l'unité de la perméabilité magnétique du vide µ 0. Donner

Plus en détail

Structures algébriques

Structures algébriques Structures algébriques 1. Lois de composition s Soit E un ensemble. Une loi de composition interne sur E est une application de E E dans E. Soient E et F deux ensembles. Une loi de composition externe

Plus en détail

À propos des matrices échelonnées

À propos des matrices échelonnées À propos des matrices échelonnées Antoine Ducros appendice au cours de Géométrie affine et euclidienne dispensé à l Université Paris 6 Année universitaire 2011-2012 Introduction Soit k un corps, soit E

Plus en détail

DIFFRACTion des ondes

DIFFRACTion des ondes DIFFRACTion des ondes I DIFFRACTION DES ONDES PAR LA CUVE À ONDES Lorsqu'une onde plane traverse un trou, elle se transforme en onde circulaire. On dit que l'onde plane est diffractée par le trou. Ce phénomène

Plus en détail

Projet CLANU en 3GE: Compléments d algèbre linéaire numérique

Projet CLANU en 3GE: Compléments d algèbre linéaire numérique Projet CLANU en 3GE: Compléments d algèbre linéaire numérique Année 2008/2009 1 Décomposition QR On rappelle que la multiplication avec une matrice unitaire Q C n n (c est-à-dire Q 1 = Q = Q T ) ne change

Plus en détail

TP : Suivi d'une réaction par spectrophotométrie

TP : Suivi d'une réaction par spectrophotométrie Nom : Prénom: n groupe: TP : Suivi d'une réaction par spectrophotométrie Consignes de sécurité de base: Porter une blouse en coton, pas de nu-pieds Porter des lunettes, des gants (en fonction des espèces

Plus en détail

Cours d Analyse. Fonctions de plusieurs variables

Cours d Analyse. Fonctions de plusieurs variables Cours d Analyse Fonctions de plusieurs variables Licence 1ère année 2007/2008 Nicolas Prioux Université de Marne-la-Vallée Table des matières 1 Notions de géométrie dans l espace et fonctions à deux variables........

Plus en détail

Sujet. calculatrice: autorisée durée: 4 heures

Sujet. calculatrice: autorisée durée: 4 heures DS SCIENCES PHYSIQUES MATHSPÉ calculatrice: autorisée durée: 4 heures Sujet Spectrophotomètre à réseau...2 I.Loi de Beer et Lambert... 2 II.Diffraction par une, puis par deux fentes rectangulaires... 3

Plus en détail

NOTATIONS PRÉLIMINAIRES

NOTATIONS PRÉLIMINAIRES Pour le Jeudi 14 Octobre 2010 NOTATIONS Soit V un espace vectoriel réel ; l'espace vectoriel des endomorphismes de l'espace vectoriel V est désigné par L(V ). Soit f un endomorphisme de l'espace vectoriel

Plus en détail

β-galactosidase A.2.1) à 37 C, en tampon phosphate de sodium 0,1 mol/l ph 7 plus 2-mercaptoéthanol 1 mmol/l et MgCl 2 1 mmol/l (tampon P)

β-galactosidase A.2.1) à 37 C, en tampon phosphate de sodium 0,1 mol/l ph 7 plus 2-mercaptoéthanol 1 mmol/l et MgCl 2 1 mmol/l (tampon P) bioch/enzymo/tp-betagal-initiation-michaelis.odt JF Perrin maj sept 2008-sept 2012 page 1/6 Etude de la β-galactosidase de E. Coli : mise en évidence d'un comportement Michaélien lors de l'hydrolyse du

Plus en détail

Calcul matriciel. Définition 1 Une matrice de format (m,n) est un tableau rectangulaire de mn éléments, rangés en m lignes et n colonnes.

Calcul matriciel. Définition 1 Une matrice de format (m,n) est un tableau rectangulaire de mn éléments, rangés en m lignes et n colonnes. 1 Définitions, notations Calcul matriciel Définition 1 Une matrice de format (m,n) est un tableau rectangulaire de mn éléments, rangés en m lignes et n colonnes. On utilise aussi la notation m n pour le

Plus en détail

AGREGATION DE BIOCHIMIE GENIE BIOLOGIQUE

AGREGATION DE BIOCHIMIE GENIE BIOLOGIQUE AGREGATION DE BIOCHIMIE GENIE BIOLOGIQUE CONCOURS EXTERNE Session 2005 TRAVAUX PRATIQUES DE BIOCHIMIE PHYSIOLOGIE ALCOOL ET FOIE L éthanol, psychotrope puissant, est absorbé passivement dans l intestin

Plus en détail

Ce document a été mis en ligne par le Canopé de l académie de Bordeaux pour la Base Nationale des Sujets d Examens de l enseignement professionnel.

