Concours. Annales corrigées. 17 sujets d annales. Épreuves d admission

Dimension: px
Commencer à balayer dès la page:

Download "Concours. Annales corrigées. 17 sujets d annales. Épreuves d admission"

Transcription

1 PARAMÉDICAL CONCOURS 2014/2015 Concours Masseurkinésithérapeute Annales corrigées Plannings de révision Autoévaluation Méthode 17 sujets d annales Corrigés détaillés Épreuves d admission Biologie (1 re et terminale S) Physique (1 re et terminale S) Chimie (1 re et terminale S) le Social.fr

2

3 PARAMÉDICAL Concours Masseur kinésithérapeute Annales corrigées Lydie Clolus Professeur agrégée de physique-chimie Rafael De Guevara Docteur ès sciences université Paris VII Denis Diderot enseignant en classes préparatoires paramédicales

4

5 Sommaire Avant-propos 5 PARTIE 1 Biologie Méthodologie et conseils Planning de révision Auto-évaluation Sujets d annales corrigés AFREP, podologie CEERRF, podologie IFMK EFOM, kinésithérapie et podologie partie EPM Marseille, podologie IFMK Berck-sur-Mer, kinésithérapie INP Paris, podologie IFMK Saint-Michel, kinésithérapie IFMK EFOM, podologie partie PARTIE 2 Physique Méthodologie et conseils Planning de révision Auto-évaluation Sujets d annales corrigés Assas IFMK CEERRF IFMK EFOM IFMK Berck-sur-Mer IFMK Saint-Michel

6 PARTIE 3 Chimie Planning de révision Auto-évaluation Sujets d annales corrigés IFMK Berck-sur-Mer IFMK Saint-Michel IFMK EFOM IFMK CEERRF

7 Avant-propos Cet ouvrage se propose de préparer le candidat aux épreuves des concours d entrée dans les écoles de kinésithérapies et de podologie. Les corrigés de cet ouvrage d annales ne sont pas les grilles de correction confiées aux correcteurs et dont on doit conserver le caractère de confidentialité. Ils sont donc le fait des auteurs. Il faut avant tout garder à l esprit qu il s agit d un concours : c est une idée première dont il faudra s imprégner jusqu au succès final. La sélection y est sévère, et le fait de parvenir à se hisser à une honnête moyenne au cours de votre formation ne suffit pas. Il est impératif de se fixer l excellence pour objectif. Si les indications et les conseils qui composent cet ouvrage peuvent être de précieux atouts, il n en reste pas moins vrai que la clé du succès passe avant tout par un travail intense et soutenu de la part du candidat. Nous voulons attirer l attention sur le fait que la majorité des instituts de formation conserve les sujets. Cette pratique relativement récente pose bien des questions de transparence. Elle laisse, de plus, les candidats dans une situation angoissante puisqu ils ne peuvent s entraîner aux modalités particulières que pourrait avoir un concours, chaque école organisant son épreuve sous la forme qui lui convient. Il devient donc difficile de proposer des annales qui ont pour but d aider les candidats dans leur réussite, notamment pour ceux non inscrits dans une école préparatoire intégrée. Nous avons donc choisi de vous proposer des sujets dits «d entraînement» afin de satisfaire une attente légitime d un contenu suffisant pour un livre dit «d annales». 5

8 Autoévaluation Voici un test de 210 questions regroupées par chapitre ; répondez-y par «vrai» ou «faux». Il est constitué de questions simples, générales. Vous pouvez l utiliser de différentes manières selon votre type de travail avant de réviser chaque partie de votre cours par exemple. Il se fait alors sans s astreindre à un temps donné. Il est prétexte à réciter la partie du cours concernée par la question ; une autre possibilité est de le traiter dans sa globalité, une fois votre apprentissage terminé. Le temps nécessaire est alors de 60 à 80 minutes. Vous tester ainsi votre rapidité de traitement de vos connaissances. Cette dernière modalité a ma préférence, c est pourquoi je l applique à mes étudiants. Dans tous les cas, vous faites ainsi la part entre ce qui est assimilé et ce qui ne l est pas encore vraiment. Il ne vous reste plus qu à parfaire votre apprentissage avant de vous attaquer aux annales. 1. Les constituants de la matière vivante 1 L ADN est un élément de la chromatine. V F 2 L ADN disparaît dans une cellule pendant toute la mitose. V F 3 L ARN est coloré en rose par la méthode de Feulgen. V F 4 L acide phosphorique est présent dans les nucléotides. V F 5 Une séquence ribonucléique est définie par les bases ATGC. V F 6 Les oses sont des sucres réducteurs. V F 7 Les phospholipides sont des lipides structuraux. V F 8 Le compartiment hydrique intracellulaire représente environ 40 % de la masse corporelle chez l adulte. V F 12

9 Auto-évaluation 2. Cellule et virus 9 Les systèmes endomembranaires définissent l ensemble des cellules du monde vivant. V F 10 Les mitochondries représentent le lieu privilégié de la synthèse d ATP. V F 11 Les procaryotes se multiplient par division binaire. V F 12 L appareil de Golgi correspond à un ensemble de cavités interconnectées entre elles. V F 13 La membrane plasmique peut être considérée comme une surface d échange et de reconnaissance. V F 14 Les antibiotiques permettent d éviter les mutations chez les bactéries. V F 15 La turgescence conduit au choc osmotique chez toutes les cellules. V F BIOLOGIE 16 Les protéines pompes membranaires effectuent le transport actif. V F 17 La membrane plasmique répond au modèle de mosaïque fluide. V F 18 Les virus sont capables de se reproduire dans le milieu extracellulaire. V F 19 L ADN est le matériel génétique des adénovirus. V F 20 Un provirus est un virus intégré au génome cellulaire. V F 21 La famille des rétrovirus comprend le VIH. V F 22 La taille du VIH est de l ordre de 200 nm. V F 23 Les bactéries résistantes mutent plus souvent. V F 24 La capside du VIH contient uniquement comme enzymes deux rétrotranscriptases. V F 3. Cycle cellulaire 25 La réplication de l ADN est observable au microscope optique au niveau des fourches de réplication. V F 26 L anaphase est l étape la plus longue de la mitose. V F 27 Le cycle cellulaire est classiquement défini par quatre étapes. V F 28 La mitose assure la distribution des chromosomes monochromatidiens entre les cellules filles de façon équitable. V F 29 Le renouvellement cellulaire s effectue par des mitoses. V F 30 Toutes les cellules de l organisme sont concernées par la mitose. V F 13

10 Sujets corrigés Sujet n 1 AFREP 2013, podologie Difficulté Durée 2 heures Partie 1 1 Définissez et commentez en quelques courtes phrases les expressions et mots suivants : a. Conséquences d une ovariectomie bilatérale b. Métaphase II c. Ganglion spinal d. Choppers e. Plasmocyte f. Anatoxine tétanique g. Western blot h. Crossing-over i. Protéine TDF j. Corne antérieure 2 Vous présenterez en 10 lignes maximum l intérêt de l expérience présentée dans l encadré ci-dessous. 24

11 Sujet 1 Partie 2 : le déterminisme de la ménopause Document 1 Dans l ovaire d une femme non ménopausée, on peut observer au microscope la structure ( 40) présentée dans le document ci-dessous. Des dosages urinaires de l hormone lutéinisante (LH) antéhypophysaire sont réalisés chez des femmes non ménopausées et sont présentés dans les documents 2 ci-dessous. BIOLOGIE Document 2a : Dosage urinaire de LH chez la femme avant la ménopause 25

12 Sujets d annales Document 2b : Dosage urinaire de LH chez une femme ménopausée Document 3 : Expériences réalisées chez des femelles pubères de mammifères et résultats CONDITIONS EXPÉRIMENTALES Animal intact Ablation des 2 ovaires Ovariectomie puis greffe d ovaires Ovariectomie puis injection d extraits hypophysaires RÉSULTATS Activité cyclique de l appareil génital Atrophie de l endomètre, arrêt des cycles utérins Développement cyclique de l endomètre Pas de variation cyclique Questions de la partie 2 1 Après avoir identifié la structure présentée dans le document 1, vous la reproduirez sur votre copie (prévoir un schéma de 10 cm 10 cm) et annoterez et titrerez votre schéma. 2 Vous analyserez les résultats des dosages présentés dans le document 2. 3 Quels sont les renseignements supplémentaires apportés par les expériences du document 3? 4 En vous référant aux différents documents et à leur exploitation, complétés de vos connaissances, vous réaliserez une synthèse sur le contrôle hormonal de la ménopause. Votre exposé sera agrémenté d un schéma fonctionnel. Partie 3 : la synthèse des protéines Document 1A Des cellules sont cultivées en présence d uracile radioactif. Un autoradiogramme est obtenu après une exposition de 15 minutes à l uracile radioactif. 26

13 Sujet 1 Document 1B Un autoradiogramme est également obtenu après une exposition de 15 minutes à l uracile radioactif, suivie d une culture pendant 88 minutes en présence d uracile radioactif. Document 1 ( 4 500) BIOLOGIE Document 2 Le document ci-dessous est une photographie prise au microscope électronique du noyau d une cellule eucaryote présentant un fort taux de synthèse protéique. 27

14 Sujets d annales Document 3 On a isolé le début d un gène permettant la synthèse d une protéine humaine. Le sens de lecture est de gauche à droite. Brin 1 : ATGGTGCACCTGACTCCTGAGGAGAAG Brin 2 : TACCACGTGGACTGAGGACTCCTCTTC Questions de la partie 3 1 Pourquoi utilise-t-on l uracile radioactif? 2 Définissez le terme «pulse-chase» du document 1B. 3 Citez les différences essentielles entre une molécule d ADN et une molécule d ARN. 4 Expliquez les résultats obtenus du document 1. 5 D après vos connaissances, quels sont les différents types d ARN synthétisés? 6 Proposez un schéma du mécanisme observé dans les documents 1A et 1B. 7 Indiquez la structure des éléments fléchés 1 et 2 dans le document 2. Vous commenterez les événements qui se déroulent dans la zone 3 du document 2. 8 Vous proposerez un schéma explicatif légendé du phénomène observé dans la zone 3 de la photographie (15 cm 15 cm). 9 Écrivez la séquence d ARN messager produite à partir de la séquence du gène proposée dans le document 3. Justifiez votre réponse. 10 Indiquez quel sera le polypeptide obtenu en expliquant votre démarche. 28

15 Sujet 1 Corrigé Partie 1 1 a. L ovariectomie bilatérale consiste en l ablation des deux ovaires. Il en résulte une situation physiologique qui correspond à la ménopause. La ménopause est l arrêt naturel des fonctions exocrine et endocrine ovariennes. Il y a stérilité, absence de sécrétion d œstrogènes et de progestérone, disparition du cycle utérin et donc des menstruations. Les taux hypophysaires de FSH et de LH deviennent élevés par absence de rétrocontrôle négatif. b. Elle correspond à l alignement à l équateur d un lot haploïde de chromosomes observé lors de la deuxième division méiotique. Dans le cadre de la gamétogenèse, c est le stade ovocyte 2 qui correspond à cette phase. Elle prépare l anaphase II, qui doit séparer les chromatides. c. C est une structure nerveuse localisée au niveau de la racine dorsale d un nerf rachidien. Il résulte de la réunion des corps cellulaires des neurones pseudo-unipolaires sensitifs. À son niveau, ce sont donc les messages nerveux afférents qui le traversent. d. C est un outil rudimentaire en pierre présentant un bord tranchant obtenu par quelques coups de galet. On le nomme aussi «galet aménagé». Il est représentatif de l industrie oldowayenne. Les plus anciens sont datés d environ 2,4 millions d années. Homo habilis les fabriquait. e. C est une cellule immunitaire différenciée sécrétrice d anticorps dans le cadre de la réponse spécifique à médiation humorale. Le plasmocyte résulte de la transformation d un LB activé par contact antigénique, suite à la stimulation par des interleukines sécrétées par le LT auxiliaire. Il présente un appareil protéosynthétique développé permettant la synthèse et l exocytose des anticorps spécifiques appelés «gammaglobulines». f. L anatoxine est une substance, à l origine fabriquée par une bactérie, dénaturée par un traitement lui ôtant ainsi ses propriétés toxiques mais gardant ses propriétés immunisantes. Cette propriété immunogène mais non pathogène permet de l utiliser comme vaccin antitétanique afin d éviter le tétanos. Une fois injectée, elle provoque la synthèse d anticorps antitétaniques. g. Technique qui permet de rechercher dans le sérum sanguin des protéines antigéniques et tout particulièrement des protéines issues d un virus. Elle est caractérisée par un transfert des protéines sur une membrane artificielle, séparées auparavant par électrophorèse. Par la suite, le dépistage est comparable à un test ELISA. h. Échange de segment de chromatides entre deux chromosomes homologues. Dans le cadre de la gamétogenèse, il correspond au brassage intrachromosomique créant une combinaison allélique originale portée par le gamète, source de diversité des individus. On l observe en prophase I au sein du bivalent. Il participe aussi à la création de famille multigénique. On parle alors de «crossingover inégal». i. C est un facteur de différenciation testiculaire qui oriente vers la 7 e semaine les cellules germinales primordiales en spermatogonies. En son absence, elles deviennent des ovogonies vers la 8 e semaine. La protéine TDF permet aussi la formation des cordons séminifères et la différenciation des cellules de Leydig. Il résulte de l expression du gène Sry porté par la région holandrique du Y. j. C est la région ventrale de la substance grise centrale médullaire. On y trouve les corps cellulaires des motoneurones périphériques contactant les muscles squelettiques. Dans la boucle myotatique, elle représente le centre intégrateur à l échelle de l organe. 2 L expérience consiste en l injection d un antigène atténué qui n est plus mortel puisque le lapin survit. Le complexe immun obtenu montre la présence d anticorps dans le sérum de l animal. On en déduit la mise en place d une réponse immunitaire à médiation humorale. Les anticorps produits neutralisent l antigène. Cette expérience indique la possibilité d utiliser l anatoxine comme méthode préventive de protection, ici, contre le tétanos. Elle décrit le principe de la vaccination. BIOLOGIE 29

