La bioinformatique à Jouy-en-Josas La bioinformatique dans GABI

Dimension: px
Commencer à balayer dès la page:

Download "La bioinformatique à Jouy-en-Josas La bioinformatique dans GABI"

Transcription

1 La bioinformatique à Jouy-en-Josas La bioinformatique dans GABI Centre de Jouy-en-Josas 5 février 2015

2 SOMMAIRE Unité GABI : Génétique Animale et Biologie Intégrative Présentation Générale Projets marquants 2014 La bioinformatique dans GABI Par qui? Pourquoi? Comment? Besoins? Maria Bernard/ Présenation unité GABI.02 5 février 2015

3 _01 Génétique Animale et Biologie Intégrative.03

4 GABI: présentation générale Direction : Claire Rogel Gaillard TGU d environ 200 personnes appartenant INRA AgroParis Tech CEA ENVA (Ecole Nationale des Vétérinaires de Maison Alfort) 8 équipes de recherche et 1 équipe plateformes: Plateformes histologie, microscopie) BIGE (Biologie Intégrative et Génétique Equine) G2B (Génétique et Génomique Bovine) GenAqua (Génétique et Aquaculture) GF-PGM (Génomique Fonctionnelle et Physiologie de la Glande Mammaire) GIS (Génomique, Immunité, Santé) LGS (Lait Génome Santé) MoDiT (Modèles animaux et Différentiation Tissulaire) PSGEN (Populations, Statistiques et Génomes) Les thématiques de recherche visent à: à étudier la structure et le fonctionnement des génomes animaux, à comprendre le déterminisme de caractères complexes (immunité et santé, qualité des produits, différenciation et croissance, adaptation) et à proposer des stratégies de gestion, d'évaluation, d amélioration et de valorisation des ressources génétiques animales contribuant au développement de systèmes de production innovants, compétitifs et durables..04

5 G2B Projet «1000 génomes bovins» (collab MoDiT) Evo-devo : pourquoi les bovins n'ont que deux doigts LGS (collab Plateforme) Microgenomics 2014 ou l analyse du génome et de son expression à l échelle tissulaire et cellulaire Comparaison de cinq sources d'arn différents pour analyser le transcriptome mammaire bovin par RNAseq GF-PGM Transmission des microarn du lait chez le jeune GIS GABI: les projets marquants 2014 Les miarns, régulateurs et biomarqueurs du stress alimentaire, de la régression du mélanome et des interactions entre hôtes et pathogènes Séquençage du génome du lapin : comment le lapin sauvage est devenu domestique Metagenomique de la microbiote intestinale chez le cochon PSGEN Datation de la formation de la zone de métissage taurins x zébus ouest-africaine et identification des facteurs responsables de son maintien Plateforme Capture du génome d un parasite bovin GenAqua Le séquençage du génome de la truite revisite l évolution des génomes de vertébrés.05

6 _02 La Bioinformatique dans GABI.06

7 La bioinformatique dans GABI Par qui? Résultat d enquête : 22 réponses.07

8 La bioinformatique dans GABI Par qui? Quel genre de bioinformaticien sommes nous? mixed That s my job I don t consider myself a bioinformatician but I feel autonomous in this field I am a biologist but I am able to use scripts and bioinformatics softwares under linux I need an infertace such as Galaxy to perform bioinformatics analysis I use a bioinformatician for my bioinformatics needs Other : I try to use script ; I m mostly a biostatistician; A quelle fréquence utilisons nous / avons nous besoins de bioinformatique? Sometimes [10] For my all studies [12].08

9 La bioinformatique dans GABI Pourquoi? Notre définition de la bioinformatique?.09

10 La bioinformatique dans GABI Pourquoi? Nos applications de la bioinformatique.010

11 La bioinformatique dans GABI Comment? Nos environnements de bioinformatique Windows computer Linux computer Migale cluster Genotoul cluster Roscoff cluster CTIG cluster Other cluster Linux VM Gandalf VM Other.011

12 La bioinformatique dans GABI Besoins? Help by bioinformatician Better informatic environment Programming skills Galaxy knowledge Linux knowledge I m satisfied Other : basic learning Nos Besoins en bioinformatiques Idées lancées! sessions individuelles de formation sur des topics bien particuliers aide à la programmation en perl ou python identification de personnes référentes de logiciels créer les conditions d'autonomie pour des utilisations "standard " des logiciels, principalement sous environnement linux; certains des besoins ne nécessitent pas forcément le recours à des bioinformaticiens, mais requièrent plutôt une formation améliorée à l'utilisation des commandes Linux. (à conjuguer au passé antérieur).012

Gènes Diffusion - EPIC 2010

Gènes Diffusion - EPIC 2010 Gènes Diffusion - EPIC 2010 1. Contexte. 2. Notion de génétique animale. 3. Profil de l équipe plateforme. 4. Type et gestion des données biologiques. 5. Environnement Matériel et Logiciel. 6. Analyses

Plus en détail

Analyses bioinformatiques pour le PCIM

Analyses bioinformatiques pour le PCIM Analyses bioinformatiques pour le PCIM Journée de rencontre des utilisateurs du Pôle de calcul intensif pour la mer 17 janvier 2014 La bioinfo, késaco? Approche in silico de la biologie L'organisation,

Plus en détail

Master de Bioinformatique et Biologie des Systèmes Toulouse http://m2pbioinfo.biotoul.fr Responsable : Pr. Gwennaele Fichant

Master de Bioinformatique et Biologie des Systèmes Toulouse http://m2pbioinfo.biotoul.fr Responsable : Pr. Gwennaele Fichant Master de Bioinformatique et Biologie des Systèmes Toulouse http://m2pbioinfo.biotoul.fr Responsable : Pr. Gwennaele Fichant Parcours: Master 1 : Bioinformatique et biologie des Systèmes dans le Master

Plus en détail

OFFRE DE FORMATION L.M.D.

