L AMPLIFICATION GÉNIQUE PAR PCR. (Polymérase Chain Reaction)

Save this PDF as:

Dimension: px
Commencer à balayer dès la page:

Download "L AMPLIFICATION GÉNIQUE PAR PCR. (Polymérase Chain Reaction)"


1 L AMPLIFICATION GÉNIQUE PAR PCR (Polymérase Chain Reaction) ATELIER DE FORMATION SUR LE DIAGNOSTIC DE LA FIEVRE APHTEUSE 21 mai 2012 Corinne SAILLEAU Agence Nationale de Sécurité Sanitaire Laboratoire de Santé Animale de Maisons-Alfort

2 Recherche du génome d un agent infectieux à partir de Provenant etc Extraction des acides nucléiques RT : Reverse-transcription (ARN ADNc ) PCR ou RT-PCR

3 Quels sont les pré-requis pour développer une PCR? Sélection du gène candidat Diagnostic tous sérotypes ou spécifique de sérotype Connaitre la séquence ou une partie Choix et synthèse des amorces spécifiques ADN ou ADNc Utilisation d une ADN polymérase

4 Cible sélectionnée Amorces sélectionnées Sens et anti-sens Synthèse de l ADN À l aide de la Taq Polymérase et de dntp



7 a.2 n a : nombre initial de copies du génome n : nombre de cycles

8 Quantité de produit amplifié

9 Composition du mélange réactionnel (mix) ADN ou ARN? dntps Taq Polymérase (Reverse Transcriptase) 2 amorces spécifiques Tampon (Tris, KCl, MgCl2)

10 La PCR conventionnelle Lecture des résultats (en point final)

11 PRECAUTIONS PROPRES A LA MANIPULATION PCR Préparation des solutions et du mélange réactionnel Extraction des acides nucléiques Amplification Visualisation Sensibilité aux contaminations Contamination de l environnement 1 PIECE Séparation par une hotte à flux laminaire 1 PIECE Utilisation de gants Pointes à filtres Matériel dédié à chaque pièce et poste de travail

12 La PCR en temps réel ou PCR quantitative

13 La PCR en temps réel- Principe Dilution 1/2 CT : 1 Dilution 1/10 CT : 3.32

14 La PCR en temps réel- La chimie Le système SYBR GREEN Le système Taqman

15 Fluorophores utilisés FAM TAMRA Spectres d émission

16 Lecture des résultats Courbes en mode linéaire Courbes en mode logarithmique Lecture des résultats (phase exponentielle)

17 COURBES ATYPIQUES exemple : ARN trop concentré Solution : dilution des ARN (1/10 et 1/100)

18 COURBES ATYPIQUES : résultats faussement positifs

19 PCR en temps réel multiplex Amplification dans un même tube de plusieurs cibles Exemple : Cible 1 Segment 10 BTV (sonde FAM) Cible 2 gène de la β actine (sonde VIC) Pathogène recherché Gène présent dans les cellules animales Internal Positive Control IPC ARN dntps Taq Polymérase Reverse Transcriptase Tampon (Tris, KCl, MgCl2) 4 amorces (2 spécifiques BTV, 2 spécifiques β actine) 2 sondes marquées ( FAM-TAMRA -BTV) (VIC-TAMRA- β actine)

20 Echantillon Positif Echantillon négatif

21 Avantages Rapidité Outil très puissant (sensibilité ++++) Spécificité élevée Détection du génome (conditions de conservation du prélèvement moins importantes) Inconvénients Sensibilité Contamination (faux positifs) Détection du génome Interprétation pas toujours évidente Lien entre la présence du génome et la clinique! Coût

22 Application au diagnostic de la fièvre Aphteuse Kamila Gorna Atelier de formation sur le diagnostic de la FA mai 2012

23 Méthodes RT-PCR en temps réel utilisées au laboratoire RT-PCR en temps réel en deux étapes simplex pour détection Pan FA (détecte une cible dans une réaction) Les cibles : IRES et/ou 3D, et cible endogène : β-actine Sondes TaqMan marquées FAM (en 5 ) et TAMRA (en 3 ) Analyse d un échantillon nécessite 3 réactions RT-PCR différentes L VP4 VP2 VP3 VP1 2A 2B 2C 3A 3B 3B 3B 3C 3D 5 3 VP g IRES P1 P2 P3 IRES Pan FA 3D Pan FA

24 Méthodes RT-PCR en temps réel utilisées au laboratoire RT-PCR en temps réel en une étape duplex pour détection Pan FA (détecte deux cibles dans une réaction) Les cibles : IRES et β-actine / 3D et β-actine RT-PCR en temps réel en une étape duplex pour sérotypage (détecte deux cibles dans une réaction) Les cibles: O type- β-actine /A type - β-actine /Asia1 type - β-actine /SAT2 type- β-actine* Sondes TaqMan marquées FAM (en 5 ) et TAMRA (en 3 ) pour les cibles de la FA Sondes TaqMan marquées VIC (en 5 ) et TAMRA (en 3 ) pour le cible -actine Analyse d un échantillon nécessite 2 réactions (pour Pan FA) Suivant le contexte épidémiologique 1 à 4 réactions (pour sérotypage) L VP4 VP2 VP3 VP1 2A 2B 2C 3A 3B 3B 3B 3C 3D 5 3 VP g IRES P1 P2 P3 IRES Pan FA VP1 region Pour sérotypage 3D Pan FA * Préconisé par IAH Pirbright

25 RT-PCR en temps réel en deux étapes simplex pour détection Pan FA A) Gamme de dilution du virus FA type O (O Manisa) (dilutions de 10 en 10 dans le broyat de la langue de bœuf) C) A) Courbes de RT-PCR pour le cible 3D B) D) B) Plan de plaque/résultats avec des valeurs CT pour la cible 3D de la FA C) Courbes de RT-PCR pour les cible -Actine D) Plan de plaque/résultats avec des valeurs CT pour la cible -Actine

