ED Biologie moléculaire. E. Turpin J. Lehmann-Che 5-6 novembre 2007

Dimension: px
Commencer à balayer dès la page:

Download "ED Biologie moléculaire. E. Turpin J. Lehmann-Che 5-6 novembre 2007"

Transcription

1 ED Biologie moléculaire E. Turpin J. Lehmann-Che 5-6 novembre 2007

2 PCR 1983: Kary Mullis Amplification in vitro par une méthode enzymatique d'un fragmentd'adn en présence de deux oligonucléotides spécifiques de la séquence à amplifier. Succession de 20 à 40 cycles thermiques: 1/dénaturation 2/hybridation des oligonucléotides 3/extension par une Taq DNA polymérase

3 Dénaturation (95 C) ADN cible :1 copie

4 Hybridation (50 à 60 C) Amorces ' 5' picomoles de chaque amorce: 10x10-12 x6.02x10 23 = 6.02x10 12 molécules de chaque primer

5 Extension (68 à72 C) ADN cible :2 copies : ADN Polymérase A C G T: 4 désoxyribonucléotides

6 5 3 Cycle 2 4 copies Amplicon Cycle 3 8 copies 3 5

7 Exercice: dessiner des amorces de PCR La séquence présentée est celle d une partie du gène de la β globine humaine comprenant le promoteur, l exon 1 et une partie de l intron 1. Sur cette séquence de 315 pb (paires de bases), le n 100 (A s ur le brin codant) correspond au début de la transcription, de 150 à 153 est l ATG initiateur de la traduction et le n 241 est le G de fin de l exo n 1. On veut amplifier par PCR le fragment commençant à 36 et se terminant à 302 suivant la numérotation indiquée au dessus du brin codant ) Quelles amorces seront utilisées? 2) Quels sont les différents constituants nécessaires à la réaction de PCR? 3) Quelles sont les différentes étapes d une réaction de PCR? A quoi serventelles? 4) Comment peut-on mettre en évidence le produit de PCR? 5) Quelle est la taille attendue pour le produit de PCR?

8 Région 5 du gène de la β globine humaine GTGGAGCCAC ACCCTAGGGT TGGCCAATCT ACTCCCAGGA GCAGGGAGGG CAGGAGCCAG GGCTGGGCAT AAAAGTCAGG GCAGAGCCAT CTATTGCTTA CATTTGCTTC TGACACAACT GTGTTCACTA GCAACCTCAA ACAGACACCA TGGTGCACCT GACTCCTGAG GAGAGGTCTG CCGTTACTGC CCTGTGGGGC AAGGTGAACG TGGATGAAGT TGGTGGTGAG GCCCTGGGCA GGTTGGTATC AAGGTTACAA GACAGGTTTA AGGAGACCAA TAGAAACTGG GCATGTGGAG 310 ACAGAGAAGA CTCTT - 3

9 Correction 1/ Oligonucléotides à commander: Sens: 5 AGGA GCAGGGAGGG CAGGAG 3 Anti sens: 5 GTCTCCACATGCCCAGTTTC 3 5 -AGGA GCAGGGAGGG CAGGAGCCAG 3 -TCCT CGTCCCTCCC GTCCTCGGTC GGCTGGGCAT AAAAGTCAGG GCAGAGCCAT CTATTGCTTA CATTTGCTTC TGACACAACT CCGACCCGTA TTTTCAGTCC CGTCTCGGTA GATAACGAAT GTAAACGAAG ACTGTGTTGA GTGTTCACTA GCAACCTCAA ACAGACACCA TGGTGCACCT GACTCCTGAG GAGAGGTCTG CACAAGTGAT CGTTGGAGTT TGTCTGTGGT ACCACGTGGA CTGAGGACTC CTCTTCAGAC CCGTTACTGC CCTGTGGGGC AAGGTGAACG TGGATGAAGT TGGTGGTGAG GCCCTGGGCA GGCAATGACG GGACACCCCG TTCCACTTGC ACCTACTTCA ACCACCACTC CGGGACCCGT GGTTGGTATC AAGGTTACAA GACAGGTTTA AGGAGACCAA TAGAAACTGG GCATGTGGAG CCAACCATAG TTCCAATGTT CTGTCCAAAT TCCTCTGGTT ATCTTTGACC CGTACACCTC AC - 3 TG - 5

10 Cinétique de la PCR Comparaison PCR en point final/ QPCR

11 Modes de détection du produit d amplification SYBR Green Sondes marquées Sondes TaqMan (sondes d hydrolyse) Sondes d hybridation

12 Principe du FRET Sonde intacte: Q absorbe l énergie de R qui n émet pas de fluorescence Lors élongation, activité 5 exonucléasique de la Taq hydrolyse la sonde Q ne peut plus absorber l énergie de R qui émet une fluorescence, proportionnelle à la quantité d ADN nouvellement synthétisée.

13 Comment passer d une fluorescence à un résultat? (1) 1/ Détermination des Ct Ct= intersection entre la courbe d amplification et la barre de seuil Bruit de fond Barre de seuil

14 Comment passer d une fluorescence à un résultat? (2) 2/ Comparaison des Ct Quantification absolue Quantification relative Résultat en nombre de copies Nécessite une courbe standard Résultat: rapport entre Ct ou par rapport au calibrateur Pas de standards mais -un contrôle endogène -un calibrateur

15 Quantification absolue (1) Y= (1+E) n X Qté de produits de PCR Qté initiale de la cible Nbre de cycles Y= 2 n X Doublement à chaque cycle

16 Quantification absolue (2)

17 Quantification relative (1) Contrôle endogène: reflet de la qté de matrice par puit doit être identique pour tous les échantillons analysés permet de normaliser les qtés de matrice indroduites Si on met 2x plus de matériel qu au départ?

