Introduction à la Génomique. 1. Les outils de base. 1. Les outils de base 2. Les techniques d hybridation

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimension: px
Commencer à balayer dès la page:

Download "Introduction à la Génomique. 1. Les outils de base. 1. Les outils de base 2. Les techniques d hybridation"

Transcription

1 Introduction à la Génomique 1. Les outils de base 2. Les techniques d hybridation Southern blot et dérivés, micro arrays 3. La PCR 4. Les marqueurs polymorphes 5. Le clonage positionnel 1. Les outils de base Les enzymes Techniques de marquage Electrophorèse Enzymes de biologie moléculaire Enzymes de restriction = endonucléases Ligase Phosphatase Kinase ADN pol fragment de klenow (activité exonucléase) T4 DNA pol Digestion par enzymes de restriction extrémités cohésives EcoRI GAATTC G AATTC CTTAAG CTTAA G PstI CTGCAG CTGCA G GACGTC G ACGTC extrémités franches HaeIII GGCC GG CC CCGG CC GG 1

2 Formation de molécules d ADN recombinant AmpR digestion Les enzymes de restriction permettent de couper l ADN en des endroits précis (reconnaissance de séquences le plus souvent palindromiques) La ligase permet de «coller» deux fragments d ADN avec des extrémités compatibles insert L animation suivante (DNA restriction) peut être visualisée ou téléchargée ici : restriction (Ampicilline) Techniques de Marquage Différentes types de marquage Radioactif 32 P : exposition courte (24h, très sensible), 1/2 vie = 15 jours, rayonnement ß- important (taches diffuses) 35 S : exposition 1 semaine, 1/2 vie = 3 mois, moins de rayonnement ß- important (taches plus nettes) 3 H : rayonnement ß- très faible (taches très nettes), exposition plusieurs semaines (utilisé pour hybridation in situ) Froid Biotine - streptavidine + anticorps Nucléotides couplés à des fluorochromes Stratégies de Marquage Random Priming (amorçage au hasard) 3 3 Penser à dénaturer la sonde (100 C) avant utilisation C dctp* datp dttp dgtp 25 C, hybridation Toutes les séquences Avec les amorces De 6 bases possibles (hexamères aléatoires) ADN polymérase I, Fragment de Klenow (pas d activité exonucléase) 3 3 2

3 Stratégies de Marquage Nick Translation (déplacement de coupure) Stratégies de Marquage Marquage d oligonucléotide synthétique Dnase I (création de cassures simple brin) ADN polymérase I (action - exonucléase) P OH OU OH OH T4 polynucléotide kinase P P P -Ribose γ β α -Adénine (γ32 P ATP) Penser à dénaturer la sonde (100 C) avant utilisation.. dctp* datp dttp dgtp ADN polymérase I, (activité polymérasique) P OH Electrophorèse en gel d agarose Coulage du gel Electrophorèse en gel d agarose Chargement du gel 3

4 Electrophorèse en gel d agarose Electrophorèse en gel d agarose cette animation (gel electrophoresis) peut être visualisée ici : cathode anode Gel Photo (top view) Interaction ADN + molécule intercalante fluorescente (Bromure d éthidium (BET) ou mégafluor) L ADN devient «visible» sous les UV Electrophorèse (gel d agarose) Introduction à la Génomique Cathode Paires de bases Anode 1 2 Poids moléculaire (échelle logarithmique) Migration en mm (par rapport au puits) 1. Les outils de base 2. Les techniques d hybridation Southern blot et dérivés, micro arrays 3. La PCR 4. Les marqueurs polymorphes 5. Le clonage positionnel 4

5 2. Hybridation moléculaire : Principe 2. Hybridation moléculaire : Principe % simple brin 100% 50% Dénaturation : Chauffer à une température > Tm (faire bouillir ) Hybridation : Température < Tm (refroidissement lent ) Refroidissement rapide : les molécules restent sous forme simple brin (ex : SSCP) Tm température Tm : température de fusion (melting) Facteurs influençant Composition en bases (% GC) ADN < 30bases : Tm = 2(A+T) + 4(G+C) Tm = 69,3 + 0,41 (% G+C) - (650/ longueur) Ex : oligonucléotide 20 bases (10 AT, 10 GC) Tm1 = 2(10) + 4(20) = 60 C Tm2 = 69,3 + 0,41*50 - (650/20) = 57,3 C Facteurs influençant Longueur des Fragments Présence de mésappariements Tm : - 1 C par % de mésappariement Influence du milieu Concentration en sels (cations) Plus la concentration en cation est basse, plus la double hélice est instable, plus l hybridation demandera de spécificité : hybridation «stringente» (à 0,2M en ion Na+) 5

6 Applications : Southern Blot 1. Les échantillons d ADN digérés par enzyme de restriction sont chargés sur un gel d électrophorèse Applications : Southern Blot Puits 1 : Marqueurs de taille radioactifs Puits 2 : ADN digéré par l enzyme A Puits 3 : ADN digéré par l enzyme B Gel d électrophorèse 4. Après incubation dans une solution de blocage, la membrane est placée dans un sac plastique scellé avec une solution contenant la sonde marquée Sonde radioactive L ADN est dénaturé Le gel est placé sur une éponge 2. Les différents fragment d ADN sont séparés par électrophorèse mais invisibles Poids Papier absorbant Membrane Gel Eponge Tampon 3. Membrane, papier absorbant et poids sont placés sur le gel. Le tampon remonte par capillarité et transfère les fragments d ADN du gel vers la membrane 5. La membrane est lavée pour enlever la sonde non hybridée, séchée, puis mise en contact avec un film d autoradiographie Autoradiogramme : Autoradiographie Les marqueurs sont révélés car radioactifs Puits 2 et 3 : seules les bandes hybridées avec la sonde sont révélées. Applications : Dot blot Dépôts des ADN directement sur membrane Pas d information sur la taille des fragments Sondes = oligonucléotides marqués Applications : Dot blot Dot blot : hybridation différentielle avec les oligosondes spécifiques de l allèle normal (a) et de l allèle muté (b, mutation F508) du gène CF responsable de la mucoviscidose (ASO : Allele-specific oligo) Ex: mucoviscidose. Mutation la plus fréquente: GAA AAT ATC ATC TTT GGT GTT glu asn ile ile phe gly val a b F508 GAA AAT ATC ATT GGT GTT glu asn ile ile gly val Deux oligonucléotides : - séquence normale - séquence mutée m+ : ADN témoin non muté m- : ADN témoin F508 homozygote 6

7 Applications : northern blot Principe identique au Southern blot Mais : ARN, petite taille, pas de digestion Sonde utilisée, ARN ou ADN Applications : étude de l expression des gènes en fonction des tissus Applications : Les puces à ADN (DNA microarrays, DNA chips) Immobilisation des séquences connues (sondes) sur un support Ajout d un mélange de séquences inconnues (cible) marquées Détection de l hybridation par la présence de marquage fixée sur la puce Les étapes d une expérience Choix de la sonde (oligos, ADNc, chromosome,...génome entier ) Fabrication de la puce (fixation de la sonde) Fabrication de la cible (ARNm --> ADNc fluorescent) Hybridation Lecture et analyse informatique Micro Arrays, un exemple : Quels gènes de levure sont exprimés en aérobie et/ou en anaérobie Saccharomyces cerevisiae, génome entièrement séquencé, ~ 6000 gènes 7

8 Préparation des ARNm Synthèse des ADNc amorce = poly dt, transcriptase inverse Culture des cellules (conditions différentes) +O 2 + RNase -O 2 Extraction des ARNm +O 2 -O 2 +O 2 -O 2 Mélange des ADNc Ajout des ADNc sur la puce-1 +O 2 Puce à ADN (un point = une séquence codante. Levure, 6000 gènes, donc 6000 points) -O 2 -O 2 +O 2 8