26 RT-PCR en temps réel en une étape duplex pour génotypage Gamme de dilution du virus FA type O (O Manisa) (dilutions de 10 en 10 dans le broyat de la langue de bœuf) Courbes pour FA la cible 3D Courbes pour les cibles: FA/3D avec la sonde FAM (Verts) -actine avec la sonde VIC (Noirs) Courbes pour la cible - actine Plan de plaque/résultats avec les valeurs CT en vert pour 3D et en noir pour -actine

27 RT-PCR classique pour la détection de la Fièvre Aphteuse Sérotype Tous* Tous* Région nom IRES1 sens IRES4 reverse Séquence (5-3 ) CCT GGT CTT TCC AGG TCT AGA CCT ATT CAG GCG TAG AAG CTT Tous* 3D sens TTC GAG AAC GGC ACG GTC GGA Taille attendu 375 bp Tous* 3D reverse GTA AAG TGA TCT GTA GCT TGG 957bp Tous** IRES sens CGT CHG CGC ACG AAA CGC Tous** IRES 527 bp RCG ATR AAR CAG TCR GTY R reverse Tous** 3D sens GAC AAA GGT TTT GTT CTT GGT CA Tous** 3D reverse TCA CCG CAC ACG GCG TTC A 295 bp * Utilisé principalement pour la détection de la FA ** Utilisé aussi pour la recherche de mutations dans la région des cibles IRES et 3D de la rtrt-pcr

28 Exemple de résultats RT-PCR avec les amorces pour amplification des fragments IRES et 3D (Détection de la FA) Amorces: IRES1 (F) IRES4 (R) Taille attendu: 375bp Amorces: IRES (F) IRES (R) Taille attendu: 527bp Amorces: 3D (F) 3D (R) Taille attendu: 957bp

29 RT-PCR classique pour le sérotypage de la Fièvre Aphteuse Sérotype Nom Séquence (5-3 ) Taille attendu Type O VN-OF sens AGATTTGTGAAAGTDACACCA 650bp Type A VN-AF sens CTTGCACTCCCTTACACCGCG 416bp Type Asia1 VN-AsiaF sens GCGSTHRYYCACACAGGYCCGG 521bp Multiplex RT-PCR Tous VN-VP1R reverse CATGTCYTCYTGCATCTGGTT NA SAT2 (Lybie Egypte)* SAT2 Fcl SAT2 Rcl GTAACCCGCTTTGCCATC CGCGTCGAATCTGTCTCTG 288bp RT-PCR conventionnelle * Préconisé par IAH Pirbright

30 Exemple de résultats RT-PCR avec les amorces pour amplification du fragment VP1 (Sérotypage) pour les échantillons: de sérotype O, A, Asia1 en RT-PCR multiplex de sérotype SAT2 en RT-PCR conventionnelle Multiplex RT-PCR Amorces utilisées: VN-OF sens VN-AF sens VN-VP1R VN-AsiaF sens reverse Taille attendue: 650bp 416bp 521bp RT-PCR SAT2 conventionnelle Amorces utilisées: SAT2 Fcl et SAT2 Rcl Taille attendue: 288bp Sérotype O A ASIA SAT1 SAT2 SAT2 SAT2 Erythrée Zimbabwe

31 RT-PCR classique ciblant la région VP1 ( séquençage) FA, fragment du génome bp O-1C-244F O-1C-277F O-1C-283F C-445F P1-1223F A-1C-562F A-1C-612F EUR2B52R bp SAT2B208R Sérotype Amorce forward Région (F) Amorce reverse Région (R) Taille de fragment obtenu O 1C-244F VP3 EUR-2B52R 2B 1155bp O 1C-272F VP3 EUR-2B52R 2B 1130bp O 1C-283F VP3 EUR-2B52R 2B 1119bp A 1C-562F VP3 EUR-2B52R 2B 846bp A 1C-612F VP3 EUR-2B52R 2B 795bp SAT2 1C-445F VP3 SAT2B208R 2B 1125bp SAT2 P1-1223F VP3 SAT2B208R 2B 1255bp Etude d épidémiologie moléculaire


ATELIER EPIGENETIQUE Juin 2012 ATELIER EPIGENETIQUE Utilisation de la Q-PCR pour analyser des données de ChIP ou de MeDIP Emmanuèle Mouchel-Vielh I. La PCR quantitative: principe et généralités II. Interprétation des résultats

Plus en détail

La PCR en temps réel frederic.gevaudant@bordeaux.inra.fr

La PCR en temps réel frederic.gevaudant@bordeaux.inra.fr La PCR en temps réel frederic.gevaudant@bordeaux.inra.fr INRA Centre de recherche de Bordeaux UMR Biologie du Fruit et Pathologie Historique 1985 : Invention par Kary Mullis de la technique de (PCR). 1991

Plus en détail

Apport de la PCR en temps réel en maladies infectieuses

Apport de la PCR en temps réel en maladies infectieuses Apport de la PCR en temps réel en maladies infectieuses Biologie moléculaire Amplification PCR I. Dénaturation ADN 95 C II. Hybridation t = Tm III. Extension t dépend de la polymérase employée PCR «classique»

Plus en détail

d identification et de typage des orbivirus (action A1)

d identification et de typage des orbivirus (action A1) Développement d outils d d identification d et de typage des orbivirus (action A1) Stéphan ZIENTARA, Corinne SAILLEAU, Emmanuel BREARD, Cyril VIAROUGE, Kamilla GORNA, Anthony RELMY, Alexandra DESPRAT UMR

Plus en détail

Ingénierie des protéines

Ingénierie des protéines Ingénierie des protéines Stéphane Delbecq EA 4558 Vaccination antiparasitaire Laboratoire de Biologie Cellulaire et Moléculaire Faculté de Pharmacie - Montpellier Rappel: transcription et traduction Universalité

Plus en détail

ED Biologie moléculaire. E. Turpin J. Lehmann-Che 5-6 novembre 2007

ED Biologie moléculaire. E. Turpin J. Lehmann-Che 5-6 novembre 2007 ED Biologie moléculaire E. Turpin J. Lehmann-Che 5-6 novembre 2007 PCR 1983: Kary Mullis Amplification in vitro par une méthode enzymatique d'un fragmentd'adn en présence de deux oligonucléotides spécifiques

Plus en détail

Enquête. Un médecin a reçu des morceaux d ADN provenant de 2 patients différents. Il a mélangé les tubes et a donc besoin de votre aide pour savoir:

Enquête. Un médecin a reçu des morceaux d ADN provenant de 2 patients différents. Il a mélangé les tubes et a donc besoin de votre aide pour savoir: Enquête Un médecin a reçu des morceaux d ADN provenant de 2 patients différents. Il a mélangé les tubes et a donc besoin de votre aide pour savoir: Quel patient a le plus de chance d être d origine japonaise?