16 Sujets d annales Partie 2 : le déterminisme de la ménopause 1 Il s agit d un follicule mûr de De Graaf. Titre : schéma d une coupe de follicule mûr montrant son organisation histologique. 2 Les dosages sont effectués sur une même durée correspondant à celle d un cycle. Chez la femme fertile, le taux est faible avec un pic au milieu du cycle dont la valeur dépasse celle observée chez la femme ménopausée. Chez cette dernière, le taux est élevé et constant. Par comparaison, on peut conclure à une régulation du taux de LH lorsque les gonades sont fonctionnelles. Cette régulation est négative mais aussi positive vers le 15 e jour. 3 L expérience 2 indique que les ovaires stimulent le fonctionnement utérin. L expérience 1 sert de référence. Grâce à la greffe de l expérience 3, qui est suivie d un développement cyclique de l endomètre, on conclut que la stimulation se fait par voie hormonale. L expérience 4 montre que, malgré les injections d extraits hypophysaires, les cycles utérins sont stoppés en absence d ovaires. Ce sont bien les ovaires qui stimulent directement l utérus. 4 Le fonctionnement cyclique est déterminé par la mise en place de boucles de contrôle en retour exercées par les hormones gonadiques sur le complexe hypothalamo-hypophysaire. Ce dernier détecte en permanence la variation de leur taux et y répond généralement par une diminution de ses sécrétions (document 2a : taux faible de LH). On parle de rétrocontrôle négatif. L initiation de la décharge ovulante est due, en revanche, à un rétrocontrôle positif (document 2a : pic de LH) de la part des œstrogènes à forte dose en fin de phase folliculaire. C est donc la durée du développement folliculaire et la durée de vie du corps jaune qui, par le biais de leurs hormones respectives, autoconditionnent la durée du cycle ovarien, utérin et hypothalamo-hypophysaire. Dans le cycle utérin, le développement endométrial est soumis à l action des œstrogènes puis des œstrogènes et de la progestérone (document 3). En absence d hormones, une atrophie s installe (document 3, expérience 2) et la disparition des rétrocontrôles aboutit à un taux élevé de gonadostimulines (document 2b). L origine de cette situation générale est l atrésie folliculaire, qui démarre dès la gestation. Lorsque les derniers follicules ovariens disparaissent, c est la ménopause. Partie 3 : la synthèse des protéines 1 L uracile est une base azotée spécifique de l ARN. L uracile radioactif utilisé comme précurseur permet l étude des processus biologiques impliquant cette molécule. 30

17 Sujet 1 2 Le pulse-chase est un protocole expérimental qui permet de suivre le devenir des molécules marquées au bout d intervalles de temps variables. Il consiste à faire un marquage court dans le temps, ici 15 minutes, puis de fournir un précurseur non radioactif. 3 Les nucléotides constituant l ARN, molécule monocaténaire sont formés par : le ribose (C 5 H 10 O 5 ) ; une des bases azotées : adénine, guanine, uracile remplaçant la thymine de l ADN et la cytosine ; l acide phosphorique H 3 PO 4. Les nucléotides constituant l ADN, molécule bicaténaire, sont formés par : le désoxyribose (C 5 H 10 O 4 ) ; une des bases azotées : adénine, guanine, thymine, cytosine ; l acide phosphorique H 3 PO 4. 4 La photo 1A, prise à 15 minutes, montre un marquage concentré de forme ronde. Pour le même temps d incubation, la photo 1B, prise plus tardivement, montre ce marquage dans le reste de la cellule. On en conclut que le précurseur radioactif est incorporé au niveau du noyau, qui est donc le lieu de la synthèse de l ARN. Cette molécule sort du noyau, indiquant que le cytoplasme est le lieu de son utilisation. 5 Les différents types sont : l ARN de transfert, l ARN ribosomal, l ARN messager et l ARN prémessager dans le cas de gènes morcelés. 6 7 Flèche 1 : molécule d ADN constitutive du chromosome, c est une double hélice alpha. Les deux brins, dits «antiparallèles», sont reliés entre eux par des liaisons hydrogène entre les bases azotées complémentaires adénine/thymine et guanine/cytosine. Flèche 2 : molécule d ARN, molécule monocaténaire. La zone 3 est une unité transcriptionnelle. Elle correspond à un gène subissant un grand nombre de transcription car la cellule présente un fort taux de synthèse protéique. La double hélice s ouvre et plusieurs ARN polymérases parcourent le brin porteur de l information génétique. Au vu de la différence de taille entre les ARN en cours de synthèse, on conclue que le début du gène est à gauche, la fin, à droite de l encadré. 8 Schéma de la transcription 9 Le sens de lecture est de gauche à droite. On dispose des deux brins d ADN et du début du gène. On cherche donc la séquence TAC caractéristique du codon AUG initiateur. Le brin 2 est donc transcrit par complémentarité des bases A/U et G/C. BIOLOGIE ARNm : AUG GUG CAC CUG ACU CCU GAG GAG AAG Brin 2 : TAC CAC GTG GAC TGA GGA CTC CTC TTC 10 Chaque codon de trois lettres correspond à un acide aminé selon le code génétique. La séquence de l ARNm donne donc la séquence des acides aminés du polypeptide réunis par des liaisons peptidiques. La méthionine utilisée pour l initiation de la traduction sera par la suite éliminée. Polypeptide : mét val his leu thr pro glu glu lys 31

18

19 Auto-évaluation 9 On considère la réaction de fusion nucléaire suivante : 2 H + 2 H 3 H + 1 H. L énergie de liaison par nucléon est de 1,11 MeV pour le deutérium et de 2,83 MeV pour le tritium. L énergie libérée au cours de cette réaction est 4,05 MeV. 10 Le défaut de masse d un noyau est toujours positif. 11 On donne 14 Si ; 15 P ; 16 S ; 31 Ga ; 32 Ge ; 33 As. Le phosphore 32 est un isotope du germanium de symbole Ge. 12 Les noyaux 206 Hg et 206 Pb ont le même numéro atomique. 13 Le thorium 230 Th subit une série de désintégration α et 90 β conduisant à la formation de 206 Pb 82 stable. L équation globale de cette série de désintégrations radioactive s écrit : 230 Th 206 Pb + xα yβ. Les valeurs de x et y sont x = 8 ; y = Lors de la fission d un noyau d uranium 235 U après bombardement par un neutron, on observe 92 que les produits de la réaction sont : 3 neutrons, 1 noyau de 94 Kr et 1 noyau de 135 Xe L équation 2 H + 3 H 4 He + 1 n traduit une désintégration de type alpha Lors d une radioactivité β +, il y a émission d un positon de symbole 0 e La fission nucléaire est une réaction nucléaire spontanée. 18 Dans une désintégration β, le numéro atomique du noyau fils augmente d une unité. PHYSIQUE 19 Le brome 77 est un isotope radioactif utilisé en imagerie médicale. Le noyau fils est le sélénium 77. Le brome 77 est un émetteur β. 20 Dans un réacteur nucléaire se produit la réaction suivante : 235 U + 1 n 135 X + 97 Y Z 39 x1 n. 0 Cette réaction produit 3 neutrons. 111

20 2. Vision, image et couleur 1 On considère une tomate rouge éclairée en lumière verte. La couleur perçue de la tomate est verte. 2 Le daltonisme correspond à un dysfonctionnement des cônes. 3 Une lentille à bords épais est divergente. 4 Une lentille mince convergente de distance focale f = 10,0 cm donne d un objet AB une image A B. A est un point de l axe optique tel que la mesure algébrique de A soit égale à 20,0 cm. La vergence de la lentille est C = 10,0 dioptries. 5 Une voiture bleue est éclairée en lumière jaune. La couleur perçue de la voiture est noire. 6 Le laser peut être considéré comme une source de lumière à infra-incandescence. 7 La température de surface de la Lune quand le Soleil est à son zénith vaut 110 C. Les radiations alors émises par la surface de la Lune possèdent des longueurs d onde de l ordre de μm. 8 L unité dans le système international de la constante de la loi de Wien est m.k. 9 Une lentille est d autant plus convergente que sa vergence est grande. 10 L image d un objet se trouvant dans le plan focal objet se trouve dans le plan focal image. 11 À la suite de plusieurs expériences et recherches, des astronomes ont pu déterminer la longueur d onde λ max de plusieurs astres : ASTRE Astre n 1 Astre n 2 Astre n 3 Astre n 4 LONGUEUR D ONDE λ max (nm) 210 nm 511 nm nm 300 nm Donnée : constante de Wien : k = 2, S.I ASTRE TEMPÉRATURE (EN C) L astre 3 est Rigel. Terre 15 C Rigel C Capella C Véga C 112

21

22 Sujet n 2 Difficulté Durée 1 heure CEERRF, 2013 Choisir la (ou les) bonne(s) réponse(s). Chaque question est sur 2 points. Dans le cas où plusieurs réponses sont possibles, vous obtenez 2 points si votre réponse est complète et sans erreur, 1 point s il y a omission, 0 point dans tous les autres cas. Exercice n 1 (10 points) On considère une moto M et une voiture V sur une route plane rectiligne : à t = 0, V est à la distance D (D positive) devant M et ralentit avec une décélération constante de norme a, sa vitesse initiale est notée v. À la même date initiale, M démarre avec une accélération constante de valeur a. Questions 1 On note T la date à laquelle M dépasse V. On peut affirmer que : a. 2D = (a + a )T 2 2vT. b. T = (v + 2aD) 1/2 (a + a ). c. T = (v 2aD) 1/2 (a + a ). d. T = (v 2 + a D) (2a). e. T = (v + (v 2 + 2D(a + a )) 1/2 ) (a + a ). f. aucune proposition ne convient. 2 On note T la date à laquelle les vitesses de M et V sont égales. On peut dire que : a. T = a v. b. T = v a. c. T =(ad) 1/2 a. d. T = v (a + a ). e. T = v (2a). f. aucune proposition ne convient. 3 À la date T, la distance parcourue par M est : a. d = v 2 (2a 2 ). b. d = v 2 (a 2 + a 2 ). c. d = v 2 (2(a 2 + a 2 )). d. d = v 2 (2a 2 ) + D. e. d = D v 2 (2a 2 ). f. aucune proposition ne convient. 4 On donne a = 1,0 m.s 2 ; a = 0,50 m.s 2 ; v = 1, cm/s ; D = 100 m. On peut dire que : a. T = 10 s. v = 10 m/s. b. T = 20 s. c. T = 30 s. d. T = 4,0 s. e. T 5,0 s. f. aucune proposition ne convient. 5 On note v la vitesse atteinte par M à la date T. On peut dire que : a. v = 3,3 m/s. b. v = 6,5 s. c. v = 9,5 s. d. d 9 m. e. d 11 m. f. aucune proposition ne convient. 146

