SUJETS D'EXAMENS ~J!'-J'""~J'~~""~~J'""'I-~~ IMAITRIS~ 2ème CVCLE

Dimension: px
Commencer à balayer dès la page:

Download "SUJETS D'EXAMENS ~J!'-J'""~J'~~""~~J'""'I-~~ IMAITRIS~ 2ème CVCLE"

Transcription

1 SUJETS D'EXAMENS ~J!'-J'""~J'~~""~~J'""'I-~~ IMAITRIS~ 2ème CVCLE JUIN 2003

2 UNIVERSITE HENRI POINCARE-NANCY 1 FACULTE DES SCIENCES SUJET D'EXAMEN DIPLOME: MBCP Option Animale Durée du sujet: 2 heures Rédacteur: Professeur Thomton Epreuve de : UE 6 Physiologie et signalisation de la cellule Session de :juin 2003 Date: Horaire: 0 Documents autorisés IR]Documents non autorisés 0 Calculatrices autorisées IR]Calculatrices non autorisées Décrivez les différents types de modulation et communication présents au niveau des synapses (en comparant les neurotransmetteurs de faible poids moléculaireet les peptides neurotransmetteurs).

3 UNIVERSITE HENRI POINCARE-NANCY 1 FACUL TE DES SCIENCES SUJET D'EXAMEN DIPLOME: MBCP Option Animale Durée du sujet: 2 heures Rédacteur: Professeur Thomton Epreuve de : UE 6 Physiologiedes grandes fonctions Session de :juin 2003 Date: Horaire: 0 Documents autorisés 181Documents non autorisés 0 Calculatrices autorisées 181Calculatrices non autorisées Décrivez le fuseau neuromusculaire et sa fonction. Quels rôles jouent les différentes parties du cerveau impliquées dans le contrôle du mouvement?

4 UNIVERSITE DE NANCY 1 DIPLOME: cellulaire Epreuve d' Session de Date: Maîtrise de biologie et physiologie Immunologie Juin 2003 Durée du sujet: 2h Nom du rédacteur: A. Ropars Documents non autorisés 1 ) Expliquez le déroulement d'une allergie respiratoire (au sens large du terme) et les différents médicaments permettant de la soigner. Durée conseillée pour traiter la question: 30 mn. 2 ) Expliquez pourquoi la synthèse de cytokines et l'apoptose sont 2 phénomènes essentiels pour une réponse immunitaire efficace et contrôlée. Durée conseillée pour répondre à la question: Ih 30.

5 ~,,r t ;\. MAITRISE DE BIOLOGIE CELLULAIRE ET PHYSIOLOGIE OPTIONS«SCIENCES DE LA CELLULE ET DE L'ANIMAL» (MBCP A) ET «SCIENCESET TECHNOLOGIESDU VÉGÉTAL» (MBCPV) Epreuve de Génétique Moléculaire et Cellulaire Sujet rédigé par Elisabeth WEBER Durée: 2 heures - Sans documents IL N'EST PAS DEMANDE DE RECITER LE COURS MAIS D'UTILISER CERTAINES DONNEES POUR EXPLIQUER LES RESULTATS PRESENTES... IL N'EST PAS NON PLUS NECESSAIRE DE CONNAITRE LE NOM EXACT DES DIFFERENTS GENES ET PROTEINES IMPLIQUES DANS LES PHENOMENES DECRITS MAIS PLUTÔT DE JUSTIFIER LEUR MODE D'ACTION. Chez la levure Saccharomyces cerevisiae, 3 loci sont impliqués dans la détermination du signe conjugal, tous trois sont situés sur le chromosome III : le locus MA T, le locus HMR et le locus HML. Il existe deux formes alléliques possibles pour ces loci: la forme a qui est généralement présente au locus HMR, la forme a généralement présente au locus HML. Au locus MAT, les levures haploïdes (n) ont soit l'allèle a, soit l'allèle a. Pour pouvoir conjuguer, 2 levures n doivent porter des allèles MAT différents. Elles se reconnaissent alors par le biais de peptides spécifiques excrétés dans le milieu et de récepteurs de surface spécifiques. Les levures diploïdes qui possèdent à la fois MAT(a) et MAT(a) ne peuvent conjuguer avec aucun type de levures (phénotype«non mating»). La délétion du locus MAT(a) conduit, chez des levures n, à un phénotype «amating», c'est-à-dire que ces levures deviennent capables de conjuguer avec des levures n portant MAT(a) mais ne conjuguent plus avec des levures n MAT(a). Des levures n ayant subi la délétion de MAT(a) restent «a-mating». La délétion des loci HML et/ou HMR ne modifie pas la conjugaison des levures haploïdes, quel que soit l'allèle présent au locus MAT. Commenter et interprétez ces données. Des séquences d'environ 200 pb chacune, appelées ici AEB, ont été mises en évidence de part et d'autre des loci HMR et HML mais pas du locus MAT. Pour des levures n possédant l'allèle a au locus MAT, la délétion des séquences AEB de part et d'autre de HMR(a) conduit à un phénotype «non-mating». L'insertion de séquences AEB de part et d'autre du locus MAT conduit à un phénotype «a- mating» chez des levures n, quel que soit l'allèle au locus MAT.

6 t Comment pouvez-vous expliquer ces résultats? L'inactivation de gènes tels que SIR2, SIR3, SIR4, RAP 1 et ABFI dans des cellules haploïdesconduità un phénotype«non mating» alors que la séquencedes locimat, HMR et HML n'est pas modifiée dans ces mutants. Certaines mutations des gènes codantles histonesh4 et H3 donnentégalementun phénotype«nonmating». L'ADN génomique de souches haploïdes MAT(a), sauvages d'une part et mutantes sir d'autre part, a été utilisé pour des expériences d'hybridation ADN/ADN dans les conditions suivantes: digestion de l'adn par une enzyme ayant un seul site de coupure dans l'allèle a et hybridation avec une sonde interne à cet allèle. Les résultats suivants ont été obtenus: - si l'adn génomique a été déprotéinisé avant digestion enzymatique, l'hybridation permet de détecter 4 bandes pour l'adn de la souche sauvage comme pour l'adn des mutants sir. - Si l'adn génomique est extrait dans des conditions qui periï1et de préserver l'association spécifique de protéines à l'adn, 3 bandes majeures d'hybridation sont obtenues pour l'adn de la souche sauvage et 4 bandes majeures sont obtenues pour l'adn des mutants sir. Commentezet interprétez ces résultats. Les souches utilisées en laboratoire sont, pour la plupart, mutées dans le gène HO (génotype ho). Si par transformation, le gène HO fonctionnel est apporté dans des souches haploïdes ho, on observe au bout de quelques générations une majorité de cellules diploïdes. Comment pouvez-vous expliquer ce résultat?,- MATa +- a2 210aa _, a1 '75 aa 1 - n- - X 704 bp Ya 747 bp Z bp MATa +-. a2 119aa a1.1 I~ _12~_~a.. X 70~bp Ya 6~2 bp Z -i 328bp La protéine al est un activateur transcriptionnel ; la protéine a2 est un répresseur transcriptionnel La protéine al associée à la protéine a2 forme un répresseur transcriptionnel Isolément, les protéines al et a2 n'ont pas de rôle défini.

7 ,., ~ DaBCP Option Végétale. Biotechnologies JP Jacquot 'J/:1~ h. Pas de documents 1 les de calculette Sui te à de brillantes études à l'uni versi té Henri Poincaré, et titulaire d' illl diplôme de maîtrise BCP Option végétale, vous avez réussi à vous faire engager dans une société CE Biotechnologie dont nous tairons le nom. Votre directeur vous darande èe réaliser le proj et suivant: 1 suppr:im2r le site PvuI du plasmide pet-3d 10 pts 2 déléter le T7 tag présent entre les sites NcoI et B3IrriHI en insérant à la place un nouveau si te PvuI entre les deux si tes NcoI et B3IrriHI 10 pts Vous disposez dans les docurœnts suivants: èe la carte du plasmide et èe sa séquence en nucléotides de la séquence codante du gène arrpicilline avec la position du si te PvuI de la structure de plusieurs sites de restriction uniques. Proposez des stratégies de clonage et décrire les séquences correspondantes. Chacune des questions vaut 10 pts. A'ITENTION : LA SEX;:2UENCENUCLEDI'IDIQUE de PEI'- 3d EST CELLE DU BRIN REVERSE PAR RAPPORT A L'ENCADRE SOUS LA CARTE ID PLASMIDE PS1 Ce n'est pas pour vous embêter j1ai pris les données telles qu'elles sont présentées dans le catalcgue èe la société... PS2 Bon courage