9 Ajout des ADNc sur la puce-2 Hybridation Lavage Lecture de la puce Insertion de la puce dans le système de lecture (laser) Analyse de la fluorescence +O 2 -O 2 aérobique Exprimé ± O 2 anaérobique +O 2 -O 2 Image superposée (merged) résultat Applications : Hybridation in situ Puce contenant tous les gènes de levure (S. cerevisiæ) Coupes de tissus, embryons de drosophile, chromosomes Sondes radioactives ou fluorescentes L utilisation des fluorochromes permet de combiner plusieurs sondes + ADNc ±O 2 9

10 Applications : Hybridation in situ Exemple : embryon de drosophile, 2 sondes s hybridant aux ARNs de 2 gènes de développement (ftz et wg) Translocation entre chromosomes 1 et 6 chez le porc mise en évidence par FISH Introduction à la Génomique 1. Les outils de base 2. Les techniques d hybridation Southern blot et dérivés, micro arrays 3. La PCR 4. Les marqueurs polymorphes 5. Le clonage positionnel 3. Polymerase chain reaction Principe Matériel et méthodes Limites et précautions Applications Conclusion 10

11 Principe PCR = Amplification spécifique in vitro d un segment particulier d ADN à partir d un mélange de séquences PCR 1 génome 1 génome + 2 n copie de la séquence recherchée PCR : Matériel ADN matrice ADN polymérase datp, dgtp, dttp et dctp (dntp) 2 Amorces Tampon (MgCl 2 ) PCR : Principe PCR : Méthodes Voir Animations Température d hybridation : Inférieure de ~5 C au Tm des amorces ADN polymérase thermorésistante (par ex : Taq polymérase (extraite de Thermus aquaticus) pour résister aux passages successifs à 94 C) 11

12 PCR : résultat Choix des amorces : Séquence d une partie du gène mitochondrial «cytb» du lynx (Lynx lynx) -taaacttatttacccccttcatattaaccgcaatgtttatcctactt -atttgaataaatgggggaagtataattggcgttacaaataggatgaa ttacctatcattatatctaacacccaactatataaaaatagcctatatcc aatggatagtaatatagattgtgggttgatatatttttatcggatatagg tcattacgtaaaaaccacaatctcctatgcctttactatcagcatgatcc agtaatgcatttttggtgttagaggatacggaaatgatagtcgtactagg cgactataatattcatctcttcagggcaggaaacagttatctcaaactga gctgatattataagtagagaagtcccgtcctttgtcaatagagtttgact Gel à 3% d agarose coloré au Bromure d Ethidium contenant l ADN de Bordetella pertussis amplifié avec les amorces QH8F et QH2R. Puits: 1, contrôle négatif (tous les réactifs sauf l ADN matrice); 2, échelle de 100-bp; 3, souche B. pertussis 1772 de type prn1 (260 bp); 4, isolat Bordetella pertussis de type prn2 (275 bp); 5, isolat B. pertussis de type prn3 (260 bp); 6, isolat B. pertussis de of type prn4 (245 bp); et 7, B. pertussis de type prn5 (245 bp). Mäkinen et al., emmerging infectious diseases, Vol. 7, 2001 cactgattatcaatccaaacccttaagctatcactgagctttaaaataga gtgactaatagttaggtttgggaattcgatagtgactcgaaattttatct ctacttctcaatcatcttcatccccgtagcacttttcgtcacatgat- gatgaagagttagtagaagtaggggcatcgtgaaaagcagtgtacta- PCR : limites et précautions Taille du fragment à amplifier Nombre de copies de matrice Inhibiteurs Choix des amorces Choix de la polymérase Contaminations PCR : limites et précautions Taille du fragment à amplifier Sans difficultés jusqu à 2-3 kb Possible jusqu à 20 kb en conditions optimisées (enzyme très fidèle, temps d élongation) 12

13 PCR : limites et précautions Taille du fragment à amplifier Nombre de copies de matrice Inhibiteurs Choix des amorces Choix de la polymérase Contaminations PCR : limites et précautions Taille du fragment à amplifier Nombre de copies de matrice En théorie, une copie est suffisante (mais peu de produit à la fin). Pour augmenter la sensibilité : PCR nichée (meilleure spécificité aussi PCR1 PCR2 PCR : limites et précautions Taille du fragment à amplifier Nombre de copies de matrice Inhibiteurs Choix des amorces Choix de la polymérase Contaminations PCR : limites et précautions Taille du fragment à amplifier Nombre de copies de matrice Inhibiteurs 13

14 PCR : limites et précautions Taille du fragment à amplifier Nombre de copies de matrice Inhibiteurs Choix des amorces Choix de la polymérase Contaminations PCR : limites et précautions Taille du fragment à amplifier Nombre de copies de matrice Inhibiteurs Choix des amorces Hybridation spécifique Distance entre les amorces Pas d hybridation sur elles-mêmes ni l une avec l autre PCR : limites et précautions Taille du fragment à amplifier Nombre de copies de matrice Inhibiteurs Choix des amorces Choix de la polymérase Contaminations PCR : limites et précautions Taille du fragment à amplifier Nombre de copies de matrice Inhibiteurs Choix des amorces Choix de la polymérase Il existe des polymérases plus ou moins fidèles. Adapter en fonction de ce que l on veut faire (coût différent) 14

15 PCR : limites et précautions PCR : limites et précautions Taille du fragment à amplifier Nombre de copies de matrice Inhibiteurs Choix des amorces Choix de la polymérase Contaminations Liées à la sensibilité de la technique Précautions : séparer les opérations, contrôles positif et négatif Plateau variable (perte d efficacité de la Taq, réactifs devenant limitants, dénaturation moins efficace, ) 96 amplifications d une même échantillon phase plateau variable Besoin de quantification : PCR quantitative ou PCR en temps réél La fluorescence émise, fonction du nombre d amplicons, est mesurée à chaque cycle PRCq : principe Les 3 méthodes de détection principales: a. Molécules se fixant à l ADN db (SYBR Green) b. Sondes d hydrolyse (TaqMan, Beacons, Scorpions) c. Sondes d hybridation (Light Cycler) 15

16 PCR en temps réel : méthode TaqMan 1 2 Comme PCR classique : ADN matrice, amorces, dntps, polymerase En plus : sonde qui s hybride sur la matrice entre les amorces La sonde porte un fluorochrome et un extincteur (quencher) Animation : 3 PCR en temps réel : principe de la technique TaqMan 4 Rn vs Cycle, échelle linéaire Rn vs Cycle, échelle logarithmique Linéaire ~20 to ~

17 Linéaire ~20 to ~1500 seuil = 300 échantillon +R n seuil ΔR n R n Contrôle négatif R n C T cycles Dilutions de 10 en 10 17

18 Seuil (threshold) Quantification Quantification absolue (résultat en nombre de copies): nombre de génomes viraux, Calcul avec courbe étalon Ct Quantification relative (resultat par rapport à un échantillon référence): expression d un gène, Comparaison des Ct ( Ct) Dilutions de 10 en 10 Quantification absolue Quantification absolue Ct Ct= 29.7 Log Qté = 3.28 soit Qté = 1, Log Qté 18