18 Quantification relative (2) Les pentes des 2 gènes ne sont pas équivalentes Ici, le CT n est pas constant quelque soit la quantité de cdna À retenir: les PCR des 2 gènes (d intérêt et endogène) doivent avoir une efficience proche (donc une pente équivalente) pour pouvoir calculer des CT

19 Erreur en fonction de l Efficacité de la réaction PCR Efficacité 99% 95% 90% 85% 80% 75% 70% 1 1% 3% 5% 8% 11% 14% 18% 2 1% 5% 11% 17% 23% 31% 38% 3 2% 8% 17% 26% 37% 49% 63% 3,32 2% 9% 19% 30% 42% 56% 72% 4 2% 11% 23% 37% 52% 71% 92% ξ Ct 5 3% 13% 29% 48% 69% 95% 125% 6 3% 16% 36% 60% 88% 123% 165% 7 4% 19% 43% 73% 109% 155% 212% 8 4% 22% 51% 87% 132% 191% 267% 9 5% 26% 59% 102% 158% 233% 332% 10 5% 29% 67% 118% 187% 280% 408% Efficience de 85% pour une différence de 1 CT, l erreur est de 8%

20 Quantification de l ARNm d un gène: Q-RT-PCR Transcription Traduction ADN Gène ARN messager protéine Amplifications géniques Q PCR Amorces- sondes modifications d expression Q RT-PCR analyse du transcriptome (microarray) Présence et localisation Immunohistochimie Tissue array Anticorps Reverse transcription des ARNm cdna

21 Reverse trancription d'un ARN messager en ADN complémentaire 5 ARNm AAAAAA Hybride ARNm/ADNc 5 3 AAAAAA : Reverse transciptase Oligonucléotide: spécifique hexamers oligo(dt) 12-20

22 PCR après RT Hybride ARNm/ADNc 5 3 AAAAAA 3' 5 Dénaturation 5 3 AAAAAA Hybridation 3' 5 Extension 3' 5 PCR classique

23 Exemples d application de la Q PCR ou Q-RTPCR Détermination de la charge virale ex: HIV-1 en suivi du SIDA Détermination de l amplification d un gène QPCR ex: HER-2 dans le cancer du sein Détermination de la surexpression d un gène Q RT-PCR ex: ERα dans le cancer du sein

24 Exemples Exemple 1: -1/ Quel est l échantillon de cdna le plus concentré et combien de fois? - 2/ Quel organe exprime le plus d IL10 et combien de fois plus?

25 Correction 1 Question 1: -Le CT du gène endogène est un reflet de la quantité de cdna dans l échantillons Ici le 18S rrna est le gène endogène ou gène de ménage L échantillon le plus concentré est celui qui a le CT le plus petit donc le cerveau. -Il existe une différence de = 2 cycles entre les 2 échantillons 2 2 = 4 donc l échantillon du cerveau est 4 fois plus concentré que celui du foie Question 2: On compare les CT des 2 échantillons : l IL10 est plus exprimé dans le foie que dans le cerveau Il existe une différence de 6 CT entre les 2 échantillons donc l IL-10 est exprimé 64 fois plus dans le foie

26 Exemples Exemple 2: Une culture cellulaire subit un traitement par une drogue. On compare l expression d un gène au cours du temps après traitement. Quelle est l action de la drogue sur l expression du gène d intérêt, en fonction du temps? Expression en 2 - CT

27 Correction 2 On calcule les CT pour chaque temps: CTt 0 = =20 CTt 12 = =15 CTt 24 = 24-9 =15 CTt 48 = =20 On compare par rapport au temps T0: T12= CTt 12 - CTt 0 = =32 T24= 15-20= -5 T48= 20-20=0 Conclusion: la drogue active l expression du gène d intérêt d un facteur 32 entre 12 et 24h après administration. On constate un retour à l expression basale 48h après traitement.

ATELIER EPIGENETIQUE

ATELIER EPIGENETIQUE Juin 2012 ATELIER EPIGENETIQUE Utilisation de la Q-PCR pour analyser des données de ChIP ou de MeDIP Emmanuèle Mouchel-Vielh I. La PCR quantitative: principe et généralités II. Interprétation des résultats

Plus en détail

La PCR en temps réel frederic.gevaudant@bordeaux.inra.fr

La PCR en temps réel frederic.gevaudant@bordeaux.inra.fr La PCR en temps réel frederic.gevaudant@bordeaux.inra.fr INRA Centre de recherche de Bordeaux UMR Biologie du Fruit et Pathologie Historique 1985 : Invention par Kary Mullis de la technique de (PCR). 1991

Plus en détail

Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013

Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013 Sélectionner les propositions exactes Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013 QCM 1 La plupart des techniques de biologie moléculaire repose sur le principe de complémentarité

Plus en détail

Méthodes et techniques de la biologie du développement

Méthodes et techniques de la biologie du développement Méthodes et techniques de la biologie du développement 1. Etude de l expression des gènes : Détecter les transcrits et les protéines au cours de l ontogenèse l outil anticorps 1.1. La RT-PCR La réaction

Plus en détail

LA PCR QUANTITATIVE EN TEMPS REEL OU LA "TAQMAN"

LA PCR QUANTITATIVE EN TEMPS REEL OU LA TAQMAN LA PCR QUANTITATIVE EN TEMPS REEL OU LA "TAQMAN" I- Terminologie Le terme TaqMan est souvent utilisé par abus de langage pour désigner : - la technique de PCR quantitative par détection en temps réel de

Plus en détail

PRINCIPES THEORIQUES DE LA PCRq

PRINCIPES THEORIQUES DE LA PCRq PRINCIPES THEORIQUES DE LA PCRq Ce chapitre aborde les notions présentées rapidement dans l introduction (Ct, droite standard, principes de la quantification). Il détaille les différents formats de fluorescence

Plus en détail

Structure de l Opéron Tryptophane

Structure de l Opéron Tryptophane Régulation de la transcription (procaryote) Structure de l Opéron Tryptophane Opéron anabolique 5 gènes de structure nécessaires à la synthèse du tryptophane Trp Trp Trp Trp Trp 1 Régulation de la transcription

Plus en détail

Etude du transcriptome et du protéome en Neurooncologie

Etude du transcriptome et du protéome en Neurooncologie Etude du transcriptome et du protéome en Neurooncologie Principes, aspects pratiques, applications cliniques François Ducray Neurologie Mazarin, Unité Inserm U711 Groupe hospitalier Pitié-Salpêtrière Etude