Ce document a été mis en ligne par le Canopé de l académie de Bordeaux pour la Base Nationale des Sujets d Examens de l enseignement professionnel. Ce document a été mis en ligne par le Canopé de l académie de Bordeaux pour la Base Nationale des Sujets d Examens de l enseignement professionnel. Ce fichier numérique ne peut être reproduit, représenté,

Plus en détail

Exercices - Polynômes : corrigé. Opérations sur les polynômes

Exercices - Polynômes : corrigé. Opérations sur les polynômes Opérations sur les polynômes Exercice 1 - Carré - L1/Math Sup - Si P = Q est le carré d un polynôme, alors Q est nécessairement de degré, et son coefficient dominant est égal à 1. On peut donc écrire Q(X)

Plus en détail

Master de mathématiques Analyse numérique matricielle

Master de mathématiques Analyse numérique matricielle Master de mathématiques Analyse numérique matricielle 2009 2010 CHAPITRE 1 Méthodes itératives de résolution de systèmes linéaires On veut résoudre un système linéaire Ax = b, où A est une matrice inversible

Plus en détail

EXERCICE II. SYNTHÈSE D UN ANESTHÉSIQUE : LA BENZOCAÏNE (9 points)

EXERCICE II. SYNTHÈSE D UN ANESTHÉSIQUE : LA BENZOCAÏNE (9 points) Bac S 2015 Antilles Guyane http://labolycee.org EXERCICE II. SYNTHÈSE D UN ANESTHÉSIQUE : LA BENZOCAÏNE (9 points) La benzocaïne (4-aminobenzoate d éthyle) est utilisée en médecine comme anesthésique local

Plus en détail

Recherche dans un tableau

Recherche dans un tableau Chapitre 3 Recherche dans un tableau 3.1 Introduction 3.1.1 Tranche On appelle tranche de tableau, la donnée d'un tableau t et de deux indices a et b. On note cette tranche t.(a..b). Exemple 3.1 : 3 6

Plus en détail

Stress osmotique et activation des MAP Kinases ERK1/2 chez les hépatocytes de turbot, Scophthalmus maximus

Stress osmotique et activation des MAP Kinases ERK1/2 chez les hépatocytes de turbot, Scophthalmus maximus Stress osmotique et activation des MAP Kinases ERK1/2 chez les hépatocytes de turbot, Scophthalmus maximus : implication des voies de signalisation intracellulaire du processus de RVD. Audrey Fouchs Confrontées

Plus en détail

Fiche 19 La couleur des haricots verts et cuisson

Fiche 19 La couleur des haricots verts et cuisson Fiche 19 La couleur des haricots verts et cuisson Objectif : Valider ou réfuter des «précisions culinaires»* permettant de "conserver une belle couleur verte" lors la cuisson des haricots verts frais (gousses

Plus en détail

EXERCICE I : Où il est question de lumière (8 points) PARTIE A. Figure 2

EXERCICE I : Où il est question de lumière (8 points) PARTIE A. Figure 2 EXERCICE I : Où il est question de lumière (8 points) PARTIE A 1. Figure 2 D On observe sur l'écran un étalement du faisceau laser, perpendiculaire à la direction du fil, constitué d'une tache centrale

Plus en détail

X-ENS PSI - 2009 Un corrigé

X-ENS PSI - 2009 Un corrigé X-ENS PSI - 009 Un corrigé Première partie.. Des calculs élémentaires donnent χ A(α) = χ B(α) = X X + et χ A(α)+B(α) = X X + 4α + 4 On en déduit que Sp(A(α)) = Sp(B(α)) = {j, j } où j = e iπ 3 Sp(A(α)

Plus en détail

Site : http://www.isnab.com mail : mennier@isnab.fr SUJET ES - session 2003 Page 1 68-(7(6VHVVLRQ

Site : http://www.isnab.com mail : mennier@isnab.fr SUJET ES - session 2003 Page 1 68-(7(6VHVVLRQ Site : http://www.isnab.com mail : mennier@isnab.fr SUJET ES - session 003 Page 1 68-(7(6VHVVLRQ LE JUS E FRUIT 35(0,Ê5(3$57,(%LRFKLPLHSRLQWV L'analyse d'un jus de fruit révèle la présence d'un composé