19 Quantification relative : Ct principe: les échantillons dont la concentration de départ diffère d un facteur 2 auront une différence de Ct de 1 Quantification relative : Ct Mais on va normaliser par rapport à un gène de référence! = actin, GAPDH, 18S ΔCT = CT (cible( cible) ) - CT (référence( référence) Les échantillons qui diffèrent d un facteur 10 auront un écart de Ct de 3,33 Δ Δ CT = Δ CT (traité( traité) ) - Δ CT (non traité) Example 1: Ct(A)= 30 Ct(B)= 31 RQ = 2 1 = 2 Example 2: Ct(A)= 30 Ct(B)= 33,3 RQ = = 10 Relative Quantity = 2 Ct Quantité relative = 2 CT (échantillon) - CT (basal) Ct method: Exemple Ct method: Exemple Exemple 1: Exemple 2: ΔCT = CT (cible) - CT (Reference) ΔCt(ctrl SOCS3)= = 7 ΔΔ CT = Δ CT (traité) - Δ CT (contrôle) ΔCt(traité traité SOCS3)= = 4 ΔΔCt = 4 7 = -3 RQ = 2 3 = 8 l expression desocs3 dans l échantillon traité est 8 fois supérieure à celle de l échantillon non traité ΔCT = CT (cible) - CT (Reference) ΔCt(ctrl SOCS3)= 28-16= 12 ΔΔ CT = Δ CT (traité) - Δ CT (contrôle) ΔCt(traité traité SOCS3)= 25-13=12 ΔΔCt =12-12=0 RQ = 2 0 = 1 l expression desocs3 dans l échantillon traité est identique à celle de l échantillon non traité ctrl 18S tr 18S tr SOCS3 ctrl SOCS3 tr 18S ctrl 18S tr SOCS3 ctrl SOCS3 19

20 méthode Ct Pas besoin de dilutions en série gain de temps, de matériel MAIS: l efficacité d amplification de la cible et du contrôle doivent être comparables CYCLE AMOUNT OF DNA AMOUNT OF DNA AMOUNT OF DNA AMOUNT OF DNA 100% EFFICIENCY 90% EFFICIENCY 80% EFFICIENCY 70% EFFICIENCY , ,048 1, ,096 2,213 1, ,192 4,205 2, ,384 7,990 3,748 1, ,768 15,181 6,747 2, ,536 28,844 12,144 4, ,072 54,804 21,859 8, , ,127 39,346 14, , ,842 70,824 23, ,048, , ,482 40, ,097, , ,468 69, ,194,304 1,356, , , ,388,608 2,578, , , ,777,216 4,898,763 1,338, , ,554,432 9,307,650 2,408, , ,108,864 17,684,534 4,335, , ,217,728 33,600,615 7,804,726 1,667, ,435,456 63,841,168 14,048,506 2,835, ,870, ,298,220 25,287,311 4,819, ,073,741, ,466,618 45,517,160 8,193,466 Efficacité de l amplification AMOUNT OF DNA AMOUNT OF DNA AMOUNT OF DNA 1,200,000, % 100% EFF EFF 1,000,000,000 90% EFF 1,000,000,000 90% EFF 80% EFF 800,000,000 70% EFF 80% EFF 800,000,000 70% EFF 600,000, ,000, ,000, ,000, ,000, ,000, PCR CYCLE NUMBER PCR CYCLE NUMBER 10,000,000,000 1,000,000, % EFF 100,000,000 90% EFF 80% EFF 10,000,000 70% EFF 1,000, ,000 10,000 1, PCR CYCLE NUMBER Efficacité La pente de la partie linéaire de la représentation logarithmique est le reflet de l efficacité méthode ΔCt La cible a-t-elle la même efficacité d amplificationd que le contrôle endogène? L efficacité de la réaction peut-être calculée par l équation : Eff=10 (pente) 1. L efficacité de la PCR doit être % (pente idéale = -3.3) Plusieurs variables peuvent affecter l efficacité de la PCR. Longueur de l amplicon, structure secondaire, dessin des amorces Courbes étalon NON OUI méthode ΔΔCt 20

21 PCR : Applications Clonage Etude de l expression des gènes : RT-PCR Analyse qualitative de la structure des génomes PCR multiplexe Amplification spécifique d allèle PCR-SSCP PCR : Applications Clonage Dès qu on en connaît la séquence, on peut amplifier n importe quel fragment d ADN (pour le cloner, l étudier, le muter La PCR a énormément simplifié la manipulation des gènes PCR : Applications Etude de l expression des gènes : RT-PCR Un gène donné est-il exprimé dans tel ou tel tissu?? RT-PCR = PCR précédé d une étape de transcription inverse (ARNÞ ADNc). Meilleure sensibilité que le northern blot. AAAAA- AAAAA- AAAAA- TTTTT- 1er cycle de PCR TTTTT- Autres cycles de PCR + transcriptase inverse + amorce PCR : Applications Analyse qualitative de la structure des génomes Détection de la présence d un pathogène par la mise en évidence de son génome (ADN ou ARN) PCR multiplexe : plusieurs couples d amorces dans le même tube Diagnostic pour plusieurs pathogènes en une seule réaction (FIV-FeLV) Diagnostic de maladies génétiques, ex : Myopathie de Duchenne, due à délétion importante du gène DMD : quels sont les exons qui sont touchés? 21

22 exon1 exon2 exon15 exon16 exon28 exon pb 200 pb pb -380pb -250pb -200pb -140pb 380 pb PCR : Applications Analyse qualitative de la structure des génomes Amplification spécifique d allèle (ASA) T A Séquence non mutée G C Séquence mutée Amorce amont n 1 : le dernier nucléotide en correspond à la séquence non mutée T T A Amorce amont n 2 : le dernier nucléotide en correspond à la séquence mutée G T C Diagnostic de Myopathie de Duchenne par PCR multiplexe : Les amorces sont choisies de façon à amplifier des segments de tailles différentes à partir de différents exons. Puits 2 : ADN normal Puits 3 à 5 : ADN de personnes atteintes. Les bandes manquantes permettent d estimer l ampleur de la délétion T G A G G C PCR : Applications Analyse qualitative de la structure des génomes PCR-SSCP (single strand conformation polymorphism) : Un ADN dénaturé et refroidi brusquement reste simple brin avec une conformation dépendante de sa séquence PCR : Applications Analyse qualitative de la structure des génomes PCR-SSCP (single strand conformation polymorphism) ADN non muté ADN muté homozygote ADN muté hétérozygote PCR-SSCP PCR-SSCP PCR-SSCP Gel non dénaturant 22

23 PCR : Applications Analyse qualitative de la structure des génomes PCR-SSCP (single strand conformation polymorphism) PCR : Applications Analyse qualitative de la structure des génomes Evolution, médecine légale : amplification d ADN à partir de prélèvements abîmés et de petite taille Lutte contre les fraudes Sexage Figure 1 : analyse du gène p53 par PCR-SSCP N : ADN normal; T, ADN de tumeur; (A), exon 7; (B), exon8. Les mutations sont indiquées par les flèches Figure 2 : Mutation du gène p53 identifiées par séquençage de l ADN des exons 7 et 8 amplifié en figure 1. (A), exon 7; (B), exon8. Les bases mutées sont indiquées par les flèches Pooart et al., Clinical Biochemistry, vol 3, 1999, Pages ELISA: détection des AC ELISA: détection des Ag - + Ag connu spécifique de l AC recherché Incubation du sérum à tester - + AC connu spécifique de Ag recherché Ag Incubation du liquide biologique à tester Lavage - + Ez Ajout des AC anti-fc marqué par une enzyme Ez Lavage - + Ajout des AC spécifiques de Ag couplés un fluorochrome Lavage Ez Ajout du substrat chromogène de Ez Lavage Pas de coloration Coloration Pas de coloration Coloration 23

24 Western blot Extrait protéique 100 C Sodium Dodécyl Sulfate (SDS, détergent ionique fort) --> protéines dénaturées et chargées négativement --> sur gel de polyacrylamide : séparation en fonction de la taille - Grands PM PCR en temps réel ex : Herpes virus félin --> transfert sur membrane (application d un champ électrique) --> Anticorps primaire + Petits PM Lavage et Anticorps secondaire

POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA

POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA Amplification spécifique Détection spécifique Clonage dans des vecteurs Amplification in vitro PCR Hybridation moléculaire - hôte cellulaire

Plus en détail

ED Biologie moléculaire. E. Turpin J. Lehmann-Che 5-6 novembre 2007

ED Biologie moléculaire. E. Turpin J. Lehmann-Che 5-6 novembre 2007 ED Biologie moléculaire E. Turpin J. Lehmann-Che 5-6 novembre 2007 PCR 1983: Kary Mullis Amplification in vitro par une méthode enzymatique d'un fragmentd'adn en présence de deux oligonucléotides spécifiques

Plus en détail

ATELIER EPIGENETIQUE

ATELIER EPIGENETIQUE Juin 2012 ATELIER EPIGENETIQUE Utilisation de la Q-PCR pour analyser des données de ChIP ou de MeDIP Emmanuèle Mouchel-Vielh I. La PCR quantitative: principe et généralités II. Interprétation des résultats

Plus en détail

Méthodes et techniques de la biologie du développement

Méthodes et techniques de la biologie du développement Méthodes et techniques de la biologie du développement 1. Etude de l expression des gènes : Détecter les transcrits et les protéines au cours de l ontogenèse l outil anticorps 1.1. La RT-PCR La réaction

Plus en détail

TD de Biochimie 4 : Coloration.