Plus en détail

Mise en évidence des agents infectieux par Biologie Moléculaire

Mise en évidence des agents infectieux par Biologie Moléculaire UE de l agent infectieux à l hôte Janvier 2012 Mise en évidence des agents infectieux par Biologie Moléculaire Dr Isabelle GARRIGUE Laboratoire de Virologie Professeur FLEURY isabelle.garrigue@chu-bordeaux.fr

Plus en détail

La PCR en temps réel

La PCR en temps réel La PCR en temps réel Hôpital La Rabta Tunis 6 juin 2013 Dr Sabine Favre-Bonté Maître de Conférences, Université Claude Bernard Lyon 1 UMR CNRS 5557 Ecologie Microbienne Equipe Multi-résistance environnementale

Plus en détail

Apport de la PCR en temps réel en maladies infectieuses

Apport de la PCR en temps réel en maladies infectieuses Apport de la PCR en temps réel en maladies infectieuses Biologie moléculaire Amplification PCR I. Dénaturation ADN 95 C II. Hybridation t = Tm III. Extension t dépend de la polymérase employée PCR «classique»

Plus en détail

Le monde des bio-puces

Le monde des bio-puces Le monde des bio-puces D1 Le «dogme central» de la biologie moléculaire Transcription Epissage Traduction ADN ARNpm ARNm Protéines Génome Transcriptome Protéome D2 Puces à ADN Techniques de génomique fonctionnelle

Plus en détail

De l histoire naturelle de la QPCR à ses développements actuels

De l histoire naturelle de la QPCR à ses développements actuels De l histoire naturelle de la QPCR à ses développements actuels Jean-José Maoret Frédéric Martins Contact : GeT-TQ@genotoul.fr Plan de la présentation. 1- Introduction 2- Projet de QPCR : quelles étapes?

Plus en détail

Mise en évidence des agents infectieux par Biologie Moléculaire

Mise en évidence des agents infectieux par Biologie Moléculaire UE de l agent infectieux à l hôte Février 2015 Mise en évidence des agents infectieux par Biologie Moléculaire Dr Isabelle GARRIGUE UMR CNRS MFP Microbiologie Fondamentale et Pathogénicité isabelle.garrigue@chu-bordeaux.fr

Plus en détail

Introduction au PCR en. Par Philipe Lampron, M.Sc.

Introduction au PCR en. Par Philipe Lampron, M.Sc. Introduction au PCR en temps réel Par Philipe Lampron, M.Sc. Résumé Fondements du PCR en temps réel (qpcr) Théorie du PCR en temps réel Types de chimies Méthode de quantification Acquisition de résultats

Plus en détail

L Expression génique, la transcription et sa régulation : Approches expérimentales.

L Expression génique, la transcription et sa régulation : Approches expérimentales. L Expression génique, la transcription et sa régulation : Approches expérimentales. I - Généralités I - 1 : Expression et niveaux de régulations d un gène eucaryote ADN Transcrit primaire Transcription

Plus en détail

TD Révision BIO57. Connaissance et Technique du gène

TD Révision BIO57. Connaissance et Technique du gène TD Révision BIO57 Connaissance et Technique du gène Novembre 2007 Cécile BAUDOT cecile.baudot@medecine.univ-mrs.fr INSERM 910 «Génétique Médicale et Génomique Fonctionnelle» Maladies Neuromusculaires Le

Plus en détail

Principe des études moléculaires en génétique médicale Méthodes d analyse des microlésions du génome

Principe des études moléculaires en génétique médicale Méthodes d analyse des microlésions du génome Mercredi 23 Octobre LECLERCQ Barbara L2 GM Pr Krahn 10 pages Principe des études moléculaires en génétique médicale Méthodes d analyse des microlésions du génome Plan A. Introduction B. Techniques courantes

Plus en détail

Les différentes stratégies de quantification :

Les différentes stratégies de quantification : Les différentes stratégies de quantification : Ce chapitre présente les 2 principales stratégies de quantification relative utilisée classiquement : la méthode des droites standards et celle des Ct. Les

Plus en détail

POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA

POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA Amplification spécifique Détection spécifique Clonage dans des vecteurs Amplification in vitro PCR Hybridation moléculaire - hôte cellulaire

Plus en détail

Licence-Master Bioinformatique Contrôle continu 06/03/06. Correction

Licence-Master Bioinformatique Contrôle continu 06/03/06. Correction Licence-Master Bioinformatique Contrôle continu 06/03/06 Correction -«Vraies» questions de cours -«fausses» questions de cours: questions pour voir si pouviez imaginer une réponse crédible qui n était

Plus en détail

L AMPLIFICATION GÉNIQUE PAR PCR. (Polymérase Chain Reaction)

L AMPLIFICATION GÉNIQUE PAR PCR. (Polymérase Chain Reaction) L AMPLIFICATION GÉNIQUE PAR PCR (Polymérase Chain Reaction) ATELIER DE FORMATION SUR LE DIAGNOSTIC DE LA FIEVRE APHTEUSE 21 mai 2012 Corinne SAILLEAU Corinne.sailleau@anses.fr Agence Nationale de Sécurité

Plus en détail

Guide sur le PCR en temps réel (qpcr)

Guide sur le PCR en temps réel (qpcr) Guide sur le PCR en temps réel (qpcr) Un service complet est offert par la plateforme de génomique de l IRIC pour le qpcr incluant l analyse de votre ARN, la préparation de vos cdna, le design des essais,

Plus en détail

Université du Québec à Montréal

Université du Québec à Montréal RECUEIL D EXERCICES DE BICHIMIE 6. Les acides nucléiques 6.2. Réplication, transcription et traduction P P P CH 2 H N H N N NH NH 2 Université du Québec à Montréal 6.2. Réplication, transcription et traduction

Plus en détail

Tumeurs du sein triple négatif: Biologie moléculaire et projets de recherche

Tumeurs du sein triple négatif: Biologie moléculaire et projets de recherche 64 ème réunion du GERM Tumeurs du sein triple négatif: Biologie moléculaire et projets de recherche Tumeurs du sein triple négatif (TN) 12-17% des cancers du sein Contexte familial porteuses des mutations

Plus en détail

Biologie Moléculaire & Génie Génétique. 6GT SG&SB FWB A.R. d Esneux Maître de Stage: Sylvie Bossrez Stagiaire: Pierre LECOCQ