8 .. SEQUEK::E NtJCL!DTJDJ:QUE le pet- 3d 1 TICICA'IGIT 'IGACAœITA 'l'ca'icgataagctitaa'igc OOI'AGI'ITAT 51 CN::N:JITAAATIGCI'AACGC~ CGroI'A'IGAA A'ICI'AACAAT 101 G:GCTCA'ICG 'ICA'ICCICG3 ~ CI'G3A'IœIG TNXJ::ATNr: 151 crrœrra'ig CCG3I'ACIGC CG3X.'CICIT GCG33ATA'IC GICCATICCG 201 ~ CAGICACI'ATGX:GIGCIGC TAGC.œI'ATA 'IŒ:GTIGA'IG 251 CAATI'ICI'AT œr:::r::x:œar 'l'ci'c:g3.ag:acigiccgacc G:TI'IGIXX ccœccpillc crœrcœit CGCrACI'IG3 AG:::.CJCrA'IC GN::rN:JXJ3A 351 'ICA'IG3CGACCK:N:.CCGIC CIGIOOATAT CCG3ATATAGTICCIœI'IT 401 CAG:::AAAAAAccccrcAAGA. CCCGI'1TAGA~ OOI'TA'IGCTA 451 GIT.ATIœTC ~ ~ CAGCI'ICCIT 'IC'G33:TITG 501 'ITAGCAGX'GG8.'Iœ.GACCCA'ITIGCTGIC CACCAGICAT œragc:ca'rg 551 GTATA'ICICC TICITMAGI' T~T TATI'ICTAGA ~ 601 'TGIœICICC cratagigag 'ICGI'A'ITAAT TJ:DX'G33AT CGAGA'ICICG 651 A'IœICI'ACG ~T CGIG3CCG3C A~ ~ 701 œrrgc'tg3::: OC'CI'ATA'ICG~ CGA'IG:D3AA ~ 751 G::CACI'ICG3 GCI'CA'IGAœ Gcl'lGl'l'lCG GCGIG33I'AT ~ 801 CCCGI'CDXX3aD3ACIGIT ~ 'ICCI'IœA'IG CACCATIœI' 851 'IGC:.'G:L'G3C GI'GCTCAACGOC'CICAACCI'FCr~ 'IGCI'ICCTAA 901 'TGCAG3AGICœATAPGJJA GAGCGICGACCGA'IGC.'CCITGAGAGCCI'IC 951 AN:œ:PGrCA GCI'CCTICCG GIG33C'G:.Œ mea'tgaci'a 'ICGTCGCCGC 1001 ACITA'IGACI' GICI'ICITI'A 'TCA'IGCAACI'CGr~ GJ:G:'CGGCAG c:œicig33r CATITICG3C ~ TIC.œIG3AG CGCGACGA'IG 1101 A'I'CGX.'CTGI'cœrIG::.'Cm' A~ TIGCACGCCC 'l'c'g2icaagc 1151 CI'IŒIC'ACr œrccx::gcx:::accaaacgi'it ~ CN:5:ITA'ITA 'IC'G:::CG3:AT~ ~ ACGICI'I'G:::T <D:GI'I'CG:.'G ~ G3A'IG:XX:TI' CCCCA'ITA'IG ATTCI'ICICG ~ CA'ICG33A'IG CCCG:GI'IGC ~ ~ GI'AGA'IGACG ~ N::NrITCAA G3A~ C'G32TCITAC CJ:>œcrNCr 1401 'l'cga'icaci GACC.œTGATCGTCACG:X.'GATTTA'I'GCCGCCICG3C.GAG 1451 ~ CD:IrI'G3CAT G3ATI'GI'Nr: ca::cgcccra TACCrIGI'CI' 1501 occr.cccax GI'I'G2GI'CGC œ:rœa'ig8a ~ CTCGACCIGA 1551 A~ ~ œr~t 'ICACCACICCAAGAA.TI.G3A œcaatc:aat 'ICI'I'G:G3AG AACIGIGAAT ~ ~ 1651 GAACATA'ICCA'I'CG2GICCG CCA'ICICCAG ~ ~ ~ 'IGXID:'CIG3 ~ GCA'IGA'ICGI' œrccigicg 1751 TIGAG3AœC ~ G:::ŒmITGC crtacid3it ~ 1801 A'ICACCGATA~ ~ CIGCIGCIGC AAAACGICIG 1851 CGACCIGAGCAN:AN:NlGA A'IG3ICI'ICG GITICCGIGI' TICGI'MAGI' ~ ~ cr.ccra::n::.catta'igi'tcc G3A'ICIœAT 1951 CG::J:G:lArr.r:r.'J:œI'G:rrAC CCIGIG3AAC ACCI'ACA'ICT GI'ATTAACGA 2001 ~ TIGACCC'IGA GIGATI'ITIC 'ICIG3ICCCG CCGCA'ICCAT N:.CœCN:JIT GrITACCC'TC N::AN:.GITCC IDrAAC.CG0:3 CA'IGI'ICA'IC 2101 KI.'ClGrNCC CGrA'IŒIGA GCA'ICCI'CTC 'ICGITI'CA'IC OOI'A'ICATTA 2151 c:ccc:x:a'igaacjgan:(iccc CC'ITACACG} NXJ::A'ICIDr GNx:AAN:AG 2201 GAAJ:.N.P.œG CCCITAACATm::cc.œ:rrr A~ AGN:::NITAPC 2251 GCI'I'CJ:'mAG AAlCICAACG ~ G3A~ œ.agn::arrcr 2301 GIGAA'ICœI' ~ GCIGA'IGAGC TTTACC.œAG cro:::.acg::x; 2351 C'GI'I'ICG3TGA'IGACG3TGAAACCICIGA~ 'TCXX:G3AGAC 2401 G3ICACAœI' 'IGICIGI'AAG CG3ATG:::.'CG3~ G:X:CGI'C'AG ~ G33I'GI'ID3C ~ ~T GN:.CC:PaICA

9 w ~~~~~~~~~~~~~wwwwwwwwwwwwwwwwwwww~~~~~~~~~~ ~. m~~~~ww~~~~oo~~oooo~~mm~~~~ww~~~~oo~~oooo~~mm~~ ~ o~o~o~o~o~o~o~o~o~o~o~o~o~o~o~o~o~o~o~o~o~o i illiiillliiüiliiili~liliillilii~lll i UlIlIUIIUrllllUllllIlUlIlIUUnUI t ; iluiiuiuliliuuulilliluiunul 1lililiiIIIIUUIUIIIIUIUIUIUIII

10 ~ Sites de restriction. AatII BamHI EgIII FcoRI MscI NcoI PvuI PvuII SalI ScaI Spb1 SspI gacg'ic gga'icc AgA1CT gaattc TggCCA CCATgg CgA'ICg CagCl'g g'icgac AçfrACr gcatgc AATA'IT

11 ~ SE(UEN:E TRAIDITE ID GENE b1a CODANT'RJJR LA RESISTAN:E AL' AMPICILI.JNE 1/1 31/11 A'IGlGrA'ITCMCATTICc:mGICG:CcrrATI'CCCTITTITCD3œATIT'Iœcrrœr ~~ili~~~~~~~~~~~~~~~~~ 61/21 91/31 GITTITœrCK:.CCAClN>.l>ŒCIGGIGA»..GrAA»..GATœI'GPAGATCAGTIGOOI'<rA ~~~~~~~~~~~~~~~~~~~~ 121/41 151/51 CGAGIGG3I'TACA'ICClN>.CIGGATCICNCJ:.œG3l'ANJrA'ICcrrG.ZIBlGrTITm::cœ ~~~~ili~~~~~~~~ili~~~~~~ 181/61 211/71 ClN>.GPA cm TIT CCA A'IG A'IG.Kr. K:r TIT A».. GIT CIG cm 'IGI'G3: CD3 GrA Tm 'ID: ~~~~~~~~~~~~~~~~~~~~ 241/81 271/91 CJ:TI.GITŒCG:CG33CMG.ZIBCMCICG3l'm::m::ATACK:.'mT'ICI'CAGl>KrŒCTIG ~~~~~~~~~~~~~~~~~~~~ 301/ /111 GITG.ZIBTAC'ICACCAGICJ:CAGPAAN.;CATcrrl>ŒGATG3:A'IGJ:CAGrANlAGPA'rIA ~~~~~~~~~~~~~~~~~~~~ 361/ /131 'IœlGrœrG:C~~A'IGlGrGATNCK:rCD3G:CNCTmcrrCIGJ:CA~~ ~~~~ili~~~~~~~~~~~~~~ili 421/ /151 ~~~AN.;G.Z\1}cm~œI'TITTIG~NC~~GATCATGrAK:rm::m ~~~~~~~~~~~~~~~~~~~~ 481/ /171 GATCGI"IG3GPA~G.Z\1}CIGl>KrClN>.G:CATACCANCGK:.G.ZIBc:mGK:.~l>ŒA'IG ~~~~~~~~~~ili~~~~~~~~~ 541/ /191 ccrœaœaa'igœaj:cal>œtigcg:a»..cmtmk:rg3:gpacmcrrk:rcmœr ~~~~~~~~~~~~~~~~~~~~ 601/ /211 'ICCœ;CMCM'ITA~GK:.'IG3A'IGG.ZIBCD3GATA»..GITœA~CCAcrrCIGcœ ~~~~~ili~~~~~~~~~~~~~~ 661/ /231 'IŒG:CmCCGœrcn::'IG3TITATI'œI'GATA»..'ICI'~G:CG3l'G.ZIBc:m~'ICI' ~~~~~~~~ili~~~~~~~~~~~ 721/ /251 cœooi'a'ica'itœaœacigg33ccagatooi'anjrccc'iccc:ma'icgragita'ictac ~~iliili~~~~~~~~~~~~~~ili~ 781/ /271 NJ:3NJ:3G33lGrCAGœAPCrA'IGGATGPACGAl>KrNlACAGA'ICœI'G.ZIBATAOOI'm:: ~~~~~~~~~~~~~~~~~ili~~ 841/281 'ICA CIG A'IT AN.; 00' 'IG3 TM ~ leu ile lys bis ~ stc:p

12 pet-3a-dvectors pet-3a pet-3b pet-3c pet-3d DNA DNA DNA DNA Cal.No TB026 12/98 The pet-3a-d veetors carry an N-terminal T7oTagœsequence and BamH 1cloning site. These veetors are the precursors to many pet family vectors; the pet-23a-d(+) series corresponds to pet-3a-d but incorporates several additional features. Unique sites are shown on the circle map. Note that the sequence is numbered by the pbr322 convention, so the T7 expression region is reversed on the circular map. The c1oninglexpression region of the coding strand transcribed by T7 RNA polymerase is shown below. pet-3asequencelandmarks T7 promoter T7 transcription start T7 otag coding sequence T7 terminator pbr322 origin bja coding sequence EcoR 1(4638) Apo 1(4638) Gia 1(24) Hind 111(29) The mars for pet-3b, pet-3c and pet-3d are the same as pet-3a (shown) with the following exceptions: pet-3b is a 4639bp plasmid; subtract Ibp from each site beyond BamH 1at 510. pet-3c is a 4638bp plasmid; subtract 2bp from each site beyond BamH 1 at 510. pet-3d is a 4637bp plasmid; the BamH 1site is in the same reading Crame as in pet-3c. An Nco 1site is substituted for the Nde 1site with a net 1bp deletion at position 550 of pet-3c. As a result, Nco 1 cuts pet-3d at 546. For the rest ofthe sites, subtract 3bp from each site beyond position 551 in pet-3a. Nde 1 does not eut pet-3d. pet-3a (4640bp) Sph 1(843) EcoN 1(903) Sall(928) PshA 1(993) Eag 1(1216) Nru 1(1251) ApaB 1(1329) BspM 1(1331) BspLU11 1(2752). Afllll(2752) Sap 1(2636) 6st11071(2523) 6saA 1(2504) Tth111 1(2497) 6sm6 1(2393) Pvu 11(2343) Bsm 1(1636) Ava 1(1702) Msc 1(1723) Bpu10 1(1858) BscG 1(1912) 17 promoter primer # ~ Bg/II 17promoter.. Xbal ~ AGA TCTCGA TCCCGCGAAA TT AA T ACGACTCACT ATAGGGAGACCACAACGGTTTCCCTCT AGAAA T AA TTTTGTTT AACTTT AAGAAGGAGA ~ 17oTag pet-30 BamH! Bpu11021 TA TACA T ATGGC TAGCA TGACTGGTGGACAGCAAA TGGGTCGCGGA TCCGGC TGCT AACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCAiiGCTGAGCAA TAAëTï::GëATÀA MetA 1oSerMetThrG 1yG 1yG 1nG 1nMetG 1yArgG 1ySerG 1yCysEnd 17 terminator Drimer # AACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAA T AAC TAGCA T pet -3b. GGTCGGGA TCCGGC TGCT A pet-3d Neo!. GI yargaspproaloa leasnlysai earglysg 1uA log 1uLeuA 1cA loa 1oThrAI cg lug InEnd TGGCT AGC. MetAleSer.. pet-3c.d. GGTCGGA TCCGGCTGC T AACAAAGCCCGAAAGGAAGCTGAGTTGGC TGC TGCCACCGCTGAGCAA T AACT AGCA T AA. G 1yAro!1 earoleuleuthrlysprog 1uArqLysLeuSerTroLeuLeuPrcProLeuSerAsnAsnEnd. T ACCA 17 termtnator CCCC TTGGGGCC TCT AAACGGGTCTTGAGGGGTTTTTTG pet-3a-dcloning/expression region