OFFRE DE FORMATION L.M.D. REPUBLIQUE ALGERIENNE DEMOCRATIQUE ET POPULAIRE MINISTERE DE L ENSEIGNEMENT SUPERIEUR ET DE LA RECHERCHE SCIENTIFIQUE OFFRE DE FORMATION L.M.D. MASTER ACADEMIQUE Etablissement Faculté / Institut Département

Plus en détail

MUSEUM NAT. D'HISTOIRE NATURELLE PARIS Référence GALAXIE : 4113

MUSEUM NAT. D'HISTOIRE NATURELLE PARIS Référence GALAXIE : 4113 MUSEUM NAT. D'HISTOIRE NATURELLE PARIS Référence GALAXIE : 4113 Numéro dans le SI local : Référence GESUP : 4113 Corps : Maître de conférences du Muséum national d'histoire naturelle Article : 32ou40 Chaire

Plus en détail

BIN 1002: INTÉGRATION BIOSCIENCES/INFORMATIQUE

BIN 1002: INTÉGRATION BIOSCIENCES/INFORMATIQUE BIN 1002: INTÉGRATION BIOSCIENCES/INFORMATIQUE Plan de Cours Automne 2015 Professeurs: Sylvie Hamel, Département d Informatique et de Recherche Opérationnelle Guillaume Lettre, Institut de Cardiologie

Plus en détail

Mise en place de serveurs Galaxy dans le cadre du réseau CATI BBRIC

Mise en place de serveurs Galaxy dans le cadre du réseau CATI BBRIC Mise en place de serveurs Galaxy dans le cadre du réseau CATI BBRIC {Sebastien.Carrere, Ludovic.Legrand,Jerome.Gouzy}@toulouse.inra.fr {Fabrice.Legeai,Anthony.Bretaudeau}@rennes.inra.fr CATI BBRIC 35 bioinformaticiens

Plus en détail

Modalité de gestion et d utilisation du cluster de calcul de l UMR AGAP

Modalité de gestion et d utilisation du cluster de calcul de l UMR AGAP 27/01/2014 Page 1 sur 5 Modalité de gestion et d utilisation du cluster de calcul de l UMR AGAP Historique des versions Référence : Gestionnaire : qualité Version date de version Historique des modifications

Plus en détail

Charte d'utilisation des infrastructures de la plate-forme bioinformatique Genotoul

Charte d'utilisation des infrastructures de la plate-forme bioinformatique Genotoul Page 1/5 Objet de la modification Tableau des modifications Création du document 06/2014 Interdiction de lancer tout traitement de données sur les serveurs frontaux et purge du work sans préavis si fichiers

Plus en détail

Présentation de la mention. Biologie-Santé. School BMP. 11 décembre 2013

Présentation de la mention. Biologie-Santé. School BMP. 11 décembre 2013 Présentation de la mention Biologie-Santé School BMP 11 décembre 2013 Etablissements d enseignement supérieur impliqués Mention Biologie-Santé Agro Paris Tech (Grignon) UVSQ UFR des sciences UVSQ UFR Sciences

Plus en détail

Big data et sciences du Vivant L'exemple du séquençage haut débit

Big data et sciences du Vivant L'exemple du séquençage haut débit Big data et sciences du Vivant L'exemple du séquençage haut débit C. Gaspin, C. Hoede, C. Klopp, D. Laborie, J. Mariette, C. Noirot, MS. Trotard bioinfo@genopole.toulouse.inra.fr INRA - MIAT - Plate-forme

Plus en détail

L'analyse protéomique et les sciences -omiques: des données massives à interpréter et sauvegarder

L'analyse protéomique et les sciences -omiques: des données massives à interpréter et sauvegarder L'analyse protéomique et les sciences -omiques: des données massives à interpréter et sauvegarder Christine CARAPITO, Alexandre BUREL, Patrick GUTERL, Alexandre WALTER, Jérôme PANSANEL, Fabrice VARRIER,

Plus en détail

PHARMACIEN POLYTECHNICIEN SCIENCES CHIMIQUES VERSUS DE LA SANTÉ SCIENCES BIOLOGIQUES?

PHARMACIEN POLYTECHNICIEN SCIENCES CHIMIQUES VERSUS DE LA SANTÉ SCIENCES BIOLOGIQUES? PHARMACIEN POLYTECHNICIEN DE LA SANTÉ SCIENCES CHIMIQUES VERSUS SCIENCES BIOLOGIQUES? Professeur Pascale Cohen Professeur Marc Leborgne ISPB-Pharmacie Université Lyon I Quelle est la place actuelle de

Plus en détail

Liste des matières enseignées

Liste des matières enseignées Liste des matières enseignées Domaine : Sciences de la Nature et de la Vie Filière : Biologie Parcours : Tronc Commun Semestre1 VHG Coefficient Cours TD/TP Crédits/s. unité crédits U.E fondamental : 13

Plus en détail

Correspondance entre les formations du catalogue CEF - PASTEL et les formations 2015-2016 de l'ueve - Paris-Saclay - MASTER

Correspondance entre les formations du catalogue CEF - PASTEL et les formations 2015-2016 de l'ueve - Paris-Saclay - MASTER Correspondance entre les formations du catalogue CEF - PASTEL et les formations 2015-2016 de l'ueve - Paris-Saclay - MASTER ID CEF-Pastel Formation catalogue - CEF Pastel - 2014 / 2015 Correspondance nouvelle

Plus en détail

DESCRIPTION DU PROJET (en français)

DESCRIPTION DU PROJET (en français) DESCRIPTION DU PROJET (en français) Titre Court (max 20 caractères) Galaxy4Bioinformatics Pièce 2 Titre complet de l école (en majuscules) : «Développement et intégration d applications sous Galaxy» THEME

Plus en détail

http://galaxy-workbench.toulouse.inra.fr

http://galaxy-workbench.toulouse.inra.fr -- 1 -- Vos traitements bioinformatiques avec GALAXY Maria Bernard Sarah Maman Ibouniyamine Nabihoudine 5 Février 2014 DOKEOS http://galaxy-workbench.toulouse.inra.fr -- 2 -- Galaxy pour vos traitements