23 Sujet 2 Exercice n 2 (10 points) Soit le dispositif qui précède constitué d un ressort de constante de raideur k, relié à un bloc de masse m par un fil (par l intermédiaire d une poulie en I qui ne jouera aucun rôle par la suite). Le dispositif est initialement au repos, le ressort est détendu. On néglige les frottements. On ne s intéresse qu à la première descente du bloc (on n étudie pas les oscillations et montées suivantes). Données : m = g ; g = 10 m.s 2 ; α = 30 ; k = 20 N.m 1. 6 La distance d maximale parcourue par le bloc après avoir lâché le système s écrit : a. d = mg cos α k. b. d = mg sin α k. c. d = 3mg cos α k. d. d = 3mg sin α k. e. d = 2mg sin α k. f. aucune proposition ne convient. 7 La distance d maximale parcourue par le bloc après avoir lâché le système vaut : a. d = 5 cm. b. d = 4 cm. c. d = 3 cm. d. d = 2 cm. e. d = 1 cm. f. aucune proposition ne convient. PHYSIQUE 8 Le graphe qui représente l énergie cinétique du bloc en fonction de la distance parcourue est : a. une droite. b. une droite qui passe par l origine. c. un cercle. d. une parabole. e. une sinusoïde. f. aucune proposition ne convient. 9 Quand le bloc a parcouru 2 cm sur le plan incliné, son énergie cinétique vaut : a. 7 mj. b. 6 mj. c. 5 mj. d. 4 mj. e. 3 mj. f. aucune proposition ne convient. 10 Quand le bloc a parcouru 2 cm sur le plan incliné, son énergie cinétique dans le système international peut s écrire : a. 0,01 mg sin α 0,2k. b. 0,05 mg sin α 0,2k. c. 0,1 mg sin α 0,2k. d. 0,1 mg sin α 0,2k. e. 0,1 mg sin α 0,1k. f. aucune proposition ne convient. 147

24 Sujets d'annales Exercice n 3 (10 points) 11 On considère un objet noté AB, perpendiculaire à l axe optique d une lentille convergente L, un écran E également perpendiculaire à l axe optique de la lentille. On constate que pour une certaine distance objet écran notée D telle que D = AA', on obtient deux positions de la lentille permettant d obtenir une image nette sur l écran (image notée A B ). Le centre optique de la lentille est noté O et sa distance focale image f. On pose x = AO. a. La lentille (L) utilisée est une lentille à bords épais. b. La lentille utilisée pourrait être une lentille biconvexe. c. Dans la situation qui nous intéresse, l image peut être qualifiée de virtuelle. d. On peut écrire OA' = x D. e. On peut écrire OA' = D x. f. Aucune proposition ne convient. 12 En appliquant la formule de conjugaison de Descartes, on trouve une équation du second degré entre x, D et f qui est : a. x 2 + Dx f D = 0. b. x 2 + Dx + f D = 0. c. x 2 Dx f D = 0. d. x 2 + Dx + f D = 0. e. x 2 D 2 x = f D. f. Aucune proposition ne convient. 13 Les deux positions de la lentille permettant d obtenir une image sur l écran sont notées x 1 et x 2. On pose d = x 1 x 2, d est une distance. a. Pour obtenir les deux positions précédentes, on doit vérifier la relation : D 2 + 4f D > 0. b. Pour obtenir les deux positions précédentes, on doit vérifier la relation : D 2 4f D = 0. c. On peut écrire que f = (D 2 d 2 ) (4D). d. On peut écrire que f = (D 2 + d 2 ) (4D). e. On peut écrire que f = (d 2 D 2 ) (4D). f. Aucune proposition ne convient. 14 Pour D = 2,0 m, on trouve d = 1,4 m. Aide aux calculs : on prendra 1,4 1,4 = 2,0 a. La lentille étudiée a pour vergence C = 8,0 δ. b. La lentille étudiée a pour vergence C = 10 δ. c. La lentille étudiée a pour distance focale f = 10 cm. d. La lentille étudiée a pour distance focale f = 12,5 cm. e. La lentille étudiée a pour distance focale f = 25 cm. f. Aucune proposition ne convient. 15 On place maintenant un objet réel à 10 cm de la lentille dont on vient de déterminer la distance focale. a. L image obtenue est virtuelle. b. L image obtenue est réelle. c. L image obtenue est rejetée à l infini. d. L image obtenue est droite. e. L image obtenue est rétrécie. f. Aucune proposition ne convient. 148

25 Sujet 2 Exercice n 4 (10 points) Dans cet exercice, on considère l œil modélisé. Le cristallin de l œil est assimilable à une lentille convergente L. Un objet sera vu nettement par l œil seulement si son image se forme sur la rétine (on assimilera celle-ci à un écran). La distance lentille-écran est constante et égale à 15,4 mm. Par contraction du muscle ciliaire, la courbure du cristallin peut se modifier et la vergence de la lentille varier. Aides aux calculs : 1/7,70 = 0,130 ; 1/7,80 = 0,128 ; 1/7,90 = 0,127 ; 1/6 = 0, On s intéresse à la source lumineuse éclairant un objet. Le flux énergétique d une source lumineuse noté Φ correspond à la quantité d énergie lumineuse émise par unité de temps. En fonction des unités de base, Φ s exprime en : a. m.kg.s 3. b. m 2.kg.s 1. c. W. d. m 2.kg.s 2. e. m 2.kg.s. f. Aucune proposition ne convient. 17 On suppose que l œil étudié ne présente pas de défaut de vision (on dit qu il est «emmétrope»). Sa vergence au repos C 0 (en dioptries) est donc : a. 62. b. 63. c. 64. d. 65. e. 66. f. Aucune proposition ne convient. 18 On suppose que l œil emmétrope accommode au maximum. Sa vergence est alors C 1 = 70 δ. La distance minimale de vision distincte pour cet œil est de : a. 15 cm. b. 20 cm. c. 25 cm. d. 30 cm. e. 100 cm. f. aucune proposition ne convient. 19 Lorsqu un œil présente un défaut de vision, on utilise un verre correcteur assimilable aussi à une lentille. Lorsqu on associe deux lentilles minces (L 1 ; O 1 ) et (L 2 ; O 2 ) on applique parfois pour déterminer la vergence C du système une relation qui peut être : Donnée : e = O 1 O a. C = C 1 + C 2 ec 1 C 2. b. C = C 1 + C 2 e 2 C 1 C 2. c. C = C 1 + C 2 ec 12 C 22. d. C = C 1 + C 2 ec 1. e. C = C 1 + C 2 ec 2. f. C = C 1 + C 2 ec 1 C 2. PHYSIQUE 20 L œil présente en fait un défaut de vision. Il est hypermétrope. Pour voir un objet à l infini, il faut accoler une lentille de 5,0 δ. Sans cette lentille dite «correctrice», où se formerait l image d un objet situé à l infini? a. 2,5 mm en avant de la rétine. b. 2,5 mm après la rétine. c. 1,5 mm en avant de la rétine. d. 2,0 mm après la rétine. e. 1,3 mm après la rétine. f. Aucune proposition ne convient. 149

26 Sujets d'annales Corrigé Exercice n 1 1 a, e. 1. Pour la moto : x m = 1 2 a't2 2. Pour la voiture : x v = 1 2 a't2 + vt + D 3. À la date t = T : x m = x v donc 1 2 a't2 = 1 2 at2 + vt + D a't 2 = at 2 + 2vT + 2D 2D = (a + a)t2 2vT 4. Équation du second degré : (a + a)t2 2vT 2D = 0 5. Discriminant : Δ = b2 4ac = 4v2 + 8(a + a)d = 4(v2 + 2(a + a)d) Solutions : T = b ± Δ 2a donc T = v + v2 + 2(a' + a)d (a' + a) 2 e. v m = dx m dt = a't v v = dx v dt = at + v Pour t = T : v m = v v donc a T = at + v v d où T' = (a' + a) 3 Pour la moto : x m = 1 2 a't2 Pour t = T : d = 1 2 a't'2 = 1 2 a' v 2 (a' + a) = a'v 2 2 2(a' + a) 2 4 b. T = v + v2 + 2(a + a')d (a' + a) = T' = v (a' + a) = = 1,5 = 30 2 donc T = 20 s. (a' + a) = donc T 6,7 s. 5 a, e. Pour la moto : x m = 1 2 a't2 et v m = a t Pour t = T : v = a T = = 10 3 d = 1 2 a't'2 = ( 20 3 ) 2 = 400 donc d 11 m Exercice n = Le système est conservatif : E m = constante donc E pp max = E pe max d où mgh = 1 2 kx2 avec x = d et h = d sin α mgd sin α = 1 2 kd 2 d où d = 2mg sin α k 7 a. 2 0,1 10 sin(30) d = = 2 0,50 = 0, donc d = 5, m = 5,0 cm. 8 d. Le système est conservatif : E m = constante donc ΔE m = 0 = ΔE C + ΔE pp + ΔE pe À t = 0 : E c = 0 J donc ΔE c = E c d où ΔE pp = mgx sin α et ΔE pe = 1 2 kx2 E c = ΔE pp ΔE pe = mgx sin α = 1 2 kx2 Équation d une parabole 9 b. E C = 0,1 10 2, sin(30) (2, ) 2 = 1, , = 10, = 4, E c = 6, J = 6,0 mj. 10 f. E c = 0,02 mg sin α k Exercice n 3 11 b, e. Une lentille convergente possède des bords fins. OA' = OA + AA' = AO + AA' = x + D donc OA' = D x 12 f. 1 1 Relation de conjugaison : OA' OA = 1 f' 1 donc D x + 1 x = 1 f' x + (D x) = 1 donc f x + f (D x) = x(d x) x(d x) f' d où x2 Dx + f D = 0 150

27 Sujet 2 13 c, e. Résolution de l équation du second degré : x2 Dx + f D = 0 Discriminant : Δ = D2 4f D Pour obtenir deux solutions : Δ > 0 donc D2 4f D > 0 x 1 = D + Δ 2 et x 2 = D Δ 2 donc x 1 x 2 = D + Δ 2 d2 = Δ = D2 4f D f' = D2 d 2 4D = d 2 D 2 4D D Δ 2 14 d. 4,0 2,0 f' = = = 1 4 = 0,25 m donc f = 25 cm et C = 4 δ. 15 a, d. Exercice n 4 16 c. = Δ 17 d. C 0 = = = 3 f' 0 15, ,4 donc C 65 δ b. f' 1 = 1 = 1 m, OA' = 15,4 mm, OA = distance C 1 70 minimale de vision distincte. 1 1 Relation de conjugaison : OA' OA = 1 f' 1 1 donc OA = 1 1 = C OA' f' 0 C 1 = = 5 1 Donc OA = 0,20 m = 20 cm 19 f. 20 e. L image d un objet situé à l infini se forme dans le plan focal image donc la vergence de l œil corrigé vaut C 0 = 65 δ. C 0 = C 1 + C 2 ec 1 C 2 or la lentille est accolée donc e = 0. C 0 = C œil + C lentille donc C œil = C 0 C lentille = 65 5 = 60 δ. 1 f' œil = = 1 C œil 60 = 1, m L image se forme à d = 16,7 15,4 = 1,3 mm. PHYSIQUE 151