TD de Biochimie 4 : Coloration. TD de Biochimie 4 : Coloration. Synthèse de l expérience 2 Les questions posées durant l expérience 2 Exposé sur les méthodes de coloration des molécules : Générique Spécifique Autres Questions Pourquoi

Plus en détail

3. Biotechnologie de l ADN

3. Biotechnologie de l ADN 3. Biotechnologie de l ADN 3.1. Technologie de l ADN recombinant 3.1.1. Isolation d ADN et d ARN 3.1.2. Fragmentation de l ADN (les Endonucléases) 3.1.3. Analyse d ADN sur d agarose et d acrylamide 3.1.4.

Plus en détail

8.3.3 Réactifs. La polymérase catalyse la synthèse de brins complémentaires d ADN.

8.3.3 Réactifs. La polymérase catalyse la synthèse de brins complémentaires d ADN. 8.3.3 Réactifs 1. AD polymérase: La polymérase catalyse la synthèse de brins complémentaires d AD. Des polymérases qui sont résistantes à la chaleur sont utilisées, telles que la Taq polymérase (Thermus

Plus en détail

Pathologies et génétique moléculaire

Pathologies et génétique moléculaire Biochimie - Biologie moléculaire Pathologies et génétique moléculaire Julien Fauré Institut de Formation en Soins Infirmiers 1 ère Année Année universitaire 2014-2015 Plan Les outils de la génétique moléculaire

Plus en détail

Principales techniques utilisées en génie génétique Ces différentes techniques peuvent également se combiner entre elles. Séquençage de l ADN

Principales techniques utilisées en génie génétique Ces différentes techniques peuvent également se combiner entre elles. Séquençage de l ADN Principales techniques utilisées en génie génétique Ces différentes techniques peuvent également se combiner entre elles Séquençage de l ADN 1- Un brin complémentaire de l ADN à séquencer est fabriqué

Plus en détail

Lettres: A, T, G, C. Mots: à 3 lettres (codons) Phrase: gène (information pour synthétiser une protéine). Ponctuation

Lettres: A, T, G, C. Mots: à 3 lettres (codons) Phrase: gène (information pour synthétiser une protéine). Ponctuation 2- Les molécules d ADN constituent le génome 2-1 La séquence d ADN représente l information génétique Lettres: A, T, G, C Mots: à 3 lettres (codons) Phrase: gène (information pour synthétiser une protéine).

Plus en détail

La PCR en temps réel frederic.gevaudant@bordeaux.inra.fr

La PCR en temps réel frederic.gevaudant@bordeaux.inra.fr La PCR en temps réel frederic.gevaudant@bordeaux.inra.fr INRA Centre de recherche de Bordeaux UMR Biologie du Fruit et Pathologie Historique 1985 : Invention par Kary Mullis de la technique de (PCR). 1991

Plus en détail

LE GÉNIE GÉNÉTIQUE ET LA BIOLOGIE MOLÉCULAIRE

LE GÉNIE GÉNÉTIQUE ET LA BIOLOGIE MOLÉCULAIRE LE GÉNIE GÉNÉTIQUE ET LA BIOLOGIE MOLÉCULAIRE Plan Introduction I - Qu est ce Que le génie génétique? II - Quels sont les outils du génie génétique? II.1- Les Enzymes II.1.1- Enzymes de restriction II.1.2-

Plus en détail

Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013

Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013 Sélectionner les propositions exactes Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013 QCM 1 La plupart des techniques de biologie moléculaire repose sur le principe de complémentarité

Plus en détail

Méthodes d études. Chapitre 8 : Professeur Joël LUNARDI. UE1 : Biochimie Biologie moléculaire

Méthodes d études. Chapitre 8 : Professeur Joël LUNARDI. UE1 : Biochimie Biologie moléculaire Chapitre 8 : UE1 : Biochimie Biologie moléculaire Méthodes d études Professeur Joël LUNARDI Année universitaire 2010/2011 Université Joseph Fourier de Grenoble - Tous droits réservés. Chapitre 8. 8. Méthodes

Plus en détail

Les outils du génie génétique.

Les outils du génie génétique. Les outils du génie génétique. I\ Les enzymes. On va se servir des enzymes pour couper, coller et synthétiser des acides nucléiques. A\ Les polymérases. Toutes les polymérases agissent de 5 vers 3. En

Plus en détail

L AMPLIFICATION GÉNIQUE PAR PCR. (Polymérase Chain Reaction)

L AMPLIFICATION GÉNIQUE PAR PCR. (Polymérase Chain Reaction) L AMPLIFICATION GÉNIQUE PAR PCR (Polymérase Chain Reaction) ATELIER DE FORMATION SUR LE DIAGNOSTIC DE LA FIEVRE APHTEUSE 21 mai 2012 Corinne SAILLEAU Corinne.sailleau@anses.fr Agence Nationale de Sécurité

Plus en détail

Technologie de l ADN recombinant. Complément de cours sur: «Les Méthodes d Etude de la Cellule»

Technologie de l ADN recombinant. Complément de cours sur: «Les Méthodes d Etude de la Cellule» Technologie de l ADN recombinant Complément de cours sur: «Les Méthodes d Etude de la Cellule» 1 Les techniques de l ADN Recombinant But: isoler des fragments d ADN de génomes complexes et les recombiner

Plus en détail

Licence-Master Bioinformatique Contrôle continu 06/03/06. Correction

Licence-Master Bioinformatique Contrôle continu 06/03/06. Correction Licence-Master Bioinformatique Contrôle continu 06/03/06 Correction -«Vraies» questions de cours -«fausses» questions de cours: questions pour voir si pouviez imaginer une réponse crédible qui n était

Plus en détail

METHODOLOGIE. Southern, Northern,, Western, PCR,Séquence.

METHODOLOGIE. Southern, Northern,, Western, PCR,Séquence. METHODOLOGIE Southern, Northern,, Western, PCR,Séquence. Les grandes étapes * Transciptase Reverse : 1970 (Temin et Baltimore) * Enzymes de Restriction : 1970 (Smith et Nathan) * Vecteurs recombinants

Plus en détail

TP de Biochimie Groupe 4 Forestier Michèle 25.05.2010 Fournier Coralie Freyre Christophe Manipulation d ADN

TP de Biochimie Groupe 4 Forestier Michèle 25.05.2010 Fournier Coralie Freyre Christophe Manipulation d ADN MANIPULATION D ADN Clonage du gène «venus» dans des plasmides et expression de celui-ci chez les bactéries E.Coli. Assistants: U. Loizides M. Umebayashi C. Gehin - 1 - 1. Résumé Lors de notre expérience,

Plus en détail

3. Biotechnologie de l ADN

3. Biotechnologie de l ADN 3. Biotechnologie de l ADN 3.1. Technologie de l ADN recombinant 3.1.1. Isolation d ADN et d ARN 3.1.2. Fragmentation de l ADN (les Endonucléases) 3.1.3. Analyse d ADN sur d agarose et d acrylamide 3.1.4.