Plus en détail

Votre projet de formation Eleveur- pensionneur

Votre projet de formation Eleveur- pensionneur Votre projet de formation Eleveur- pensionneur 24 Rue du Château des Rentiers 75013 PARIS (France) Tel 01 83 64 05 99 AUDRECO FORMATION SA au capital de 38113 EUROS SIRET 39335113500024 CODE APE 8559A

Plus en détail

Galaxy Training days. Liste des sessions disponibles : http://bioinfo.genotoul.fr. Les formateurs :

Galaxy Training days. Liste des sessions disponibles : http://bioinfo.genotoul.fr. Les formateurs : -- 1 -- Galaxy Training days Durée / Programme : 3 journées. Galaxy : First step. Galaxy : Reads alignment and SNP calling. Galaxy : RNAseq alignment and transcripts assemblies. Public : Personnes souhaitant

Plus en détail

Vos traitements bioinformatiques avec GALAXY. Sarah Maman Maria Bernard École Bioinformatique AVIESAN 2015

Vos traitements bioinformatiques avec GALAXY. Sarah Maman Maria Bernard École Bioinformatique AVIESAN 2015 Vos traitements bioinformatiques avec GALAXY Sarah Maman Maria Bernard École Bioinformatique AVIESAN 2015 Galaxy Project Equipe Galaxy project : Le Center for Comparative Genomics and Bioinformatics -

Plus en détail

Apprentissage du langage PERL 5

Apprentissage du langage PERL 5 RESSOURCES HUMAINES SERVICE DE FORMATION DU PERSONNEL EPFL PL RH-F Téléphone : +41 21 693 34 30 Bâtiment BI Fax : +41 21 341 31 58 Station 7 CH-1015 Lausanne Site web : http://sfp.epfl.ch Apprentissage

Plus en détail

AUTOSAR : Premières étapes vers une production série. A.Gilberg, E.Dequi, J.Leflour

AUTOSAR : Premières étapes vers une production série. A.Gilberg, E.Dequi, J.Leflour : Premières étapes vers une production série A.Gilberg, E.Dequi, J.Leflour Sommaire Objectifs Approche Plan de Migration L automobile fait face à une complexité croissante 70 to 80 % des innovations sont

Plus en détail

PROJET AGENAE. Analyse des GENomes des Animaux d'elevage

PROJET AGENAE. Analyse des GENomes des Animaux d'elevage PROJET AGENAE Analyse des GENomes des Animaux d'elevage Le programme AGENAE : développer des recherches génériques et des actions de recherche finalisées dans le domaine de la génomique animale. quatre

Plus en détail

CREATION DE VALEUR PAR L EXPLOITATION DES NOUVELLES TECHNOLOGIES

CREATION DE VALEUR PAR L EXPLOITATION DES NOUVELLES TECHNOLOGIES CREATION DE VALEUR PAR L EXPLOITATION DES NOUVELLES TECHNOLOGIES CONSEIL STRATEGIQUE & ACCOMPAGNEMENT OPERATIONNEL 2, Rue de la Claire - 69009 Lyon-France Tél. : +33 (0)4.78.83.40.40 - Fax : +33 (0)4.78.64.02.23

Plus en détail

Mention Biologie Intégrative et Physiologie (BIP) School BASE Biodiversité, Agriculture et Alimentation, Société et Environnement

Mention Biologie Intégrative et Physiologie (BIP) School BASE Biodiversité, Agriculture et Alimentation, Société et Environnement Mention Biologie Intégrative et Physiologie (BIP) School BASE Biodiversité, Agriculture et Alimentation, Société et Environnement Objectifs : un socle de connaissances et de compétences de biologie centrées

Plus en détail

Correspondance entre les formations du catalogue CEF - PASTEL et les formations 2015-2016 de l'ueve - Paris-Saclay - MASTER

Correspondance entre les formations du catalogue CEF - PASTEL et les formations 2015-2016 de l'ueve - Paris-Saclay - MASTER Correspondance entre les formations du catalogue CEF - PASTEL et les formations 2015-2016 de l'ueve - Paris-Saclay - MASTER ID CEF-Pastel Formation catalogue - CEF Pastel - 2014 / 2015 Correspondance nouvelle

Plus en détail

Dia terre : le nouvel outil de diagnostic énergie gaz à effet de serre des exploitations agricoles. SIMA, 21 février 2011 Ademe Institut de l Elevage

Dia terre : le nouvel outil de diagnostic énergie gaz à effet de serre des exploitations agricoles. SIMA, 21 février 2011 Ademe Institut de l Elevage Dia terre : le nouvel outil de diagnostic énergie gaz à effet de serre des exploitations agricoles SIMA, 21 février 2011 Ademe Institut de l Elevage Contexte et enjeux : place de l agriculture L agriculture,

Plus en détail

Biologie Intégrative Projet Fédérateur Biogenouest

Biologie Intégrative Projet Fédérateur Biogenouest Biologie Intégrative Projet Fédérateur Biogenouest Coordinateurs: C. Pineau (INSERM U625 & PF protéomique BGO) D. Eveillard (LINA Université de Nantes UMR CNRS 6241) Animateur: Y. Le Bras (Biogenouest)

Plus en détail

Spécialisation 3A AgroSup Dijon IAA Microbiologie Industrielle et Biotechnologie (MIB)

Spécialisation 3A AgroSup Dijon IAA Microbiologie Industrielle et Biotechnologie (MIB) Spécialisation 3A AgroSup Dijon IAA Microbiologie Industrielle et Biotechnologie (MIB) Responsable : Jean-François Cavin (Pr. Microbiologie Biotechnologie) Tel 03 80 77 40 72, Fax 03 80 77 23 84 jf.cavin@agrosupdijon.fr

Plus en détail

Le séquençage haut-débit

Le séquençage haut-débit Nouveaux outils en biologie Le séquençage haut-débit DES d hématologie 16 janvier 2015 Paris Alice Marceau-Renaut Laboratoire d hématologie CHRU Lille NGS = Next-Generation Sequencing Whole-genome Whole-exome

Plus en détail

MOOC Agroécologie Séquence 1 Septembre 2015. Application pour l enherbement des cultures pérennes. Elena Kazakou

MOOC Agroécologie Séquence 1 Septembre 2015. Application pour l enherbement des cultures pérennes. Elena Kazakou CONCEPT DES TRAITS FONCTIONNELS Application pour l enherbement des cultures pérennes Elena Kazakou Dans cet exemple je vais vous présenter le concept des traits fonctionnels et vous illustrer comment on

Plus en détail

Intrants médicamenteux en agriculture et en santé : les écosystèmes microbiens sont-ils un problème ou une solution?