28 PARTIE 3 Chimie Planning de révision 180 Auto-évaluation 183 Sujets d annales corrigés 231

29 Autoévaluation 1. Réaction chimique et avancement Exercice n 1 : QCM Cochez la (ou les) bonne(s) réponse(s). (1 point par question, soit 7 points) 1 On dispose d une solution mère de concentration molaire C 0 = 5, mol.l 1. On souhaite préparer une solution fille de concentration molaire C 1 = 1, mol.l 1 et d un volume V = 500 ml. a. Il faut utiliser une pipette jaugée de 10 ml munie d une propipette pour prélever le volume de solution mère. b. Il faut utiliser une pipette jaugée de 1 ml munie d une propipette pour prélever le volume de solution mère. c. Il faut utiliser une pipette jaugée de 5 ml munie d une propipette pour prélever le volume de solution mère. d. Il faut utiliser une éprouvette graduée de 10 ml munie d une propipette pour prélever le volume de solution mère. e. Il faut utiliser une éprouvette graduée de 5 ml munie d une propipette pour prélever le volume de solution mère. 2 On effectue une dilution au centième d une solution mère pour fabriquer une solution fille d un volume V 1 = 200 ml. a. La solution fille est 100 fois plus concentrée que la solution mère. b. La solution fille est 100 fois moins concentrée que la solution mère. c. Le volume de solution mère à prélever est V 0 = 200 ml. d. Le volume de solution mère à prélever est V 0 = 2,0 ml. 3 La solution fille possède une concentration molaire C 1 = 2, mol.l 1, alors que la solution mère a une concentration molaire C 0 = 5, mol.l 1. a. La solution mère est diluée 20 fois. b. La solution mère est diluée 0,05 fois. c. Il faut choisir une fiole jaugée de 200 ml et une pipette jaugée de 10 ml. d. Il faut choisir une fiole jaugée de 500 ml et une pipette jaugée de 10 ml. 4 On dispose d une solution mère de concentration molaire C mère = 4, mol.l 1, ainsi que d une fiole jaugée de 50 ml et d une pipette jaugée de 20 ml. a. La concentration de la solution fille vaut C fille = 1, mol.l 1. b. La concentration de la solution fille vaut C fille = 1, mol.l 1. c. La solution mère a été diluée 2,5 fois. d. La solution mère a été diluée 0,4 fois. CHIMIE 183

30 5 Au cours d une dilution au vingtième : a. la quantité de matière prélevée est divisée par 20. b. la quantité de matière prélevée reste inchangée. c. la concentration molaire de la solution fille est divisée par 20. d. la concentration molaire de la solution mère est divisée par Pour préparer une solution fille diluée au dixième par rapport à la solution mère, on utilise : a. une fiole jaugée de 100 ml et une pipette jaugée de 1 ml. b. une fiole jaugée de 50 ml et une pipette jaugée de 5 ml. c. une fiole jaugée de 200 ml et une pipette jaugée de 10 ml. d. une fiole jaugée de 250 ml et une pipette jaugée de 20 ml. 7 On souhaite préparer une solution de concentration molaire C 1 = 3, mol.l 1 à l aide d une fiole jaugée de 100 ml et d une pipette jaugée de 10 ml. La concentration molaire de la solution mère doit être : a. C 0 = 3, mol.l 1. b. C 0 = 3, mol.l 1. c. C 0 = 3, mol.l 1. d. C 0 = 3, mol.l 1. Exercice n 2 (1 point par case, soit 12 points) Complétez les tableaux ci-dessous. Chaque «case vide» vaut 1 point. Masses molaires atomiques : M(C) = 12,0 g.mol 1 ; M(Cu) = 63,5 g.mol 1 ; M(O) = 16,0 g.mol 1 M(H) = 1,0 g.mol 1 ; M(S) = 32,1 g.mol 1 ; M(I) = 126,9 g.mol 1 ; M(Na) = 23,0 g.mol 1 MASSE DE SOLUTÉ DISSOUTE QUANTITÉ DE MATIÈRE DE SOLUTÉ MASSE MOLAIRE DU SOLUTÉ VOLUME DE LA SOLUTION CONCENTRATION MOLAIRE CONCENTRATION MASSIQUE SOLUTION AQUEUSE DE DIIODE I2 2,0 g?? 200 ml?? MASSE DE SOLUTÉ DISSOUTE QUANTITÉ DE MATIÈRE DE SOLUTÉ MASSE MOLAIRE DU SOLUTÉ VOLUME DE LA SOLUTION CONCENTRATION MOLAIRE CONCENTRATION MASSIQUE SOLUTION AQUEUSE DE SULFATE DE? 5, mol?? 1, mol.l 1? CUIVRE CUSO 4 MASSE DE SOLUTÉ DISSOUTE QUANTITÉ DE MATIÈRE DE SOLUTÉ MASSE MOLAIRE DU SOLUTÉ VOLUME DE LA SOLUTION CONCENTRATION MOLAIRE CONCENTRATION MASSIQUE 90 g SOLUTION AQUEUSE DE GLUCOSE???? 60 g.l 1 C 6 H 12 O 6 184

31 Auto-évaluation Exercice n 3 : Tableau d avancement (0,5 point par question, soit 1 point) Complétez le tableau d avancement proposé. Indiquez si les réactifs sont introduits dans les proportions stœchiométriques. Sinon, identifiez le réactif limitant et le réactif en excès. Justifiez. ÉTAT DU SYSTÈME AVANCEMENT 4 CO + Fe 3 O 4 4 CO Fe État Initial EI En cours de transformation État Final EF x 3, , x x f 2. Cohésion des solides ioniques et moléculaire Dissolution Exercice n 1 Complétez le tableau. (0,5 point par case, soit 8 points) NOM DU CRISTAL IONIQUE Chlorure de fer (II) FORMULE DU CRISTAL IONIQUE IONS CONSTITUANT LE CRISTAL IONIQUE (FORMULE ET NOM) Sulfate de magnésium Ca(OH) 2 Ion carbonate Ion sodium Permanganate de potassium LiBr Ion manganèse Ion phosphate CuI 2 CHIMIE 185

32 Sujet n 3 IFMK de l EFOM, 2013 Difficulté Durée 30 minutes Calculatrice interdite Données : Masses molaires atomiques en g/mol. M(C) = 12,0 M(H) = 1,0 M(O) = 16,0 QCM (10 points) 1 a. Lors du titrage ph-métrique d un acide faible par une base forte, le ph du milieu réactionnel à la demi-équivalence est égal à la moitié du ph à l équivalence, soit pka. b. Lors du titrage ph-métrique d un acide fort par une base forte, à l équilibre le ph vaut 7 à 25 C. c. Lorsque les réactifs sont introduits dans les proportions stœchiométriques de l équation chimique de la réaction support d un titrage ph-métrique, le ph dépend de la température du milieu réactionnel. d. Lors du titrage ph-métrique d une base forte par un acide fort, on peut écrire, à l équivalence du titrage : ph = pke/2. e. Lors d un dosage par titrage ph-métrique, il convient d utiliser un indicateur coloré de ph pour repérer l équivalence, grâce au changement de couleur du milieu réactionnel. 2 Soit la réaction d équation : CH 3 COOH(aq) + HO (aq) CH 3 COO (aq) + H 2 O(l). a. La constante d acidité Ka du couple acide éthanoïque/ion éthanoate s écrit : Ka = [CH 3 COO (aq)]éq/([ch 3 COOH(aq)]éq [HO (aq)]éq). b. L acide éthanoïque possède un groupe caractéristique acide carboxylique. c. L acide éthanoïque ne possède pas de carbone tétraédrique. d. Le dosage d une solution d acide éthanoïque par une solution d hydroxyde de sodium peut aussi bien être réalisé par titrage ph-métrique que colorimétrique ou conductimétrique. On mélange 50,0 ml d une solution aqueuse d acide éthanoïque de concentration molaire volumique en soluté apporté C A = 1, mol/l avec 25,0 ml d une solution aqueuse d hydroxyde de sodium de même concentration apportée. e. La solution obtenue est une solution tampon de ph. 3 a. La représentation de Lewis d une molécule permet la visualisation dans l espace de cette molécule. b. La molécule de 1-bromo-1-chloroéthane ne possède pas de carbone asymétrique. c. Il est possible de passer d une conformation d une molécule à une autre par rupture de liaisons simples. d. Un mélange racémique est un mélange de 2 diastéréoisomères. e. Deux énantiomères réagissent différemment avec des réactifs chiraux. 242

33 Sujet 3 4 Le chlorure de cuivre II est très soluble dans l eau. À 25 C, on peut dissoudre 700 g de ce cristal ionique anhydre dans un litre d eau. Une solution de chlorure de cuivre II a une concentration en ions chlorure égale à 20,0 mmol/l. Sa concentration en ions cuivre II est : a. 10,0 mmol/l b. 40,0 mmol/l On veut préparer une solution de concentration [Cu 2+ (aq)] = 20,0 mmol/l avec des cristaux de chlorure de cuivre II, solide hydraté de formule CuCl 2,2H 2 O. On donne M(CuCl 2 ) = 134,5 g/mol. La masse de solide à dissoudre pour obtenir 100 ml de solution est : c. 0,341 g. d. 0,269 g. e. On utilise un bécher gradué de 250 ml pour fabriquer cette solution. 5 Les acides -aminés sont les constituants des protéines. Ils ont pour formule générale : NH 2 -CHR-CO 2 H. a. Ces molécules possèdent 2 groupes caractéristiques : le groupe amine et le groupe acide carboxylique. b. Ces acides -aminés possèdent un caractère amphotère. La kératine est le principal constituant du cheveu. C est une protéine formée à partir d acides -aminés dont l un d entre eux est la cystéine de formule : H O HS CH 2 C C NH 2 O H c. La cystéine est une molécule achirale. d. Les représentations de Cram suivantes sont celles de 2 énantiomères de la cystéine : COOH COOH N H 2 C H CH 2 SH H CH 2 SH C NH 2 e. La cystéine possède un carbone de géométrie plane. 6 Les ions iodure I sont oxydés lentement par les ions peroxodisulfate S 2 O 8 2. On peut étudier expérimentalement la cinétique de cette réaction en dosant régulièrement le diiode formé, ce qui permet de tracer la courbe [S 2 O 8 2 (aq)] = f(t), donnant en fonction du temps la concentration en ions peroxodisulfate restants. Une première expérience, réalisée en présence de l ion Fe 3+ (aq) catalyseur à la température 1, permet de tracer la courbe (1) ci-après. CHIMIE 243

34 Sujets d annales a. La catalyse de la réaction par les ions Fe 3+ est une catalyse hétérogène. b. À t = 60 min, la concentration en diiode dans la solution est de 1, mol/l. On recommence la même expérience à une température 2 différente et on obtient la courbe (2) cidessus. c. 2> 1. d. 2< 1. e. La température du milieu réactionnel est un catalyseur de la réaction étudiée. Donnée : couples oxydant/réducteur I 2 /I S 2 O 8 2 /SO Le sang est coloré en rouge par l hémoglobine, molécule dont la masse molaire moléculaire vaut environ 66 kg/mol. Cette protéine, associée à l ion Fe 2+, contient en masse 0,34 % de fer. À 37 C, le ph du sang, régulé par le couple CO 2,H 2 O/HCO 3 est voisin de 7,4 ; mais le sang veineux est plus riche en dioxyde de carbone que le sang artériel. Données : Ke à 25 C = 1, M(Fe) = 56,0 g/mol Le produit ionique de l eau augmente avec la température de la solution. Aide au calcul : 17/7 = 2,4. a. À 37 C, le sang du corps humain est basique. b. Le couple CO 2,H 2 O/HCO 3 qui régule le ph sanguin est un «tampon» biologique. c. Le sang veineux est plus acide que le sang artériel. d. Une molécule d hémoglobine comporte 4 atomes de fer. e. pke(37 C) > pke(25 C) 8 On considère une molécule de formule brute C 4 H 7 OCl qui présente un spectre RMN du proton comportant 3 signaux : un quadruplet, un singulet et un doublet. Cette molécule possède un groupe carbonyle qui n est pas situé en bout de chaîne. a. Cette molécule peut être CH 2 Cl CH 2 CO CH 3. b. Cette molécule peut être CH 3 CHCl CO CH 3. c. Cette molécule peut être CH 3 CH 2 CO CH 2 Cl. d. La courbe d intégration correspondant au doublet présente un palier de hauteur 3 fois plus importante que celle du palier correspondant au quadruplet. e. La courbe d intégration présente 3 paliers de mêmes hauteurs. 9 On considère une molécule de formule brute C 9 H 20. Son spectre RMN du proton présente un quadruplet et un triplet. a. Cette molécule contient 2 groupes de protons équivalents. b. Le signal d intégration du spectre présente, pour chaque multiplet, des hauteurs identiques. c. Les signaux d intégration du spectre présentent, pour chaque multiplet, un rapport H q /H t = 2/3 avec H q la hauteur du signal d intégration du quadruplet et H t la hauteur du signal d intégration du triplet. d. La molécule étudiée peut être le 3,3-diéthylpentane. e. Le triplet correspond aux protons appartenant à un groupe méthyle. 10 Le principe tinctorial de l orcanette était utilisé par les anciens Égyptiens. Le colorant pourpre extrait des racines de l orcanette remplaçait la vraie pourpre (extraite de divers coquillages comme le murex) et était utilisé pour des textiles ordinaires. L écorce de ces racines contient plusieurs pigments naphtoquinoniques en assez forte proportion et on y trouve notamment l alkannine (acide anchusique) de formule : 244