Plus en détail

Partie Observer : Ondes et matière CHAP 04-ACT/DOC Analyse spectrale : Spectroscopies IR et RMN

Partie Observer : Ondes et matière CHAP 04-ACT/DOC Analyse spectrale : Spectroscopies IR et RMN Partie Observer : Ondes et matière CHAP 04-ACT/DOC Analyse spectrale : Spectroscopies IR et RMN Objectifs : Exploiter un spectre infrarouge pour déterminer des groupes caractéristiques Relier un spectre

Plus en détail

EXERCICE 2 : SUIVI CINETIQUE D UNE TRANSFORMATION PAR SPECTROPHOTOMETRIE (6 points)

EXERCICE 2 : SUIVI CINETIQUE D UNE TRANSFORMATION PAR SPECTROPHOTOMETRIE (6 points) BAC S 2011 LIBAN http://labolycee.org EXERCICE 2 : SUIVI CINETIQUE D UNE TRANSFORMATION PAR SPECTROPHOTOMETRIE (6 points) Les parties A et B sont indépendantes. A : Étude du fonctionnement d un spectrophotomètre

Plus en détail

Utiliser les propriétés Savoir réduire un radical savoir +,-,x,: Utiliser les propriétés des puissances Calculer avec des puissances

Utiliser les propriétés Savoir réduire un radical savoir +,-,x,: Utiliser les propriétés des puissances Calculer avec des puissances ARITHMETIQUE 1 C B A Numération Ecrire en lettres et en chiffres Poser des questions fermées autour d un document simple (message, consigne, planning ) Connaître le système décimal Déterminer la position

Plus en détail

Exercices - Fonctions de plusieurs variables : corrigé. Pour commencer

Exercices - Fonctions de plusieurs variables : corrigé. Pour commencer Pour commencer Exercice 1 - Ensembles de définition - Première année - 1. Le logarithme est défini si x + y > 0. On trouve donc le demi-plan supérieur délimité par la droite d équation x + y = 0.. 1 xy

Plus en détail

ACIDES BASES. Chap.5 SPIESS

ACIDES BASES. Chap.5 SPIESS ACIDES BASES «Je ne crois pas que l on me conteste que l acide n ait des pointes Il ne faut que le goûter pour tomber dans ce sentiment car il fait des picotements sur la langue.» Notion d activité et

Plus en détail

3 Approximation de solutions d équations

3 Approximation de solutions d équations 3 Approximation de solutions d équations Une équation scalaire a la forme générale f(x) =0où f est une fonction de IR dans IR. Un système de n équations à n inconnues peut aussi se mettre sous une telle

Plus en détail

Résolution d équations non linéaires

Résolution d équations non linéaires Analyse Numérique Résolution d équations non linéaires Said EL HAJJI et Touria GHEMIRES Université Mohammed V - Agdal. Faculté des Sciences Département de Mathématiques. Laboratoire de Mathématiques, Informatique

Plus en détail

Université de Nantes Année 2009-2010 Faculté des Sciences et des Techniques Département de Mathématiques. Topologie et calculs différentiel Liste n 5

Université de Nantes Année 2009-2010 Faculté des Sciences et des Techniques Département de Mathématiques. Topologie et calculs différentiel Liste n 5 Université de Nantes Année 009-010 Faculté des Sciences et des Techniques Département de Mathématiques Topologie et calculs différentiel Liste n 5 Applications Différentiables Exercice 1. Soit f : R n

Plus en détail

SUIVI CINETIQUE PAR SPECTROPHOTOMETRIE (CORRECTION)

SUIVI CINETIQUE PAR SPECTROPHOTOMETRIE (CORRECTION) Terminale S CHIMIE TP n 2b (correction) 1 SUIVI CINETIQUE PAR SPECTROPHOTOMETRIE (CORRECTION) Objectifs : Déterminer l évolution de la vitesse de réaction par une méthode physique. Relier l absorbance

Plus en détail

1 Codes linéaires. G = [I k A]. Dans ce cas on constate que la matrice. H = [ t A I n k ] est une matrice de contrôle de C. Le syndrome de x F n q

1 Codes linéaires. G = [I k A]. Dans ce cas on constate que la matrice. H = [ t A I n k ] est une matrice de contrôle de C. Le syndrome de x F n q 1 Codes linéaires Un code de longueur n est une partie de F n q. Un code linéaire C de longueur n sur le corps ni F q est un sous-espace vectoriel de F n q. Par défaut, un code sera supposé linéaire. La