Intrants médicamenteux en agriculture et en santé : les écosystèmes microbiens sont-ils un problème ou une solution? Les Rencontres de l Inra au Salon de l agriculture Intrants médicamenteux en agriculture et en santé : les écosystèmes microbiens sont-ils un problème ou une solution? Lundi 23 février 2015 Programme 14h30

Plus en détail

Table-ronde : Management des Services : où en est votre entreprise et quels bénéfices peut-elle en retirer?

Table-ronde : Management des Services : où en est votre entreprise et quels bénéfices peut-elle en retirer? Table-ronde : Management des Services : où en est votre entreprise et quels bénéfices peut-elle en retirer? Challenge Optimum S.A. Conseil, Formation & Logiciels en Systèmes de Management Genève, mardi

Plus en détail

UNIVERSITE DES ANTILLES et DE LA GUYANE Campus de Fouillole BP250-97157 Pointe-à-Pitre Cedex MASTER DOMAINE : STS. Mention : Biologie Santé (BS)

UNIVERSITE DES ANTILLES et DE LA GUYANE Campus de Fouillole BP250-97157 Pointe-à-Pitre Cedex MASTER DOMAINE : STS. Mention : Biologie Santé (BS) UNIVERSITE DES ANTILLES et DE LA GUYANE Campus de Fouillole BP250-97157 Pointe-à-Pitre Cedex MASTER DOMAINE : STS Mention : Biologie Santé (BS) Spécialité : BIOLOGIE, SANTE, ALIMENTATION en milieu tropical

Plus en détail

Lyon, le 1er juillet 2010. Nos réf. : bb/6124/22062010. Madame, Monsieur,

Lyon, le 1er juillet 2010. Nos réf. : bb/6124/22062010. Madame, Monsieur, Lyon, le 1er juillet 2010 Nos réf. : bb/6124/22062010 Madame, Monsieur, Suite au succès du Programme Leonardo Mobilité organisé en Belgique, Espagne et Danemark entre 2007 et 2009 et auquel ont participé

Plus en détail

Master BIO-INFORMATIQUE. Analyse et Modélisation des Données

Master BIO-INFORMATIQUE. Analyse et Modélisation des Données Master BIO-INFORMATIQUE Analyse et Modélisation des Données Le 24/11/2015 Une formation en master depuis 15 ans 2000 : DESS Bioinformatique 2004 : Master 2 Bioinformatique 2008 : Master Génétique et Physiologie,

Plus en détail

Stéphane DERACO, DSI CNRS l Argos Devops : de l hyperviseur aux conteneurs l 11/12/2014 DOCKER

Stéphane DERACO, DSI CNRS l Argos Devops : de l hyperviseur aux conteneurs l 11/12/2014 DOCKER DOCKER HISTOIRE Projet interne de www.dotcloud.com (PaaS) 1 ère release Open Source en mars 2013 Objectif : conteneurs CONTENEURS «Vieux» concept chroot Unix : 1983 jails FreeBSD : 1998 Isoler l exécution

Plus en détail

Obtention de données génétiques à grande échelle

Obtention de données génétiques à grande échelle Obtention de données génétiques à grande échelle Stéphanie FERREIRA Ph.D. Campus de l Institut Pasteur de Lille 1, rue du Professeur Calmette 59000 LILLE Tel : 03 20 87 71 53 Fax : 03 20 87 72 64 contact@genoscreen.fr

Plus en détail

LICENCE 3. Mention Biologie BAC + 1 2 3 4 5

LICENCE 3. Mention Biologie BAC + 1 2 3 4 5 LICENCE 3 2013-2014 Mention Biologie Parcours Génie Biologique et Informatique 1. Editorial du responsable La licence de BIOLOGIE se distingue par la richesse des enseignements dispensés dans les différents

Plus en détail

http://sigenae-workbench.toulouse.inra.fr

http://sigenae-workbench.toulouse.inra.fr -- 1 -- Vos traitements bioinformatiques avec GALAXY DOKEOS http://sigenae-workbench.toulouse.inra.fr -- 2 -- Galaxy pour vos traitements (bio)informatiques Vidéo disponible sur «sig-learning» Présentation

Plus en détail

Epidémiologie appliquée aux sciences vétérinaires DES DAOA DES - DEA

Epidémiologie appliquée aux sciences vétérinaires DES DAOA DES - DEA Epidémiologie appliquée aux sciences vétérinaires DES DAOA DES - DEA Claude SAEGERMAN Département des maladies infectieuses et parasitaires, Service d épidémiologie et analyse de risques appliquées aux

Plus en détail

Fida KHATER & Abdoulaziz MOUSSA 03 mars 2012 - Journée Portes Ouvertes à l'um2

Fida KHATER & Abdoulaziz MOUSSA 03 mars 2012 - Journée Portes Ouvertes à l'um2 DEVELOPPEMENT D UNE INTERFACE GRAPHIQUE : LOCAL WEB GUI FOR BLAST (LWBG), POUR LES TRAITEMENTS DE DONNEES BIOLOGIQUES Fida KHATER & Abdoulaziz MOUSSA 03 mars 2012 - Journée Portes Ouvertes à l'um2 Plan

Plus en détail

Présentation succincte. Jean Cavarelli. Septembre 2014

Présentation succincte. Jean Cavarelli. Septembre 2014 Master Sciences du Vivant Spécialité Biologie structurale, bioinformatique et biotechnologies Parcours Biologie structurale intégrative et bio-informatique Présentation succincte. Jean Cavarelli Septembre

Plus en détail

PLANIFICATION ET OPERATIONS INTEGREES DU TRANSPORT MULTIMODAL

PLANIFICATION ET OPERATIONS INTEGREES DU TRANSPORT MULTIMODAL PLANIFICATION ET OPERATIONS INTEGREES DU TRANSPORT MULTIMODAL KEYWORDS : SYSTEMX, Transport, Multimodal, Simulation, Optimisation, Supervision CONTEXTE de l IRT SYSTEMX L IRT SystemX est un institut de

Plus en détail

Tutorial. Galaxy environment. Toulouse, 22-23 septembre 2015. Sarah Maman Plateforme Sigenae - INRA Toulouse. Contact : sigenae-support@listes.inra.