35 Sujet 3 OH O OH OH O a. La formule brute de l alkannine est C 16 H 16 O 5. b. La formule de l alkannine donnée ci-dessus est une formule semi-développée. c. Un pigment est une substance colorante généralement soluble dans le milieu dans lequel elle est placée, contrairement à un colorant. d. La molécule d alkannine possède un carbone asymétrique. La molécule d alkannine peut être obtenue à partir de la réaction d équation suivante : OH O OH O OH + H 2 O OH O OH O e. Il s agit d une réaction de substitution. 11 L indigo est un pigment naturel autrefois extrait de plusieurs plantes comme le pastel ou l indigotier. Aujourd hui, c est une teinture très largement synthétisée et utilisée. La synthèse industrielle de l indigo (noté I) se fait à partir de naphtalène. La dernière étape de la fabrication correspond à la réaction d équation suivante : a. Les molécules notées A et B possèdent le même groupe caractéristique carbonyle. Pour réaliser la synthèse de l indigo au laboratoire, on procède de la façon suivante : on mélange 1,51 g de A, 7,25 ml de B (liquide densité d B = 0,80) et 10 ml d eau distillée ; on ajoute ensuite, goutte à goutte, 4,0 ml d une solution d hydroxyde de sodium à 2,0 mol/l apporté ; le mélange s échauffe et brunit : l indigo précipite ; l indigo formé est isolé, séché puis pesé. On obtient une masse de 580 mg de ce produit. Les masses molaires moléculaires des réactifs et des produits sont les suivantes : COMPOSÉ A B I MASSE MOLAIRE G/MOL b. Le réactif limitant est le réactif A. c. L opération qui permet d isoler l indigo formé du milieu réactionnel est une décantation. d. La masse d indigo attendue est d environ 1,0 g. e. Le rendement de la synthèse est d environ 58 %. CHIMIE 245

36 Sujets d annales 12 La mesure de l absorbance d une solution d indigo, dans l éthanol acidifié, en fonction de la longueur d onde conduit au spectre ci-dessous. a. La solution d indigo absorbe principalement dans le jaune/orangé. b. La couleur de l indigo correspond au mélange de toutes les radiations du visible non absorbées. c. Le spectre ci-dessus est une courbe d étalonnage. d. La molécule d indigo possède plusieurs liaisons doubles conjuguées. e. Les groupes C=O présents dans la molécule d indigo sont des groupes chromophores. Corrigé QCM 1 c, d. Pour les autres propositions : À la 1/2 équivalence, ph = pka. Ce n est pas à l équilibre mais à l équivalence. Pour choisir convenablement un indicateur coloré pour un titrage colorimétrique, il faut que le ph à l équivalence soit contenu dans la zone de virage de l indicateur coloré. C est l indicateur coloré qui change de couleur 2 b, d. b. Attention, Ka = [CH 3 COO (aq)]éq [H 3 O + (aq)]éq / ([CH 3 COOH(aq)]éq) d. C est le cas du titrage d un acide faible par une base forte. On est ici à la 1/2 équivalence. On a donc ph = pka. 3 e. La plupart des processus du vivant mettent en jeu des phénomènes chiraux. Un récepteur biologique peut reconnaître en général une seule forme énantiomère d une molécule chirale et pas l autre! Deux énantiomères ont des propriétés physiques et chimiques identiques mais des propriétés biologiques différentes. Exemple : l énantiomère de configuration R de l adrénaline est un très bon stimulant cardiaque, tandis que l énantiomère S n exerce aucun effet thérapeutique! Pour les autres propositions : Cette représentation met en évidence les liaisons covalentes et les doublets non liants d une molécule dans le plan. Le carbone est relié à 4 atomes ou groupes d atomes différents. Il est donc asymétrique. Le passage d une conformation à l autre se fait par simple rotation autour de la liaison carbone/ carbone. Pas de rupture de liaison! C est un mélange équimolaire de 2 énantiomères. 4 a, c. a. [Cl ] = 2[Cu 2+ ] = 20 mmol/l c. CuCl 2, 2H 2 O Cu Cl xf = n(cu 2+ ) = ,1 = mol. M(CuCl 2,2H 2 O) = 134, = 170,5 g/mol. m(cucl 2, 2H 2 O) = xf M = 0,341 g. Pour la dernière proposition : Pour la dissolution de ce cristal, on utilise une fiole jaugée de 100 ml. 246

37 Sujet 3 5 a, b, d, e. b. Selon le ph, ces acides peuvent jouer le rôle d un acide ou d une base dans deux couples différents. Exemple : l alanine : NH 2 CH 3 CH COOH pka 1 (CH 3 CH(NH 3+ ) COOH/CH 3 CH(NH 3+ ) COO ) = 2,35 pka 2 (CH 3 CH(NH 3+ ) COO /CH 3 CH(NH 2 ) COO ) = 9,7 2,3 9,7 CH 3 CH(NH 3+ ) COOH CH 3 CH(NH 3+ ) COO CH 3 CH(NH 2 ) COO e. Il s agit du carbone du groupe carboxyle COOH. Pour la troisième proposition : Elle possède un carbone asymétrique. Elle est donc chirale. COOH H CH 2 SH C NH 2 ph c. Le sang veineux est plus riche en dioxyde de carbone que le sang artériel (cf. énoncé) CO 2,H 2 O + H 2 O HCO 3 + H 3 O + Si la quantité de CO 2 est plus importante dans le sang veineux, il y a déplacement de l équilibre dans le sens direct, c est-à-dire la formation des ions H 3 O +. Le ph sera donc de plus en plus faible. La solution de sang veineux est donc de plus en plus acide. d. M(Hémoglobine) = g/mol. %(Fe) = 0,34 = (56 x 100)/M(hémoglobine) x = 4. Pour la dernière proposition : Le pke diminue avec la température. pke(37 C) < pke(25 C) 8 b, d. d. 6 b, c. b. S 2 O I 2SO I 2 À 60 min, [S 2 O 8 2 ] restant = mol/l (courbe 1) [I 2 ] formé = [S 2 O 8 2 ] initial [S 2 O 8 2 ] restant = 1, mol/l. On recommence la même expérience à une température 2 différente et on obtient la courbe (2) ci-dessus. c. La pente de la courbe 2 est plus forte que celle de la courbe 1. La cinétique de l expérience réalisée à 2 est plus grande. Cela est dû à l augmentation de la température. On atteint plus rapidement l état d équilibre. Autrement dit, le temps de demi-réaction de l expérience 2 est plus faible que celui de l expérience 1. Pour les autres propositions : Attention, le catalyseur et les réactifs sont dans la même phase. Il s agit d une catalyse homogène. La température est un facteur cinétique. 7 a, b, c, d. a. Le Ke augmente avec la température donc le pke diminue avec la température. Donc à 37 C, pke < 7. Par conséquent, à ph = 7,4, le sang humain a bien un ph basique. 9 a, c, d, e. a. CH 2 CH 3 CH 2 CH 3 C CH 2 CH 3 CH 2 CH 3 Pour la deuxième proposition : 12 protons équivalents sont responsables du triplet. 8 protons équivalents sont responsables du quadruplet. 10 a, d. Pour les autres propositions : Il s agit d une formule topologique dans laquelle les atomes de carbone n apparaissent pas. C est l inverse, le pigment est insoluble dans le milieu dans lequel il est placé, contrairement au colorant. C est une réaction d addition. Il y a rupture de la double liaison C=C. CHIMIE 247

38 Sujets d annales 11 d, e. d. n(i) = n(ho )/2 = mol. m = = 1,048 g soit 1 g environ. e. R = m(indigo)obtenu expérimentalement/ m(indigo si réaction totale) = 0,58/1 = 58 %. Pour les autres propositions : Il y a un groupe carbonyle de type aldéhyde pour la molécule A et de type cétone pour la molécule B. Le réactif limitant est le réactif A. n(a) = m/m = 1,51/151 = 0,01 mol. n(b) = m/m = ρv/m = 0,1 mol. n(ho ) = mol. C est HO qui est limitant! C est une filtration. 12 a, b, d, e. a. La solution a une absorption maximale autour de 600 nm, qui correspond bien à la longueur du jaune/orangé. d. Vrai, il y a des groupes chromophores responsable de la coloration de cette molécule. e. L absorption d un photon dans le domaine UVvisible peut être attribuée à des électrons appartenant à des groupes d atomes du type : C=C ; C =O ; C=N ; C C ; C N. Pour la troisième proposition : C est une courbe représentant l absorbance en fonction de la longueur d onde. 248

39

40 PARAMÉDICAL CONCOURS 2014/2015 Concours Masseur-kinésithérapeute Annales corrigées Mettez toutes les chances de votre côté! Un ouvrage complet : des plannings de révision des tests d auto-évaluation une méthodologie détaillée avec des conseils pratiques 17 sujets d annales en biologie, physique et chimie Des auteurs spécialistes du concours, enseignants et formateurs au plus près des réalités des épreuves Une collection pour répondre à tous vos besoins Le Tout-en-un pour une préparation complète Les Entraînements pour se mettre en condition Les Fiches pour aller à l essentiel Un site dédié aux concours : toutes les infos utiles et de nombreux entraînements gratuits ISBN :

EXERCICE II. SYNTHÈSE D UN ANESTHÉSIQUE : LA BENZOCAÏNE (9 points)

EXERCICE II. SYNTHÈSE D UN ANESTHÉSIQUE : LA BENZOCAÏNE (9 points) Bac S 2015 Antilles Guyane http://labolycee.org EXERCICE II. SYNTHÈSE D UN ANESTHÉSIQUE : LA BENZOCAÏNE (9 points) La benzocaïne (4-aminobenzoate d éthyle) est utilisée en médecine comme anesthésique local

Plus en détail

CHAPITRE 3 LA SYNTHESE DES PROTEINES

CHAPITRE 3 LA SYNTHESE DES PROTEINES CHAITRE 3 LA SYNTHESE DES ROTEINES On sait qu un gène détient dans sa séquence nucléotidique, l information permettant la synthèse d un polypeptide. Ce dernier caractérisé par sa séquence d acides aminés

Plus en détail

SUIVI CINETIQUE PAR SPECTROPHOTOMETRIE (CORRECTION)

SUIVI CINETIQUE PAR SPECTROPHOTOMETRIE (CORRECTION) Terminale S CHIMIE TP n 2b (correction) 1 SUIVI CINETIQUE PAR SPECTROPHOTOMETRIE (CORRECTION) Objectifs : Déterminer l évolution de la vitesse de réaction par une méthode physique. Relier l absorbance

Plus en détail

BAC BLANC SCIENCES PHYSIQUES. Durée : 3 heures 30

BAC BLANC SCIENCES PHYSIQUES. Durée : 3 heures 30 Terminales S1, S2, S3 2010 Vendredi 29 janvier BAC BLANC SCIENCES PHYSIQUES Durée : 3 heures 30 Toutes les réponses doivent être correctement rédigées et justifiées. Chaque exercice sera traité sur une

Plus en détail

Ce document a été mis en ligne par le Canopé de l académie de Bordeaux pour la Base Nationale des Sujets d Examens de l enseignement professionnel.

Ce document a été mis en ligne par le Canopé de l académie de Bordeaux pour la Base Nationale des Sujets d Examens de l enseignement professionnel. Ce document a été mis en ligne par le Canopé de l académie de Bordeaux pour la Base Nationale des Sujets d Examens de l enseignement professionnel. Ce fichier numérique ne peut être reproduit, représenté,

Plus en détail

Cahier de texte de la classe 1 ère 4 - SVT

Cahier de texte de la classe 1 ère 4 - SVT Cahier de texte de la classe 1 ère 4 - SVT DATE SEQUENCE lundi 12 : revoir la fiche méthodologique «utiliser le microscope optique» (disponible sur le site du lycée) Lundi 12 1 er contact avec les élèves.