Plus en détail

Items étudiés dans le CHAPITRE N5. 7 et 9 p 129 D14 Déterminer par le calcul l'antécédent d'un nombre par une fonction linéaire

Items étudiés dans le CHAPITRE N5. 7 et 9 p 129 D14 Déterminer par le calcul l'antécédent d'un nombre par une fonction linéaire CHAPITRE N5 FONCTIONS LINEAIRES NOTION DE FONCTION FONCTIONS LINEAIRES NOTION DE FONCTION FONCTIONS LINEAIRES NOTION DE FONCTION Code item D0 D2 N30[S] Items étudiés dans le CHAPITRE N5 Déterminer l'image

Plus en détail

Épreuve pratique de mathématiques Printemps 2009. Descriptifs. (Page vide)

Épreuve pratique de mathématiques Printemps 2009. Descriptifs. (Page vide) Épreuve pratique de mathématiques Printemps 2009 Descriptifs (Page vide) Sujet 001 Épreuve pratique de mathématiques Descriptif Étude d une fonction dépendant d un paramètre Étant donné une fonction dépendant

Plus en détail

DÉRIVÉES. I Nombre dérivé - Tangente. Exercice 01 (voir réponses et correction) ( voir animation )

DÉRIVÉES. I Nombre dérivé - Tangente. Exercice 01 (voir réponses et correction) ( voir animation ) DÉRIVÉES I Nombre dérivé - Tangente Eercice 0 ( voir animation ) On considère la fonction f définie par f() = - 2 + 6 pour [-4 ; 4]. ) Tracer la représentation graphique (C) de f dans un repère d'unité

Plus en détail

Calcul intégral élémentaire en plusieurs variables

Calcul intégral élémentaire en plusieurs variables Calcul intégral élémentaire en plusieurs variables PC*2 2 septembre 2009 Avant-propos À part le théorème de Fubini qui sera démontré dans le cours sur les intégrales à paramètres et qui ne semble pas explicitement

Plus en détail

Université Victor Segalen Bordeaux 2 UFR Science de la Vie

Université Victor Segalen Bordeaux 2 UFR Science de la Vie Université Victor Segalen Bordeaux 2 UFR Science de la Vie Licence Professionnelle «Techniques et Applications en Biologie Cellulaire et Biologie Moléculaire» Examen 2006-2007 UE1 : «Technologies en Biologie

Plus en détail

TD : Oscillateur harmonique

TD : Oscillateur harmonique TD : Oscillateur harmonique Observation du chromosome X par microscopie à force atomique. À gauche : nanoparticules observées par microscopie à force atomique (AFM, SP1-P2). Image du Dr. K. Raghuraman

Plus en détail

La fonction exponentielle

La fonction exponentielle DERNIÈRE IMPRESSION LE 2 novembre 204 à :07 La fonction exponentielle Table des matières La fonction exponentielle 2. Définition et théorèmes.......................... 2.2 Approche graphique de la fonction

Plus en détail

DYNAMIQUE DE FORMATION DES ÉTOILES

DYNAMIQUE DE FORMATION DES ÉTOILES A 99 PHYS. II ÉCOLE NATIONALE DES PONTS ET CHAUSSÉES, ÉCOLES NATIONALES SUPÉRIEURES DE L'AÉRONAUTIQUE ET DE L'ESPACE, DE TECHNIQUES AVANCÉES, DES TÉLÉCOMMUNICATIONS, DES MINES DE PARIS, DES MINES DE SAINT-ÉTIENNE,

Plus en détail

Cours Informatique Master STEP

Cours Informatique Master STEP Cours Informatique Master STEP Bases de la programmation: Compilateurs/logiciels Algorithmique et structure d'un programme Programmation en langage structuré (Fortran 90) Variables, expressions, instructions

Plus en détail

Biochimie I. Extraction et quantification de l hexokinase dans Saccharomyces cerevisiae 1. Assistants : Tatjana Schwabe Marcy Taylor Gisèle Dewhurst

Biochimie I. Extraction et quantification de l hexokinase dans Saccharomyces cerevisiae 1. Assistants : Tatjana Schwabe Marcy Taylor Gisèle Dewhurst Biochimie I Extraction et quantification de l hexokinase dans Saccharomyces cerevisiae 1 Daniel Abegg Sarah Bayat Alexandra Belfanti Assistants : Tatjana Schwabe Marcy Taylor Gisèle Dewhurst Laboratoire