13 t pet.3arestrictionsites TB026 12/98 Enzyme 'Sites Locations E e ' Sites Locations E ' Sites Locations Aatll Cac81 32 Pvul Acel Cjel 18 Pvull Aeelll CjePI 22 Real Aeil 86 Cial 1 24 Rsal Mill CviJl 79 Sal! Alul 18 CviRI 21 Sapl Alwl 14 Odet Sau Alw Sau3AI Opnl 25 Seal Alw Oral SerFI 16 AlwNl Osai SlaNI 22 ApaBI Eael Stel Apol SgrAI Aval Eagl Sphl Aval! Eam Sspl Earl Styl BamHI Eeil Taql Bani Ee Eco Taqll BanI! EeoNI Bbsl EeoO1O Tfii Bbvl 24 EeoRI Becl EeoRII Thal Tsel 24 Bce EeoRV Tsp Faul Beell Fokl 12 Tsp Bcgl Fspl Gdill T!h Btal Hael Tth UbaJi 21 8g Haell 11 Vspl g Haelll 23 Xbal Bpml Hgal 11 Xmnl Bpu HgiEIi Bpu Hhal 31 Enzymes!hatdonetcutpET-3a: Bsal Hin MI! Agel Apal Ascl Avrl! BsaAI Hinell Bael Bcll Bmgl BsaXI BseRI BsaBI Hindlll 1 29 BsrGI BssHII BstEIi BstXl Bsu361 BsaHI Hinfi 11 Oralll Ordl! Fsel Hpal Kpnl 4564 Hphl 12 Mlul Muni Neol Notl Nsil BsaJl Maell NspV Pacl Pmel PmI! RleAl Rsrll Sael Saell SexAl Sfil BsaWI Maelll 17 Sgfi Smal Sna81 Spel Srtl 3936 Mboll 11 Sse83871Stul Sunl Swal Xeml Bsbl Mmel Xhol BscGI Mnl! 30 Bsil Mscl BsiEI Msel Msl! Bsl! Bsml Mspl 28 BsmAl MspA BsmBI BsmFI Mwol 37 B5OFI 45 Narl Bsp Neil Bsp Ndel NgoAIV BspEI Nhel BspGI Nlalll 27 BspLU NlalV 25 BspMI Nrul Bsrl 20 Nspl srBI P BsrOI PfiMI BsrFI Plel PshAl Bstll Psp BstYI Psp Pstl

14 Durée UNIVERSITE HENRI POINCARE, NANCY 1 FACULTE DES SCIENCES SUJET D'EXAMEN DIPLOME: Maîtrise de Biolologie 1 cellulaire et Physiologie - option Science et technologie du végétal 2 heures Epreuve de : Réponses l'environnement Session: Juin 2003 Date: Horaire: Traitez les questions suivantes: des plantes à 1 Nomdu rédacteur: P. Dizengremel DDocuments autorisés ŒJDocuments non autorisés ŒJCalculatrices autorisées DCalculatrices non autorisées 1) La Figure 1 présente la réponse de plusieurs paramètres hydriques et métaboliques de feuilles de plants de Tournesol soumis à un déficit hydrique progressif. Commentez les résultats obtenus. (a) g,~ ~- 2 -'- "E'"" : 1.5 ~ ~ 1.\1 ëe 0.5 ès 2.5 / -0- OsmotlC pressure Turgor (b) ci -; 0.6 ~ '" -g "E " <ii ùj Figllre -1.Theeffectofexpos<I"ta increasingwaterdeficit(leafwaterpotential, MPa)on water relations, gas exchangeand R<lBPcontentof s<lnflower(helianthus... c, c: 1500 annuus L) leaves with 0.35 mmol CO2 mor' air and 1200 mmol m-2,,' plloto syntheticaliy active radiation. (a) Osmotic presstlre and t<lrgo' (b) Stomatal " conductance (mol m-2,,') and intereeliular CO2 concentration (}.Lmolmar'). 300 (c) Photosynthetic rate (}.Lm01 m-2 s-i) and rib<llosebisphosphate (R<lBP, }.Lmolm-2) 0 " (after Cimenez et al., 1992; Gimenez and Lawlo <lnp<lblished) ffi 100 ïj " (c) 50 ~ 40 '" 16 ~ 30 ~ ~ 20 ~" A RuBP "- 75 cc cr: Water patential (MPa) 2) L'effet de l'ozone sur les végétaux supérieurs a fait l'objet de nombreuses expériences dont certaines, menées sur des espèces différentes, sont décrites ci-dessous: - de jeunes plants de pin loblolly (Pinus taeda) ont été placés pendant 3 ans dans des chambres à ciel ouvert soumises soit à de l'air filtré (CF), soit à de l'air ambiant (NF = non filtré), soit à de l'air enrichi 2 fois en ozone (2x) par rapport à l'air ambiant (ce qui correspond à 92 ppb ou nll-1 pendant 12h par jour au cours de la saison de croissance d'avril à Octobre). La Figure 2 présente l'activité photosynthétique (A) et l'activité de la Rubisco (B) mesurées chez des aiguilles du premier "flush" de l'année 1989 (89-1), du 3ème"flush" de l'année 1989 (89-3) ainsi que du premier "flush" de l'année 1990 (90-1). Les résultats sont exprimés par rapport à la dose cumulée d'ozone depuis le début de l'expérience. A

15 - la Figure 3 présente les résultats de quantités de protéines des 2 sous-unités de la rubisco:. la LSU dans des aiguilles de 1 an lors d'exposition de pins d'alep pendant 24 jours à 200 nll-1 d'ozone (fig. 3A, C: contrôle sans ozone, 03: exposition à l'ozone). la SSU, dans de jeunes feuilles, lors d'exposition pendant 3 semaines de haricots à une concentration en ozone dans l'air ambiant augmentée de 80 ppb (ou nll-1) (fig. 3B, NF = non filtré ou air ambiant; + 80, en présence d'ozone); l'expérience est répétée 3 fois (3 pistes). - la Figure 4 présente les résultats de l'effet de l'ozone sur les quantités de transcrits des 2 sous-unités de la rubisco:. les transcrits rbcl obtenus au jour 24 de traitement, dans des aiguilles âgées d'1 an de pins d'alep soumis pendant 24 jours à 200 nll-1 d'ozone (fig. 4A. C: contrôle sans ozone, 03 : exposition à l'ozone). les transcrits rbcs obtenus au jour 21 de traitement, dans des aiguilles âgées d'l an d'épicéas soumis pendant 24 jours à 200 nll-1 d'ozone (fig. 4B. C: contrôle sans ozone, 03: exposition à l'ozone) 120 ~ 100 * '-' <U.~ :> CIJ 80.~ ~ <U ::: ~ ~ 40 0 c A B 100 ïo!:p.. 80 ê. 60 ~ ~ >- g i:l Cumulative Ozone Exposure (ppm.h) () _. CIJ -. () :::.0 «20 ~ 0 ~ '-'. R 89-1 CF. R 89-1 NF c R 89-12x ~ R 89-3 CF. R 89-3 NF 0 R x Ji.. R 90-1 CF ~ R 90-1 NF + R x tr z /A'\ Proteins A. ~ LSU ~' c NF +80 " \1 \.~][fj ~, '..... Rubisco,~,..:,,,' 4E -ssu Transcripts rbcl c clay rbcs C 03 of=l ~~ 4-2.