Plus en détail

Outils de génie génétique 1.TERMINOLOGIE ENZYMES UTILISÉS SONDES MOLECULAIRE ET HYBRIDATION MOLECULAIRE

Outils de génie génétique 1.TERMINOLOGIE ENZYMES UTILISÉS SONDES MOLECULAIRE ET HYBRIDATION MOLECULAIRE Outils de génie génétique 1.TERMINOLOGIE ENZYMES UTILISÉS SONDES MOLECULAIRE ET HYBRIDATION MOLECULAIRE 1 Terminologie ADN recombinant : combinaison de deux molécules d ADN appartenant à deux espèces différentes;

Plus en détail

Biologie Moléculaire 6 GT SG FWB Leçon n 5

Biologie Moléculaire 6 GT SG FWB Leçon n 5 Biologie Moléculaire 6 GT SG FWB Leçon n 5 Tests de paternité (fin labo électrophorèse) Un test de paternité consiste à analyser l'adn de deux personnes dans le but d'établir un lien de parenté génétique.

Plus en détail

Apport de la PCR en temps réel en maladies infectieuses

Apport de la PCR en temps réel en maladies infectieuses Apport de la PCR en temps réel en maladies infectieuses Biologie moléculaire Amplification PCR I. Dénaturation ADN 95 C II. Hybridation t = Tm III. Extension t dépend de la polymérase employée PCR «classique»

Plus en détail

Mise en évidence des agents infectieux par Biologie Moléculaire

Mise en évidence des agents infectieux par Biologie Moléculaire UE de l agent infectieux à l hôte Janvier 2012 Mise en évidence des agents infectieux par Biologie Moléculaire Dr Isabelle GARRIGUE Laboratoire de Virologie Professeur FLEURY isabelle.garrigue@chu-bordeaux.fr

Plus en détail

Méthodes d études. Chapitre 8 : Professeur Joël LUNARDI. UE1 : Biochimie Biologie moléculaire

Méthodes d études. Chapitre 8 : Professeur Joël LUNARDI. UE1 : Biochimie Biologie moléculaire Chapitre 8 : UE1 : Biochimie Biologie moléculaire Méthodes d études Professeur Joël LUNARDI Année universitaire 2011/2012 Université Joseph Fourier de Grenoble - Tous droits réservés. Chapitre 8. 8. Méthodes

Plus en détail

Manipulation des acides nucléiques

Manipulation des acides nucléiques Manipulation des acides nucléiques (voir chapitre 6 du Voet et Voet) - les acides nucléiques forment des polymères : ADN et ARN - ils sont composés de 4 nucléotides: A, C, G et T pour l ADN A, C, G et

Plus en détail

Techniques moléculaires non morphologiques. Dr S Poglio Année 2015-2016

Techniques moléculaires non morphologiques. Dr S Poglio Année 2015-2016 Techniques moléculaires non morphologiques Dr S Poglio Année 2015-2016 Généralités Techniques d Analyse : -Au niveau Tissulaire : IHC, macroscopie -Au niveau Cellulaire : FISH, culture, microscopie, cytométrie

Plus en détail

Polytech UEF1. BONCOMPAGNI Éric MCU - Univ. Nice Sophia Antipolis Site WEB : sites.unice.fr/eb. Outils moléculaires pour l analyse des génomes

Polytech UEF1. BONCOMPAGNI Éric MCU - Univ. Nice Sophia Antipolis Site WEB : sites.unice.fr/eb. Outils moléculaires pour l analyse des génomes Polytech UEF1 BONCOMPAGNI Éric MCU - Univ. Nice Sophia Antipolis Site WEB : sites.unice.fr/eb Outils moléculaires pour l analyse des génomes Pourquoi la génétique moléculaire? La génétique formelle renseigne

Plus en détail

PCR (POLYMERASE CHAIN REACTION)

PCR (POLYMERASE CHAIN REACTION) PCR (POLYMERASE CHAIN REACTION) Amplification des acides nucléiques PCR RT-PCR Et leurs applications PCR en temps réel La PCR : une révolution technologique en biologie moléculaire APPLICATIONS : - Médecine

Plus en détail

P.C.R. POLYMERASE CHAIN REACTION ou AMPLIFICATION PAR POLYMERISATION EN CHAÎNE

P.C.R. POLYMERASE CHAIN REACTION ou AMPLIFICATION PAR POLYMERISATION EN CHAÎNE P.C.R. POLYMERASE CHAIN REACTION ou AMPLIFICATION PAR POLYMERISATION EN CHAÎNE P.C.R.: Méthode rapide d'amplification d'une séquence déterminée d'a.d.n. à partir d'une matrice. Elle permet d'obtenir plusieurs

Plus en détail

Mise en évidence des agents infectieux par Biologie Moléculaire

Mise en évidence des agents infectieux par Biologie Moléculaire UE de l agent infectieux à l hôte Février 2015 Mise en évidence des agents infectieux par Biologie Moléculaire Dr Isabelle GARRIGUE UMR CNRS MFP Microbiologie Fondamentale et Pathogénicité isabelle.garrigue@chu-bordeaux.fr

Plus en détail

TP BC : ADN recombinant BCPST1, ENCPB

TP BC : ADN recombinant BCPST1, ENCPB TP BC : principe et analyse de résultats des technologies de l ADN recombinant = clonage moléculaire = génie génétique Sources des illustrations : Analyse génétique moderne, Griffith et al., De Boeck,

Plus en détail

L2 microbiologie TD08: méthodes de la microbiologie moléculaire

L2 microbiologie TD08: méthodes de la microbiologie moléculaire # Andrew Tolonen (atolonen@gmail.com) # avril 2013 L2 microbiologie TD08: méthodes de la microbiologie moléculaire Exercise 1: amplification d'un gène d'intéret par PCR Vous êtes un médecin travaillant

Plus en détail

LA PCR QUANTITATIVE EN TEMPS REEL OU LA "TAQMAN"

LA PCR QUANTITATIVE EN TEMPS REEL OU LA TAQMAN LA PCR QUANTITATIVE EN TEMPS REEL OU LA "TAQMAN" I- Terminologie Le terme TaqMan est souvent utilisé par abus de langage pour désigner : - la technique de PCR quantitative par détection en temps réel de

Plus en détail

Séquençage de l ADN. Définition

Séquençage de l ADN. Définition Définition Séquençage de l ADN Le séquençage de l ADN, est la détermination de la succession des nucléotides le composant. C est aujourd'hui une technique de routine pour les laboratoires de biologie.

Plus en détail

ANNATUT. [Année ] Qcm issus des Tutorats. Correction détaillée

ANNATUT. [Année ] Qcm issus des Tutorats. Correction détaillée ANNATUT [Année 2012-2013] Qcm issus des Tutorats Correction détaillée SOMMAIRE 1. QCM Mixtes... 3 Correction :... 6 Le tutorat est gratuit. Toute reproduction ou vente sont interdites. Page 2 sur 7 2011

Plus en détail

Clonage de Vénus et transformation de E.Coli.