Plus en détail

Date : 18.11.2013 Tangram en carré page

Date : 18.11.2013 Tangram en carré page Date : 18.11.2013 Tangram en carré page Titre : Tangram en carré Numéro de la dernière page : 14 Degrés : 1 e 4 e du Collège Durée : 90 minutes Résumé : Le jeu de Tangram (appelé en chinois les sept planches

Plus en détail

Conversion électronique statique

Conversion électronique statique Conversion électronique statique Sommaire I) Généralités.2 A. Intérêts de la conversion électronique de puissance 2 B. Sources idéales.3 C. Composants électroniques..5 II) III) Hacheurs..7 A. Hacheur série

Plus en détail

RÉVISION DE CALCUL NUMÉRIQUE

RÉVISION DE CALCUL NUMÉRIQUE RÉVISION DE CALCUL NUMÉRIQUE. Les ensembles numériques. Propriétés des nombres réels. Ordre des opérations. Nombres premiers. Opérations sur les fractions 7. Puissances entières 0.7 Notation scientifique.8

Plus en détail

CODEX ŒNOLOGIQUE INTERNATIONAL. Mesure de la viscosité COEI-2-VISCPE : 2009

CODEX ŒNOLOGIQUE INTERNATIONAL. Mesure de la viscosité COEI-2-VISCPE : 2009 DETERMINATION DE LA CAPACITE D'UNE PREPARATION ENZYMATIQUE A COUPER LES CHAINES PECTIQUES PAR LA MESURE DE LA VISCOSITE (OIV-Oeno 351-2009) 1. PRINCIPE On se propose ici de mesurer la quantité d'enzyme

Plus en détail

3: Clonage d un gène dans un plasmide

3: Clonage d un gène dans un plasmide 3: Clonage d un gène dans un plasmide Le clonage moléculaire est une des bases du génie génétique. Il consiste à insérer un fragment d'adn (dénommé insert) dans un vecteur approprié comme un plasmide par

Plus en détail

Chapitre 02. La lumière des étoiles. Exercices :

Chapitre 02. La lumière des étoiles. Exercices : Chapitre 02 La lumière des étoiles. I- Lumière monochromatique et lumière polychromatique. )- Expérience de Newton (642 727). 2)- Expérience avec la lumière émise par un Laser. 3)- Radiation et longueur

Plus en détail

Conception assistée par ordinateur de molécules thérapeutiques

Conception assistée par ordinateur de molécules thérapeutiques Conception assistée par ordinateur de molécules thérapeutiques D. Gilis Bioinformatique génomique et structurale Faculté des sciences appliquées Université Libre de Bruxelles Objectif: illustrer en quoi

Plus en détail

U-31 CHIMIE-PHYSIQUE INDUSTRIELLES

U-31 CHIMIE-PHYSIQUE INDUSTRIELLES Session 200 BREVET de TECHNICIEN SUPÉRIEUR CONTRÔLE INDUSTRIEL et RÉGULATION AUTOMATIQUE E-3 SCIENCES PHYSIQUES U-3 CHIMIE-PHYSIQUE INDUSTRIELLES Durée : 2 heures Coefficient : 2,5 Durée conseillée Chimie

Plus en détail

TS Physique L automobile du futur Electricité

TS Physique L automobile du futur Electricité P a g e 1 TS Physique Electricité Exercice résolu Enoncé Le moteur thermique, étant très certainement appelé à disparaître, les constructeurs automobiles recourront probablement au «tout électrique» ou

Plus en détail

Correction de l examen de la première session

Correction de l examen de la première session de l examen de la première session Julian Tugaut, Franck Licini, Didier Vincent Si vous trouvez des erreurs de Français ou de mathématiques ou bien si vous avez des questions et/ou des suggestions, envoyez-moi

Plus en détail

Josef KAISER - Jean LACROIX

Josef KAISER - Jean LACROIX SERVICES D'ELECTRONIQUE DE SACLAY Section d'assistance Electronique Générale (SES/SEG/R-75-35) Nomenclature Programme : 0140 Y Saclay, le 26 mai 1975 2 Ispra nuclear electronics symposium. Stresa (italy),

Plus en détail

Cours d analyse numérique SMI-S4

Cours d analyse numérique SMI-S4 ours d analyse numérique SMI-S4 Introduction L objet de l analyse numérique est de concevoir et d étudier des méthodes de résolution de certains problèmes mathématiques, en général issus de problèmes réels,

Plus en détail

Interactions des rayonnements avec la matière

Interactions des rayonnements avec la matière UE3-1 : Biophysique Chapitre 2 : Interactions des rayonnements avec la matière Professeur Jean-Philippe VUILLEZ Année universitaire 2011/2012 Université Joseph Fourier de Grenoble - Tous droits réservés.