Plus en détail

Mise en évidence des agents infectieux par Biologie Moléculaire

Mise en évidence des agents infectieux par Biologie Moléculaire UE de l agent infectieux à l hôte Janvier 2012 Mise en évidence des agents infectieux par Biologie Moléculaire Dr Isabelle GARRIGUE Laboratoire de Virologie Professeur FLEURY isabelle.garrigue@chu-bordeaux.fr

Plus en détail


LA PCR QUANTITATIVE EN TEMPS REEL OU LA TAQMAN LA PCR QUANTITATIVE EN TEMPS REEL OU LA "TAQMAN" I- Terminologie Le terme TaqMan est souvent utilisé par abus de langage pour désigner : - la technique de PCR quantitative par détection en temps réel de

Plus en détail

Alanine (Ala) Codons: GCT, GCC, GCA, GCG

Alanine (Ala) Codons: GCT, GCC, GCA, GCG A Alanine (Ala) Codons: GCT, GCC, GCA, GCG R Arginine (Arg) Le nourrisson ne peut pas la fabriquer L'arginine est fréquemment retrouvée dans les energy drinks. Depuis 2008, elle a été remplacée par la

Plus en détail

La PCR en temps réel

La PCR en temps réel La PCR en temps réel Hôpital La Rabta Tunis 6 juin 2013 Dr Sabine Favre-Bonté Maître de Conférences, Université Claude Bernard Lyon 1 UMR CNRS 5557 Ecologie Microbienne Equipe Multi-résistance environnementale

Plus en détail

Prédiction de gènes. Présentation du problème. Open Reading Frame. HMM (Modèles de Markov cachés) Fonctionnement Exemples Limites

Prédiction de gènes. Présentation du problème. Open Reading Frame. HMM (Modèles de Markov cachés) Fonctionnement Exemples Limites Présentation du problème Open Reading Frame Fonctionnement Exemples Limites Procaryotes versus eucaryotes Validation des résultats: 1) comparaison de séquences 2) utilisation de données statistiques HMM

Plus en détail


P.C.R. POLYMERASE CHAIN REACTION ou AMPLIFICATION PAR POLYMERISATION EN CHAÎNE P.C.R. POLYMERASE CHAIN REACTION ou AMPLIFICATION PAR POLYMERISATION EN CHAÎNE P.C.R.: Méthode rapide d'amplification d'une séquence déterminée d'a.d.n. à partir d'une matrice. Elle permet d'obtenir plusieurs

Plus en détail


SERVICES DE SEQUENCAGE SERVICES DE SEQUENCAGE CONTROLE DES RESULTATS Tous les chromatogrammes sont analysés avec le logiciel Sequence Analyser ou Phred 20. Lorsque les séquences ne répondent pas aux critères de qualité : 2 ème

Plus en détail

E. faecium colonisant des greffés de moelle osseuse en Tunisie : fréquences de résistance aux antibiotiques et rôle des éléments génétiques mobiles

E. faecium colonisant des greffés de moelle osseuse en Tunisie : fréquences de résistance aux antibiotiques et rôle des éléments génétiques mobiles E. faecium colonisant des greffés de moelle osseuse en Tunisie : fréquences de résistance aux antibiotiques et rôle des éléments génétiques mobiles Abbassi M.S, Touati A, Achour W, Ben Hassen A Centre

Plus en détail


PCR (POLYMERASE CHAIN REACTION) PCR (POLYMERASE CHAIN REACTION) Amplification des acides nucléiques PCR RT-PCR Et leurs applications PCR en temps réel La PCR : une révolution technologique en biologie moléculaire APPLICATIONS : - Médecine

Plus en détail

Les techniques de détection et la recommandation (CE) 2013/99/UE

Les techniques de détection et la recommandation (CE) 2013/99/UE Les techniques de détection et la recommandation (CE) 2013/99/UE Gilbert Berben, Olivier Fumière, Aline Marien Atelier «Détection de l origine des produits carnés par les tests ADN» Gembloux, le 31 mai

Plus en détail

GINGIVO-STOMATITES HERPETIQUES: Quels prélèvements et quelles techniques?

GINGIVO-STOMATITES HERPETIQUES: Quels prélèvements et quelles techniques? GINGIVO-STOMATITES HERPETIQUES: Quels prélèvements et quelles techniques? Dr C. ZANDOTTI Laboratoire de Virologie du Pr D. Raoult CHU Timone, Marseille. Virus herpes simplex (HSV) Virus strictement humain,

Plus en détail

Analyse d échantillons alimentaires pour la présence d organismes génétiquement modifiés

Analyse d échantillons alimentaires pour la présence d organismes génétiquement modifiés Analyse d échantillons alimentaires pour la présence d organismes génétiquement modifiés Module 11 Détection quantitative du soja Roundup Ready par PCR en temps réel N. Foti WORLD HEALTH ORGANIZATION REGIONAL

Plus en détail


JE M ENTRAINE POUR ETRE AU TOP LE JOUR J JE M ENTRAINE POUR ETRE AU TOP LE JOUR J Exercice n 1 : du gène (brin non transcrit) à la protéine L'ocytocine et l'adh sont deux hormones peptidiques libérées par la post-hypophyse. Les séquences peptidiques