Plus en détail

SP. 3. Concentration molaire exercices. Savoir son cours. Concentrations : Classement. Concentration encore. Dilution :

SP. 3. Concentration molaire exercices. Savoir son cours. Concentrations : Classement. Concentration encore. Dilution : SP. 3 Concentration molaire exercices Savoir son cours Concentrations : Calculer les concentrations molaires en soluté apporté des solutions désinfectantes suivantes : a) Une solution de 2,0 L contenant

Plus en détail

TS1 TS2 02/02/2010 Enseignement obligatoire. DST N 4 - Durée 3h30 - Calculatrice autorisée

TS1 TS2 02/02/2010 Enseignement obligatoire. DST N 4 - Durée 3h30 - Calculatrice autorisée TS1 TS2 02/02/2010 Enseignement obligatoire DST N 4 - Durée 3h30 - Calculatrice autorisée EXERCICE I : PRINCIPE D UNE MINUTERIE (5,5 points) A. ÉTUDE THÉORIQUE D'UN DIPÔLE RC SOUMIS À UN ÉCHELON DE TENSION.

Plus en détail

Chapitre 7 Les solutions colorées

Chapitre 7 Les solutions colorées Chapitre 7 Les solutions colorées Manuel pages 114 à 127 Choix pédagogiques. Ce chapitre a pour objectif d illustrer les points suivants du programme : - dosage de solutions colorées par étalonnage ; -

Plus en détail

LABORATOIRES DE CHIMIE Techniques de dosage

LABORATOIRES DE CHIMIE Techniques de dosage LABORATOIRES DE CHIMIE Techniques de dosage Un dosage (ou titrage) a pour but de déterminer la concentration molaire d une espèce (molécule ou ion) en solution (généralement aqueuse). Un réactif de concentration

Plus en détail

THEME 2. LE SPORT CHAP 1. MESURER LA MATIERE: LA MOLE

THEME 2. LE SPORT CHAP 1. MESURER LA MATIERE: LA MOLE THEME 2. LE SPORT CHAP 1. MESURER LA MATIERE: LA MOLE 1. RAPPEL: L ATOME CONSTITUANT DE LA MATIERE Toute la matière de l univers, toute substance, vivante ou inerte, est constituée à partir de particules

Plus en détail

Cahier de texte de la classe 1 ère 3 - SVT

Cahier de texte de la classe 1 ère 3 - SVT Cahier de texte de la classe 1 ère 3 - SVT DATE SEQUENCE jeudi 8 : revoir la fiche méthodologique «utiliser le microscope optique» (disponible sur le site du lycée) Jeudi 8 1 er contact avec les élèves.

Plus en détail

EXERCICE I : Où il est question de lumière (8 points) PARTIE A. Figure 2

EXERCICE I : Où il est question de lumière (8 points) PARTIE A. Figure 2 EXERCICE I : Où il est question de lumière (8 points) PARTIE A 1. Figure 2 D On observe sur l'écran un étalement du faisceau laser, perpendiculaire à la direction du fil, constitué d'une tache centrale

Plus en détail

Les solutions. Chapitre 2 - Modèle. 1 Définitions sur les solutions. 2 Concentration massique d une solution. 3 Dilution d une solution

Les solutions. Chapitre 2 - Modèle. 1 Définitions sur les solutions. 2 Concentration massique d une solution. 3 Dilution d une solution Chapitre 2 - Modèle Les solutions 1 Définitions sur les solutions 1.1 Définition d une solution : Une solution est le mélange homogène et liquide d au moins deux espèces chimiques : Le soluté : c est une

Plus en détail

EXERCICE 2 : SUIVI CINETIQUE D UNE TRANSFORMATION PAR SPECTROPHOTOMETRIE (6 points)

EXERCICE 2 : SUIVI CINETIQUE D UNE TRANSFORMATION PAR SPECTROPHOTOMETRIE (6 points) BAC S 2011 LIBAN http://labolycee.org EXERCICE 2 : SUIVI CINETIQUE D UNE TRANSFORMATION PAR SPECTROPHOTOMETRIE (6 points) Les parties A et B sont indépendantes. A : Étude du fonctionnement d un spectrophotomètre

Plus en détail

TP : Suivi d'une réaction par spectrophotométrie

TP : Suivi d'une réaction par spectrophotométrie Nom : Prénom: n groupe: TP : Suivi d'une réaction par spectrophotométrie Consignes de sécurité de base: Porter une blouse en coton, pas de nu-pieds Porter des lunettes, des gants (en fonction des espèces

Plus en détail

ACIDES BASES. Chap.5 SPIESS

ACIDES BASES. Chap.5 SPIESS ACIDES BASES «Je ne crois pas que l on me conteste que l acide n ait des pointes Il ne faut que le goûter pour tomber dans ce sentiment car il fait des picotements sur la langue.» Notion d activité et

Plus en détail

ANALYSE SPECTRALE. monochromateur

ANALYSE SPECTRALE. monochromateur ht ANALYSE SPECTRALE Une espèce chimique est susceptible d interagir avec un rayonnement électromagnétique. L étude de l intensité du rayonnement (absorbé ou réémis) en fonction des longueurs d ode s appelle

Plus en détail

Partie Observer : Ondes et matière CHAP 04-ACT/DOC Analyse spectrale : Spectroscopies IR et RMN

Partie Observer : Ondes et matière CHAP 04-ACT/DOC Analyse spectrale : Spectroscopies IR et RMN Partie Observer : Ondes et matière CHAP 04-ACT/DOC Analyse spectrale : Spectroscopies IR et RMN Objectifs : Exploiter un spectre infrarouge pour déterminer des groupes caractéristiques Relier un spectre

Plus en détail

Rappels sur les couples oxydantsréducteurs

Rappels sur les couples oxydantsréducteurs CHAPITRE 1 TRANSFORMATIONS LENTES ET RAPIDES 1 Rappels sur les couples oxydantsréducteurs 1. Oxydants et réducteurs Un réducteur est une espèce chimique capable de céder au moins un électron Demi-équation

Plus en détail

(aq) sont colorées et donnent à la solution cette teinte violette, assimilable au magenta.»

(aq) sont colorées et donnent à la solution cette teinte violette, assimilable au magenta.» Chapitre 5 / TP 1 : Contrôle qualité de l'eau de Dakin par dosage par étalonnage à l'aide d'un spectrophotomètre Objectif : Vous devez vérifier la concentration massique d'un désinfectant, l'eau de Dakin.

Plus en détail

Chapitre 02. La lumière des étoiles. Exercices :

Chapitre 02. La lumière des étoiles. Exercices : Chapitre 02 La lumière des étoiles. I- Lumière monochromatique et lumière polychromatique. )- Expérience de Newton (642 727). 2)- Expérience avec la lumière émise par un Laser. 3)- Radiation et longueur

Plus en détail

DÉTERMINATION DU POURCENTAGE EN ACIDE D UN VINAIGRE. Sommaire

DÉTERMINATION DU POURCENTAGE EN ACIDE D UN VINAIGRE. Sommaire BACCALAURÉAT SÉRIE S Épreuve de PHYSIQUE CHIMIE Évaluation des compétences expérimentales Sommaire I. DESCRIPTIF DU SUJET DESTINÉ AUX PROFESSEURS... 2 II. LISTE DE MATÉRIEL DESTINÉE AUX PROFESSEURS ET

Plus en détail

Olympiade francophone de chimie 2009 : 1 ère épreuve Niveau 1 Correctif

Olympiade francophone de chimie 2009 : 1 ère épreuve Niveau 1 Correctif Olympiade francophone de chimie 2009 : 1 ère épreuve Niveau 1 Correctif 1. Question 1 Etant donné que le germanium (Ge) est dans la même colonne que le carbone, cela implique qu il possède 4 électrons

Plus en détail

Dr E. CHEVRET UE2.1 2013-2014. Aperçu général sur l architecture et les fonctions cellulaires

Dr E. CHEVRET UE2.1 2013-2014. Aperçu général sur l architecture et les fonctions cellulaires Aperçu général sur l architecture et les fonctions cellulaires I. Introduction II. Les microscopes 1. Le microscope optique 2. Le microscope à fluorescence 3. Le microscope confocal 4. Le microscope électronique

Plus en détail

Comment suivre l évolution d une transformation chimique? + S 2 O 8 = I 2 + 2 SO 4

Comment suivre l évolution d une transformation chimique? + S 2 O 8 = I 2 + 2 SO 4 Afin d optimiser leurs procédés, les industries chimiques doivent contrôler le bon déroulement de la réaction de synthèse menant aux espèces voulues. Comment suivre l évolution d une transformation chimique?

Plus en détail

Titre alcalimétrique et titre alcalimétrique complet

Titre alcalimétrique et titre alcalimétrique complet Titre alcalimétrique et titre alcalimétrique complet A Introduction : ) Définitions : Titre Alcalimétrique (T.A.) : F m / L T.A. T.A.C. Définition : C'est le volume d'acide (exprimé en ml) à 0,0 mol.l

Plus en détail

POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA

POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA Amplification spécifique Détection spécifique Clonage dans des vecteurs Amplification in vitro PCR Hybridation moléculaire - hôte cellulaire

Plus en détail

La spectrophotométrie

La spectrophotométrie Chapitre 2 Document de cours La spectrophotométrie 1 Comment interpréter la couleur d une solution? 1.1 Décomposition de la lumière blanche En 1666, Isaac Newton réalise une expérience cruciale sur la

Plus en détail

pka D UN INDICATEUR COLORE

pka D UN INDICATEUR COLORE TP SPETROPHOTOMETRIE Lycée F.BUISSON PTSI pka D UN INDIATEUR OLORE ) Principes de la spectrophotométrie La spectrophotométrie est une technique d analyse qualitative et quantitative, de substances absorbant

Plus en détail

FICHE 1 Fiche à destination des enseignants

FICHE 1 Fiche à destination des enseignants FICHE 1 Fiche à destination des enseignants 1S 8 (b) Un entretien d embauche autour de l eau de Dakin Type d'activité Activité expérimentale avec démarche d investigation Dans cette version, l élève est

Plus en détail

AGREGATION DE BIOCHIMIE GENIE BIOLOGIQUE

AGREGATION DE BIOCHIMIE GENIE BIOLOGIQUE AGREGATION DE BIOCHIMIE GENIE BIOLOGIQUE CONCOURS EXTERNE Session 2005 TRAVAUX PRATIQUES DE BIOCHIMIE PHYSIOLOGIE ALCOOL ET FOIE L éthanol, psychotrope puissant, est absorbé passivement dans l intestin

Plus en détail

Suivi d une réaction lente par chromatographie

Suivi d une réaction lente par chromatographie TS Activité Chapitre 8 Cinétique chimique Suivi d une réaction lente par chromatographie Objectifs : Analyser un protocole expérimental de synthèse chimique Analyser un chromatogramme pour mettre en évidence

Plus en détail

Chapitre n 6 MASSE ET ÉNERGIE DES NOYAUX

Chapitre n 6 MASSE ET ÉNERGIE DES NOYAUX Chapitre n 6 MASSE ET ÉNERGIE DES NOYAUX T ale S Introduction : Une réaction nucléaire est Une réaction nucléaire provoquée est L'unité de masse atomique est une unité permettant de manipuler aisément

Plus en détail

Spectrophotométrie - Dilution 1 Dilution et facteur de dilution. 1.1 Mode opératoire :

Spectrophotométrie - Dilution 1 Dilution et facteur de dilution. 1.1 Mode opératoire : Spectrophotométrie - Dilution 1 Dilution et facteur de dilution. 1.1 Mode opératoire : 1. Prélever ml de la solution mère à la pipette jaugée. Est-ce que je sais : Mettre une propipette sur une pipette

Plus en détail

Chapitre 11: Réactions nucléaires, radioactivité et fission

Chapitre 11: Réactions nucléaires, radioactivité et fission 1re B et C 11 Réactions nucléaires, radioactivité et fission 129 Chapitre 11: Réactions nucléaires, radioactivité et fission 1. Définitions a) Nucléides (= noyaux atomiques) Les nucléides renferment les

Plus en détail

Le vivant est complexe: - 30 millions de types d organismes - 100 000 protéines différentes chez l homme

Le vivant est complexe: - 30 millions de types d organismes - 100 000 protéines différentes chez l homme Introduction Le vivant est complexe: - 30 millions de types d organismes - 100 000 protéines différentes chez l homme Informatique: - stocker les données - éditer les données - analyser les données (computational

Plus en détail

Mesures et incertitudes

Mesures et incertitudes En physique et en chimie, toute grandeur, mesurée ou calculée, est entachée d erreur, ce qui ne l empêche pas d être exploitée pour prendre des décisions. Aujourd hui, la notion d erreur a son vocabulaire

Plus en détail

DM n o 8 TS1 2012 Physique 10 (satellites) + Chimie 12 (catalyse) Exercice 1 Lancement d un satellite météorologique