Tutorial. Galaxy environment. Toulouse, 22-23 septembre 2015. Sarah Maman Plateforme Sigenae - INRA Toulouse. Contact : sigenae-support@listes.inra. Tutorial Galaxy environment Toulouse, 22-23 septembre Sarah Maman Plateforme Sigenae - INRA Toulouse 1 sur 11 Galaxy est une plateforme de traitements (bio)informatiques accessible depuis l'url : http://galaxy-workbench.toulouse.inra.fr/

Plus en détail

Le DUT Génie Biologique option Bioinformatique une formation à BAC+2 unique en France. Valérie Polonais

Le DUT Génie Biologique option Bioinformatique une formation à BAC+2 unique en France. Valérie Polonais Le DUT Génie Biologique option Bioinformatique une formation à BAC+2 unique en France Valérie Polonais Le DUT : Diplôme Universitaire de Technologie - Diplôme à Bac+2 - Seul diplôme universitaire dont

Plus en détail

Eclipse atelier Python

Eclipse atelier Python Eclipse atelier Python Table des matières 1. Introduction...2 2. Téléchargement et installation d eclipse...3 3. Ajout du plugin PyDev...4 4. Utilisation...9 Eclipse est un projet de la Fondation Eclipse

Plus en détail

Les grandes bases de données en biologie et les. Guy Perrière. Pôle Rhône-Alpes de Bioinformatique. Forum «Big Data» 16 mai 2014

Les grandes bases de données en biologie et les. Guy Perrière. Pôle Rhône-Alpes de Bioinformatique. Forum «Big Data» 16 mai 2014 Les grandes bases de données en biologie et les problèmes associés Forum «Big Data» Guy Perrière Pôle Rhône-Alpes de Bioinformatique 16 mai 2014 Guy Perrière (PRABI) Forum «Big Data» 16 mai 2014 1 / 17

Plus en détail

Projet Personnalisé Encadré PPE 2

Projet Personnalisé Encadré PPE 2 BTS Services Informatiques aux Organisations Session 2014 Projet Personnalisé Encadré PPE 2. GESTION D'UTILISATEURS SYSTÈMES ET BASE DE DONNÉES, INSTALLATION ET CONFIGURATION D'OUTILS DE SUPERVISION ET

Plus en détail

Jabra CHAT - POUR PC. Mode d emploi. www.jabra.com

Jabra CHAT - POUR PC. Mode d emploi. www.jabra.com Jabra CHAT - POUR PC Mode d emploi www.jabra.com Sommaire BIENVENUE...3 Présentation du produit...3 Installation...4 connexion...4 INSTALLATION...4 fonctions d'appels...4 Obtenir de l assistance...5 2

Plus en détail

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq Présenté par Xi LIU ATCGCGCTAGCTGGTGTATCGCATCGCGCTAGCTGGTGTATCGCGCTAGCTGGTGTATCGCGCTAGCCTGGTGTATCGCCATCGCGCTAGCTGGCGCTAGCTGAATCGCGCATATG 17 Septembre 2013 Homéoallèles Génome Normalisation Analyse différentielle

Plus en détail

Oracle Solaris Studio 12.4 : Guide de sécurité

Oracle Solaris Studio 12.4 : Guide de sécurité Oracle Solaris Studio 12.4 : Guide de sécurité Référence: E60512 Octobre 2014 Copyright 2013, 2014, Oracle et/ou ses affiliés. Tous droits réservés. Ce logiciel et la documentation qui l'accompagne sont

Plus en détail

Guide de démarrage -------

Guide de démarrage ------- Guide de démarrage ------- Chargés de cours et laboratoire Date Nom Version 28 août 2010 Bonnet-Laborderie Alexandre 1.6 Sommaire Avant de commencer... 3 1) Accès au site avec un navigateur internet...

Plus en détail

Etude de la lysine acetyl transferase PCAF dans le développement du diabète et de l'obésité.

Etude de la lysine acetyl transferase PCAF dans le développement du diabète et de l'obésité. Etude de la lysine acetyl transferase PCAF dans le développement du diabète et de l'obésité. Tuteur : Jean-Sébastien Annicotte EGID CNRS UMR8199 Faculté de Médecine-Pôle Recherche, 2eme étage Bd J. Leclercq

Plus en détail

http://galaxy-workbench.toulouse.inra.fr

http://galaxy-workbench.toulouse.inra.fr -- 1 -- Vos traitements bioinformatiques avec GALAXY Maria Bernard Laurent Cauquil - Sarah Maman Ibouniyamine Nabihoudine 5 Février 2014 DOKEOS http://galaxy-workbench.toulouse.inra.fr -- 2 -- Galaxy pour

Plus en détail

Galaxy est une plateforme de traitements (bio)informatiques accessible depuis l'url : (en précisant votre login et mot de passe LDAP «genotoul»).