Plus en détail

DM n o 8 TS1 2012 Physique 10 (satellites) + Chimie 12 (catalyse) Exercice 1 Lancement d un satellite météorologique

DM n o 8 TS1 2012 Physique 10 (satellites) + Chimie 12 (catalyse) Exercice 1 Lancement d un satellite météorologique DM n o 8 TS1 2012 Physique 10 (satellites) + Chimie 12 (catalyse) Exercice 1 Lancement d un satellite météorologique Le centre spatial de Kourou a lancé le 21 décembre 200, avec une fusée Ariane, un satellite

Plus en détail

La Licence Mathématiques et Economie-MASS Université de Sciences Sociales de Toulouse 1

La Licence Mathématiques et Economie-MASS Université de Sciences Sociales de Toulouse 1 La Licence Mathématiques et Economie-MASS Université de Sciences Sociales de Toulouse 1 La licence Mathématiques et Economie-MASS de l Université des Sciences Sociales de Toulouse propose sur les trois

Plus en détail

CHAPITRE IX : Les appareils de mesures électriques

CHAPITRE IX : Les appareils de mesures électriques CHAPITRE IX : Les appareils de mesures électriques IX. 1 L'appareil de mesure qui permet de mesurer la différence de potentiel entre deux points d'un circuit est un voltmètre, celui qui mesure le courant

Plus en détail

------- SESSION 2013 ÉPREUVE À OPTION. (durée : 4 heures coefficient : 6 note éliminatoire 4 sur 20) CHIMIE

------- SESSION 2013 ÉPREUVE À OPTION. (durée : 4 heures coefficient : 6 note éliminatoire 4 sur 20) CHIMIE CNCURS SUR ÉPREUVES UVERT AUX CANDIDATS TITULAIRES D UN DIPLÔME U TITRE CNFÉRANT LE GRADE DE MASTER U D'UN DIPLÔME U TITRE HMLGUÉ U ENREGISTRÉ AU RÉPERTIRE NATINAL DES CERTIFICATINS PRFESSINNELLES AU NIVEAU

Plus en détail

Exo7. Sujets de l année 2008-2009. 1 Partiel. Enoncés et corrections : Sandra Delaunay. Exercice 1 Soit A une matrice 2 2 à coefficients réels.

Exo7. Sujets de l année 2008-2009. 1 Partiel. Enoncés et corrections : Sandra Delaunay. Exercice 1 Soit A une matrice 2 2 à coefficients réels. Enoncés et corrections : Sandra Delaunay Exo7 Sujets de l année 28-29 1 Partiel Exercice 1 Soit A une matrice 2 2 à coefficients réels. On suppose a + c = b + d = 1 et a b 1. ( ) a b c d 1. Soient (x 1,x

Plus en détail

Fonctions de plusieurs variables, intégrales multiples, et intégrales dépendant d un paramètre

Fonctions de plusieurs variables, intégrales multiples, et intégrales dépendant d un paramètre IUFM du Limousin 2009-10 PLC1 Mathématiques S. Vinatier Rappels de cours Fonctions de plusieurs variables, intégrales multiples, et intégrales dépendant d un paramètre 1 Fonctions de plusieurs variables

Plus en détail

Retournement Temporel

Retournement Temporel Retournement Temporel Rédigé par: HENG Sokly Encadrés par: Bernard ROUSSELET & Stéphane JUNCA 2 juin 28 Remerciements Je tiens tout d'abord à remercier mes responsables de mémoire, M.Bernard ROUSSELET

Plus en détail

L2 MIEE 2012-2013 VAR Université de Rennes 1

L2 MIEE 2012-2013 VAR Université de Rennes 1 . Sous-ensembles de R n et fonctions (suite) 1 Nappes paramétrées Si f une fonction de deux variables, son graphe est une surface incluse dans R 3 : {(x, y, f(x, y)) / (x, y) R 2 }. Une telle surface s

Plus en détail

Sujet. calculatrice: autorisée durée: 4 heures

Sujet. calculatrice: autorisée durée: 4 heures DS SCIENCES PHYSIQUES MATHSPÉ calculatrice: autorisée durée: 4 heures Sujet Approche d'un projecteur de diapositives...2 I.Questions préliminaires...2 A.Lentille divergente...2 B.Lentille convergente et

Plus en détail

MINISTERE DE L INTERIEUR PREFECTURE DE LA ZONE DE DEFENSE ET DE SECURITE NORD !!!