Clonage de Vénus et transformation de E.Coli. Clonage de Vénus et transformation de E.Coli. Samueal Joseph, Romain Laverrière, Elias Laudato, Noé Mage Assisstants : Gisele Dewhurst, Charlotte Gehin, Miwa Umebayashi Résumé [1] L expérience consiste

Plus en détail

Université Bordeaux Segalen - PACES 2011-2012 ED UE9s Mars 2012

Université Bordeaux Segalen - PACES 2011-2012 ED UE9s Mars 2012 Sélectionner les propositions exactes Université Bordeaux Segalen - PACES 2011-2012 ED UE9s Mars 2012 QCM 1. La température de fusion (Tm) d une molécule d ADN : A. est mise en évidence par l augmentation

Plus en détail

Exercice 1 1) Identifier les bases présentes dans les structures suivantes :

Exercice 1 1) Identifier les bases présentes dans les structures suivantes : Exercice 1 1) Identifier les bases présentes dans les structures suivantes : 2) Parmi ces bases, lesquelles : a) contiennent du ribose. b) contiennent du désoxyribose. c) contiennent une purine. d) contiennent

Plus en détail

TD Révision BIO57. Connaissance et Technique du gène

TD Révision BIO57. Connaissance et Technique du gène TD Révision BIO57 Connaissance et Technique du gène Novembre 2007 Cécile BAUDOT cecile.baudot@medecine.univ-mrs.fr INSERM 910 «Génétique Médicale et Génomique Fonctionnelle» Maladies Neuromusculaires Le

Plus en détail

TUTORAT UE spécifiques 2010-2011

TUTORAT UE spécifiques 2010-2011 FACULTE de PHARMACIE TUTORAT UE spécifiques 2010-2011 Méthodes d étude et d analyse du génome Eric Badia, Bernard Carcy Séance préparée par Alexandre Leboucher (ATM²), Astrid Robert (ATP) QCM n 1: Synthèse

Plus en détail

Génie génétique. Définition : Outils nécessaires : Techniques utilisées : Application du génie génétique : - Production de protéines

Génie génétique. Définition : Outils nécessaires : Techniques utilisées : Application du génie génétique : - Production de protéines Génie génétique Définition : Ensemble de méthodes d investigation et d expérimentation sur les gènes. Outils nécessaires : ADN recombinant, enzyme de restriction, vecteur, banque ADNc, sonde nucléique...

Plus en détail

La PCR en temps réel

La PCR en temps réel La PCR en temps réel Hôpital La Rabta Tunis 6 juin 2013 Dr Sabine Favre-Bonté Maître de Conférences, Université Claude Bernard Lyon 1 UMR CNRS 5557 Ecologie Microbienne Equipe Multi-résistance environnementale

Plus en détail

2: Les enzymes de restriction

2: Les enzymes de restriction 2: Les enzymes de restriction Les enzymes de restriction sont des protéines synthétisées par des bactéries pour se protéger des infections de virus (bactériophages). Ces enzymes coupent l ADN viral à des

Plus en détail

Le séquençage selon la technique de Sanger

Le séquençage selon la technique de Sanger Séquençage de l ADN Définition Le séquençage de l ADN, est la détermination de la succession des nucléotides le composant. C est aujourd'hui une technique de routine pour les laboratoires de biologie.

Plus en détail

DEVOIR A LA MAISON. BMGG (temps recommandé : 2H00)

DEVOIR A LA MAISON. BMGG (temps recommandé : 2H00) Pour jeudi 12/02/2014 DEVOIR A LA MAISON BMGG (temps recommandé : 2H00) Calculatrice non autorisée Dictionnaire anglais/français autorisé. Clonage et PCR En 1983, Kary Mullis conçut l'idée de la réaction

Plus en détail

Le monde des bio-puces

Le monde des bio-puces Le monde des bio-puces D1 Le «dogme central» de la biologie moléculaire Transcription Epissage Traduction ADN ARNpm ARNm Protéines Génome Transcriptome Protéome D2 Puces à ADN Techniques de génomique fonctionnelle

Plus en détail

CHAPITRE III: Le Clonage

CHAPITRE III: Le Clonage BIOLOGIE MOLECULAIRE CHAPITRE III: Le Clonage I) Définition: Cloner un fragment d'adn consiste à: isoler physiquement ce fragment. en augmenter le nombre de copie (cf: amplification) II) Principe: Le clonage

Plus en détail

Le marquage moléculaire

Le marquage moléculaire Le marquage moléculaire Le marquage moléculaire regroupe un ensemble de techniques révélant des différences de séquences d (acide désoxyribonucléique) entre individus. Les marqueurs moléculaires permettent

Plus en détail

Approche pratique de la transgénèse :

Approche pratique de la transgénèse : Approche pratique de la transgénèse : Recherche et analyse fine d une modification génétique dans le génome murin octobre 2006 1) 2) 3) 7) 8) 9) 10) 11) 12) 13) 14) Plan / Introduction Extraction et Préparation

Plus en détail

Techniques de base de la biologie moléculaire

Techniques de base de la biologie moléculaire Techniques de base de la biologie moléculaire Présenté par : Addoun Hadjer Ait Saadi Taous Plan: Introduction Purification des acides nucléiques 1-extraction à partir de matériels biologiques 2-estimation

Plus en détail

AVANT PROPOS. Il faut aussi bien connaître les méthodes de l embryologie moléculaire et savoir les utiliser.

AVANT PROPOS. Il faut aussi bien connaître les méthodes de l embryologie moléculaire et savoir les utiliser. AVERTISSEMENT Au fil de l ouvrage, les termes ou les notions importantes développés dans le livre de cours Bases cellulaires et moléculaires du développement (Ellipses, 2007), sont notés (I) ou (I, p.x).

Plus en détail

10b : La PCR (locus PV92)

10b : La PCR (locus PV92) 10b : La PCR (locus PV92) Cette expérience a été mise en place afin de remplacer le protocole intitulé "PCR (locus D1S80)". L amplification est en effet meilleure et les résultats plus simples à interpréter.

Plus en détail

Structure de l Opéron Tryptophane

Structure de l Opéron Tryptophane Régulation de la transcription (procaryote) Structure de l Opéron Tryptophane Opéron anabolique 5 gènes de structure nécessaires à la synthèse du tryptophane Trp Trp Trp Trp Trp 1 Régulation de la transcription

Plus en détail

Licence d Informatique Année 2001-2002 Option: Introduction à la biologie moléculaire. LA P.C.R. Polymerase Chain Reaction

Licence d Informatique Année 2001-2002 Option: Introduction à la biologie moléculaire. LA P.C.R. Polymerase Chain Reaction Licence d Informatique Année 2001-2002 Option: Introduction à la biologie moléculaire LA P.C.R. Polymerase Chain Reaction "chercher une aiguille dans une meule de foin"? Chercher à repérer un gène particulier

Plus en détail

Etude du transcriptome et du protéome en Neurooncologie

Etude du transcriptome et du protéome en Neurooncologie Etude du transcriptome et du protéome en Neurooncologie Principes, aspects pratiques, applications cliniques François Ducray Neurologie Mazarin, Unité Inserm U711 Groupe hospitalier Pitié-Salpêtrière Etude

Plus en détail

Ecole Centrale Paris Année 2009-2010 1 ère année. Cours «Biologie». Vendredi 28 mai 2010

Ecole Centrale Paris Année 2009-2010 1 ère année. Cours «Biologie». Vendredi 28 mai 2010 Ecole Centrale Paris Année 2009-2010 1 ère année. Cours «Biologie». Vendredi 28 mai 2010 Contrôle des Connaissances. 2 ème session) (Durée : 1h30, tous documents autorisés, ordinateur interdit) Important

Plus en détail

Biologie Appliquée. Dosages Immunologiques TD9 Mai 2015. Stéphanie Sigaut INSERM U1141 stephanie.sigaut@inserm.fr

Biologie Appliquée. Dosages Immunologiques TD9 Mai 2015. Stéphanie Sigaut INSERM U1141 stephanie.sigaut@inserm.fr Biologie Appliquée Dosages Immunologiques TD9 Mai 2015 Stéphanie Sigaut INSERM U1141 stephanie.sigaut@inserm.fr 1 ELISA 2 3 4 [Ac] 5 6 7 8 9 Correction : Faire la moyenne D0-1 et D0-2 pour toute les valeurs

Plus en détail

Interprétation des résultats et troubleshooting

Interprétation des résultats et troubleshooting Interprétation des résultats et troubleshooting Le Service de séquençage du Centre d innovation Génome Québec et Université McGill utilise des appareils 3730xl DNA Analyzer d Applied Biosystems. Cette

Plus en détail

S 4B0602: Biologie Moléculaire pour les Biotechnologies

S 4B0602: Biologie Moléculaire pour les Biotechnologies S 4B0602: Biologie Moléculaire pour les Biotechnologies 16h TP: Sexage de viande bovine Production d une protéine recombinante, la TAQ ADN Polymérase. 12h CM: Empreintes génétiques Détection d OGM Construction