DM n o 8 TS1 2012 Physique 10 (satellites) + Chimie 12 (catalyse) Exercice 1 Lancement d un satellite météorologique DM n o 8 TS1 2012 Physique 10 (satellites) + Chimie 12 (catalyse) Exercice 1 Lancement d un satellite météorologique Le centre spatial de Kourou a lancé le 21 décembre 200, avec une fusée Ariane, un satellite

Plus en détail

Cours 5. Transmission et remaniement de l information génétique. http://rna.igmors.u-psud.fr/gautheret/cours/

Cours 5. Transmission et remaniement de l information génétique. http://rna.igmors.u-psud.fr/gautheret/cours/ Cours 5 Transmission et remaniement de l information génétique http://rna.igmors.u-psud.fr/gautheret/cours/ 1 Plan Rappels sur la réplication de l ADN Le cycle cellulaire et ses contrôles La mitose Recombinaisons

Plus en détail

Niveau 2 nde THEME : L UNIVERS. Programme : BO spécial n 4 du 29/04/10 L UNIVERS

Niveau 2 nde THEME : L UNIVERS. Programme : BO spécial n 4 du 29/04/10 L UNIVERS Document du professeur 1/7 Niveau 2 nde THEME : L UNIVERS Physique Chimie SPECTRES D ÉMISSION ET D ABSORPTION Programme : BO spécial n 4 du 29/04/10 L UNIVERS Les étoiles : l analyse de la lumière provenant

Plus en détail

La physique nucléaire et ses applications

La physique nucléaire et ses applications La physique nucléaire et ses applications I. Rappels et compléments sur les noyaux. Sa constitution La représentation symbolique d'un noyau est, dans laquelle : o X est le symbole du noyau et par extension

Plus en détail

1 er sujet : ancre GPI et association aux rafts (64 points)

1 er sujet : ancre GPI et association aux rafts (64 points) Université Joseph Fourier - Grenoble I Année 2007-2008 Epreuve de BIO121 1 ère session mai 2008 Durée : 2 heures Les documents, la calculette et le téléphone portable ne sont pas autorisés. Total des points

Plus en détail

5.5.5 Exemple d un essai immunologique

5.5.5 Exemple d un essai immunologique 5.5.5 Exemple d un essai immunologique Test de grossesse Test en forme de bâtonnet destiné à mettre en évidence l'hormone spécifique de la grossesse, la gonadotrophine chorionique humaine (hcg), une glycoprotéine.

Plus en détail

Résonance Magnétique Nucléaire : RMN

Résonance Magnétique Nucléaire : RMN 21 Résonance Magnétique Nucléaire : RMN Salle de TP de Génie Analytique Ce document résume les principaux aspects de la RMN nécessaires à la réalisation des TP de Génie Analytique de 2ème année d IUT de

Plus en détail

Meine Flüssigkeit ist gefärbt*, comme disaient August Beer (1825-1863) et Johann Heinrich Lambert (1728-1777)

Meine Flüssigkeit ist gefärbt*, comme disaient August Beer (1825-1863) et Johann Heinrich Lambert (1728-1777) 1ère S Meine Flüssigkeit ist gefärbt*, comme disaient August Beer (1825-1863) et Johann Heinrich Lambert (1728-1777) Objectif : pratiquer une démarche expérimentale pour déterminer la concentration d une

Plus en détail

A retenir : A Z m n. m noyau MASSE ET ÉNERGIE RÉACTIONS NUCLÉAIRES I) EQUIVALENCE MASSE-ÉNERGIE

A retenir : A Z m n. m noyau MASSE ET ÉNERGIE RÉACTIONS NUCLÉAIRES I) EQUIVALENCE MASSE-ÉNERGIE CP7 MASSE ET ÉNERGIE RÉACTIONS NUCLÉAIRES I) EQUIVALENCE MASSE-ÉNERGIE 1 ) Relation d'équivalence entre la masse et l'énergie -énergie de liaison 2 ) Une unité d énergie mieux adaptée 3 ) application 4

Plus en détail

Séquence 1. Physique Couleur, vision et image Chimie La réaction chimique. Sommaire

Séquence 1. Physique Couleur, vision et image Chimie La réaction chimique. Sommaire Séquence 1 Physique Couleur, vision et image Chimie La réaction chimique Sommaire 1. Physique : Couleur, vision et image Résumé Exercices 2. Chimie : La réaction chimique Résumé Exercices Séquence 1 Chapitre

Plus en détail

PHYSIQUE-CHIMIE. Partie I - Spectrophotomètre à réseau

PHYSIQUE-CHIMIE. Partie I - Spectrophotomètre à réseau PHYSIQUE-CHIMIE L absorption des radiations lumineuses par la matière dans le domaine s étendant du proche ultraviolet au très proche infrarouge a beaucoup d applications en analyse chimique quantitative

Plus en détail

TD de Biochimie 4 : Coloration.

TD de Biochimie 4 : Coloration. TD de Biochimie 4 : Coloration. Synthèse de l expérience 2 Les questions posées durant l expérience 2 Exposé sur les méthodes de coloration des molécules : Générique Spécifique Autres Questions Pourquoi

Plus en détail

Exemple de cahier de laboratoire : cas du sujet 2014

Exemple de cahier de laboratoire : cas du sujet 2014 Exemple de cahier de laboratoire : cas du sujet 2014 Commentaires pour l'évaluation Contenu du cahier de laboratoire Problématique : Le glucose est un nutriment particulièrement important pour le sportif.

Plus en détail

Chapitre 5 : Noyaux, masse et énergie

Chapitre 5 : Noyaux, masse et énergie Chapitre 5 : Noyaux, masse et énergie Connaissances et savoir-faire exigibles : () () (3) () (5) (6) (7) (8) Définir et calculer un défaut de masse et une énergie de liaison. Définir et calculer l énergie

Plus en détail

Lycée Galilée Gennevilliers. chap. 6. JALLU Laurent. I. Introduction... 2 La source d énergie nucléaire... 2

Lycée Galilée Gennevilliers. chap. 6. JALLU Laurent. I. Introduction... 2 La source d énergie nucléaire... 2 Lycée Galilée Gennevilliers L'énergie nucléaire : fusion et fission chap. 6 JALLU Laurent I. Introduction... 2 La source d énergie nucléaire... 2 II. Équivalence masse-énergie... 3 Bilan de masse de la

Plus en détail

Physique Chimie. Réaliser les tests de reconnaissance des ions Cl -,

Physique Chimie. Réaliser les tests de reconnaissance des ions Cl -, Document du professeur 1/5 Niveau 3 ème Physique Chimie Programme A - La chimie, science de la transformation de la matière Connaissances Capacités Exemples d'activités Comment reconnaître la présence

Plus en détail

Chapitre 6. Réactions nucléaires. 6.1 Généralités. 6.1.1 Définitions. 6.1.2 Lois de conservation

Chapitre 6. Réactions nucléaires. 6.1 Généralités. 6.1.1 Définitions. 6.1.2 Lois de conservation Chapitre 6 Réactions nucléaires 6.1 Généralités 6.1.1 Définitions Un atome est constitué d électrons et d un noyau, lui-même constitué de nucléons (protons et neutrons). Le nombre de masse, noté, est le

Plus en détail

TRANSCRIPTION TRADUCTION

TRANSCRIPTION TRADUCTION 4 TRANSCRIPTION TRADUCTION Objectifs : définir transcription et traduction et donner leur localisation cellulaire sur un schéma, identifier les acteurs de la transcription (ARNpol, brin transcrit, ARNm)

Plus en détail

Sujet. calculatrice: autorisée durée: 4 heures

Sujet. calculatrice: autorisée durée: 4 heures DS SCIENCES PHYSIQUES MATHSPÉ calculatrice: autorisée durée: 4 heures Sujet Spectrophotomètre à réseau...2 I.Loi de Beer et Lambert... 2 II.Diffraction par une, puis par deux fentes rectangulaires... 3

Plus en détail

BREVET D ÉTUDES PROFESSIONNELLES AGRICOLES SUJET

BREVET D ÉTUDES PROFESSIONNELLES AGRICOLES SUJET SESSION 2010 France métropolitaine Option : élevage canin et félin BREVET D ÉTUDES PROFESSIONNELLES AGRICOLES ÉPREUVE E DU DEUXIÈME GROUPE Durée : 2 heures Matériel(s) et document(s) autorisé(s) : Calculatrice

Plus en détail

1 ère partie : tous CAP sauf hôtellerie et alimentation CHIMIE ETRE CAPABLE DE. PROGRAMME - Atomes : structure, étude de quelques exemples.

1 ère partie : tous CAP sauf hôtellerie et alimentation CHIMIE ETRE CAPABLE DE. PROGRAMME - Atomes : structure, étude de quelques exemples. Référentiel CAP Sciences Physiques Page 1/9 SCIENCES PHYSIQUES CERTIFICATS D APTITUDES PROFESSIONNELLES Le référentiel de sciences donne pour les différentes parties du programme de formation la liste

Plus en détail

BACCALAURÉAT GÉNÉRAL PHYSIQUE-CHIMIE

BACCALAURÉAT GÉNÉRAL PHYSIQUE-CHIMIE BAALAURÉAT GÉNÉRAL SESSIN 2015 PYSIQUE-IMIE Série S Durée de l épreuve : 3 heures 30 oefficient : 6 L usage de la calculatrice est autorisé e sujet ne nécessite pas de feuille de papier millimétré Le sujet

Plus en détail

K W = [H 3 O + ] [OH - ] = 10-14 = K a K b à 25 C. [H 3 O + ] = [OH - ] = 10-7 M Solution neutre. [H 3 O + ] > [OH - ] Solution acide

K W = [H 3 O + ] [OH - ] = 10-14 = K a K b à 25 C. [H 3 O + ] = [OH - ] = 10-7 M Solution neutre. [H 3 O + ] > [OH - ] Solution acide La constante d autoprotolyse de l eau, K W, est égale au produit de K a par K b pour un couple acide/base donné : En passant en échelle logarithmique, on voit donc que la somme du pk a et du pk b d un

Plus en détail

EXERCİCE N 1 : «Synthèse de l éthanamide» (7 pts)

EXERCİCE N 1 : «Synthèse de l éthanamide» (7 pts) Terminale S Lycée Massignon DEVİR MMUN N 4 Durée : 2h Les calculatrices sont autorisées. Il sera tenu compte de la qualité de la rédaction et de la cohérence des chiffres significatifs. EXERİE N 1 : «Synthèse

Plus en détail

Indicateur d'unité Voyant Marche/Arrêt

Indicateur d'unité Voyant Marche/Arrêt Notice MESURACOLOR Colorimètre à DEL Réf. 22020 Indicateur d'unité Voyant Marche/Arrêt Indicateur Etalonnage Bouton Marche/Arrêt Indicateur de sélection de la longueur d'onde Indicateur de mode chronomètre

Plus en détail

Comprendre l Univers grâce aux messages de la lumière

Comprendre l Univers grâce aux messages de la lumière Seconde / P4 Comprendre l Univers grâce aux messages de la lumière 1/ EXPLORATION DE L UNIVERS Dans notre environnement quotidien, les dimensions, les distances sont à l échelle humaine : quelques mètres,

Plus en détail

DAEU- cours de Sciences de la Nature et de la Vie- Marie Claire Garnier

DAEU- cours de Sciences de la Nature et de la Vie- Marie Claire Garnier Partie 3 : génétique Chapitre 1 : la transmission d un caractère au cours de la reproduction sexuée Rappel : la reproduction sexuée comprend 2 phénomènes fondamentaux successifs : La méiose lors de la

Plus en détail

Fiche 19 La couleur des haricots verts et cuisson

Fiche 19 La couleur des haricots verts et cuisson Fiche 19 La couleur des haricots verts et cuisson Objectif : Valider ou réfuter des «précisions culinaires»* permettant de "conserver une belle couleur verte" lors la cuisson des haricots verts frais (gousses

Plus en détail

EXERCICES : MECANISMES DE L IMMUNITE : pages 406 407 408 409 410

EXERCICES : MECANISMES DE L IMMUNITE : pages 406 407 408 409 410 EXERCICES : MECANISMES DE L IMMUNITE : pages 406 407 408 409 410 EXERCICE 1 PAGE 406 : EXPERIENCES A INTERPRETER Question : rôles respectifs du thymus et de la moelle osseuse dans la production des lymphocytes.