Galaxy est une plateforme de traitements (bio)informatiques accessible depuis l'url : (en précisant votre login et mot de passe LDAP «genotoul»). Galaxy est une plateforme de traitements (bio)informatiques accessible depuis l'url : (en précisant votre login et mot de passe LDAP «genotoul»). http://galaxy-workbench.toulouse.inra.fr/ Quelque soit

Plus en détail

INSTITUT CARNOT PASTEUR MALADIES INFECTIEUSES INSTITUT CARNOT SANTE ANIMALE 2 E APPEL D OFFRES CONJOINT

INSTITUT CARNOT PASTEUR MALADIES INFECTIEUSES INSTITUT CARNOT SANTE ANIMALE 2 E APPEL D OFFRES CONJOINT AO conjoint ICSAPMI 2015 INSTITUT CARNOT PASTEUR MALADIES INFECTIEUSES INSTITUT CARNOT SANTE ANIMALE 2 E APPEL D OFFRES CONJOINT RESUME ET OBJECTIFS Afin de développer des collaborations et renforcer les

Plus en détail

Lier un site de liaison d'un facteur de transcription et son gène cible

Lier un site de liaison d'un facteur de transcription et son gène cible Berder 2013 : Corrélation, causalité et régulation en biologie Lier un site de liaison d'un facteur de transcription et son gène cible Laurent M. SACHS (sachs@mnhn.fr) Laboratoire Evolution des Régulations

Plus en détail

PARCOURS : BIOLOGIE, GENETIQUE, IMMUNOLOGIE, MICROBIOLOGIE ENSEIGNEMENT (SEMESTRE 1)

PARCOURS : BIOLOGIE, GENETIQUE, IMMUNOLOGIE, MICROBIOLOGIE ENSEIGNEMENT (SEMESTRE 1) PARCOURS : BIOLOGIE, GENETIQUE, IMMUNOLOGIE, MICROBIOLOGIE ENSEIGNEMENT (SEMESTRE 1) Apport de la Biologie Cellulaire et Moléculaire aux innovations médicales (bases et prérequis de biologie cellulaire

Plus en détail

LIPM-BIOINFO / BBRIC. Projet INRA Archive. Pérennité et partage des données

LIPM-BIOINFO / BBRIC. Projet INRA Archive. Pérennité et partage des données Projet INRA Archive Pérennité et partage des données Constat Progression exponentielle de la production des données de séquences (et autres) Fluctuation des politiques du SRA@NCBI ou ENA@EBI En outre,

Plus en détail

Centre ressource et d expertise collaboratif en Analyse en Cycle de Vie en région Nord-Pas de Calais. www.avnir.org

Centre ressource et d expertise collaboratif en Analyse en Cycle de Vie en région Nord-Pas de Calais. www.avnir.org Centre ressource et d expertise collaboratif en Analyse en Cycle de Vie en région Nord-Pas de Calais. www.avnir.org La plateforme [avnir] a pour objectif de favoriser l intégration de l ACV dans les démarches

Plus en détail

Génétique et génomique Pierre Martin

Génétique et génomique Pierre Martin Génétique et génomique Pierre Martin Principe de la sélections Repérage des animaux intéressants X Accouplements Programmés Sélection des meilleurs mâles pour la diffusion Index diffusés Indexation simultanée

Plus en détail

Programme Observatoire ESSpace

Programme Observatoire ESSpace Programme Observatoire ESSpace Observatoire ESSpace est un projet interrégional conduit par les 4 Chambres régionales de l économie sociale et solidaire (ESS) des régions de Franche-Comté et Rhône-Alpes

Plus en détail

PLEXUS OI, UN INNOVANT

PLEXUS OI, UN INNOVANT PLEXUS OI, UN INNOVANT UN PROJET E-SANTE PLEXUS OI Genèse du projet L innovation au cœur du parcours de prise en charge LAGENÈSE DU PROJET Favoriser l émergence de territoires d excellence Des démarches

Plus en détail

Université Paris Saclay De quoi parle t-on?

Université Paris Saclay De quoi parle t-on? Université Paris Saclay De quoi parle t-on? Présentation L Université Paris-Saclay regroupe un potentiel scientifique exceptionnel. 20 établissements : - 2 universités, - 10 grandes écoles, - 7 organismes

Plus en détail

Stages 2015-2016 ISOFT : 25 ANS DE RECHERCHE EN INFORMATIQUE DECISIONNELLE ET. Contact : Mme Lapedra, stage@isoft.fr ANALYSE DE DONNEES

Stages 2015-2016 ISOFT : 25 ANS DE RECHERCHE EN INFORMATIQUE DECISIONNELLE ET. Contact : Mme Lapedra, stage@isoft.fr ANALYSE DE DONNEES Stages 2015-2016 Contact : Mme Lapedra, stage@isoft.fr ISOFT : 25 ANS DE RECHERCHE EN INFORMATIQUE DECISIONNELLE ET ANALYSE DE DONNEES ISoft est un concepteur-éditeur de logiciels spécialisé dans la recherche

Plus en détail

PARCOURS : BIOLOGIE, GENETIQUE, IMMUNOLOGIE, MICROBIOLOGIE ENSEIGNEMENT (SEMESTRE 1)

PARCOURS : BIOLOGIE, GENETIQUE, IMMUNOLOGIE, MICROBIOLOGIE ENSEIGNEMENT (SEMESTRE 1) PARCOURS : BIOLOGIE, GENETIQUE, IMMUNOLOGIE, MICROBIOLOGIE ENSEIGNEMENT (SEMESTRE 1) Apport de la Biologie Cellulaire et Moléculaire aux innovations médicales (bases et prérequis de biologie cellulaire

Plus en détail

ASA-Advanced Solutions Accelerator. Solution pour la gestion des données des laboratoires et des plateformes de service

ASA-Advanced Solutions Accelerator. Solution pour la gestion des données des laboratoires et des plateformes de service ASA-Advanced Solutions Accelerator Partenaire informatique des Laboratoires de Recherche 100lims Solution pour la gestion des données des laboratoires et des plateformes de service Parce que vous cherchez

Plus en détail

FIRMES MULTINATIONALES et INSERTION TERRITORIALE

FIRMES MULTINATIONALES et INSERTION TERRITORIALE FIRMES MULTINATIONALES et INSERTION TERRITORIALE 1 Christian Milelli (CNRS EconomiX) Workshop «Localisation des entreprises et performances des territoires» Nanterre 18 novembre 2009 Problématique Modalités

Plus en détail

JMP 9 Guide de l administrateur pour les versions Windows et Macintosh sous licence annuelle

JMP 9 Guide de l administrateur pour les versions Windows et Macintosh sous licence annuelle JMP 9 Guide de l administrateur pour les versions Windows et Macintosh sous licence annuelle La référence bibliographique correcte pour ce manuel est la suivante : SAS Institute Inc. 2010. JMP 9 Guide