Plus en détail

Techniques d étude des Gènes et de leur Régulation. A. Galmiche, 2011-2012

Techniques d étude des Gènes et de leur Régulation. A. Galmiche, 2011-2012 Techniques d étude des Gènes et de leur Régulation A. Galmiche, 2011-2012 1. Introduction et techniques de base 2. Détection des acides nucléiques et mesure de l expression des gènes: Hybridations PCR

Plus en détail

L'hybridation fluorescente (FISH)

L'hybridation fluorescente (FISH) L'hybridation fluorescente (FISH) fluorescent in situ hybridization DR Thierry PALUKU THEY-THEY LABO GENETIQUE ET PATHO MOLECULAIRE JUIN 2007 Définition repérer la présence d'anomalies chromosomiques par

Plus en détail

Fanny Coulpier. http://www.transcriptome.ens.fr/sgdb/

Fanny Coulpier. http://www.transcriptome.ens.fr/sgdb/ Fanny Coulpier http://www.transcriptome.ens.fr/sgdb/ Un peu d histoire 1953 : Découverte de la structure en double hélice de l ADN par James Dewey Watson, (prix Nobel de physiologie ou médecine en 1962).

Plus en détail

Quelques notions de génomique fonctionnelle: l exemple des puces à ADN

Quelques notions de génomique fonctionnelle: l exemple des puces à ADN Quelques notions de génomique fonctionnelle: l exemple des puces à ADN Frédéric Devaux Laboratoire de génétique moléculaire Ecole Normale Supérieure Le «dogme central» de la biologie moléculaire Transcription

Plus en détail

ANNEXE V ISOLEMENT ET CARACTÉRISATION DES TÉLOMÈRES

ANNEXE V ISOLEMENT ET CARACTÉRISATION DES TÉLOMÈRES ANNEXE V ISOLEMENT ET CARACTÉRISATION DES TÉLOMÈRES Une cellule humaine contient environ 6 pg d ADN, soit ± 6 x 10 9 pb**, réparti entre 46 chromosomes. Pour étudier la structure des télomères, et notamment

Plus en détail

Chapitre 10 L isolement et la manipulation de gènes. Injection d ADN étranger dans une cellule animale

Chapitre 10 L isolement et la manipulation de gènes. Injection d ADN étranger dans une cellule animale Chapitre 10 L isolement et la manipulation de gènes Injection d ADN étranger dans une cellule animale Comment amplifier un gène d intérêt? Amplification in vivo à l aide du clonage d ADN L ensemble formé

Plus en détail

Exercice 1. 1) Identifier les bases présentes dans les structures suivantes : A = adénosine et guanine, B = uracile, C = cytosine, D = thymine

Exercice 1. 1) Identifier les bases présentes dans les structures suivantes : A = adénosine et guanine, B = uracile, C = cytosine, D = thymine Exercice 1 1) Identifier les bases présentes dans les structures suivantes : A = adénosine et guanine, B = uracile, C = cytosine, D = thymine 2) Parmi ces bases, lesquelles : a) contiennent du ribose.

Plus en détail

M É D E C I N E D E N TA I R E Z I A N I A LES OUTILS DE LA BIOLOGIE MOLECULAIRE

M É D E C I N E D E N TA I R E Z I A N I A LES OUTILS DE LA BIOLOGIE MOLECULAIRE U N I V E R S I T E D A LG E R FA C U LT É D E M É D E C I N E E T D E M É D E C I N E D E N TA I R E Z I A N I A LES OUTILS DE LA BIOLOGIE MOLECULAIRE DR H.YAHIA PR R.BOUDIAF PLAN DU COURS I/INTRODUCTION

Plus en détail

Méthodes d étude et d analyse du génome

Méthodes d étude et d analyse du génome TUT RENTREE 2012 / 2013 UE11 Méthodes d étude et d analyse du génome 1 OBJECTIFS : - Connaître les principales techniques de Biologie Moléculaire - Comprendre ses applications en génétique médicale 2 Les

Plus en détail

Taq'Ozyme Purple Mix MANUEL D UTILISATION

Taq'Ozyme Purple Mix MANUEL D UTILISATION Taq'Ozyme Purple Mix OZYA003-40 - 40 réactions OZYA003-200 - 200 réactions (avec supplément de MgCl 2 ) OZYA003-200XL - 200 réactions (avec supplément de MgCl 2 ) OZYA003-1000 - 1000 réactions (avec supplément

Plus en détail

Séance génome : Explication PCR et électrophorèse

Séance génome : Explication PCR et électrophorèse Séance génome : Explication PCR et électrophorèse La PCR (Polymérase Chain Reaction) est une technique qui permet de démultiplier en de très nombreuses quantités une séquence de nucléotides parmi l ensemble

Plus en détail

PRINCIPES THEORIQUES DE LA PCRq

PRINCIPES THEORIQUES DE LA PCRq PRINCIPES THEORIQUES DE LA PCRq Ce chapitre aborde les notions présentées rapidement dans l introduction (Ct, droite standard, principes de la quantification). Il détaille les différents formats de fluorescence

Plus en détail

BACCALAURÉAT TECHNOLOGIQUE

BACCALAURÉAT TECHNOLOGIQUE BACCALAURÉAT TECHNOLOGIQUE Série : Sciences et Technologies de Laboratoire Spécialité : Biotechnologies SESSION 2015 Sous-épreuve écrite de Biotechnologies Lundi 22 juin 2015 Coefficient de la sous-épreuve

Plus en détail

Méthodes diagnostiques en génétique moléculaire

Méthodes diagnostiques en génétique moléculaire Méthodes diagnostiques en génétique moléculaire P. Latour Praticien Hospitalier Responsable UF 3427 Neurogénétique Moléculaire Laboratoire de Neurochimie Pr Renaud HCL Centre de Biologie Est DES Neurologie

Plus en détail

PRINCIPALES TECHNIQUES UTILISEES EN GENOMIQUE

PRINCIPALES TECHNIQUES UTILISEES EN GENOMIQUE PRINCIPALES TECHNIQUES UTILISEES EN GENOMIQUE Définitions généralités Quelques chiffres 46 chromosomes 22 paires d autosomes (n=44) 1 paire de gonosomes (n=2) : XX/F et XY/H 300 bandes cytogénétiques =

Plus en détail

Projet I. Objectifs. Vérifier la carte de restriction d une insertion d ADN. Cartographie des plasmides inconnus

Projet I. Objectifs. Vérifier la carte de restriction d une insertion d ADN. Cartographie des plasmides inconnus Projet I Vérifier la carte de restriction d une insertion d ADN Objectifs Déterminer quel gène vous avez (Bioinfo) Générer une carte théorique (Bioinfo) Vérifier expérimentalement la carte Déterminer l

Plus en détail

TD de Biologie Moléculaire (hybridation 1)

TD de Biologie Moléculaire (hybridation 1) UE BIO12 TD (hybridation 1) Année 2007-2008 Corinne MAUREL-ZAFFRAN L2 SV TD de Biologie Moléculaire (hybridation 1) RAPPEL DE QUELQUES NOTIONS SUR L HYBRIDATION Beaucoup de méthodes de biologie moléculaire

Plus en détail

CLONAGE D UN GÈNE DE MEDUSE BIOCHIMIE DE L ADN

CLONAGE D UN GÈNE DE MEDUSE BIOCHIMIE DE L ADN CLONAGE D UN GÈNE DE MEDUSE BIOCHIMIE DE L ADN But de la manipulation Le but de cette manipulation est l introduction d un gène de méduse codant pour une protéine fluorescente dans des bactéries par l

Plus en détail

Les virus dans les aliments : un nouveau défi pour les laboratoires de microbiologie