16 - la Figure S présente les résultats d'activités enzymatiques déterminées soit:. sur les aiguilles des pins loblolly (Fig. SA, même traitement que Figure 2). sur les aiguilles d'épicéa (Fig. SB, même traitement que Figure 4B). sur les aiguilles de pin d'alep (Fig. SC, même traitement que Figures 3A et 4A). - la Figure 6 montre les résultats des effets de l'ozone sur les pins d'alep au niveau de la quantité de protéines et de transcrits de la phosphoénolpyruvate carboxylase (aujour 24 du traitement, identique à celui rencontré dans les figures 3A, 4A et SC) Commentez soigneusement l'ensemble des résultats et fournissez une hypothèse d'action de l'ozone sur le métabolisme carboné primaire foliaire. 2001,-.,, * '-' >.. -.::: <:J -< 100 Q,)... -.::: CIl a:; =- ~ Photosynthesis ~ Rubisco G6PDH = glucose 6 phosphate déshydrogénase Cumulative Ozone Exposure (ppm.h) PFK = phosphofructokinase PEPC = phosphoénolpyruvate PK = pyruvate kinase carboxylase NADP-ME = enzyme malique à NADP NAD-ME = enzyme malique à NAD ,.., ~ 0 'B 0 0\1...:: '; 0:; CI:: 0 PFK. Fumarrase 0 G6PDH. PEPC ~. :~ ụ i;.. o:i ~ 1 0-1)?~ 1 riu..j-~ '"' 1: Daysof Ireahnent ho t s ~f~';~ PEPe ~:y; ~;.. --_._-- c 03 pepe ~ r:- I\\~v'v'-- (; 7~~ V\,t:; c 03 3

17 UNIVERSITE HENRI POINCARÉ, NANCY 1 FACULTÉ DES SCIENCES et TECHNIQUES SUJET Diplôme: Maîtrise de Biologie Cellulaire et Physiologie Mention: Génétique Moléculaire et Cellulaire Epreuve de: Bioloqie du Développement Session de :juin 2003 Date: Horaire' D'EXAMEN Durée des sujets: Ih Nom du rédacteur: Professeur Michel DAUÇA [ ] Documents autorisés [X] Documents non autorisés [ ] Calculatrices autorisées [X] Calculatrices non autorisées Maîtrise de Biologie Cellulaire et Physiologie Génétique Moléculaire et Cellulaire Génétique du Développement Sujet de Monsieur le Professeur M. DAUÇA A partir de quelques exemples de votre choix, vous montrerez la diversité chez la drosophile des mécanismes régulant l'expression des gènes du développement et des fonctions exercées par les protéines codées par ces gènes. NB: Les sujets de Monsieur le Professeur Michel DAUÇA et de Monsieur Bertrand AIGLE sont à traiter sur des copies séparées. Il sera tenu compte de la qualité de la rédaction et de l'illustration ainsi que de la maîtrise de l'orthographe.

18 UNIVERSITE HENRI POINCARÉ, NANCY 1 FACULTÉ DES SCIENCES et TECHNIQUES SUJET D'EXAMEN Diplôme: Maîtrise de Biologie Cellulaire et Physiologie Mention: Génétique Moléculaire et Cellulaire Epreuve de : Bioloqiedu Développement Session de :juin 2003 Date: Horaire. Durée des sujets: Ih Nom du rédacteur: Bertrand AIGLE [ ] Documents autorisés [X] Documents non autorisés [ ] Calculatrices autorisées [X] Calculatrices non autorisées Maîtrise de Biologie Cellulaire et Physiologie Génétique Moléculaire et Cellulaire Génétique du Développement Voir sujet ci-joint Les sujets de Monsieur le Professeur Michel DAUÇA et de Monsieur Bertrand AIGLE sont à traiter sur des copies séparées.

19 Examen MGMC, juin 2003 Génétique du développement Sujet de cours proposé par B. Aigle Durée 1 heure, aucun document n'est autorisé Justifiez vos réponses et soyez clairs et concis! La sporulation chez la bactérie Bacillus subtilis est gouvernée par une série de facteurs de transcription qui sont soumis à des régulations spatiales et temporelles. La phase d'initiation est contrôlée par la protéine SpoOAqui est considérée comme le régulateur clé pour l'entrée dans la voie de sporulation. Des travaux ont été menés afin de déterminer si SpoOA pourrait avoir éventuellement d'autres rôles que ceux décrits jusqu'à présent. Dans un premier temps, le gène de la GFP ("green fluorescent protein") a été placé sous le contrôle des promoteurs PspoIlGet Pspacc. Pspaccest un promoteur constitutif alors que PspoIlG(promoteur de l'opéron spolie) est sous le contrôle de la forme active de SpoOA. Les cellules de B. subtilis ont été analysées pour la présence de fluorescence (Fig. 1) trois heures après l'entrée dans le processus de sporulation (stade d'engouffrement -"engulfment"- atteint). GFP Po;pollG-gfp P spac C-gfp Fig. 1 : Localisation subcellulaire de la GFP. La fluorescence apparaît ici sous forme blanche. La barre blanche = 1/lm. 11 Interprétez les résultats obtenus Fig. 1. SpoOA est-elle uniquement active pendant la phase d'initiation de la sporulation? Remarque: la transcription à partir des deux promoteurs est due à la même forme de l'arnpolymérase (celle contenant le facteur sigma principal, cra). Des anticorps anti-spooa ont été utilisés afin de rechercher la présence éventuelle postdivisionnel. Les résultats sont montrés Fig. 2. de SpoOA dans le sporangium 2/ Interprétez. Ces résultats sont-ils compatibles avec ceux présentés Fig. 1? Remarque: l'utilisation d'anticorps anti-cramontre des signaux d'intensité très similaire entre le compartiment «forespore» et le compartiment cellule-mère «<mother cell»). 2h Fig. 2 : Localisation subcellulaire de SpoOA. Les cellules sporulantes de la souche sauvage sont collectées à différents temps après le début de la sporulation et observées par microscopie. La protéine SpoOA est détectée par immunofluorescence à l'aide d'anticorps anti-spooaet d'un anticorps secondaire lié au FITC (fluorophore vert). Les cellules représentatives sont entourées par les rectangles et les flèches indiquent la localisation de la «forespore» au niveau de ces cellules. La barre blanche = l/lm 3h 4h

20 CI ~,/1,:t: )1...1,~; UNIVERSITE HENRI POINCARE, NANCY 1 FACULTE DES SCIENCES SUJET D'EXAMEN DIPLOME: Maîtrise de Biologie Cellulaire et Physiologie iopn'orf:sc..'c..~cj-tcùl"",ljj,,k d,... "'~~hsi Epreuve de :. Interactions Plantes Microorganismes Session: Date: Horaire: Durée du sujet: 2 heures Nom du rédacteur: B.BOITON DDocuments autorisés IIDDocumentsnon autorisés IIDCalcu1atricesautorisées DCalcu1atrices non autorisées Dans le but de comparer l'assunilationde l'ammonium chez les ectomycorlrizesde Hê1re(Fig. 1) et d'epicéa (Fig. 2 et 3), celles-ci ont été incubées dans un milieu de culture renfermant de l'ammoniummarqué à l'isotope l~, en présence ou en absence de Méthionine sulfoximine (MSX). A partir des cinétiques d'accnmul$on des composés dans la celluleet de l'enrichissementisotopique des acides aminés, déduire les voies métaboliques d'incorporation de l'ammonium dans les composés organiques et les enzymes impliquées, pour chacun des deux types de mycorhizes. (1'~ès 2. et 3 jointes)

21 ~ ).,? \,(c; t....- ~ ~ ~600 Z ~ ~ = 0.- ~ ~0 u ~ 501'.".'. ~ Z 800 ~.5 30 ~vi Time (h) 6 8 Figure 1 : Effect of anmonium feeding and 1 mm MSX on the levels on intracellularariunonium(inset:. ~). total tree aminoacids(ii.[j) and glutamine (8. 0) in ectomycorrhizas of Fagus sylvatica. Open symbols. without MSX; closed symbols. withmsx...'..

22 e =' 1: J : ~ ' ~ 1.4 -!: A ~ f";' '" t". ",0;1 ri) "0... g~l1 0" 12'~.~ ~ 10 e;)~-!: ~ : (Ü - 8 ~ 3 6 9' ' Incubation period (h), 18 Figure 2. Effect of ammoniumfeedd1gon the-leveis of the h1tracelluiarammonium (A) and the total free amino acid pool (B). The ~hed spruce-hebe1oma sp. ectomycorrbizas collected!rom a nursery were incubate4 in Pachlewski's medium conn.ining 5 mm ammonium sulphate (50 atom % excess,cea France), without enzymeb1hibitor~~wdh2smmmsx œ '" ':,' SOLA B 40 ~z Incubation period (h) 18 Figure 3. Tune course of lsn incoiporationin the amido-n of glutamine (0), the amino-n of glutamine(e), glutamate(8), y-aminobutyricacid (+) and alanine (A)of spmce ectomycorrhizas fed with 5 mm ls~2s04 (50 Item % excess, CEA France).The detachedspmce-hebeloma sp. ectomycorrhizascollected from a nursery were incubated in Pachlewski's medium, without enzymeinhibitor(a) or containing2.5 mmmsx (B).

23 Epreuve de 'P.~j).QLb. LE,.". UNIVERSITE DE NANCY l FACULTE DES SCIENCES ET TECHNIQUES DIPLOME (1:(~.t1: 1:.1:$ {;.'13,:tJ SUJET M.~..13.~...P..~..f:...f!!... (I?ii.f?...B İ.. L( Cf /JI (II oi e.f...f".~~~.5a;h1-~ S.' "/ <> ' 6J.p ri. 0. Vl....ni{.8.P.t=$.... Ii. T... E. ev.ry f., EI:t ~.. ti)iu~ f. T.l ~ Session de Ji..J.~M 2..~~.~... Date,... Horaire, '.'." '. D'EXAMEN J tf Durée du sujet 2.: ~ Nom du rédacteur r:e.l.(f.~.ky... Documents autorisés ~ 1 NON 1 (1) Calculatrices autorisées L OUI linon 1 (1) (lt Rayer la mention inutile 1.- Question principale (temps conseillé: 1 heure 30) Les transferts de D1atière dans les quatre processus fondamentaux de pédogenèse des principales zones bioclimatiques: facteurs, mécanismes et résultats questions à réponses brèves go minutes) : CD Dans quels sols se forme la Caractères essentiels d'un humus de type Qu'est-ce qu'une les trois caractéristiques d'une "structure Pourquoi les nitrates sont-il entraînés rapidement dans les eaux de drainage?