Plus en détail


PRINCIPES THEORIQUES DE LA PCRq PRINCIPES THEORIQUES DE LA PCRq Ce chapitre aborde les notions présentées rapidement dans l introduction (Ct, droite standard, principes de la quantification). Il détaille les différents formats de fluorescence

Plus en détail

Mise en évidence des agents infectieux par Biologie Moléculaire

Mise en évidence des agents infectieux par Biologie Moléculaire UE de l agent infectieux à l hôte Février 2015 Mise en évidence des agents infectieux par Biologie Moléculaire Dr Isabelle GARRIGUE UMR CNRS MFP Microbiologie Fondamentale et Pathogénicité isabelle.garrigue@chu-bordeaux.fr

Plus en détail

Forces agissant sur le polymorphisme synonyme et la composition en bases dans les génomes d angiospermes

Forces agissant sur le polymorphisme synonyme et la composition en bases dans les génomes d angiospermes Forces agissant sur le polymorphisme synonyme et la composition en bases dans les génomes d angiospermes Yves Clément, Jacques David & Sylvain Glémin Journées ARCAD 28/10/2014 Outline Sélection sur l usage

Plus en détail

Université Claude Bernard - Lyon 1. MADG Année 2016

Université Claude Bernard - Lyon 1. MADG Année 2016 Université Claude Bernard - Lyon 1 MADG Année 2016 P r Jean R. Lobry NOM Prénom.............................. Première partie On s intéresse aux résultats de 22 élèves de seconde dans 8 matières. Les élèves

Plus en détail

TD Révision BIO57. Connaissance et Technique du gène

TD Révision BIO57. Connaissance et Technique du gène TD Révision BIO57 Connaissance et Technique du gène Novembre 2007 Cécile BAUDOT cecile.baudot@medecine.univ-mrs.fr INSERM 910 «Génétique Médicale et Génomique Fonctionnelle» Maladies Neuromusculaires Le

Plus en détail

Etude du transcriptome et du protéome en Neurooncologie

Etude du transcriptome et du protéome en Neurooncologie Etude du transcriptome et du protéome en Neurooncologie Principes, aspects pratiques, applications cliniques François Ducray Neurologie Mazarin, Unité Inserm U711 Groupe hospitalier Pitié-Salpêtrière Etude

Plus en détail

Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013

Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013 Sélectionner les propositions exactes Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013 QCM 1 La plupart des techniques de biologie moléculaire repose sur le principe de complémentarité

Plus en détail

8.3.3 Réactifs. La polymérase catalyse la synthèse de brins complémentaires d ADN.

8.3.3 Réactifs. La polymérase catalyse la synthèse de brins complémentaires d ADN. 8.3.3 Réactifs 1. AD polymérase: La polymérase catalyse la synthèse de brins complémentaires d AD. Des polymérases qui sont résistantes à la chaleur sont utilisées, telles que la Taq polymérase (Thermus

Plus en détail


CORRECTION DES EXERCICES DE GENETIQUE SYNTHESE PROTEIQUE : P 136-137 CORRECTION DES EXERCICES DE GENETIQUE SYNTHESE PROTEIQUE : P 136-137 Exercice 1 p 171 : définir en une phrase les mots suivants Polypeptide : chaine de plusieurs acides aminés. Séquence protéinique : séquence

Plus en détail

Méthodes et techniques de la biologie du développement

Méthodes et techniques de la biologie du développement Méthodes et techniques de la biologie du développement 1. Etude de l expression des gènes : Détecter les transcrits et les protéines au cours de l ontogenèse l outil anticorps 1.1. La RT-PCR La réaction

Plus en détail

Tests de laboratoire recommandés pour identifier le virus de la grippe aviaire A dans les prélèvements humains

Tests de laboratoire recommandés pour identifier le virus de la grippe aviaire A dans les prélèvements humains Tests de laboratoire recommandés pour identifier le virus de la grippe aviaire A dans les prélèvements humains Généralités La grippe aviaire due à certains sous-types du virus grippal A hautement pathogènes

Plus en détail


RETRACER L ÉVOLUTION DES GÈNES N A D I A EL- M A B R O U K RETRACER L ÉVOLUTION DES GÈNES N A D I A EL- M A B R O U K Le dogme central de la biologie moléculaire Replication Transcription Translation www. Bioalgorithms.info L ADN ADN: Séquence de 4 nucléotides

Plus en détail

3. Biotechnologie de l ADN

3. Biotechnologie de l ADN 3. Biotechnologie de l ADN 3.1. Technologie de l ADN recombinant 3.1.1. Isolation d ADN et d ARN 3.1.2. Fragmentation de l ADN (les Endonucléases) 3.1.3. Analyse d ADN sur d agarose et d acrylamide 3.1.4.

Plus en détail

Techniques de biologie moléculaire utilisées dans un cadre diagnostique. A. CALENDER 7.11 couvrant l ensemble des techniques

Techniques de biologie moléculaire utilisées dans un cadre diagnostique. A. CALENDER 7.11 couvrant l ensemble des techniques Techniques de biologie moléculaire utilisées dans un cadre diagnostique A. CALENDER 7.11 couvrant l ensemble des techniques Introduction Diagnostic clinique Confirmation par l analyse génétique Traitement

Plus en détail


GENETIQUE, ENTRE CRAINTES ET ESPOIRS GENETIQUE, ENTRE CRAINTES ET ESPOIRS Un peu de science ADN, gènes, chromosomes, code génétique La génétique et nous Gènes & médecine : l histoire d un chien aveugle... Les tests d ADN : mais que fait la

Plus en détail

TP de Biochimie Groupe 4 Forestier Michèle 25.05.2010 Fournier Coralie Freyre Christophe Manipulation d ADN

TP de Biochimie Groupe 4 Forestier Michèle 25.05.2010 Fournier Coralie Freyre Christophe Manipulation d ADN MANIPULATION D ADN Clonage du gène «venus» dans des plasmides et expression de celui-ci chez les bactéries E.Coli. Assistants: U. Loizides M. Umebayashi C. Gehin - 1 - 1. Résumé Lors de notre expérience,