Les virus dans les aliments : un nouveau défi pour les laboratoires de microbiologie : un nouveau défi pour les laboratoires de microbiologie Véronique ZULIANI, Institut de la Filière Porcine Jean Christophe Augustin, ENVA, ASA Qu est ce qu un virus? Microorganisme de 15 à 40 nm Environ

Plus en détail

8. Amplification et séquençage des acides nucléiques

8. Amplification et séquençage des acides nucléiques 8. Amplification et séquençage des acides nucléiques ADN chromosomique, plasmides (ADN bactérienne), ARN messager Rupture cellulaire Isolation et purification des acides nucléiques Concentration et amplification

Plus en détail

Jean-Louis Bergé-Lefranc

Jean-Louis Bergé-Lefranc Apport du séquençage du génome humain à la toxicologie: Toxicogénomique Jean-Louis Bergé-Lefranc QuickTime et un décompresseur TIFF (LZW) sont requis pour visionner cette image. QuickTime et un décompresseur

Plus en détail

Identification et détection des virus. A) Détection symptomatologique

Identification et détection des virus. A) Détection symptomatologique Identification et détection des virus La détection et l'identification des virus font appel à différentes méthodes. Ces méthodes se caractérisent par leur spécificité et leur sensibilité. On peut citer

Plus en détail

BACCALAURÉAT TECHNOLOGIQUE

BACCALAURÉAT TECHNOLOGIQUE BACCALAURÉAT TECHNOLOGIQUE Série : Sciences et Technologies de Laboratoire Spécialité : Biotechnologies SESSION 2013 Sous-épreuve écrite de Biotechnologies Coefficient de la sous-épreuve : 4 Ce sujet est

Plus en détail

GINGIVO-STOMATITES HERPETIQUES: Quels prélèvements et quelles techniques?

GINGIVO-STOMATITES HERPETIQUES: Quels prélèvements et quelles techniques? GINGIVO-STOMATITES HERPETIQUES: Quels prélèvements et quelles techniques? Dr C. ZANDOTTI Laboratoire de Virologie du Pr D. Raoult CHU Timone, Marseille. Virus herpes simplex (HSV) Virus strictement humain,

Plus en détail

L HYBRIDATION MOLECULAIRE

L HYBRIDATION MOLECULAIRE L HYBRIDATION MOLECULAIRE 2-1/ La température de fusion de l ADN : C est une température, appelée également températurede demi dénaturation (Tm) qui correspond à l ouverture ou au déroulement de 50% de

Plus en détail

Polymorphismes de l ADN

Polymorphismes de l ADN Introduction Polymorphismes de l ADN Présentation et mise en évidence Recherche de gènes responsables de maladies génétiques : Analyse de pedigrees où la maladie est présente Sur quel chromosome? À quel

Plus en détail

Voir en annexe, un tableau résumant toutes les techniques de la génétique moléculaire.

Voir en annexe, un tableau résumant toutes les techniques de la génétique moléculaire. Séance 5. Chapitre 4 : LA BIOLOGIE MOLECULAIRE ET SES APPLICATIONS I/ Les outils de la génétique moléculaire. Voir en annexe, un tableau résumant toutes les techniques de la génétique moléculaire. 1. Découverte

Plus en détail

Série : STL Spécialité biotechnologies SESSION 2014 BACCALAURÉAT TECHNOLOGIQUE

Série : STL Spécialité biotechnologies SESSION 2014 BACCALAURÉAT TECHNOLOGIQUE BACCALAURÉAT TECHNLGIQUE Série : STL Spécialité biotechnologies SESSIN 2014 CBSV : sous épreuve coefficient 4 Biotechnologies : sous épreuve coefficient 4 Durée totale de l épreuve: 4 heures Les sujets

Plus en détail

Approfondissement des connaissances en biologie moléculaire

Approfondissement des connaissances en biologie moléculaire Approfondissement des connaissances en biologie moléculaire nicolas.glaichenhaus@unice.fr Master IADE Année 2013-2014 Plan du cours Rappels de biologie moléculaire et de biologie cellulaire Les molécules

Plus en détail

De l histoire naturelle de la QPCR à ses développements actuels

De l histoire naturelle de la QPCR à ses développements actuels De l histoire naturelle de la QPCR à ses développements actuels Jean-José Maoret Frédéric Martins Contact : GeT-TQ@genotoul.fr Plan de la présentation. 1- Introduction 2- Projet de QPCR : quelles étapes?

Plus en détail

Ingénierie des protéines

Ingénierie des protéines Ingénierie des protéines Stéphane Delbecq EA 4558 Vaccination antiparasitaire Laboratoire de Biologie Cellulaire et Moléculaire Faculté de Pharmacie - Montpellier Rappel: transcription et traduction Universalité

Plus en détail

METABOLISME DES VEGETAUX TD N 1

METABOLISME DES VEGETAUX TD N 1 METABOLISME DES VEGETAUX TD N 1 Exercice n 1 Les séquences nucléotidiques des gènes sont proches. 1 Production ATPase: On part de l'adnc de la levure pour savoir si la régulation se fait par la protéine

Plus en détail

HIBRYDATION IN SITU METHODOLOGIE EN ANATOMIE PATHOLOGIE SESSION 2008-2009

HIBRYDATION IN SITU METHODOLOGIE EN ANATOMIE PATHOLOGIE SESSION 2008-2009 METHODOLOGIE EN ANATOMIE PATHOLOGIE SESSION 2008-2009 HIBRYDATION IN SITU Dr Mokrane Yacoub. AHU Histologie Faculté de médecine de Poitiers Service d anatomie pathologique PLAN I- Définition et principes

Plus en détail

Taq Ozyme (Nouvelle Formulation) ADN polymérase thermostable

Taq Ozyme (Nouvelle Formulation) ADN polymérase thermostable Taq Ozyme (Nouvelle Formulation) OZYA001-1000 - 1000 unités OZYA001-5000 - 5000 unités OZYA001-1000D - 1000 unités + dntp Premix - 4x10 mm Stockage et stabilité : Taq Ozyme : 2 ans à -20 C dntp Premix

Plus en détail

2: Les enzymes de restriction

2: Les enzymes de restriction 2: Les enzymes de restriction Les enzymes de restriction sont des protéines synthétisées par des bactéries pour se protéger des infections de virus (bactériophages). Ces enzymes coupent l ADN viral à des

Plus en détail

Techniques de quantification des acides nucléiques par PCR

Techniques de quantification des acides nucléiques par PCR Outils d études cellulaire et moléculaire Techniques de quantification des acides nucléiques par PCR Jérôme Gay-Quéheillard L2 BHTS 1 1. Matériel biologique nécessaire à une PCR 1.1. préparation de l ADN

Plus en détail

Introduction au PCR en. Par Philipe Lampron, M.Sc.

Introduction au PCR en. Par Philipe Lampron, M.Sc. Introduction au PCR en temps réel Par Philipe Lampron, M.Sc. Résumé Fondements du PCR en temps réel (qpcr) Théorie du PCR en temps réel Types de chimies Méthode de quantification Acquisition de résultats

Plus en détail

REGULATION GLOBALE DE L EXPRESSION DES GENES

REGULATION GLOBALE DE L EXPRESSION DES GENES REGULATION GLOBALE DE L EXPRESSION DES GENES TP4 : Les puces à ADN -introduction 21 -réactifs et matériel 22 -protocoles extraction des ARN totaux de levure 23 purification des ARN messagers 24 synthèse

Plus en détail

Génotypage par Séquençage (GBS) : Création d une carte génétique haute densité de Tournesol Population INEDI (RILs PSC8 x XRQ)

Génotypage par Séquençage (GBS) : Création d une carte génétique haute densité de Tournesol Population INEDI (RILs PSC8 x XRQ) Génotypage par Séquençage (GBS) : Création d une carte génétique haute densité de Tournesol Population INEDI (RILs PSC8 x XRQ) Baptiste Mayjonade (IE-CDD SUNRISE) Génétique et génomique des réponses aux

Plus en détail