Fonctions de plusieurs variables

Fonctions de plusieurs variables Module : Analyse 03 Chapitre 00 : Fonctions de plusieurs variables Généralités et Rappels des notions topologiques dans : Qu est- ce que?: Mathématiquement, n étant un entier non nul, on définit comme

Plus en détail

la matièr cuivre (II) Donner la 2) Déterminer et Cu 2+ + Correction : ions chlorure. 1) Chlorure de cuivre neutralité CuCl 2. = =

la matièr cuivre (II) Donner la 2) Déterminer et Cu 2+ + Correction : ions chlorure. 1) Chlorure de cuivre neutralité CuCl 2. = = 1) Chlorure de cuivre Le chlorure de cuivre (II) est un composé ionique constitué d'ions chlorure Cl - et d'ions cuivre (II) Cu 2+. Donner la formule statistique de ce composé. Écrire l'équation de sa

Plus en détail

Résolution d équations non linéaires

Résolution d équations non linéaires Analyse Numérique Résolution d équations non linéaires Said EL HAJJI et Touria GHEMIRES Université Mohammed V - Agdal. Faculté des Sciences Département de Mathématiques. Laboratoire de Mathématiques, Informatique

Plus en détail

Théorème du point fixe - Théorème de l inversion locale

Théorème du point fixe - Théorème de l inversion locale Chapitre 7 Théorème du point fixe - Théorème de l inversion locale Dans ce chapitre et le suivant, on montre deux applications importantes de la notion de différentiabilité : le théorème de l inversion

Plus en détail

Calcul différentiel sur R n Première partie

Calcul différentiel sur R n Première partie Calcul différentiel sur R n Première partie Université De Metz 2006-2007 1 Définitions générales On note L(R n, R m ) l espace vectoriel des applications linéaires de R n dans R m. Définition 1.1 (différentiabilité

Plus en détail

Cours de mathématiques - Alternance Gea

Cours de mathématiques - Alternance Gea Cours de mathématiques - Alternance Gea Anne Fredet 11 décembre 005 1 Calcul matriciel Une matrice n m est un tableau de nombres à n lignes( et m colonnes. 1 0 Par exemple, avec n = et m =, on peut considérer

Plus en détail

Problème de l'agrégation de chimie 1976

Problème de l'agrégation de chimie 1976 Problème de l'agrégation de chimie 1976 COMPOSITION DE CHIMIE (Durée : 6 heures) Cette épreuve comporte deux parties. La première étudie le modèle des solutions strictement régulières qui permet l'évaluation

Plus en détail

THEME 2. LE SPORT CHAP 1. MESURER LA MATIERE: LA MOLE

THEME 2. LE SPORT CHAP 1. MESURER LA MATIERE: LA MOLE THEME 2. LE SPORT CHAP 1. MESURER LA MATIERE: LA MOLE 1. RAPPEL: L ATOME CONSTITUANT DE LA MATIERE Toute la matière de l univers, toute substance, vivante ou inerte, est constituée à partir de particules

Plus en détail

TS. 2012/2013. Lycée Prévert. Corrigé du contrôle n 3. Durée : 3 heures. Mardi 20/11/12

TS. 2012/2013. Lycée Prévert. Corrigé du contrôle n 3. Durée : 3 heures. Mardi 20/11/12 TS. 01/013. Lycée Prévert. Corrigé du contrôle n 3. Durée : 3 heures. Mardi 0/11/1 Exercice 1 : ( 6,5 pts) Première partie : Démonstration à rédiger { Démontrer que si ( ) et (v n ) sont deux suites telles

Plus en détail

Université Bordeaux 1 Master d informatique UE Bases de Données Sujet et correction de l examen du 27 mai 2004 8h00 9h30 (sans documents)

Université Bordeaux 1 Master d informatique UE Bases de Données Sujet et correction de l examen du 27 mai 2004 8h00 9h30 (sans documents) Numéro d anonymat: 1 Université Bordeaux 1 Master d informatique UE Bases de Données Sujet et correction de l examen du 27 mai 2004 8h00 9h30 (sans documents) Sauf mention contraire en caractères gras,

Plus en détail

Effet d une onde électromagnétique sur un atome à deux niveaux

Effet d une onde électromagnétique sur un atome à deux niveaux Université Pierre et Marie Curie Master de sciences et technologie Interaction matière-rayonnement Effet d une onde électromagnétique sur un atome à deux niveaux Introduction On considère un système atomique

Plus en détail

Université Joseph Fourier MAT231 2008-2009

Université Joseph Fourier MAT231 2008-2009 Université Joseph Fourier MAT231 2008-2009 mat231-exo-03.tex (29 septembre 2008) Feuille d exercices n o 3 Exercice 3.1 Soit K un corps commutatif et soit {P 0, P 1,... P n } une famille de polynômes de

Plus en détail

TP : Suivi d'une réaction par spectrophotométrie

TP : Suivi d'une réaction par spectrophotométrie Nom : Prénom: n groupe: TP : Suivi d'une réaction par spectrophotométrie Consignes de sécurité de base: Porter une blouse en coton, pas de nu-pieds Porter des lunettes, des gants (en fonction des espèces

Plus en détail

BACCALAURÉAT TECHNOLOGIQUE SÉRIE ST2S SCIENCES ET TECHNOLOGIES DE LA SANTÉ ET DU SOCIAL ÉPREUVE DE SCIENCES PHYSIQUES ET CHIMIQUES

BACCALAURÉAT TECHNOLOGIQUE SÉRIE ST2S SCIENCES ET TECHNOLOGIES DE LA SANTÉ ET DU SOCIAL ÉPREUVE DE SCIENCES PHYSIQUES ET CHIMIQUES Session 2014 BACCALAURÉAT TECHNOLOGIQUE SÉRIE ST2S SCIENCES ET TECHNOLOGIES DE LA SANTÉ ET DU SOCIAL ÉPREUVE DE SCIENCES PHYSIQUES ET CHIMIQUES Durée de l épreuve : 2 heures Coefficient : 3 L usage de

Plus en détail

POLY-PREPAS Centre de Préparation aux Concours Paramédicaux

POLY-PREPAS Centre de Préparation aux Concours Paramédicaux POLY-PREPAS Centre de Préparation aux Concours Paramédicaux - Sections : L1 Santé - 1 Olivier CAUDRELIER oc.polyprepas@orange.fr Chapitre 1 : Equations aux dimensions 1. Equation aux dimensions a) Dimension

Plus en détail

Applications linéaires

Applications linéaires Applications linéaires I) Applications linéaires - Généralités 1.1) Introduction L'idée d'application linéaire est intimement liée à celle d'espace vectoriel. Elle traduit la stabilité par combinaison

Plus en détail

S O 2H O S SO 3H O. une solution de thiosulfate de sodium de concentration en ion thiosulfate [S 2

S O 2H O S SO 3H O. une solution de thiosulfate de sodium de concentration en ion thiosulfate [S 2 PARTIE 3 : Réactions chimiques et milieux biologiques TP 15 La chimie des facteurs cinétiques OBJECTIFS : Mettre en œuvre une démarche expérimentale pour mettre en évidence quelques paramètres influençant

Plus en détail

DS n 8 Physique & Chimie

DS n 8 Physique & Chimie DS n 8 Physique & Chimie CONTROLE DE QUALITE D UN LAIT D APRES PONDICHERY 2014 (+ LIBAN 2014) [7 PTS] Le lait de vache est un liquide biologique de densité 1,03. Il est constitué de 87 % d'eau, 4,7 % de

Plus en détail

MC11 Mélanges d acides et de bases ; solutions tampons

MC11 Mélanges d acides et de bases ; solutions tampons MC11 Mélanges d acides et de bases ; solutions tampons Les définitions d acidité et de basicité ont beaucoup évoluées depuis leur apparition. Aujourd hui, on retient deux définitions valables. Celle donnée

Plus en détail

Cours de mathématiques pour la Terminale S

Cours de mathématiques pour la Terminale S Cours de mathématiques pour la Terminale S Savoir-Faire par chapitre Florent Girod 1 Année scolaire 2015 / 2016 1. Externat Notre Dame - Grenoble Table des matières 1) Suites numériques.................................

Plus en détail

SESSION 2013 SECOND CONCOURS ÉCOLE NORMALE SUPÉRIEURE PHYSIQUE CHIMIE. Durée : 4 heures

SESSION 2013 SECOND CONCOURS ÉCOLE NORMALE SUPÉRIEURE PHYSIQUE CHIMIE. Durée : 4 heures SESSION 2013 SECOND CONCOURS ÉCOLE NORMALE SUPÉRIEURE PHYSIQUE CHIMIE Durée : 4 heures L usage des calculatrices électroniques de poche à alimentation autonome, sans imprimante et sans document d accompagnement,

Plus en détail

Chapitre n 2. Conduction électrique et structure de la matière.

Chapitre n 2. Conduction électrique et structure de la matière. Chapitre n 2 3 Conduction électrique et structure de la matière. T.P.n 1: Les solutions aqueuses sont-elles conductrices? >Objectifs: Tester le caractère conducteur ou isolant de diverses solutions aqueuses.

Plus en détail

À propos des matrices échelonnées

À propos des matrices échelonnées À propos des matrices échelonnées Antoine Ducros appendice au cours de Géométrie affine et euclidienne dispensé à l Université Paris 6 Année universitaire 2011-2012 Introduction Soit k un corps, soit E

Plus en détail

BAC BLANC 2015 PHYSIQUE-CHIMIE

BAC BLANC 2015 PHYSIQUE-CHIMIE BAC BLANC 2015 PHYSIQUE-CHIMIE DURÉE DE L ÉPREUVE : 3 h 30 L usage d'une calculatrice EST autorisé Ce sujet comporte trois exercices (l exercice de spécialité figurant sur une feuille séparée). Chaque

Plus en détail

Partie I : Automates et langages

Partie I : Automates et langages 2 Les calculatrices sont interdites. N.B. : Le candidat attachera la plus grande importance à la clarté, à la précision et à la concision de la rédaction. Si un candidat est amené à repérer ce qui peut

Plus en détail

CCP Chimie MP 2011 Énoncé 1/5 6(66,21 03&+ (35(89(63(&,),48(),/,(5(03 zzzzzzzzzzzzzzzzzzzz &+,0,( 'XUpHKHXUHV zzzzzzzzzzzzzzzzzzzz

CCP Chimie MP 2011 Énoncé 1/5 6(66,21 03&+ (35(89(63(&,),48(),/,(5(03 zzzzzzzzzzzzzzzzzzzz &+,0,( 'XUpHKHXUHV zzzzzzzzzzzzzzzzzzzz CCP Chimie MP 20 Énoncé /5 6(66,2 03&+ C O N C O U R S C O M M U N S P O LY T E C H N I Q U E S (35(89(63(&,),48(),/,(5(03 zzzzzzzzzzzzzzzzzzzz &+,0,( 'XUpHKHXUHV zzzzzzzzzzzzzzzzzzzz %/HFDQGLGDWDWWDFKHUDODSOXVJUDQGHLPSRUWDQFHjODFODUWpjODSUpFLVLRQHWjODFRQFLVLRQGH