Plus en détail


METABOLISME DES VEGETAUX TD N 1 METABOLISME DES VEGETAUX TD N 1 Exercice n 1 Les séquences nucléotidiques des gènes sont proches. 1 Production ATPase: On part de l'adnc de la levure pour savoir si la régulation se fait par la protéine

Plus en détail

Croissance bactérienne et expression des protéines

Croissance bactérienne et expression des protéines Croissance bactérienne et expression des protéines Stéphane Delbecq Laboratoire de Biologie Cellulaire et Moléculaire EA 4558 «vaccination antiparasitaire» Faculté de Pharmacie sdelbecq@univ-montp1.fr

Plus en détail

Les virus dans les aliments : un nouveau défi pour les laboratoires de microbiologie

Les virus dans les aliments : un nouveau défi pour les laboratoires de microbiologie : un nouveau défi pour les laboratoires de microbiologie Véronique ZULIANI, Institut de la Filière Porcine Jean Christophe Augustin, ENVA, ASA Qu est ce qu un virus? Microorganisme de 15 à 40 nm Environ

Plus en détail


BACCALAURÉAT TECHNOLOGIQUE BACCALAURÉAT TECHNOLOGIQUE Série : Sciences et Technologies de Laboratoire Spécialité : Biotechnologies SESSION 2015 Sous-épreuve écrite de Biotechnologies Lundi 22 juin 2015 Coefficient de la sous-épreuve

Plus en détail

Méthodes diagnostiques en génétique moléculaire

Méthodes diagnostiques en génétique moléculaire Méthodes diagnostiques en génétique moléculaire P. Latour Praticien Hospitalier Responsable UF 3427 Neurogénétique Moléculaire Laboratoire de Neurochimie Pr Renaud HCL Centre de Biologie Est DES Neurologie

Plus en détail

Taq Ozyme (Nouvelle Formulation) ADN polymérase thermostable

Taq Ozyme (Nouvelle Formulation) ADN polymérase thermostable Taq Ozyme (Nouvelle Formulation) OZYA001-1000 - 1000 unités OZYA001-5000 - 5000 unités OZYA001-1000D - 1000 unités + dntp Premix - 4x10 mm Stockage et stabilité : Taq Ozyme : 2 ans à -20 C dntp Premix

Plus en détail

TP DE BBSG M1 (2011-2012) Production de protéines recombinantes dans Escherichia. coli Etudes structurales et fonctionnelles (C. Bordi, M-S aschtgen)

TP DE BBSG M1 (2011-2012) Production de protéines recombinantes dans Escherichia. coli Etudes structurales et fonctionnelles (C. Bordi, M-S aschtgen) TP DE BBSG M1 (2011-2012) Production de protéines recombinantes dans Escherichia. coli Etudes structurales et fonctionnelles (C. Bordi, M-S aschtgen) Introduction Le vecteur d'expression procaryote pqe31-dsred3

Plus en détail

Fanny Coulpier. http://www.transcriptome.ens.fr/sgdb/

Fanny Coulpier. http://www.transcriptome.ens.fr/sgdb/ Fanny Coulpier http://www.transcriptome.ens.fr/sgdb/ Un peu d histoire 1953 : Découverte de la structure en double hélice de l ADN par James Dewey Watson, (prix Nobel de physiologie ou médecine en 1962).

Plus en détail

Approche pratique de la transgénèse :

Approche pratique de la transgénèse : Approche pratique de la transgénèse : Recherche et analyse fine d une modification génétique dans le génome murin octobre 2006 1) 2) 3) 7) 8) 9) 10) 11) 12) 13) 14) Plan / Introduction Extraction et Préparation

Plus en détail

Utilisation des outils de mesure de la performance des analyses de laboratoire

Utilisation des outils de mesure de la performance des analyses de laboratoire Utilisation des outils de mesure de la performance des analyses de laboratoire Christiane Claessens Laboratoire de santé publique du Québec 24 octobre 2006 Surprise! Un test de laboratoire 100% précis

Plus en détail

Génie génétique. Définition : Outils nécessaires : Techniques utilisées : Application du génie génétique : - Production de protéines

Génie génétique. Définition : Outils nécessaires : Techniques utilisées : Application du génie génétique : - Production de protéines Génie génétique Définition : Ensemble de méthodes d investigation et d expérimentation sur les gènes. Outils nécessaires : ADN recombinant, enzyme de restriction, vecteur, banque ADNc, sonde nucléique...

Plus en détail

Prédiction de gènes. Licence master

Prédiction de gènes. Licence master Prédiction de gènes Hélène Touzet Licence master Deux approches 1. Prédiction par similitude comparaison à des banques d EST EST : expressed sequence tags outil de localisation : BLST comparaison à des

Plus en détail

Licence master

Licence master Prédiction de gènes Hélène Touzet Licence master www.lifl.fr/~touzet/m1/ Deux approches 1. Prédiction par similitude comparaison à des banques d EST EST : expressed sequence tags outil de localisation

Plus en détail

Enquête sportive (protéines)

Enquête sportive (protéines) Enquête sportive (protéines) Un médecin a reçu des morceaux d ADN provenant de 2 sportifs différents. Il a mélangé les tubes et a donc besoin de votre aide pour savoir: Quel sportif a le plus de chance

Plus en détail

Identification par réaction en chaîne par polymérase (PCR) des Escherichia coli pathogènes chez les animaux et zoonotiques

Identification par réaction en chaîne par polymérase (PCR) des Escherichia coli pathogènes chez les animaux et zoonotiques Identification par réaction en chaîne par polymérase (PCR) des Escherichia coli pathogènes chez les animaux et zoonotiques Table des matières ECL-PON-002 1. Objectif... 1 2. Principe... 1 3. Méthodologie...