MINISTERE DE L INTERIEUR PREFECTURE DE LA ZONE DE DEFENSE ET DE SECURITE NORD !!! S.G.A.P de LILLE Direction des ressources humaines Bureau du recrutement MINISTERE DE L INTERIEUR PREFECTURE DE LA ZONE DE DEFENSE ET DE SECURITE NORD Concours déconcentré d Agent Spécialisé de Police

Plus en détail

Mathématiques appliquées à l informatique

Mathématiques appliquées à l informatique Mathématiques appliquées à l informatique Jean-Etienne Poirrier 15 décembre 2005 Table des matières 1 Matrices 3 1.1 Définition......................................... 3 1.2 Les différents types de matrices.............................

Plus en détail

Une réponse (très) partielle à la deuxième question : Calcul des exposants critiques en champ moyen

Une réponse (très) partielle à la deuxième question : Calcul des exposants critiques en champ moyen Une réponse (très) partielle à la deuxième question : Calcul des exposants critiques en champ moyen Manière heuristique d'introduire l'approximation de champ moyen : on néglige les termes de fluctuations

Plus en détail

De même, le périmètre P d un cercle de rayon 1 vaut P = 2π (par définition de π). Mais, on peut démontrer (difficilement!) que

De même, le périmètre P d un cercle de rayon 1 vaut P = 2π (par définition de π). Mais, on peut démontrer (difficilement!) que Introduction. On suppose connus les ensembles N (des entiers naturels), Z des entiers relatifs et Q (des nombres rationnels). On s est rendu compte, depuis l antiquité, que l on ne peut pas tout mesurer

Plus en détail

Cours de Mécanique du point matériel

Cours de Mécanique du point matériel Cours de Mécanique du point matériel SMPC1 Module 1 : Mécanique 1 Session : Automne 2014 Prof. M. EL BAZ Cours de Mécanique du Point matériel Chapitre 1 : Complément Mathématique SMPC1 Chapitre 1: Rappels

Plus en détail

CORRIGE. CHAP 04-ACT PB/DOC Electrolyse de l eau 1/12 1. ALIMENTATION ELECTRIQUE D'UNE NAVETTE SPATIALE

CORRIGE. CHAP 04-ACT PB/DOC Electrolyse de l eau 1/12 1. ALIMENTATION ELECTRIQUE D'UNE NAVETTE SPATIALE Thème : L eau CHAP 04-ACT PB/DOC Electrolyse de l eau 1/12 Domaine : Eau et énergie CORRIGE 1. ALIMENTATION ELECTRIQUE D'UNE NAVETTE SPATIALE 2.1. Enoncé L'alimentation électrique d'une navette spatiale

Plus en détail

Mathématiques assistées par ordinateur

Mathématiques assistées par ordinateur Mathématiques assistées par ordinateur Chapitre 4 : Racines des polynômes réels et complexes Michael Eisermann Mat249, DLST L2S4, Année 2008-2009 www-fourier.ujf-grenoble.fr/ eiserm/cours # mao Document

Plus en détail

Mesure de Salinité Réalisation d'un conductimètre

Mesure de Salinité Réalisation d'un conductimètre Kourou Novembre 2010. MANGOTECHNO Mesure de Salinité Réalisation d'un conductimètre Frédéric BOUCHAR (TENUM Toulouse) Version 1.0 Table des matières 1.Introduction...3 2.Qu'est-ce que la salinité?...3

Plus en détail

PHYSIQUE Discipline fondamentale

PHYSIQUE Discipline fondamentale Examen suisse de maturité Directives 2003-2006 DS.11 Physique DF PHYSIQUE Discipline fondamentale Par l'étude de la physique en discipline fondamentale, le candidat comprend des phénomènes naturels et

Plus en détail

Biologie cellulaire. Perfectionnement à la culture cellulaire. Programme. ParTIe PraTIQUe. ParTIe THÉorIQUe. durée : 4 jours

Biologie cellulaire. Perfectionnement à la culture cellulaire. Programme. ParTIe PraTIQUe. ParTIe THÉorIQUe. durée : 4 jours Biologie cellulaire Perfectionnement à la culture cellulaire durée : 4 jours ingénieurs, chercheurs et chefs de projet connaissances de base en culture cellulaire ou validation du module «initiation à