Biologie Moléculaire & Génie Génétique. 6GT SG&SB FWB A.R. d Esneux Maître de Stage: Sylvie Bossrez Stagiaire: Pierre LECOCQ Biologie Moléculaire & Génie Génétique 6GT SG&SB FWB A.R. d sneux Maître de Stage: Sylvie Bossrez Stagiaire: Pierre LCOCQ 1 Introduction & Plan du cours N Les leçons proposées dans ce document s adressent

Plus en détail

PCR (POLYMERASE CHAIN REACTION)

PCR (POLYMERASE CHAIN REACTION) PCR (POLYMERASE CHAIN REACTION) Amplification des acides nucléiques PCR RT-PCR Et leurs applications PCR en temps réel La PCR : une révolution technologique en biologie moléculaire APPLICATIONS : - Médecine

Plus en détail

Quelques notions de génomique fonctionnelle: l exemple des puces à ADN

Quelques notions de génomique fonctionnelle: l exemple des puces à ADN Quelques notions de génomique fonctionnelle: l exemple des puces à ADN Frédéric Devaux Laboratoire de génétique moléculaire Ecole Normale Supérieure Le «dogme central» de la biologie moléculaire Transcription

Plus en détail

PRINCIPALES TECHNIQUES UTILISEES EN GENOMIQUE

PRINCIPALES TECHNIQUES UTILISEES EN GENOMIQUE PRINCIPALES TECHNIQUES UTILISEES EN GENOMIQUE Définitions généralités Quelques chiffres 46 chromosomes 22 paires d autosomes (n=44) 1 paire de gonosomes (n=2) : XX/F et XY/H 300 bandes cytogénétiques =

Plus en détail

Techniques de biologie moléculaire utilisées dans un cadre diagnostique. A. CALENDER 7.11 couvrant l ensemble des techniques

Techniques de biologie moléculaire utilisées dans un cadre diagnostique. A. CALENDER 7.11 couvrant l ensemble des techniques Techniques de biologie moléculaire utilisées dans un cadre diagnostique A. CALENDER 7.11 couvrant l ensemble des techniques Introduction Diagnostic clinique Confirmation par l analyse génétique Traitement

Plus en détail

Les outils du génie génétique.

Les outils du génie génétique. Les outils du génie génétique. I\ Les enzymes. On va se servir des enzymes pour couper, coller et synthétiser des acides nucléiques. A\ Les polymérases. Toutes les polymérases agissent de 5 vers 3. En

Plus en détail

8.3.3 Réactifs. La polymérase catalyse la synthèse de brins complémentaires d ADN.

8.3.3 Réactifs. La polymérase catalyse la synthèse de brins complémentaires d ADN. 8.3.3 Réactifs 1. AD polymérase: La polymérase catalyse la synthèse de brins complémentaires d AD. Des polymérases qui sont résistantes à la chaleur sont utilisées, telles que la Taq polymérase (Thermus

Plus en détail

Fanny Coulpier. http://www.transcriptome.ens.fr/sgdb/

Fanny Coulpier. http://www.transcriptome.ens.fr/sgdb/ Fanny Coulpier http://www.transcriptome.ens.fr/sgdb/ Un peu d histoire 1953 : Découverte de la structure en double hélice de l ADN par James Dewey Watson, (prix Nobel de physiologie ou médecine en 1962).

Plus en détail

Le marquage moléculaire

Le marquage moléculaire Le marquage moléculaire Le marquage moléculaire regroupe un ensemble de techniques révélant des différences de séquences d (acide désoxyribonucléique) entre individus. Les marqueurs moléculaires permettent

Plus en détail

Cahier de texte de la classe 1 ère 4 - SVT

Cahier de texte de la classe 1 ère 4 - SVT Cahier de texte de la classe 1 ère 4 - SVT DATE SEQUENCE lundi 12 : revoir la fiche méthodologique «utiliser le microscope optique» (disponible sur le site du lycée) Lundi 12 1 er contact avec les élèves.

Plus en détail

Institut de Génomique. olaso@cng.fr

Institut de Génomique. olaso@cng.fr Institut de Génomique PCR quantitative : état des lieux... (de la théorie à la pratique, MIQE, CQ et stratégie de normalisation) olaso@cng.fr Microarray data qpcr data? Règles générales pour la présentation

Plus en détail

Polytech UEF1. BONCOMPAGNI Éric MCU - Univ. Nice Sophia Antipolis Site WEB : sites.unice.fr/eb. Outils moléculaires pour l analyse des génomes

Polytech UEF1. BONCOMPAGNI Éric MCU - Univ. Nice Sophia Antipolis Site WEB : sites.unice.fr/eb. Outils moléculaires pour l analyse des génomes Polytech UEF1 BONCOMPAGNI Éric MCU - Univ. Nice Sophia Antipolis Site WEB : sites.unice.fr/eb Outils moléculaires pour l analyse des génomes Pourquoi la génétique moléculaire? La génétique formelle renseigne

Plus en détail

Projet I. Objectifs. Vérifier la carte de restriction d une insertion d ADN. Cartographie des plasmides inconnus

Projet I. Objectifs. Vérifier la carte de restriction d une insertion d ADN. Cartographie des plasmides inconnus Projet I Vérifier la carte de restriction d une insertion d ADN Objectifs Déterminer quel gène vous avez (Bioinfo) Générer une carte théorique (Bioinfo) Vérifier expérimentalement la carte Déterminer l

Plus en détail

Qu est-ce qu HER2 et comment le détecter? Pr Frédérique Penault Llorca Pathologiste Centre Jean Perrin, Clermont-Ferrand

Qu est-ce qu HER2 et comment le détecter? Pr Frédérique Penault Llorca Pathologiste Centre Jean Perrin, Clermont-Ferrand Qu est-ce qu HER2 et comment le détecter? Pr Frédérique Penault Llorca Pathologiste Centre Jean Perrin, Clermont-Ferrand Qu est-ce que HER2? HER2 est un récepteur. Il signifie human epidermal growth factor

Plus en détail

Quoi faire avec des résultats de qpcr

Quoi faire avec des résultats de qpcr Quoi faire avec des résultats de qpcr Ct=22 Ct=24 Qu est-ce que le qpcr mesure? Si vous mesurez l expression d un gène, le qpcr vous dira combien il y a d un ARNm spécifique dans vos échantillons. Vous