Plus en détail

TP Génétique Humaine. 1. Introduction. 2. L'enzyme MTHFR

TP Génétique Humaine. 1. Introduction. 2. L'enzyme MTHFR 1 2 TP Génétique Humaine 1. Introduction Le MéthylèneTétrahydroFolate Réductase est une enzyme qui joue un rôle important dans le métabolisme des folates et d'homocystéine, pour fournir de la méthionine,

Plus en détail

Infections aiguës respiratoires

Infections aiguës respiratoires Infections aiguës respiratoires Apport de la biologie moléculaire Marie-Claude Bernard D I symposium infections aiguës respiratoires 29/03/05 - p.1 Le diagnostic Culture EIA ICT (immunochromato) Immuno

Plus en détail

Faire face à la grippe aviaire A (H7N9)

Faire face à la grippe aviaire A (H7N9) Juin 2013 empres-animal-health@fao.org www.fao.org/ag/empres.html Faire face à la grippe aviaire A (H7N9) Protocoles et algorithmes de laboratoire Table des matières Introduction 1 1. Vue d ensemble des

Plus en détail

Lettres: A, T, G, C. Mots: à 3 lettres (codons) Phrase: gène (information pour synthétiser une protéine). Ponctuation

Lettres: A, T, G, C. Mots: à 3 lettres (codons) Phrase: gène (information pour synthétiser une protéine). Ponctuation 2- Les molécules d ADN constituent le génome 2-1 La séquence d ADN représente l information génétique Lettres: A, T, G, C Mots: à 3 lettres (codons) Phrase: gène (information pour synthétiser une protéine).

Plus en détail

Le séquençage haut-débit

Le séquençage haut-débit Nouveaux outils en biologie Le séquençage haut-débit DES d hématologie 16 janvier 2015 Paris Alice Marceau-Renaut Laboratoire d hématologie CHRU Lille NGS = Next-Generation Sequencing Whole-genome Whole-exome

Plus en détail

POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA

POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA Amplification spécifique Détection spécifique Clonage dans des vecteurs Amplification in vitro PCR Hybridation moléculaire - hôte cellulaire

Plus en détail

altona altona RealStar WNV RT-PCR Kit 1.0 always a drop ahead. 07/2015 altona Diagnostics GmbH Mörkenstr. 12 22767 Hamburg Germany

altona altona RealStar WNV RT-PCR Kit 1.0 always a drop ahead. 07/2015 altona Diagnostics GmbH Mörkenstr. 12 22767 Hamburg Germany altona DIAGNOSTICS altona DIAGNOSTICS RealStar WNV RT-PCR Kit 1.0 07/2015 altona Diagnostics GmbH Mörkenstr. 12 22767 Hamburg Germany phone +49 40 548 06 76-0 fax +49 40 548 06 76-10 e-mail info@altona-diagnostics.com

Plus en détail

Guide sur le PCR en temps réel (qpcr)

Guide sur le PCR en temps réel (qpcr) Guide sur le PCR en temps réel (qpcr) Un service complet est offert par la plateforme de génomique de l IRIC pour le qpcr incluant l analyse de votre ARN, la préparation de vos cdna, le design des essais,

Plus en détail


Taq'Ozyme Purple Mix MANUEL D UTILISATION Taq'Ozyme Purple Mix OZYA003-40 - 40 réactions OZYA003-200 - 200 réactions (avec supplément de MgCl 2 ) OZYA003-200XL - 200 réactions (avec supplément de MgCl 2 ) OZYA003-1000 - 1000 réactions (avec supplément

Plus en détail

Identification de Melissococcus plutonius, agent de la loque européenne, par PCR

Identification de Melissococcus plutonius, agent de la loque européenne, par PCR Méthode d analyse en santé animale RÉFÉRENCE : ANSES/SOP/ANA-I1.21 - Version 2 Août 2016 Identification de Melissococcus plutonius, agent de la loque européenne, par PCR Anses Sophia Antipolis Laboratoire

Plus en détail

Cours IFSI Rockefeller 2013 Dr Julie Marzais

Cours IFSI Rockefeller 2013 Dr Julie Marzais Cours IFSI Rockefeller 2013 Dr Julie Marzais Synthèse s Protéines Du co génétique g aux molécules du Vivant Fonction principale l information l génétique g L information est codée e dans l ADN l succession

Plus en détail



Plus en détail

De l histoire naturelle de la QPCR à ses développements actuels

De l histoire naturelle de la QPCR à ses développements actuels De l histoire naturelle de la QPCR à ses développements actuels Jean-José Maoret Frédéric Martins Contact : GeT-TQ@genotoul.fr Plan de la présentation. 1- Introduction 2- Projet de QPCR : quelles étapes?

Plus en détail

NIMP 27 PROTOCOLES DE DIAGNOSTIC. PD 2: Plum pox virus (2012)

NIMP 27 PROTOCOLES DE DIAGNOSTIC. PD 2: Plum pox virus (2012) Le présent protocole de diagnostic a été adopté par la Commission des mesures phytosanitaires en mars 2012. Cette annexe constitue une partie prescriptive de la NIMP 27:2006. NIMP 27 Annexe 2 NORMES INTERNATIONALES

Plus en détail

Manipuler des données volumineuses : les génomes bactériens

Manipuler des données volumineuses : les génomes bactériens Fiche TD avec le logiciel : tdr16 Manipuler des données volumineuses : les génomes bactériens J.R. Lobry & D. Chessel Pour tester l aptitude de à manipuler de grands ensembles de données, la fiche propose

Plus en détail

Structure de l Opéron Tryptophane

Structure de l Opéron Tryptophane Régulation de la transcription (procaryote) Structure de l Opéron Tryptophane Opéron anabolique 5 gènes de structure nécessaires à la synthèse du tryptophane Trp Trp Trp Trp Trp 1 Régulation de la transcription

Plus en détail

MLVA Streptococcus pneumoniae

MLVA Streptococcus pneumoniae H.I.A. Robert Picqué Bordeaux Laboratoire de Biologie moléculaire Version Internet 2 MLVA Streptococcus pneumoniae 1. DESCRIPTION DES OPERATIONS 1.1 Culture et extraction des ADN NB : prévoir dans la série

Plus en détail

Licence d Informatique Année 2001-2002 Option: Introduction à la biologie moléculaire. LA P.C.R. Polymerase Chain Reaction