Plus en détail

Énergie électrique mise en jeu dans un dipôle

Énergie électrique mise en jeu dans un dipôle Énergie électrique mise en jeu dans un dipôle Exercice106 Une pile de torche de f.é.m. E = 4,5 V de résistance interne r = 1,5 Ω alimente une ampoule dont le filament a une résistance R = 4 Ω dans les

Plus en détail

Épreuve d informatique 2011

Épreuve d informatique 2011 A 2011 INFO. MP ÉCOLE NATIONALE DES PONTS ET CHAUSSÉES, ÉCOLES NATIONALES SUPÉRIEURES DE L AÉRONAUTIQUE ET DE L ESPACE, DE TECHNIQUES AVANCÉES, DES TÉLÉCOMMUNICATIONS, DES MINES DE PARIS, DES MINES DE

Plus en détail

PC Brizeux TP N 1 - Correction Altmayer- Henzien 2015-2016

PC Brizeux TP N 1 - Correction Altmayer- Henzien 2015-2016 Correction TP N1 I. Etalonnage d'une solution de soude Q1. Si la solution de soude n'est pas fraîchement préparée, du dioxyde de carbone de l'air peut se dissoudre dedans puis réagir avec la soude par

Plus en détail

N Etudiant:: Place : Filière :

N Etudiant:: Place : Filière : UNIVERSITE DE BOURGOGNE UFR SCIENCES DE LA VIE, DE LA TERRE ET DE L ENVIRONNEMENT L2, PHYSIOLOGIE VEGETALE : Examen du 08 janvier 2013 (A) Professeur D. REDECKER, Professeur D. WIPF N Etudiant:: Place

Plus en détail

G.P. DNS02 Septembre 2012. Réfraction...1 I.Préliminaires...1 II.Première partie...1 III.Deuxième partie...3. Réfraction

G.P. DNS02 Septembre 2012. Réfraction...1 I.Préliminaires...1 II.Première partie...1 III.Deuxième partie...3. Réfraction DNS Sujet Réfraction...1 I.Préliminaires...1 II.Première partie...1 III.Deuxième partie...3 Réfraction I. Préliminaires 1. Rappeler la valeur et l'unité de la perméabilité magnétique du vide µ 0. Donner

Plus en détail

Chapitre 1 Régime transitoire dans les systèmes physiques

Chapitre 1 Régime transitoire dans les systèmes physiques Chapitre 1 Régime transitoire dans les systèmes physiques Savoir-faire théoriques (T) : Écrire l équation différentielle associée à un système physique ; Faire apparaître la constante de temps ; Tracer

Plus en détail

Points fixes de fonctions à domaine fini

Points fixes de fonctions à domaine fini ÉCOLE POLYTECHNIQUE ÉCOLE NORMALE SUPÉRIEURE DE CACHAN ÉCOLE SUPÉRIEURE DE PHYSIQUE ET DE CHIMIE INDUSTRIELLES CONCOURS D ADMISSION 2013 FILIÈRE MP HORS SPÉCIALITÉ INFO FILIÈRE PC COMPOSITION D INFORMATIQUE

Plus en détail

MICROBIOLOGIE ET GÉNIE FERMENTAIRE

MICROBIOLOGIE ET GÉNIE FERMENTAIRE Sujet zéro BREVET DE TECHNICIEN SUPÉRIEUR BIOTECHNOLOGIES MICROBIOLOGIE ET GÉNIE FERMENTAIRE Durée de l'épreuve : 2 heures Coefficient : 1 Le sujet comporte 8 pages numérotées de 1/8 à 8/8 L usage d un

Plus en détail

Réactions d oxydoréduction

Réactions d oxydoréduction Réactions d oxydoréduction Ce document a pour objectif de présenter de manière synthétique quelques bases concernant les réactions d oxydoréduction et leurs principales applications que sont les piles

Plus en détail

TP 11: Réaction d estérification - Correction

TP 11: Réaction d estérification - Correction TP 11: Réaction d estérification - Correction Objectifs : Le but de ce TP est de mettre en évidence les principales caractéristiques de l'estérification et de l'hydrolyse (réaction inverse). I ) Principe

Plus en détail

Image d un intervalle par une fonction continue

Image d un intervalle par une fonction continue DOCUMENT 27 Image d un intervalle par une fonction continue La continuité d une fonction en un point est une propriété locale : une fonction est continue en un point x 0 si et seulement si sa restriction

Plus en détail

DEVOIR DE THERMOCHIMIE

DEVOIR DE THERMOCHIMIE DEVOIR DE THERMOCHIMIE Données fournies Constante des gaz parfaits: R= 8,31 kpa.l.k-1.mol -1 Nombre d'avogadro: N A = 6,02 x 10 23 mol -1. Capacité thermique massique de l'eau solide: 2,14 J/g. C. Capacité

Plus en détail

CONCOURS D ADMISSION 2010

CONCOURS D ADMISSION 2010 A 2010 Chimie PSI ECOLE DES PONTS PARISTECH, SUPAERO (ISAE), ENSTA PARISTECH, TELECOM PARISTECH, MINES PARISTECH, MINES DE SAINT-ETIENNE, MINES DE NANCY, TELECOM BRETAGNE, ENSAE PARISTECH (FILIERE MP)

Plus en détail

Le corps R des nombres réels

Le corps R des nombres réels Le corps R des nombres réels. Construction de R à l aide des suites de Cauchy de nombres rationnels On explique brièvement dans ce paragraphe comment construire le corps R des nombres réels à partir du

Plus en détail

Injections alcalinisantes

Injections alcalinisantes Injections alcalinisantes Des solutions d'hydrogénocarbonate de sodium ou de lactate de sodium sont utilisées en injection par les médecins pour leurs propriétés alcalinisantes (traitement de l'excès d'acidité)

Plus en détail

BACCALAURÉAT TECHNOLOGIQUE

BACCALAURÉAT TECHNOLOGIQUE BACCALAURÉAT TECHNOLOGIQUE Série : Sciences et Technologies de Laboratoire Spécialité : Biotechnologies SESSION 2013 Sous-épreuve écrite de Biotechnologies Coefficient de la sous-épreuve : 4 Ce sujet est

Plus en détail

DS SCIENCES PHYSIQUES MATHSPÉ

DS SCIENCES PHYSIQUES MATHSPÉ DS SCIENCES PHYSIQUES MATHSPÉ calculatrice: autorisée durée: 4 heures Sujet Mécanique...2 I.Mise en équations...2 II.Résolution...4 III.Vérifications...4 IV.Aspects énergétiques...4 Optique...5 I.Interférences

Plus en détail

Introduction à l étude des Corps Finis

Introduction à l étude des Corps Finis Introduction à l étude des Corps Finis Robert Rolland (Résumé) 1 Introduction La structure de corps fini intervient dans divers domaines des mathématiques, en particulier dans la théorie de Galois sur

Plus en détail

Enveloppes convexes dans le plan

Enveloppes convexes dans le plan ÉCOLE POLYTECHNIQUE ÉCOLES NORMALES SUPÉRIEURES ÉCOLE SUPÉRIEURE DE PHYSIQUE ET DE CHIMIE INDUSTRIELLES CONCOURS D ADMISSION FILIÈRE MP HORS SPÉCIALITÉ INFO FILIÈRE PC COMPOSITION D INFORMATIQUE B (XECLR)

Plus en détail

BIO241 année 2007-2008

BIO241 année 2007-2008 BIO241 année 2007-2008 Examen Terminal de 2 nde session du 17 juin 2008 Documents et calculatrice non autorisés Notation sur 100 points ATTENTION!!!! Rédiger les 3 parties sur des feuilles séparées 5 pages

Plus en détail

P R O G R A M M E E T I N S T R U C T I O N S O F F I C I E L L E S

P R O G R A M M E E T I N S T R U C T I O N S O F F I C I E L L E S P R O G R A M M E E T I N S T R U C T I O N S O F F I C I E L L E S POUR L ENSEIGNEMENT DE L INFORMATIQUE MPSI première année I. Objectifs de la formation II-1 Développement de compétences et d aptitudes

Plus en détail

Résolution de systèmes linéaires : Méthodes directes. Polytech Paris-UPMC. - p. 1/51

Résolution de systèmes linéaires : Méthodes directes. Polytech Paris-UPMC. - p. 1/51 Résolution de systèmes linéaires : Méthodes directes Polytech Paris-UPMC - p. /5 Rappels mathématiques s Propriétés - p. 2/5 Rappels mathématiques Soit à résoudre le système linéaire Ax = b. Rappels mathématiques

Plus en détail

TS Physique L automobile du futur Electricité

TS Physique L automobile du futur Electricité P a g e 1 TS Physique Electricité Exercice résolu Enoncé Le moteur thermique, étant très certainement appelé à disparaître, les constructeurs automobiles recourront probablement au «tout électrique» ou

Plus en détail

1 ère partie : tous CAP sauf hôtellerie et alimentation CHIMIE ETRE CAPABLE DE. PROGRAMME - Atomes : structure, étude de quelques exemples.

1 ère partie : tous CAP sauf hôtellerie et alimentation CHIMIE ETRE CAPABLE DE. PROGRAMME - Atomes : structure, étude de quelques exemples. Référentiel CAP Sciences Physiques Page 1/9 SCIENCES PHYSIQUES CERTIFICATS D APTITUDES PROFESSIONNELLES Le référentiel de sciences donne pour les différentes parties du programme de formation la liste

Plus en détail

ECHANGE DE CHALEUR: LA CONDUCTION

ECHANGE DE CHALEUR: LA CONDUCTION ECHANGE DE CHALEUR: LA CONDUCTION Nous n étudierons dans ce chapitre que la conduction en régime permanent, c'est-à-dire lorsque l équilibre thermique est atteint ce qui se caractérise par des températures

Plus en détail

EXERCICE II. SYNTHÈSE D UN ANESTHÉSIQUE : LA BENZOCAÏNE (9 points)

EXERCICE II. SYNTHÈSE D UN ANESTHÉSIQUE : LA BENZOCAÏNE (9 points) Bac S 2015 Antilles Guyane http://labolycee.org EXERCICE II. SYNTHÈSE D UN ANESTHÉSIQUE : LA BENZOCAÏNE (9 points) La benzocaïne (4-aminobenzoate d éthyle) est utilisée en médecine comme anesthésique local

Plus en détail

Projet CLANU en 3GE: Compléments d algèbre linéaire numérique

Projet CLANU en 3GE: Compléments d algèbre linéaire numérique Projet CLANU en 3GE: Compléments d algèbre linéaire numérique Année 2008/2009 1 Décomposition QR On rappelle que la multiplication avec une matrice unitaire Q C n n (c est-à-dire Q 1 = Q = Q T ) ne change

Plus en détail

Clonage de Vénus et transformation de E.Coli.