Plus en détail

Techniques moléculaires non morphologiques. Dr S Poglio Année 2015-2016

Techniques moléculaires non morphologiques. Dr S Poglio Année 2015-2016 Techniques moléculaires non morphologiques Dr S Poglio Année 2015-2016 Généralités Techniques d Analyse : -Au niveau Tissulaire : IHC, macroscopie -Au niveau Cellulaire : FISH, culture, microscopie, cytométrie

Plus en détail

P.C.R. POLYMERASE CHAIN REACTION ou AMPLIFICATION PAR POLYMERISATION EN CHAÎNE

P.C.R. POLYMERASE CHAIN REACTION ou AMPLIFICATION PAR POLYMERISATION EN CHAÎNE P.C.R. POLYMERASE CHAIN REACTION ou AMPLIFICATION PAR POLYMERISATION EN CHAÎNE P.C.R.: Méthode rapide d'amplification d'une séquence déterminée d'a.d.n. à partir d'une matrice. Elle permet d'obtenir plusieurs

Plus en détail

Techniques d étude des Gènes et de leur Régulation. A. Galmiche, 2011-2012

Techniques d étude des Gènes et de leur Régulation. A. Galmiche, 2011-2012 Techniques d étude des Gènes et de leur Régulation A. Galmiche, 2011-2012 1. Introduction et techniques de base 2. Détection des acides nucléiques et mesure de l expression des gènes: Hybridations PCR

Plus en détail

Méthodes globales et ciblées d analyse du transcriptome tumoral

Méthodes globales et ciblées d analyse du transcriptome tumoral UER Cytogénétique et Biologie Moléculaire des Tumeurs Université Victor Segalen Année universitaire 2013-2014 Méthodes globales et ciblées d analyse du transcriptome tumoral L. ANDRIQUE/D. CAPPELLEN EA

Plus en détail

TP de Biochimie Groupe 4 Forestier Michèle 25.05.2010 Fournier Coralie Freyre Christophe Manipulation d ADN

TP de Biochimie Groupe 4 Forestier Michèle 25.05.2010 Fournier Coralie Freyre Christophe Manipulation d ADN MANIPULATION D ADN Clonage du gène «venus» dans des plasmides et expression de celui-ci chez les bactéries E.Coli. Assistants: U. Loizides M. Umebayashi C. Gehin - 1 - 1. Résumé Lors de notre expérience,

Plus en détail

Université Bordeaux Segalen - PACES 2011-2012 ED UE9s Mars 2012

Université Bordeaux Segalen - PACES 2011-2012 ED UE9s Mars 2012 Sélectionner les propositions exactes Université Bordeaux Segalen - PACES 2011-2012 ED UE9s Mars 2012 QCM 1. La température de fusion (Tm) d une molécule d ADN : A. est mise en évidence par l augmentation

Plus en détail

8. Amplification et séquençage des acides nucléiques

8. Amplification et séquençage des acides nucléiques 8. Amplification et séquençage des acides nucléiques ADN chromosomique, plasmides (ADN bactérienne), ARN messager Rupture cellulaire Isolation et purification des acides nucléiques Concentration et amplification

Plus en détail

Introduction à la Génomique. 1. Les outils de base. 1. Les outils de base 2. Les techniques d hybridation

Introduction à la Génomique. 1. Les outils de base. 1. Les outils de base 2. Les techniques d hybridation Introduction à la Génomique 1. Les outils de base 2. Les techniques d hybridation Southern blot et dérivés, micro arrays 3. La PCR 4. Les marqueurs polymorphes 5. Le clonage positionnel 1. Les outils de

Plus en détail

1. PRINCIPES DE BASE DE LA BIOLOGIE MOLECULAIRE

1. PRINCIPES DE BASE DE LA BIOLOGIE MOLECULAIRE Liste d articles pour exercices EPSC à télécharger! BiolMol 2-1 1. PRINCIPES DE BASE DE LA BIOLOGIE MOLECULAIRE 1.1. Les acides nucléiques 1.1.1. Structure et expression des acides nucléiques 1.1.2. Réplication

Plus en détail

Principales techniques utilisées en génie génétique Ces différentes techniques peuvent également se combiner entre elles. Séquençage de l ADN

Principales techniques utilisées en génie génétique Ces différentes techniques peuvent également se combiner entre elles. Séquençage de l ADN Principales techniques utilisées en génie génétique Ces différentes techniques peuvent également se combiner entre elles Séquençage de l ADN 1- Un brin complémentaire de l ADN à séquencer est fabriqué

Plus en détail

3. Biotechnologie de l ADN

3. Biotechnologie de l ADN 3. Biotechnologie de l ADN 3.1. Technologie de l ADN recombinant 3.1.1. Isolation d ADN et d ARN 3.1.2. Fragmentation de l ADN (les Endonucléases) 3.1.3. Analyse d ADN sur d agarose et d acrylamide 3.1.4.

Plus en détail

Génie génétique. Définition : Outils nécessaires : Techniques utilisées : Application du génie génétique : - Production de protéines

Génie génétique. Définition : Outils nécessaires : Techniques utilisées : Application du génie génétique : - Production de protéines Génie génétique Définition : Ensemble de méthodes d investigation et d expérimentation sur les gènes. Outils nécessaires : ADN recombinant, enzyme de restriction, vecteur, banque ADNc, sonde nucléique...

Plus en détail

TD de Biochimie 4 : Coloration.

TD de Biochimie 4 : Coloration. TD de Biochimie 4 : Coloration. Synthèse de l expérience 2 Les questions posées durant l expérience 2 Exposé sur les méthodes de coloration des molécules : Générique Spécifique Autres Questions Pourquoi

Plus en détail

Biologie Moléculaire 6 GT SG FWB Leçon n 5

Biologie Moléculaire 6 GT SG FWB Leçon n 5 Biologie Moléculaire 6 GT SG FWB Leçon n 5 Tests de paternité (fin labo électrophorèse) Un test de paternité consiste à analyser l'adn de deux personnes dans le but d'établir un lien de parenté génétique.