Plus en détail

TP 3 diffusion à travers une membrane

TP 3 diffusion à travers une membrane TP 3 diffusion à travers une membrane CONSIGNES DE SÉCURITÉ Ce TP nécessite la manipulation de liquides pouvant tacher les vêtements. Le port de la blouse est fortement conseillé. Les essuie tout en papier

Plus en détail

Transformations nucléaires

Transformations nucléaires I Introduction Activité p286 du livre Transformations nucléaires II Les transformations nucléaires II.a Définition La désintégration radioactive d un noyau est une transformation nucléaire particulière

Plus en détail

TD La régulation de la glycémie

TD La régulation de la glycémie TD La régulation de la glycémie Comme nous l avons vu dans le chapitre 1, le milieu intérieur subit en permanence des modifications dues à l activité cellulaire ou aux apports extérieurs. Cependant, un

Plus en détail

β-galactosidase A.2.1) à 37 C, en tampon phosphate de sodium 0,1 mol/l ph 7 plus 2-mercaptoéthanol 1 mmol/l et MgCl 2 1 mmol/l (tampon P)

β-galactosidase A.2.1) à 37 C, en tampon phosphate de sodium 0,1 mol/l ph 7 plus 2-mercaptoéthanol 1 mmol/l et MgCl 2 1 mmol/l (tampon P) bioch/enzymo/tp-betagal-initiation-michaelis.odt JF Perrin maj sept 2008-sept 2012 page 1/6 Etude de la β-galactosidase de E. Coli : mise en évidence d'un comportement Michaélien lors de l'hydrolyse du

Plus en détail

Chapitre 2 : régulation des cycles sexuels chez la femme

Chapitre 2 : régulation des cycles sexuels chez la femme Partie 2 : reproduction Chapitre 2 : régulation des cycles sexuels chez la femme I l aspect de certains organes varie avec le temps 1- Observations directes 2- Observations microscopiques 3- Interactions

Plus en détail

TRAVAUX PRATIQUESDE BIOCHIMIE L1

TRAVAUX PRATIQUESDE BIOCHIMIE L1 TRAVAUX PRATIQUESDE BICHIMIE L1 PRINTEMPS 2011 Les acides aminés : chromatographie sur couche mince courbe de titrage Etude d une enzyme : la phosphatase alcaline QUELQUES RECMMANDATINS IMPRTANTES Le port

Plus en détail

Enseignement secondaire

Enseignement secondaire Enseignement secondaire Classe de IIIe Chimie 3e classique F - Musique Nombre de leçons: 1.5 Nombre minimal de devoirs: 4 devoirs par an Langue véhiculaire: Français I. Objectifs généraux Le cours de chimie

Plus en détail

Synthèse et propriétés des savons.

Synthèse et propriétés des savons. Synthèse et propriétés des savons. Objectifs: Réaliser la synthèse d'un savon mise en évidence de quelques propriétés des savons. I Introduction: 1. Présentation des savons: a) Composition des savons.

Plus en détail

Partie 1. Addition nucléophile suivie d élimination (A N + E) 1.1. Réactivité électrophile des acides carboxyliques et groupes dérivés

Partie 1. Addition nucléophile suivie d élimination (A N + E) 1.1. Réactivité électrophile des acides carboxyliques et groupes dérivés Molécules et matériaux organiques Partie 1. Addition nucléophile suivie d élimination (A N + E) 1.1. Réactivité électrophile des acides carboxyliques et groupes dérivés bjectifs du chapitre Notions à connaître

Plus en détail

Séquence 5 Réaction chimique par échange de protons et contrôle de la qualité par dosage

Séquence 5 Réaction chimique par échange de protons et contrôle de la qualité par dosage Séquence 5 Réaction chimique par échange de protons et contrôle de la qualité par dosage Problématique La séquence 5, qui comporte deux parties distinctes, mais non indépendantes, traite de la réaction

Plus en détail

Atelier : L énergie nucléaire en Astrophysique

Atelier : L énergie nucléaire en Astrophysique Atelier : L énergie nucléaire en Astrophysique Elisabeth Vangioni Institut d Astrophysique de Paris Fleurance, 8 Août 2005 Une calculatrice, une règle et du papier quadrillé sont nécessaires au bon fonctionnement

Plus en détail

TP 03 B : Mesure d une vitesse par effet Doppler

TP 03 B : Mesure d une vitesse par effet Doppler TP 03 B : Mesure d une vitesse par effet Doppler Compétences exigibles : - Mettre en œuvre une démarche expérimentale pour mesurer une vitesse en utilisant l effet Doppler. - Exploiter l expression du

Plus en détail

Dosages à réactifs marqués

Dosages à réactifs marqués Dosages à réactifs marqués Principe = réaction Ag-Ac un des deux réactifs (Ag ou Ac) est marqué par un traceur Différentes méthodes selon que le traceur est radioactif (RIA), enzymatique (EIA) ou luminescent

Plus en détail

TS 31 ATTAQUE DE FOURMIS!

TS 31 ATTAQUE DE FOURMIS! FICHE 1 Fiche à destination des enseignants TS 31 ATTAQUE DE FOURMIS! Type d'activité ECE Notions et contenus du programme de Terminale S Compétences exigibles du programme de Terminale S TYPE ECE Evaluation

Plus en détail

Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013

Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013 Sélectionner les propositions exactes Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013 QCM 1 La plupart des techniques de biologie moléculaire repose sur le principe de complémentarité

Plus en détail

Stage : "Développer les compétences de la 5ème à la Terminale"

Stage : Développer les compétences de la 5ème à la Terminale Stage : "Développer les compétences de la 5ème à la Terminale" Session 2014-2015 Documents produits pendant le stage, les 06 et 07 novembre 2014 à FLERS Adapté par Christian AYMA et Vanessa YEQUEL d après

Plus en détail

Équivalence masse-énergie

Équivalence masse-énergie CHPITRE 5 NOYUX, MSSE ET ÉNERGIE Équivalence masse-énergie. Équivalence masse-énergie Einstein a montré que la masse constitue une forme d énergie appelée énergie de masse. La relation entre la masse (en

Plus en détail

A chaque couleur dans l'air correspond une longueur d'onde.

A chaque couleur dans l'air correspond une longueur d'onde. CC4 LA SPECTROPHOTOMÉTRIE I) POURQUOI UNE SUBSTANCE EST -ELLE COLORÉE? 1 ) La lumière blanche 2 ) Solutions colorées II)LE SPECTROPHOTOMÈTRE 1 ) Le spectrophotomètre 2 ) Facteurs dont dépend l'absorbance

Plus en détail

Bleu comme un Schtroumpf Démarche d investigation

Bleu comme un Schtroumpf Démarche d investigation TP Bleu comme un Schtroumpf Démarche d investigation Règles de sécurité Blouse, lunettes de protection, pas de lentilles de contact, cheveux longs attachés. Toutes les solutions aqueuses seront jetées

Plus en détail

DM 10 : La fusion nucléaire, l énergie de l avenir? CORRECTION

DM 10 : La fusion nucléaire, l énergie de l avenir? CORRECTION Physique Chapitre 4 Masse, énergie, et transformations nucléaires DM 10 : La fusion nucléaire, l énergie de l avenir? CORRECTION Date :. Le 28 juin 2005, le site de Cadarache (dans les bouches du Rhône)

Plus en détail

TP n 1: Initiation au laboratoire

TP n 1: Initiation au laboratoire Centre Universitaire d El-Tarf Institut des Sciences Agronomiques 3 ème année Contrôle de Qualité en Agroalimentaire TP n 1: Initiation au laboratoire Introduction L analyse de la matière vivante au laboratoire

Plus en détail

Chapitre 10 : Radioactivité et réactions nucléaires (chapitre 11 du livre)

Chapitre 10 : Radioactivité et réactions nucléaires (chapitre 11 du livre) Chapitre 10 : Radioactivité et réactions nucléaires (chapitre 11 du livre) 1. A la découverte de la radioactivité. Un noyau père radioactif est un noyau INSTABLE. Il se transforme en un noyau fils STABLE

Plus en détail

P17- REACTIONS NUCLEAIRES

P17- REACTIONS NUCLEAIRES PC A DOMICILE - 779165576 P17- REACTIONS NUCLEAIRES TRAVAUX DIRIGES TERMINALE S 1 Questions de cours 1) Définir le phénomène de la radioactivité. 2) Quelles sont les différentes catégories de particules

Plus en détail

Vitesse d une réaction chimique

Vitesse d une réaction chimique Chimie chapitre itesse d une réaction chimique A. Avancement d un mobile et vitesse de déplacement Soit un mobile supposé ponctuel P se déplaçant le long d un axe x [Doc. ] : sa position instantanée est

Plus en détail

Transport des gaz dans le sang

Transport des gaz dans le sang UE3-2 - Physiologie Physiologie Respiratoire Chapitre 9 : Transport des gaz dans le sang Docteur Sandrine LAUNOIS-ROLLINAT Année universitaire 2011/2012 Université Joseph Fourier de Grenoble - Tous droits

Plus en détail

SESSION 2013 MPP2008! PHYSIQUE 2. Durée : 4 heures!

SESSION 2013 MPP2008! PHYSIQUE 2. Durée : 4 heures! SESSION 2013 MPP2008 EPREUVE SPECIFIQUE - FILIERE MP " PHYSIQUE 2 Durée : 4 heures " N.B. : Le candidat attachera la plus grande importance à la clarté, à la précision et à la concision de la rédaction.

Plus en détail

Perrothon Sandrine UV Visible. Spectrophotométrie d'absorption moléculaire Étude et dosage de la vitamine B 6

Perrothon Sandrine UV Visible. Spectrophotométrie d'absorption moléculaire Étude et dosage de la vitamine B 6 Spectrophotométrie d'absorption moléculaire Étude et dosage de la vitamine B 6 1 1.But et théorie: Le but de cette expérience est de comprendre l'intérêt de la spectrophotométrie d'absorption moléculaire

Plus en détail

Ressources pour le lycée technologique

Ressources pour le lycée technologique éduscol Chimie biochimie sciences du vivant Classe de première Ressources pour le lycée technologique Présentation Thème 3 du programme Les systèmes vivants maintiennent leur intégrité et leur identité

Plus en détail

Séquence 9. Étudiez le chapitre 11 de physique des «Notions fondamentales» : Physique : Dispersion de la lumière

Séquence 9. Étudiez le chapitre 11 de physique des «Notions fondamentales» : Physique : Dispersion de la lumière Séquence 9 Consignes de travail Étudiez le chapitre 11 de physique des «Notions fondamentales» : Physique : Dispersion de la lumière Travaillez les cours d application de physique. Travaillez les exercices

Plus en détail

TP 2: LES SPECTRES, MESSAGES DE LA LUMIERE

TP 2: LES SPECTRES, MESSAGES DE LA LUMIERE TP 2: LES SPECTRES, MESSAGES DE LA LUMIERE OBJECTIFS : - Distinguer un spectre d émission d un spectre d absorption. - Reconnaître et interpréter un spectre d émission d origine thermique - Savoir qu un

Plus en détail

Fiche de révisions sur les acides et les bases

Fiche de révisions sur les acides et les bases Fiche de révisions sur les s et les s A Définitions : : espèce chimique capable de libérer un (ou plusieurs proton (s. : espèce chimique capable de capter un (ou plusieurs proton (s. Attention! Dans une

Plus en détail

Première partie: Restitution + Compréhension (08 points)

Première partie: Restitution + Compréhension (08 points) Lycée M hamdia Année scolaire : 2011/2012 Prof : Saïd Mounir Date : 17/05/2012 Première partie: Restitution + Compréhension (08 points) EXERCIE N O 1: (4 points) : 1 : a-b 2 : b 3 : a-b 4 : d 5 : d 6 :

Plus en détail

AGRÉGATION DE SCIENCES DE LA VIE - SCIENCES DE LA TERRE ET DE L UNIVERS

AGRÉGATION DE SCIENCES DE LA VIE - SCIENCES DE LA TERRE ET DE L UNIVERS AGRÉGATION DE SCIENCES DE LA VIE - SCIENCES DE LA TERRE ET DE L UNIVERS CONCOURS EXTERNE ÉPREUVES D ADMISSION session 2010 TRAVAUX PRATIQUES DE CONTRE-OPTION DU SECTEUR A CANDIDATS DES SECTEURS B ET C

Plus en détail