Clonage de Vénus et transformation de E.Coli. Clonage de Vénus et transformation de E.Coli. Samueal Joseph, Romain Laverrière, Elias Laudato, Noé Mage Assisstants : Gisele Dewhurst, Charlotte Gehin, Miwa Umebayashi Résumé [1] L expérience consiste

Plus en détail

Cours d Analyse. Fonctions de plusieurs variables

Cours d Analyse. Fonctions de plusieurs variables Cours d Analyse Fonctions de plusieurs variables Licence 1ère année 2007/2008 Nicolas Prioux Université de Marne-la-Vallée Table des matières 1 Notions de géométrie dans l espace et fonctions à deux variables........

Plus en détail

Série : STL Spécialité biotechnologies SESSION 2014 BACCALAURÉAT TECHNOLOGIQUE

Série : STL Spécialité biotechnologies SESSION 2014 BACCALAURÉAT TECHNOLOGIQUE BACCALAURÉAT TECHNLGIQUE Série : STL Spécialité biotechnologies SESSIN 2014 CBSV : sous épreuve coefficient 4 Biotechnologies : sous épreuve coefficient 4 Durée totale de l épreuve: 4 heures Les sujets

Plus en détail

Examen de l UE LM125 Janvier 2007 Corrigé

Examen de l UE LM125 Janvier 2007 Corrigé Université Pierre et Marie Curie Licence Sciences et Technologies MIME L énoncé est repris sur fond mauve. En prune : des commentaires. Examen de l UE LM15 Janvier 007 Corrigé Commentaires généraux barème

Plus en détail

UNIVERSITÉ DE CERGY Année 2012-2013 U.F.R. Économie & Gestion Licence d Économie et Mathématiques MATH104 : Mathématiques

UNIVERSITÉ DE CERGY Année 2012-2013 U.F.R. Économie & Gestion Licence d Économie et Mathématiques MATH104 : Mathématiques 1 UNIVERSITÉ DE CERGY Année 2012-201 U.F.R. Économie & Gestion Licence d Économie et Mathématiques MATH104 : Mathématiques Chapitre III : Polynômes 1 Fonctions polynômes & polynômes Définition 1. Soit

Plus en détail

22 Cours - Espaces vectoriels.nb 1/8. Espaces vectoriels. I) Généralités II) Applications linéaires III) Sous espaces vectoriels IV) Générateurs

22 Cours - Espaces vectoriels.nb 1/8. Espaces vectoriels. I) Généralités II) Applications linéaires III) Sous espaces vectoriels IV) Générateurs 22 Cours - Espaces vectoriels.nb /8 Espaces vectoriels K -espace vectoriel, loi de composition interne (commutative, associative), élément neutre, symétrique, loi externe, vecteur nul, E, sous espace vectoriel,

Plus en détail

Electrocinétique et magnétostatique

Electrocinétique et magnétostatique Chapitre 3 Electrocinétique et magnétostatique 3.1 Electrocinétique - Vecteur densité de courant Un courant électrique correspond à des charges électriques mobiles. On appelle vecteur densité de courant

Plus en détail

Eléments de correction du Bac Blanc n 2 de Mathématiquesdu Lundi 8 Avril2013. Calculatrice autorisée - Aucun document n'est autorisé.

Eléments de correction du Bac Blanc n 2 de Mathématiquesdu Lundi 8 Avril2013. Calculatrice autorisée - Aucun document n'est autorisé. TES Spé Maths Eléments de correction du Bac Blanc n 2 de Mathématiquesdu Lundi 8 Avril2013 Calculatrice autorisée - Aucun document n'est autorisé. Vous apporterez un grand soin à la présentation et à la

Plus en détail

CHAPITRE 3 LA SYNTHESE DES PROTEINES

CHAPITRE 3 LA SYNTHESE DES PROTEINES CHAITRE 3 LA SYNTHESE DES ROTEINES On sait qu un gène détient dans sa séquence nucléotidique, l information permettant la synthèse d un polypeptide. Ce dernier caractérisé par sa séquence d acides aminés

Plus en détail

Chimie des solutions Chimie organique PCSI Diagrammes binaires

Chimie des solutions Chimie organique PCSI Diagrammes binaires PC Marcelin Berthelot Devoir surveillé 2 12 octobre 2013 : Chimie des solutions Chimie organique PCSI Diagrammes binaires Devoirs 1. Diagramme binaire solide-liquide or-argent (CCP 2013) Le diagramme binaire

Plus en détail

B = (R 2 + (x x c ) 2 )

B = (R 2 + (x x c ) 2 ) PHYSQ 126: Champ magnétique induit 1 CHAMP MAGNÉTIQUE INDUIT 1 But Cette expérience 1 a pour but d étudier le champ magnétique créé par un courant électrique, tel que décrit par la loi de Biot-Savart 2.

Plus en détail

EXERCICE 2 : SUIVI CINETIQUE D UNE TRANSFORMATION PAR SPECTROPHOTOMETRIE (6 points)

EXERCICE 2 : SUIVI CINETIQUE D UNE TRANSFORMATION PAR SPECTROPHOTOMETRIE (6 points) BAC S 2011 LIBAN http://labolycee.org EXERCICE 2 : SUIVI CINETIQUE D UNE TRANSFORMATION PAR SPECTROPHOTOMETRIE (6 points) Les parties A et B sont indépendantes. A : Étude du fonctionnement d un spectrophotomètre

Plus en détail

TP Sage. Yannick Renard.

TP Sage. Yannick Renard. TP Sage. Yannick Renard. 1. Introduction. Le logiciel Software for Algebra and Geometry Experimentation (Sage) est un logiciel de mathématiques qui rassemble de nombreux programmes et bibliothèques libres

Plus en détail

BACCALAURÉAT GÉNÉRAL

BACCALAURÉAT GÉNÉRAL BACCALAURÉAT GÉNÉRAL Session 2012 PHYSIQUE-CHIMIE Série S Enseignement de Spécialité Durée de l épreuve : 3 heures 30 Coefficient : 8 L usage des calculatrices est autorisé. Ce sujet ne nécessite pas de

Plus en détail

UNIVERSITÉ DE POITIERS

UNIVERSITÉ DE POITIERS UNIVERSITÉ DE POITIERS Faculté des Sciences Fondamentales et Appliquées Mathématiques PREMIÈRE ANNEE DE LA LICENCE DE SCIENCES ET TECHNOLOGIES UE L «algèbre linéaire» Plan du cours Exercices Enoncés des

Plus en détail

Rappels d Algèbre Linéaire de P.C.S.I

Rappels d Algèbre Linéaire de P.C.S.I Rappels d Algèbre Linéaire de PCSI Table des matières 1 Structure d espace vectoriel sur IK 3 11 Définition et règles de calcul 3 12 Exemples de référence 3 13 Espace vectoriel produit 4 14 Sous-espaces

Plus en détail

DYNAMIQUE DE FORMATION DES ÉTOILES

DYNAMIQUE DE FORMATION DES ÉTOILES A 99 PHYS. II ÉCOLE NATIONALE DES PONTS ET CHAUSSÉES, ÉCOLES NATIONALES SUPÉRIEURES DE L'AÉRONAUTIQUE ET DE L'ESPACE, DE TECHNIQUES AVANCÉES, DES TÉLÉCOMMUNICATIONS, DES MINES DE PARIS, DES MINES DE SAINT-ÉTIENNE,

Plus en détail

TD de thermodynamique n o 3 Le premier principe de la thermodynamique Bilans d énergie

TD de thermodynamique n o 3 Le premier principe de la thermodynamique Bilans d énergie Lycée François Arago Perpignan M.P.S.I. 2012-2013 TD de thermodynamique n o 3 Le premier principe de la thermodynamique Bilans d énergie Exercice 1 - Influence du chemin de transformation. Une mole de

Plus en détail

La fonction exponentielle

La fonction exponentielle DERNIÈRE IMPRESSION LE 2 novembre 204 à :07 La fonction exponentielle Table des matières La fonction exponentielle 2. Définition et théorèmes.......................... 2.2 Approche graphique de la fonction

Plus en détail

Partie Observer : Ondes et matière CHAP 04-ACT/DOC Analyse spectrale : Spectroscopies IR et RMN

Partie Observer : Ondes et matière CHAP 04-ACT/DOC Analyse spectrale : Spectroscopies IR et RMN Partie Observer : Ondes et matière CHAP 04-ACT/DOC Analyse spectrale : Spectroscopies IR et RMN Objectifs : Exploiter un spectre infrarouge pour déterminer des groupes caractéristiques Relier un spectre

Plus en détail

NOTATIONS PRÉLIMINAIRES

NOTATIONS PRÉLIMINAIRES Pour le Jeudi 14 Octobre 2010 NOTATIONS Soit V un espace vectoriel réel ; l'espace vectoriel des endomorphismes de l'espace vectoriel V est désigné par L(V ). Soit f un endomorphisme de l'espace vectoriel

Plus en détail

Calculs approchés d un point fixe

Calculs approchés d un point fixe M11 ÉPREUVE COMMUNE DE TIPE 2013 - Partie D TITRE : Calculs approchés d un point fixe Temps de préparation :.. 2 h 15 minutes Temps de présentation devant les examinateurs :.10 minutes Dialogue avec les

Plus en détail

Perrothon Sandrine UV Visible. Spectrophotométrie d'absorption moléculaire Étude et dosage de la vitamine B 6

Perrothon Sandrine UV Visible. Spectrophotométrie d'absorption moléculaire Étude et dosage de la vitamine B 6 Spectrophotométrie d'absorption moléculaire Étude et dosage de la vitamine B 6 1 1.But et théorie: Le but de cette expérience est de comprendre l'intérêt de la spectrophotométrie d'absorption moléculaire

Plus en détail

prérequis 1. ÉLÉMENTS USUELS DE LA CHIMIE ORGANIQUE

prérequis 1. ÉLÉMENTS USUELS DE LA CHIMIE ORGANIQUE chapitre i prérequis 1. ÉLÉMENTS USUELS DE LA CHIMIE ORGANIQUE La chimie organique a pour objet l'étude des composés du carbone. Restreinte à l'origine aux composés du carbone que l'on pouvait extraire

Plus en détail

A chaque couleur dans l'air correspond une longueur d'onde.