Plus en détail

Licence d Informatique Année 2001-2002 Option: Introduction à la biologie moléculaire. LA P.C.R. Polymerase Chain Reaction

Licence d Informatique Année 2001-2002 Option: Introduction à la biologie moléculaire. LA P.C.R. Polymerase Chain Reaction Licence d Informatique Année 2001-2002 Option: Introduction à la biologie moléculaire LA P.C.R. Polymerase Chain Reaction "chercher une aiguille dans une meule de foin"? Chercher à repérer un gène particulier

Plus en détail

DEVOIR A LA MAISON. BMGG (temps recommandé : 2H00)

DEVOIR A LA MAISON. BMGG (temps recommandé : 2H00) Pour jeudi 12/02/2014 DEVOIR A LA MAISON BMGG (temps recommandé : 2H00) Calculatrice non autorisée Dictionnaire anglais/français autorisé. Clonage et PCR En 1983, Kary Mullis conçut l'idée de la réaction

Plus en détail

Technologie de l ADN recombinant. Complément de cours sur: «Les Méthodes d Etude de la Cellule»

Technologie de l ADN recombinant. Complément de cours sur: «Les Méthodes d Etude de la Cellule» Technologie de l ADN recombinant Complément de cours sur: «Les Méthodes d Etude de la Cellule» 1 Les techniques de l ADN Recombinant But: isoler des fragments d ADN de génomes complexes et les recombiner

Plus en détail

AVANT PROPOS. Il faut aussi bien connaître les méthodes de l embryologie moléculaire et savoir les utiliser.

AVANT PROPOS. Il faut aussi bien connaître les méthodes de l embryologie moléculaire et savoir les utiliser. AVERTISSEMENT Au fil de l ouvrage, les termes ou les notions importantes développés dans le livre de cours Bases cellulaires et moléculaires du développement (Ellipses, 2007), sont notés (I) ou (I, p.x).

Plus en détail

Q PCR sur LC480 Roche

Q PCR sur LC480 Roche Q PCR sur LC480 Roche!! NE JAMAIS LAISSER DE PLAQUE DANS L APPAREIL!! Généralités : lampe xénon à arc : s éteint 30 min après chaque run durée d un run : plq 96p = 1h10 environ plq 384p = 40 50 min environ

Plus en détail

Nouvelles mutations RAS

Nouvelles mutations RAS Nouvelles mutations RAS dans les cancers colo-rectaux Rappel RAS : interrupteur de plusieurs voies de signalisation ras MUTATION RAS /ras activé en permanence : signalisation continue de la prolifération

Plus en détail

Cahier de texte de la classe 1 ère 3 - SVT

Cahier de texte de la classe 1 ère 3 - SVT Cahier de texte de la classe 1 ère 3 - SVT DATE SEQUENCE jeudi 8 : revoir la fiche méthodologique «utiliser le microscope optique» (disponible sur le site du lycée) Jeudi 8 1 er contact avec les élèves.

Plus en détail

Les virus dans les aliments : un nouveau défi pour les laboratoires de microbiologie

Les virus dans les aliments : un nouveau défi pour les laboratoires de microbiologie : un nouveau défi pour les laboratoires de microbiologie Véronique ZULIANI, Institut de la Filière Porcine Jean Christophe Augustin, ENVA, ASA Qu est ce qu un virus? Microorganisme de 15 à 40 nm Environ

Plus en détail

Infections aiguës respiratoires

Infections aiguës respiratoires Infections aiguës respiratoires Apport de la biologie moléculaire Marie-Claude Bernard D I symposium infections aiguës respiratoires 29/03/05 - p.1 Le diagnostic Culture EIA ICT (immunochromato) Immuno

Plus en détail

THEME 1 A EXPRESSION, STABILITE ET VARIATION DU PATRIMOINE GENETIQUE

THEME 1 A EXPRESSION, STABILITE ET VARIATION DU PATRIMOINE GENETIQUE THEME 1 A EXPRESSION, STABILITE ET VARIATION DU PATRIMOINE GENETIQUE CHAPITRE 3 L EXPRESSION DU PATRIMOINE GENETIQUE I. LA RELATION GENES-PROTEINES Les protéines interviennent dans le fonctionnement d

Plus en détail

LES ORGANISMES GENETIQUEMENT MODIFIES

LES ORGANISMES GENETIQUEMENT MODIFIES LES ORGANISMES GENETIQUEMENT MODIFIES Présentation par Frédéric Debode MINISTÈRE DE LA RÉGION WALLONNE Département Qualité des Productions agricoles Laboratoire de biologie moléculaire -détection des OGM-

Plus en détail

Jean-Louis Bergé-Lefranc

Jean-Louis Bergé-Lefranc Apport du séquençage du génome humain à la toxicologie: Toxicogénomique Jean-Louis Bergé-Lefranc QuickTime et un décompresseur TIFF (LZW) sont requis pour visionner cette image. QuickTime et un décompresseur

Plus en détail

exemple de végétaux exposés au benzène atmosphérique Sylvain Dumez sylvain.dumez@univ-lille2.fr

exemple de végétaux exposés au benzène atmosphérique Sylvain Dumez sylvain.dumez@univ-lille2.fr Approches écotoxicogénomiques et application à la biosurveillance exemple de végétaux exposés au benzène atmosphérique Sylvain Dumez sylvain.dumez@univ-lille2.fr Laboratoire des Sciences végétales et fongiques,

Plus en détail

Biomarqueurs en Cancérologie

Biomarqueurs en Cancérologie Biomarqueurs en Cancérologie Définition, détermination, usage Biomarqueurs et Cancer: définition Anomalie(s) quantitative(s) ou qualitative(s) Indicative(s) ou caractéristique(s) d un cancer ou de certaines

Plus en détail

Collège Notre Dame de Jamhour. THEME 1A : Expression, stabilité et variation du patrimoine génétique

Collège Notre Dame de Jamhour. THEME 1A : Expression, stabilité et variation du patrimoine génétique Collège Notre Dame de Jamhour Classe : 1 ère S THEME 1A : Expression, stabilité et variation du patrimoine génétique Chapitre 3 : L expression du patrimoine génétique TD- 5 : La protéosynthèse, un processus

Plus en détail

Ingénierie des protéines

Ingénierie des protéines Ingénierie des protéines Stéphane Delbecq EA 4558 Vaccination antiparasitaire Laboratoire de Biologie Cellulaire et Moléculaire Faculté de Pharmacie - Montpellier Rappel: transcription et traduction Universalité

Plus en détail

METHODOLOGIE. Southern, Northern,, Western, PCR,Séquence.