Plus en détail

UTILISATION DE LA PLATEFORME WEB D ANALYSE DE DONNÉES GALAXY

UTILISATION DE LA PLATEFORME WEB D ANALYSE DE DONNÉES GALAXY UTILISATION DE LA PLATEFORME WEB D ANALYSE DE DONNÉES GALAXY Yvan Le Bras yvan.le_bras@irisa.fr Cyril Monjeaud, Mathieu Bahin, Claudia Hériveau, Olivier Quenez, Olivier Sallou, Aurélien Roult, Olivier

Plus en détail

Exonet : sauvegarde automatisée d une base de données

Exonet : sauvegarde automatisée d une base de données Exonet : sauvegarde automatisée d une base de données Description Propriétés Description Intitulé long Formation concernée Matière Présentation Notions Transversalité Outils Mots-clés Durée 4h. Auteur(es)

Plus en détail

GCSE Bitesize Controlled Assessment

GCSE Bitesize Controlled Assessment GCSE Bitesize Controlled Assessment Model 2 (for A/A* grade) Question 4 Subject: Topic: French Speaking In this document you will find practical help on how to improve your grade. Before you start working

Plus en détail

Sébastien Geiger IPHC Strasbourg

Sébastien Geiger IPHC Strasbourg Sébastien Geiger IPHC Strasbourg Retour d expérience sur la virtualisation de serveurs à l IPHC 9eme Journées Info de l IN2P3-IRFU 13-16 octobre 2014 Résidence de Camargue Sommaire Comment déterminer les

Plus en détail

S18 PHP pour des tâches batch sous IBM i

S18 PHP pour des tâches batch sous IBM i Modernisation, développement d applications et DB2 sous IBM i Technologies, outils et nouveautés 2013-2014 13 et 14 mai 2014 IBM Client Center Paris, Bois-Colombes S18 PHP pour des tâches batch sous IBM

Plus en détail

Des exemples concrets de valorisation de données

Des exemples concrets de valorisation de données L accès aux données pour la recherche & innovation» Workshop ACTA 8 Octobre 2015 Des exemples concrets de valorisation de données (problèmes rencontrés, solutions trouvées, valeur ajoutée du service...)

Plus en détail

L innovation permanente Inscrire l innovation au cœur de sa stratégie de développement. 18/11/2014 GROUPE DYADEO - Reproduction interdite

L innovation permanente Inscrire l innovation au cœur de sa stratégie de développement. 18/11/2014 GROUPE DYADEO - Reproduction interdite L innovation permanente Inscrire l innovation au cœur de sa stratégie de développement 2014 1 Notre vision DYADEO s éclaire Les entreprises ont conscience que la clé de l avenir est l Innovation. Le niveau

Plus en détail

Annexe 1 b : Description des actions de l opération 0412 Maîtrise de l énergie Programmation 2014 2020

Annexe 1 b : Description des actions de l opération 0412 Maîtrise de l énergie Programmation 2014 2020 Annexe 1 b : Description des actions de l opération 0412 Maîtrise de l énergie Programmation 2014 2020 CADRE REGLEMENTAIRE : FEADER, PROGRAMME DE DEVELOPPEMENT RURAL 2014 2020, REGION LIMOUSIN Cette annexe

Plus en détail

Business & High Technology

Business & High Technology UNIVERSITE DE TUNIS INSTITUT SUPERIEUR DE GESTION DE TUNIS Département : Informatique Business & High Technology Chapitre 09 : CC : Cloud Computing Sommaire Introduction... 2 Définition... 2 Les différentes

Plus en détail

Organisation et Fonctionnement de l Entreprise

Organisation et Fonctionnement de l Entreprise Organisation et Fonctionnement de l Entreprise Sommaire Organisation et fonctionnement de l'entreprise... 1 Les principales fonctions de l entreprise... 2 La notion de structure... 3 Caractéristiques d

Plus en détail

OFFRE DE FORMATION L.M.D.

OFFRE DE FORMATION L.M.D. REPUBLIQUE ALGERIENNE DEMOCRATIQUE ET POPULAIRE MINISTERE DE L ENSEIGNEMENT SUPERIEUR ET DE LA RECHERCHE SCIENTIFIQUE OFFRE DE FORMATION L.M.D. MASTER ACADEMIQUE Etablissement Faculté / Institut Département

Plus en détail

Importance du choix des outils pour la recherche et l analyse d information brevets : comparaisons entre logiciels gratuits et commerciaux

Importance du choix des outils pour la recherche et l analyse d information brevets : comparaisons entre logiciels gratuits et commerciaux Importance du choix des outils pour la recherche et l analyse d information brevets : comparaisons entre logiciels gratuits et commerciaux Fabien PALAZZOLI Analyste brevets, PhD Sommaire Brevets et information

Plus en détail

Quick Start Guide This guide is intended to get you started with Rational ClearCase or Rational ClearCase MultiSite.

Quick Start Guide This guide is intended to get you started with Rational ClearCase or Rational ClearCase MultiSite. Rational ClearCase or ClearCase MultiSite Version 7.0.1 Quick Start Guide This guide is intended to get you started with Rational ClearCase or Rational ClearCase MultiSite. Product Overview IBM Rational

Plus en détail

La Gestion de la Performance à travers le concept de Balanced Scorecard

La Gestion de la Performance à travers le concept de Balanced Scorecard La Gestion de la Performance à travers le concept de Balanced Scorecard Alexis Roy 26 Novembre 2004 Business and Systems Aligned. Business Empowered. TM Agenda 1. Introduction La nécessité de gérer la

Plus en détail

MCO, Pérennité et Obsolescence Journée Club Automation du 6 Juin 2013. A.VINOY : avinoy@assystem.com

MCO, Pérennité et Obsolescence Journée Club Automation du 6 Juin 2013. A.VINOY : avinoy@assystem.com MCO, Pérennité et Obsolescence Journée Club Automation du 6 Juin 2013 A.VINOY : avinoy@assystem.com L activité MCO, TMA & Pérennité Créée en 1991 Etudier et mettre en œuvre des stratégies de maintenance