Licence d Informatique Année 2001-2002 Option: Introduction à la biologie moléculaire. LA P.C.R. Polymerase Chain Reaction Licence d Informatique Année 2001-2002 Option: Introduction à la biologie moléculaire LA P.C.R. Polymerase Chain Reaction "chercher une aiguille dans une meule de foin"? Chercher à repérer un gène particulier

Plus en détail

Guide d utilisation des kits Perfect Master Mix SYBR Green

Guide d utilisation des kits Perfect Master Mix SYBR Green Guide d utilisation des kits Perfect Master Mix SYBR Green Pour les produits AnyGenes : Cat # PMSX-F2S Cat # PMSX-F4S Cat # PMSX-F8S Cat # PMSX-F12S Cat # PMSX-F24S (* Cat # pour toutes les références

Plus en détail

Détection et prise en charge de la résistance aux antirétroviraux

Détection et prise en charge de la résistance aux antirétroviraux Détection et prise en charge de la résistance aux antirétroviraux Jean Ruelle, PhD AIDS Reference Laboratory, UCLouvain, Bruxelles Corata 2011, Namur, 10 juin 2011 Laboratoires de référence SIDA (Belgique)

Plus en détail

Polytech UEF1. BONCOMPAGNI Éric MCU - Univ. Nice Sophia Antipolis Site WEB : sites.unice.fr/eb. Outils moléculaires pour l analyse des génomes

Polytech UEF1. BONCOMPAGNI Éric MCU - Univ. Nice Sophia Antipolis Site WEB : sites.unice.fr/eb. Outils moléculaires pour l analyse des génomes Polytech UEF1 BONCOMPAGNI Éric MCU - Univ. Nice Sophia Antipolis Site WEB : sites.unice.fr/eb Outils moléculaires pour l analyse des génomes Pourquoi la génétique moléculaire? La génétique formelle renseigne

Plus en détail



Plus en détail

I- Unités monomériques: Nucléotides

I- Unités monomériques: Nucléotides B- Les Acide nucléiques 1 acide nucléique = polymères de nucléotides Capacité: autoduplication transport et transmission de l information > Programme des protéines produites par chaque cellule base >reproduction

Plus en détail

Cindy Dallaire, agronome-phytopathologiste Direction de la phytoprotection


Plus en détail

TD de Biochimie 4 : Coloration.

TD de Biochimie 4 : Coloration. TD de Biochimie 4 : Coloration. Synthèse de l expérience 2 Les questions posées durant l expérience 2 Exposé sur les méthodes de coloration des molécules : Générique Spécifique Autres Questions Pourquoi

Plus en détail

Étude de validation du Bluestar Forensic

Étude de validation du Bluestar Forensic Étude de validation du Bluestar Forensic I. Matériels et matières utilisés II. des tests 2.1. Détermination du seuil de sensibilité du kit Bluestar 2.2. Détermination de taches en fonction de leur volume

Plus en détail

Chapitre 10 L isolement et la manipulation de gènes. Injection d ADN étranger dans une cellule animale

Chapitre 10 L isolement et la manipulation de gènes. Injection d ADN étranger dans une cellule animale Chapitre 10 L isolement et la manipulation de gènes Injection d ADN étranger dans une cellule animale Comment amplifier un gène d intérêt? Amplification in vivo à l aide du clonage d ADN L ensemble formé

Plus en détail

Principales techniques utilisées en génie génétique Ces différentes techniques peuvent également se combiner entre elles. Séquençage de l ADN

Principales techniques utilisées en génie génétique Ces différentes techniques peuvent également se combiner entre elles. Séquençage de l ADN Principales techniques utilisées en génie génétique Ces différentes techniques peuvent également se combiner entre elles Séquençage de l ADN 1- Un brin complémentaire de l ADN à séquencer est fabriqué

Plus en détail

Kit d extraction PicoPure DNA

Kit d extraction PicoPure DNA Directement à la PCR Le kit PicoPure DNA permet une extraction simple et rapide de l ADN génomique prêt à l utilisation en PCR. Extraire et amplifier l ADN dans le même tube, sans phase d extraction organique

Plus en détail

Génotypage par Séquençage (GBS) : Création d une carte génétique haute densité de Tournesol Population INEDI (RILs PSC8 x XRQ)

Génotypage par Séquençage (GBS) : Création d une carte génétique haute densité de Tournesol Population INEDI (RILs PSC8 x XRQ) Génotypage par Séquençage (GBS) : Création d une carte génétique haute densité de Tournesol Population INEDI (RILs PSC8 x XRQ) Baptiste Mayjonade (IE-CDD SUNRISE) Génétique et génomique des réponses aux

Plus en détail

Identification de Paenibacillus larvae, agent de la loque américaine, par PCR

Identification de Paenibacillus larvae, agent de la loque américaine, par PCR Méthode d analyse en santé animale RÉFÉRENCE : ANSES/SOP/ANA-I1.MOA.19 - Version 2 Août 2016 Identification de Paenibacillus larvae, agent de la loque américaine, par PCR Anses Sophia Antipolis Laboratoire

Plus en détail

Chapitre 1. La cellule : unité morphologique et fonctionnelle

Chapitre 1. La cellule : unité morphologique et fonctionnelle Chapitre 1. La cellule : unité morphologique et fonctionnelle 1. Historique de la biologie : Les premières cellules eucaryotes sont apparues il y a 3 milliards d années. Les premiers Homo Sapiens apparaissent

Plus en détail

Le marquage moléculaire

Le marquage moléculaire Le marquage moléculaire Le marquage moléculaire regroupe un ensemble de techniques révélant des différences de séquences d (acide désoxyribonucléique) entre individus. Les marqueurs moléculaires permettent

Plus en détail



Plus en détail

Les Evolutions techniques. Marc Delpech Laboratoire de Génétique et Biologie moléculaires de l hôpital Cochin

Les Evolutions techniques. Marc Delpech Laboratoire de Génétique et Biologie moléculaires de l hôpital Cochin Les Evolutions techniques Marc Delpech Laboratoire de Génétique et Biologie moléculaires de l hôpital Cochin 1 Les principales étapes de l évolution technologique 1975 Southern blot 1977 Séquençage Sanger

Plus en détail

3. Biotechnologie de l ADN

3. Biotechnologie de l ADN 3. Biotechnologie de l ADN 3.1. Technologie de l ADN recombinant 3.1.1. Isolation d ADN et d ARN 3.1.2. Fragmentation de l ADN (les Endonucléases) 3.1.3. Analyse d ADN sur d agarose et d acrylamide 3.1.4.