METHODOLOGIE. Southern, Northern,, Western, PCR,Séquence. METHODOLOGIE Southern, Northern,, Western, PCR,Séquence. Les grandes étapes * Transciptase Reverse : 1970 (Temin et Baltimore) * Enzymes de Restriction : 1970 (Smith et Nathan) * Vecteurs recombinants

Plus en détail

Chapitre 10 L isolement et la manipulation de gènes. Injection d ADN étranger dans une cellule animale

Chapitre 10 L isolement et la manipulation de gènes. Injection d ADN étranger dans une cellule animale Chapitre 10 L isolement et la manipulation de gènes Injection d ADN étranger dans une cellule animale Comment amplifier un gène d intérêt? Amplification in vivo à l aide du clonage d ADN L ensemble formé

Plus en détail

Identification et détection des virus. A) Détection symptomatologique

Identification et détection des virus. A) Détection symptomatologique Identification et détection des virus La détection et l'identification des virus font appel à différentes méthodes. Ces méthodes se caractérisent par leur spécificité et leur sensibilité. On peut citer

Plus en détail

La synthèse des protéines transcription code génétique traduction

La synthèse des protéines transcription code génétique traduction CEC André-Chavanne BIO 3 OS La synthèse des protéines transcription code génétique traduction I. La «Transcription» : de l ADN à l ARNm. L'adresse suivante permet d accéder à une ANIMATION sur la TRANSCRIPTION.

Plus en détail

Les microarrays: technologie pour interroger le génome

Les microarrays: technologie pour interroger le génome Les microarrays: technologie pour interroger le génome Patrick DESCOMBES patrick.descombes@frontiers-in-genetics.org Plate forme génomique NCCR Frontiers in Genetics Université de Genève http://genomics.frontiers-in-genetics.org

Plus en détail

Single Molecule Real Time (SMRT) Sequencing : PacBio RS II

Single Molecule Real Time (SMRT) Sequencing : PacBio RS II Single Molecule Real Time (SMRT) Sequencing : PacBio RS II Input sample Genome DNA, Amplicons, cdna Input sample amounts according to the protocols (10ng-10µg) High Input sample quality (integrity and

Plus en détail

Méthodes d études. Chapitre 8 : Professeur Joël LUNARDI. UE1 : Biochimie Biologie moléculaire

Méthodes d études. Chapitre 8 : Professeur Joël LUNARDI. UE1 : Biochimie Biologie moléculaire Chapitre 8 : UE1 : Biochimie Biologie moléculaire Méthodes d études Professeur Joël LUNARDI Année universitaire 2011/2012 Université Joseph Fourier de Grenoble - Tous droits réservés. Chapitre 8. 8. Méthodes

Plus en détail

HyDRIMZ. Développement de Techniques et Analyse Moléculaire de la Biodiversité

HyDRIMZ. Développement de Techniques et Analyse Moléculaire de la Biodiversité Développement de Techniques et Analyse Moléculaire de la Biodiversité HyDRIMZ DENITEXPRESS a Influence de faibles concentrations en nanoparticules de CuO sur l expression des gènes de la dénitrification

Plus en détail

L'hybridation fluorescente (FISH)

L'hybridation fluorescente (FISH) L'hybridation fluorescente (FISH) fluorescent in situ hybridization DR Thierry PALUKU THEY-THEY LABO GENETIQUE ET PATHO MOLECULAIRE JUIN 2007 Définition repérer la présence d'anomalies chromosomiques par

Plus en détail

Lettres: A, T, G, C. Mots: à 3 lettres (codons) Phrase: gène (information pour synthétiser une protéine). Ponctuation

Lettres: A, T, G, C. Mots: à 3 lettres (codons) Phrase: gène (information pour synthétiser une protéine). Ponctuation 2- Les molécules d ADN constituent le génome 2-1 La séquence d ADN représente l information génétique Lettres: A, T, G, C Mots: à 3 lettres (codons) Phrase: gène (information pour synthétiser une protéine).

Plus en détail

Quelques termes-clef de biologie moléculaire et leur définition

Quelques termes-clef de biologie moléculaire et leur définition Acide aminé (AA) Quelques termes-clef de biologie moléculaire et leur définition Isabelle Quinkal INRIA Rhône-Alpes Septembre 2003 Petite molécule dont l enchaînement compose les protéines - on dit qu

Plus en détail

Outils de génie génétique 1.TERMINOLOGIE ENZYMES UTILISÉS SONDES MOLECULAIRE ET HYBRIDATION MOLECULAIRE

Outils de génie génétique 1.TERMINOLOGIE ENZYMES UTILISÉS SONDES MOLECULAIRE ET HYBRIDATION MOLECULAIRE Outils de génie génétique 1.TERMINOLOGIE ENZYMES UTILISÉS SONDES MOLECULAIRE ET HYBRIDATION MOLECULAIRE 1 Terminologie ADN recombinant : combinaison de deux molécules d ADN appartenant à deux espèces différentes;

Plus en détail

CHAPITRE III: Le Clonage

CHAPITRE III: Le Clonage BIOLOGIE MOLECULAIRE CHAPITRE III: Le Clonage I) Définition: Cloner un fragment d'adn consiste à: isoler physiquement ce fragment. en augmenter le nombre de copie (cf: amplification) II) Principe: Le clonage

Plus en détail

Pathologies et génétique moléculaire

Pathologies et génétique moléculaire Biochimie - Biologie moléculaire Pathologies et génétique moléculaire Julien Fauré Institut de Formation en Soins Infirmiers 1 ère Année Année universitaire 2014-2015 Plan Les outils de la génétique moléculaire

Plus en détail

Méthodes d études. Chapitre 8 : Professeur Joël LUNARDI. UE1 : Biochimie Biologie moléculaire

Méthodes d études. Chapitre 8 : Professeur Joël LUNARDI. UE1 : Biochimie Biologie moléculaire Chapitre 8 : UE1 : Biochimie Biologie moléculaire Méthodes d études Professeur Joël LUNARDI Année universitaire 2010/2011 Université Joseph Fourier de Grenoble - Tous droits réservés. Chapitre 8. 8. Méthodes