Plus en détail

Projet de création de SAFRAN ANALYTICS

Projet de création de SAFRAN ANALYTICS Projet de création de SAFRAN ANALYTICS Comité de Groupe 27 février 2015 SOMMAIRE Contexte Enjeux du Big Data pour Safran Projet Safran Analytics Calendrier prévisionnel 1 / CONFIDENTIEL / 27-02-2015 /

Plus en détail

Licence Appliquée en Biotechnologies

Licence Appliquée en Biotechnologies Licence Appliquée en Biotechnologies Horaire CI ntroduction à la Mention Droit de l homme H5 H5 H H0 L S S Math appliqués Physique Chimie Générale Chimie Organique Biologie cellulaire Génétique Diversité

Plus en détail

Projet fédérateur E Biogenouest. Rennes 19 mars 2014

Projet fédérateur E Biogenouest. Rennes 19 mars 2014 Projet fédérateur E Biogenouest Rennes 19 mars 2014 Introduction Programme fédérateur Biogenouest co financé par les Régions Bretagne et Pays de la Loire 24 mois Lancé depuis Mai 2012 Porteur : Olivier

Plus en détail

e-biogenouest CNRS UMR 6074 IRISA-INRIA / Plateforme de Bioinformatique GenOuest yvan.le_bras@irisa.fr Programme fédérateur Biogenouest co-financé

e-biogenouest CNRS UMR 6074 IRISA-INRIA / Plateforme de Bioinformatique GenOuest yvan.le_bras@irisa.fr Programme fédérateur Biogenouest co-financé e-biogenouest Coordinateur : Olivier Collin Animateur : Yvan Le Bras CNRS UMR 6074 IRISA-INRIA / Plateforme de Bioinformatique GenOuest yvan.le_bras@irisa.fr Programme fédérateur Biogenouest co-financé

Plus en détail

Qu est ce qu une démarche qualité peut apporter à une plate-forme? Véronique BLIN, Séverine REMY, Françoise GROS

Qu est ce qu une démarche qualité peut apporter à une plate-forme? Véronique BLIN, Séverine REMY, Françoise GROS Qu est ce qu une démarche qualité peut apporter à une plate-forme? Véronique BLIN, Séverine REMY, Françoise GROS La démarche qualité à Biogenouest QUI? L Ingénieur Qualité de Biogenouest depuis mars 2006,

Plus en détail

Environmental Research and Innovation ( ERIN )

Environmental Research and Innovation ( ERIN ) DÉpartEment RDI Environmental Research and Innovation ( ERIN ) Le département «Environmental Research and Innovation» (ERIN) du LIST élabore des stratégies, des technologies et des outils visant à mieux

Plus en détail

Merci d avoir acheté la mini-interface USB VM167! Cette notice vous aidera à compléter l installation de votre interface.

Merci d avoir acheté la mini-interface USB VM167! Cette notice vous aidera à compléter l installation de votre interface. Guide d installation Merci d avoir acheté la mini-interface USB VM167! Cette notice vous aidera à compléter l installation de votre interface. Première connexion de l interface Insérez d abord la VM167

Plus en détail

http://galaxy-workbench.toulouse.inra.fr

http://galaxy-workbench.toulouse.inra.fr -- 1 -- Vos traitements bioinformatiques avec GALAXY Philippe Bardou Sarah Maman Ibouniyamine Nabihoudine Olivier Rué 06 Novembre 2013 DOKEOS http://galaxy-workbench.toulouse.inra.fr -- 2 -- 1 Galaxy pour

Plus en détail

Phytogéniques. et croissance des veaux. Carina Schieder Chef de Produit Phytogéniques

Phytogéniques. et croissance des veaux. Carina Schieder Chef de Produit Phytogéniques Phytogéniques et croissance des veaux Carina Schieder Chef de Produit Phytogéniques Photo: Fredleonero 200 Phytogéniques 150 100 50 25 Carina Schieder Chef de Produit Phytogéniques et croissance des veaux

Plus en détail

SyMeTRIC. projet régional pour le développement de la Médecine Systémique. alban.gaignard@univ-nantes.fr

SyMeTRIC. projet régional pour le développement de la Médecine Systémique. alban.gaignard@univ-nantes.fr SyMeTRIC projet régional pour le développement de la Médecine Systémique alban.gaignard@univ-nantes.fr portage scientifique : Jérémie Bourdon (LINA), Richard Redon (Inst. du Thorax) Systems Medicine Développer

Plus en détail

Cahier des charges fonctionnel

Cahier des charges fonctionnel Cahier des charges fonctionnel 10 Avril 2009 Historique Référence PLMA_CDCF_10042009.doc Intitulé Compte rendu Documents de référence PLMA_PAQ_29122009.doc E-mail Equipe itin J. GAUTIER (auteur) plma@googlegroups.com

Plus en détail

Le circuit de visite à la ferme de Grignon : enjeux, objectifs et mise en œuvre

Le circuit de visite à la ferme de Grignon : enjeux, objectifs et mise en œuvre Le circuit de visite à la ferme de Grignon : enjeux, objectifs et mise en œuvre Comité de pilotage GE+ - 15 Juin 2011 Enjeux Communication et Education citoyenne Un projet clé du programme Grignon Energie

Plus en détail

- LISTE DES REALISATIONS SCIENTIFIQUES -

- LISTE DES REALISATIONS SCIENTIFIQUES - - LISTE DES REALISATIONS SCIENTIFIQUES - CECILE BOURGUET Rapports d études & d expertise Bourguet C., 2015. Développement méthodologique : mise au point d un nouvel outil d étude des préférences alimentaires

Plus en détail

CPER Plateforme Epigénétique

CPER Plateforme Epigénétique CPER 2013-2016 Plateforme Epigénétique Biogenouest? SFR EA2216 MER IFREMER? Constat actuel Solutions dispersées Technologies multiples Coûts importants Analyse bioinformatique incomplète Manque de solution

Plus en détail