Plus en détail

10b : La PCR (locus PV92)

10b : La PCR (locus PV92) 10b : La PCR (locus PV92) Cette expérience a été mise en place afin de remplacer le protocole intitulé "PCR (locus D1S80)". L amplification est en effet meilleure et les résultats plus simples à interpréter.

Plus en détail

Mycoplasma genitalium,, un agent émergent autres maladies sexuellement transmissibles

Mycoplasma genitalium,, un agent émergent autres maladies sexuellement transmissibles Mycoplasma genitalium,, un agent émergent responsable d urétrites et autres maladies sexuellement transmissibles Cécile M. Bébéar, B. de Barbeyrac, G. Carcenac, M. Clerc, S. Pereyre, et C. Bébéar Laboratoire

Plus en détail


CHAPITRE III: Le Clonage BIOLOGIE MOLECULAIRE CHAPITRE III: Le Clonage I) Définition: Cloner un fragment d'adn consiste à: isoler physiquement ce fragment. en augmenter le nombre de copie (cf: amplification) II) Principe: Le clonage

Plus en détail

Clonage de Vénus et transformation de E.Coli.

Clonage de Vénus et transformation de E.Coli. Clonage de Vénus et transformation de E.Coli. Samueal Joseph, Romain Laverrière, Elias Laudato, Noé Mage Assisstants : Gisele Dewhurst, Charlotte Gehin, Miwa Umebayashi Résumé [1] L expérience consiste

Plus en détail

altona altona RealStar CMV PCR Kit 1.0 always a drop ahead. 04/2015 altona Diagnostics GmbH Mörkenstr. 12 22767 Hamburg Germany

altona altona RealStar CMV PCR Kit 1.0 always a drop ahead. 04/2015 altona Diagnostics GmbH Mörkenstr. 12 22767 Hamburg Germany altona DIAGNOSTICS altona DIAGNOSTICS RealStar CMV PCR Kit 1.0 04/2015 altona Diagnostics GmbH Mörkenstr. 12 22767 Hamburg Germany phone +49 40 548 06 76-0 fax +49 40 548 06 76-10 e-mail info@altona-diagnostics.com

Plus en détail

Les différentes stratégies de quantification :

Les différentes stratégies de quantification : Les différentes stratégies de quantification : Ce chapitre présente les 2 principales stratégies de quantification relative utilisée classiquement : la méthode des droites standards et celle des Ct. Les

Plus en détail

Nouvelles mutations RAS

Nouvelles mutations RAS Nouvelles mutations RAS dans les cancers colo-rectaux Rappel RAS : interrupteur de plusieurs voies de signalisation ras MUTATION RAS /ras activé en permanence : signalisation continue de la prolifération

Plus en détail

Travailler en toute sécurité dans un laboratoire de biologie moléculaire

Travailler en toute sécurité dans un laboratoire de biologie moléculaire VWR Tour 2012! Travailler en toute sécurité dans un laboratoire de biologie moléculaire Christian Siatka Directeur général Consultant qualité règlementations européennes Master BIOTIN Management de la

Plus en détail

Les microarrays: technologie pour interroger le génome

Les microarrays: technologie pour interroger le génome Les microarrays: technologie pour interroger le génome Patrick DESCOMBES patrick.descombes@frontiers-in-genetics.org Plate forme génomique NCCR Frontiers in Genetics Université de Genève http://genomics.frontiers-in-genetics.org

Plus en détail

altona altona RealStar Dengue RT-PCR Kit 2.0 always a drop ahead. 07/2015 altona Diagnostics GmbH Mörkenstr. 12 22767 Hamburg Germany

altona altona RealStar Dengue RT-PCR Kit 2.0 always a drop ahead. 07/2015 altona Diagnostics GmbH Mörkenstr. 12 22767 Hamburg Germany altona DIAGNOSTICS altona DIAGNOSTICS RealStar Dengue RT-PCR Kit 2.0 07/2015 altona Diagnostics GmbH Mörkenstr. 12 22767 Hamburg Germany phone +49 40 548 06 76-0 fax +49 40 548 06 76-10 e-mail info@altona-diagnostics.com

Plus en détail

Rapport final. Dossier n o 710.145. Rapport commandité par la SODIM

Rapport final. Dossier n o 710.145. Rapport commandité par la SODIM Bases physiologiques et génétiques de la croissance chez la mye commune, Mya arenaria Rapport final Dossier n o 710.145 Rapport commandité par la SODIM 1. Numéro de projet: Q-06-04-001 2. Titre du projet:

Plus en détail

Méthodes d études. Chapitre 8 : Professeur Joël LUNARDI. UE1 : Biochimie Biologie moléculaire

Méthodes d études. Chapitre 8 : Professeur Joël LUNARDI. UE1 : Biochimie Biologie moléculaire Chapitre 8 : UE1 : Biochimie Biologie moléculaire Méthodes d études Professeur Joël LUNARDI Année universitaire 2011/2012 Université Joseph Fourier de Grenoble - Tous droits réservés. Chapitre 8. 8. Méthodes

Plus en détail

Annales du Contrôle National de Qualité des Analyses de Biologie Médicale

Annales du Contrôle National de Qualité des Analyses de Biologie Médicale Annales du Contrôle National de Qualité des Analyses de Biologie Médicale ARN du virus de l hépatite C : ARN-VHC ARN-VHC 03VHC1 Novembre 2003 Edité : mars 2006 Annales ARN-VHC 03VHC1 1 / 8 ARN-VHC 03VHC1

Plus en détail