A chaque couleur dans l'air correspond une longueur d'onde. CC4 LA SPECTROPHOTOMÉTRIE I) POURQUOI UNE SUBSTANCE EST -ELLE COLORÉE? 1 ) La lumière blanche 2 ) Solutions colorées II)LE SPECTROPHOTOMÈTRE 1 ) Le spectrophotomètre 2 ) Facteurs dont dépend l'absorbance

Plus en détail

Le théorème du point xe. Applications

Le théorème du point xe. Applications 49 Le théorème du point xe. Applications 1 Comme dans le titre de cette leçon, le mot théorème est au singulier, on va s'occuper du théorème du point xe de Picard qui a de nombreuses applications. Le cas

Plus en détail

G.P. DNS05 Octobre 2012

G.P. DNS05 Octobre 2012 DNS Sujet Impédance d'une ligne électrique...1 I.Préliminaires...1 II.Champ électromagnétique dans une ligne électrique à rubans...2 III.Modélisation par une ligne à constantes réparties...3 IV.Réalisation

Plus en détail

sept.2003 I. Le problème traité, Mise en équation Le problème traité, Mise en équation 1. Généralités, hypothèses et notations

sept.2003 I. Le problème traité, Mise en équation Le problème traité, Mise en équation 1. Généralités, hypothèses et notations Modélisation et simulation de la déformation d'une pièce de tissu soumise à un champ de forces sept.23 I. Le problème traité, Mise en équation Le problème traité, Mise en équation 1. Généralités, hypothèses

Plus en détail

Espaces vectoriels et applications linéaires

Espaces vectoriels et applications linéaires Espaces vectoriels et applications linéaires Exercice 1 On considère l'ensemble E des matrices carrées d'ordre 3 défini par,,, 1) Montrer que est un sous-espace vectoriel de l'espace vectoriel des matrices

Plus en détail

DÉRIVÉES. I Nombre dérivé - Tangente. Exercice 01 (voir réponses et correction) ( voir animation )

DÉRIVÉES. I Nombre dérivé - Tangente. Exercice 01 (voir réponses et correction) ( voir animation ) DÉRIVÉES I Nombre dérivé - Tangente Eercice 0 ( voir animation ) On considère la fonction f définie par f() = - 2 + 6 pour [-4 ; 4]. ) Tracer la représentation graphique (C) de f dans un repère d'unité

Plus en détail

DST de sciences physiques

DST de sciences physiques Terminales S DST de sciences physiques (5 pages) Exercice n 1 (7 points) Acide et base faible Toutes les solutions aqueuses sont à 25 C. 1. On dispose d'une solution S a d'acide éthanoïque CH 3 COOH de

Plus en détail

EPREUVE SPECIFIQUE FILIERE MP CHIMIE. Durée : 2 heures. Les calculatrices sont autorisées * * *

EPREUVE SPECIFIQUE FILIERE MP CHIMIE. Durée : 2 heures. Les calculatrices sont autorisées * * * SESSION 2006 EPREUVE SPECIFIQUE FILIERE MP CHIMIE Durée : 2 heures Les calculatrices sont autorisées * * * NB : Le candidat attachera la plus grande importance à la clarté, à la précision et à la concision

Plus en détail

9. Équations différentielles

9. Équations différentielles 63 9. Équations différentielles 9.1. Introduction Une équation différentielle est une relation entre une ou plusieurs fonctions inconnues et leurs dérivées. L'ordre d'une équation différentielle correspond

Plus en détail

Administration unique par voie IV et sous la forme d'un bolus du principe actif. Analyse des données urinaires du principe actif

Administration unique par voie IV et sous la forme d'un bolus du principe actif. Analyse des données urinaires du principe actif Diplôme Universitaire de Pharmacocinétique de Toulouse *** Année 2007 *** Le modèle monocompartimental : Administration unique par voie IV et sous la forme d'un bolus du principe actif Analyse des données

Plus en détail

Sortie : OUI si n est premier, NON sinon. On peut voir Premier aussi comme une fonction, en remplaçant OUI par 1 et NON par 0.

Sortie : OUI si n est premier, NON sinon. On peut voir Premier aussi comme une fonction, en remplaçant OUI par 1 et NON par 0. Université Bordeaux 1. Master Sciences & Technologies, Informatique. Examen UE IN7W11, Modèles de calcul. Responsable A. Muscholl Session 1, 2011 2012. 12 décembre 2011, 14h-17h. Documents autorisés :

Plus en détail

est diagonale si tous ses coefficients en dehors de la diagonale sont nuls.

est diagonale si tous ses coefficients en dehors de la diagonale sont nuls. Diagonalisation des matrices http://www.math-info.univ-paris5.fr/~ycart/mc2/node2.html Sous-sections Matrices diagonales Valeurs propres et vecteurs propres Polynôme caractéristique Exemples Illustration

Plus en détail

Pour stocker davantage d'informations sur un disque, les scientifiques travaillent sur la mise au point d'un laser ultra violet.

Pour stocker davantage d'informations sur un disque, les scientifiques travaillent sur la mise au point d'un laser ultra violet. nom : TS 6 CONTRÔLE DE SCIENCES PHYSIQUES 14/11/11 Lors de la correction il sera tenu compte de la présentation et de la rédaction de la copie Les réponses seront justifiées et données sous forme littérale

Plus en détail

...# N # 2 # 1 # N M $ # p p. = C pi

...# N # 2 # 1 # N M $ # p p. = C pi Chapitre X Une application qualitative de la théorie orbitalaire La méthode de Hückel En 1933, Hückel propose une méthode quantique de description de la partie π du nuage électronique des molécules planes

Plus en détail

TP Méthodes Numériques

TP Méthodes Numériques ENSIMAG 1ère année, 2007-2008 TP Méthodes Numériques Objectifs Les objectifs de ce TP sont : de revenir sur les méthodes de résolution des équations différentielles vues en cours de MN ; d utiliser un

Plus en détail

Baccalauréat Série S Métropole, juin 2014

Baccalauréat Série S Métropole, juin 2014 Baccalauréat Série S Métropole, juin 4 Sujet et Corrigé Stéphane PASQUET Disponible sur http://www.mathweb.fr juin 4 Exercice (5 points) - Commun à tous les candidats Partie A Dans le plan muni d un repère

Plus en détail

C H A P I T R E 2 C A L C U L S A L G E B R I Q U E S

C H A P I T R E 2 C A L C U L S A L G E B R I Q U E S Classe de Troisième C H A P I T R E C A L C U L S A L G E B R I Q U E S UTILISER DES LETTRES...4 EXPRESSIONS ÉQUIVALENTES...6 VOCABULAIRE DU CALCUL LITTÉRAL...7 RÉDUCTIONS D'ÉCRITURES...9 DÉVELOPPER UN

Plus en détail

Concours 2015 Épreuve d Informatique Filière : MP Durée de l épreuve : 3 heures. L utilisation d une calculatrice est autorisée.

Concours 2015 Épreuve d Informatique Filière : MP Durée de l épreuve : 3 heures. L utilisation d une calculatrice est autorisée. A 2015 INFO. MP École des Ponts ParisTech, SUPAERO (ISAE), ENSTA ParisTech, Télécom ParisTech, Mines ParisTech, Mines de Saint-étienne, Mines Nancy, Télécom Bretagne, ENSAE ParisTech (filière MP), École

Plus en détail

Mesure de la conductivité des eaux

Mesure de la conductivité des eaux Mesure de la conductivité des eaux La conductivité est utilisée pour la détermination de quantité de matière dans une solution (nombre de moles dissoutes par litre). Les applications industrielles de mesure

Plus en détail

Partie Comprendre : Lois et modèles CHAP 13-ACT EXP Effets thermiques des réactions acido-basique - solution tampon et ph des milieux biologiques

Partie Comprendre : Lois et modèles CHAP 13-ACT EXP Effets thermiques des réactions acido-basique - solution tampon et ph des milieux biologiques Partie Comprendre : Lois et modèles CHAP 13-ACT EXP Effets thermiques des réactions acido-basique - solution tampon et ph des milieux biologiques CORRIGE Objectifs : Mettre en évidence l'influence des

Plus en détail

K W = [H 3 O + ] [OH - ] = 10-14 = K a K b à 25 C. [H 3 O + ] = [OH - ] = 10-7 M Solution neutre. [H 3 O + ] > [OH - ] Solution acide

K W = [H 3 O + ] [OH - ] = 10-14 = K a K b à 25 C. [H 3 O + ] = [OH - ] = 10-7 M Solution neutre. [H 3 O + ] > [OH - ] Solution acide La constante d autoprotolyse de l eau, K W, est égale au produit de K a par K b pour un couple acide/base donné : En passant en échelle logarithmique, on voit donc que la somme du pk a et du pk b d un

Plus en détail

PROBLÈME 1 : Étude de l'eau en physique

PROBLÈME 1 : Étude de l'eau en physique Banque «Agro» A - 0304 PHYSIQUE Durée : 3 h 30 L usage d une calculatrice est autorisé pour cette épreuve L usage d abaques et de tables est interdit pour cette épreuve Les trois problèmes sont indépendants

Plus en détail

SCIENCES PHYSIQUES. Les tables et calculatrices réglementaires sont autorisées.

SCIENCES PHYSIQUES. Les tables et calculatrices réglementaires sont autorisées. UNIVERSITÉ CHEIKH NT DIOP DE DKR /5 6 G 8 Durée : heures OFFICE DU BCCLURET Séries : S-S3 Coef. 8 Téléfax () 8 65 8 - Tél. : 8 95 9-8 65 8 Epreuve du er groupe SCIENCES PHYSIQUES Les tables et calculatrices

Plus en détail