Plus en détail

K W = [H 3 O + ] [OH - ] = 10-14 = K a K b à 25 C. [H 3 O + ] = [OH - ] = 10-7 M Solution neutre. [H 3 O + ] > [OH - ] Solution acide

K W = [H 3 O + ] [OH - ] = 10-14 = K a K b à 25 C. [H 3 O + ] = [OH - ] = 10-7 M Solution neutre. [H 3 O + ] > [OH - ] Solution acide La constante d autoprotolyse de l eau, K W, est égale au produit de K a par K b pour un couple acide/base donné : En passant en échelle logarithmique, on voit donc que la somme du pk a et du pk b d un

Plus en détail

Note la plus haute 87 9,77 4 2,5 20 76 9,6 4 2,5 19

Note la plus haute 87 9,77 4 2,5 20 76 9,6 4 2,5 19 Banque Agro Veto. Session 2011 Rapport sur les concours A TB Épreuve écrite de SCIENCES PHYSIQUES Concours Nb cand. Moyenne Ecart type TB ENSA- ENITA la plus basse la plus haute 87 9,77 4 2,5 20 TB ENV

Plus en détail

A l'intention des collègues dont les élèves vont tester le sujet "prospectif" de bac ES.

A l'intention des collègues dont les élèves vont tester le sujet prospectif de bac ES. A l'intention des collègues dont les élèves vont tester le sujet "prospectif" de bac ES. Le sujet proposé s'inscrit dans le cadre du texte d'orientation ci-joint. L'exercice I est du type "compréhension

Plus en détail

EPREUVE E DU DEUXIEME GROUPE

EPREUVE E DU DEUXIEME GROUPE EPREUVE E DU DEUXIEME GROUPE (Coefficient : 4 - Durée : 3 heures) Matériel(s) et document(s) autorisé(s) : Calculatrice Rappel : Au cours de l épreuve, la calculatrice est autorisée pour réaliser des opérations

Plus en détail

FICHE 1 Fiche à destination des enseignants

FICHE 1 Fiche à destination des enseignants FICHE 1 Fiche à destination des enseignants 1S 8 (b) Un entretien d embauche autour de l eau de Dakin Type d'activité Activité expérimentale avec démarche d investigation Dans cette version, l élève est

Plus en détail

A retenir : A Z m n. m noyau MASSE ET ÉNERGIE RÉACTIONS NUCLÉAIRES I) EQUIVALENCE MASSE-ÉNERGIE

A retenir : A Z m n. m noyau MASSE ET ÉNERGIE RÉACTIONS NUCLÉAIRES I) EQUIVALENCE MASSE-ÉNERGIE CP7 MASSE ET ÉNERGIE RÉACTIONS NUCLÉAIRES I) EQUIVALENCE MASSE-ÉNERGIE 1 ) Relation d'équivalence entre la masse et l'énergie -énergie de liaison 2 ) Une unité d énergie mieux adaptée 3 ) application 4

Plus en détail

* très facile ** facile *** difficulté moyenne **** difficile ***** très difficile I : Incontournable

* très facile ** facile *** difficulté moyenne **** difficile ***** très difficile I : Incontournable Eo7 Fonctions de plusieurs variables Eercices de Jean-Louis Rouget Retrouver aussi cette fiche sur wwwmaths-francefr * très facile ** facile *** difficulté moenne **** difficile ***** très difficile I

Plus en détail

Les techniques de préparation des coupes pour les microscopies optique et électronique

Les techniques de préparation des coupes pour les microscopies optique et électronique Université Mohammed V-Agdal Faculté des Sciences de Rabat Laboratoire de Zoologie et de Biologie générale Les techniques de préparation des coupes pour les microscopies optique et électronique Histologie-Embryologie

Plus en détail

Application à l astrophysique ACTIVITE

Application à l astrophysique ACTIVITE Application à l astrophysique Seconde ACTIVITE I ) But : Le but de l activité est de donner quelques exemples d'utilisations pratiques de l analyse spectrale permettant de connaître un peu mieux les étoiles.

Plus en détail

I - PUISSANCE D UN POINT PAR RAPPORT A UN CERCLE CERCLES ORTHOGONAUX POLES ET POLAIRES

I - PUISSANCE D UN POINT PAR RAPPORT A UN CERCLE CERCLES ORTHOGONAUX POLES ET POLAIRES I - PUISSANCE D UN POINT PAR RAPPORT A UN CERCLE CERCLES ORTHOGONAUX POLES ET POLAIRES Théorème - Définition Soit un cercle (O,R) et un point. Une droite passant par coupe le cercle en deux points A et

Plus en détail