Plus en détail

Réaction en chaîne par polymérase

Réaction en chaîne par polymérase Page 1 sur 13 Réaction en chaîne par polymérase Un article de Wikipédia, l'encyclopédie libre. La réaction en chaîne par polymérase (PCR en anglais pour Polymerase Chain Reaction), est une méthode de biologie

Plus en détail

Série : STL Spécialité biotechnologies SESSION 2014 BACCALAURÉAT TECHNOLOGIQUE

Série : STL Spécialité biotechnologies SESSION 2014 BACCALAURÉAT TECHNOLOGIQUE BACCALAURÉAT TECHNLGIQUE Série : STL Spécialité biotechnologies SESSIN 2014 CBSV : sous épreuve coefficient 4 Biotechnologies : sous épreuve coefficient 4 Durée totale de l épreuve: 4 heures Les sujets

Plus en détail

Clonage de Vénus et transformation de E.Coli.

Clonage de Vénus et transformation de E.Coli. Clonage de Vénus et transformation de E.Coli. Samueal Joseph, Romain Laverrière, Elias Laudato, Noé Mage Assisstants : Gisele Dewhurst, Charlotte Gehin, Miwa Umebayashi Résumé [1] L expérience consiste

Plus en détail

Taq'Ozyme Purple Mix MANUEL D UTILISATION

Taq'Ozyme Purple Mix MANUEL D UTILISATION Taq'Ozyme Purple Mix OZYA003-40 - 40 réactions OZYA003-200 - 200 réactions (avec supplément de MgCl 2 ) OZYA003-200XL - 200 réactions (avec supplément de MgCl 2 ) OZYA003-1000 - 1000 réactions (avec supplément

Plus en détail

Biologie Moléculaire (UE BI302) TD de Biologie Moléculaire (Procaryote) Année 2012/2013

Biologie Moléculaire (UE BI302) TD de Biologie Moléculaire (Procaryote) Année 2012/2013 Biologie Moléculaire (UE BI302) TD de Biologie Moléculaire (Procaryote) Année 2012/2013 M r Joshua Armitano Mr Thibault Sana M me Cécile Jourlin M me Amel Latifi M me Sandrine Pages Problème 1 : Amplification/clonage

Plus en détail

Séance génome : Explication PCR et électrophorèse

Séance génome : Explication PCR et électrophorèse Séance génome : Explication PCR et électrophorèse La PCR (Polymérase Chain Reaction) est une technique qui permet de démultiplier en de très nombreuses quantités une séquence de nucléotides parmi l ensemble

Plus en détail

Approche pratique de la transgénèse :

Approche pratique de la transgénèse : Approche pratique de la transgénèse : Recherche et analyse fine d une modification génétique dans le génome murin octobre 2006 1) 2) 3) 7) 8) 9) 10) 11) 12) 13) 14) Plan / Introduction Extraction et Préparation

Plus en détail

Imagerie de l expression génique

Imagerie de l expression génique Franck Couillaud MODULE NATIONAL D'ENSEIGNEMENT DE TECHNOLOGIES AVANCEES Imagerie de l expression génique Université de Bordeaux Résonnance Magnétique des Systèmes Biologiques CNRS UMR 5536 et des thérapies

Plus en détail

Expression des gènes Comparatif entre procaryotes et eucaryotes

Expression des gènes Comparatif entre procaryotes et eucaryotes Comparaison procaryotes/ 2TSbc Expression des gènes Comparatif entre procaryotes et eucaryotes La majeure partie des connaissances de biologie moléculaire a d'abord débuté par l'étude des phénomènes chez

Plus en détail

Taq Ozyme (Nouvelle Formulation) ADN polymérase thermostable

Taq Ozyme (Nouvelle Formulation) ADN polymérase thermostable Taq Ozyme (Nouvelle Formulation) OZYA001-1000 - 1000 unités OZYA001-5000 - 5000 unités OZYA001-1000D - 1000 unités + dntp Premix - 4x10 mm Stockage et stabilité : Taq Ozyme : 2 ans à -20 C dntp Premix

Plus en détail

LA TRANSCRIPTION. Introduction. I. Modalité générale de la transcription. II. Transcription chez les Procaryotes

LA TRANSCRIPTION. Introduction. I. Modalité générale de la transcription. II. Transcription chez les Procaryotes LA TRANSCRIPTION Introduction I. Modalité générale de la transcription II. Transcription chez les Procaryotes 1. L'ARN polymérase 2. Etapes de la transcription a. Initiation b. Elongation c. Terminaison

Plus en détail

UE oncologie-cytogénétique. Cours n 4 06/12/12

UE oncologie-cytogénétique. Cours n 4 06/12/12 1 e PARTIE : MÉTHODES DE BIOLOGIE MOLÉCULAIRE ADAPTÉES À LA GÉNOMIQUE DES TUMEURS SOLIDES Par Pr Laurence Bianchini (La précision de diapos entre parenthèse concerne des diapos plutôt inutiles, les diapos

Plus en détail

BACCALAURÉAT TECHNOLOGIQUE

BACCALAURÉAT TECHNOLOGIQUE BACCALAURÉAT TECHNOLOGIQUE Série : Sciences et Technologies de Laboratoire Spécialité : Biotechnologies SESSION 2015 Sous-épreuve écrite de Biotechnologies Lundi 22 juin 2015 Coefficient de la sous-épreuve

Plus en détail

Chapitre 2. La synthèse protéique : la relation entre le génotype et le phénotype.

Chapitre 2. La synthèse protéique : la relation entre le génotype et le phénotype. Chapitre 2. La synthèse protéique : la relation entre le génotype et le phénotype. Les maladies génétiques comme la drépanocytose ou l'albinisme sont liées à des modifications du génotype des individus

Plus en détail

Professeur Joël LUNARDI

Professeur Joël LUNARDI Biochimie - Biologie moléculaire Chapitre 3 : La réplication du matériel génétique Professeur Joël LUNARDI MED@TICE PCEM1 - Année 2006/2007 Faculté de Médecine de Grenoble - Tous droits réservés. Chapitre

Plus en détail