Organisation du Génome humain Notions essentielles

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimension: px
Commencer à balayer dès la page:

Download "Organisation du Génome humain Notions essentielles"

Transcription

1 Organisation du Génome humain Notions essentielles Biologie Moléculaire et Médecine; Kaplan et Delpech; Flammarion «How to sequence a genome» (film): Human Genome Project: Analyses génomiques en pathologie humaine Problématiques des études moléculaires en génétique humaine Biologie Moléculaire et Médecine; Kaplan et Delpech; Flammarion Human Genome Variation Society: Nomenclature mutationnelle: Analyse de variants faux-sens: Analyse de l effet de variants de séquence sur l épissage: Bases de données: Bases de données «locus-spécifiques» Listing disponible site HGVS Bases de données «centrales/globales» Human Gene Mutation Database SNP database UCSC Genome Browser genome.ucsc.edu Ensembl Dr. Martin Krahn Département de Génétique Médicale Hôpital Timone Enfants INSERM UMR Faculté de Médecine Université de la Méditerranée Marseille

2 Organisation du Génome humain Notions essentielles Martin Krahn Département de Génétique Médicale Hôpital Timone Enfants INSERM UMR Faculté de Médecine Université de la Méditerranée Marseille

3 Organisation du Génome humain Notions essentielles Quelques rappels historiques Séquençage du Génome humain Organisation du Génome humain

4 Génome = ensemble du matériel génétique d'une espèce (ADN)! ensemble des gènes!!!

5 Pourquoi cartographier le génome? Clonage positionnel : identification de gènes par exploration du génome suivant un balisage de marqueurs Médecine: pour localiser les loci morbides, associés à des maladies héréditaires, voire pour appréhender les maladies multifactorielles Depuis les premières cartes, plus de 2500 gènes impliqués dans des syndromes héréditaires ont été identifiés (OMIM, sept.2009) Cette phase est suivie d exploration thérapeutique (voir site essais cliniques AFM) Agronomie: pour localiser et cloner les gènes d intérêt ou les zones du génome impliquées dans des traits intéressants et les transférer entre espèces Bond des biotechnologies végétales, clonage, OGM

6 Histoire De l Antiquité au 19e siècle : transmission de caractères parents-enfants selon diverses théories: préformisme, animalculisme, patroclinisme, ovisme, épigénisme 1865: G. Mendel jette les bases de la génétique moderne, allèles, dominance, hétérozygotie 1910: T. Morgan découvre la recombinaison méiotique et publie ses résultats qui sont les bases de la théorie chromosomique de l hérédité 1913: première carte génétique

7 Histoire 1953: J. Watson, F. Crick et R. Franklin décryptent des clichés de diffraction et publient la structure en double hélice de l ADN 1965: J. Monod, F. Jacob et A. Lwoff «découvrent» les ARN et la régulation de l expression génique 1973: moratoire sur le clonage et le génie génétique

8 Histoire Années 1980: découverte des marqueurs polymorphiques, des techniques de RFLP, des microsatellites, grands progrès du génie génétique. Cartographie intensive 1983: découverte de la PCR. Les cartes s enrichissent de toutes ces techniques 1989: un programme mondial de séquençage du génome humain se met en place : HUGO : publication des premières cartes du génome humain par le Généthon

9 Histoire 2000: premiers résultats de thérapie génique sur l homme (Fischer) 2001: premier assemblage de la séquence du génome humain (Science 291, Nature 409) 2003: finition de l assemblage de notre séquence génomique CELERA HUGO-HGP

10 HUGO Human Genome Project Plus grand projet scientifique mondial lancé en 1988/1989 HGP démarre en 1990 Ampleur de la tâche 1 page = 3000 bases 1 tome: 500 pages = bases 1 génome = tomes!!! Capacité de séquençage En 1975, nucléotides/semaine 500 ans pour 100 personnes! En 1986, nucléotides/jour 8 ans pour 100 machines En 1998, nucléotides/jour 5 mois pour 100 machines Stratégie du Human Genome Project vs Stratégie de CELERA Genomics

11 HUGO - HGP CELERA HGP / Celera

12 Séquence finale CELERA: Seuls 2 ADN ont servi de matrice (dont celui de C. Venter). Celera a intégré les données publiques dans sa base au fur et à mesure de leur publication HGP: profondeur de séquence: 10X (10 équivalents génomiques séquençés) à partir de près d'une vingtaine d'individus différents Travail de "finition" poursuivi jusqu'en avril 2003 Précision finale: % = 1 erreur toutes les bases environ Coût global: environ 2.7 milliards $ Parties manquantes: hétérochromatine, télomères et M. KRAHN M2 centromères 2009

13 Coûts de séquençage

14 Organisation du génome humain 1/3 2/3 <3% code des protéines >50% séquences répétées

15 Le génome humain Le génome humain est composé de millions de nucléotides Les régions riches en gènes sont également les régions riches en nucléotides G/C Les régions pauvres en gènes sont riches en A/T Ces différentes régions peuvent généralement être visualisées comme des bandes claires ou sombres sur les chromosomes métaphasiques ("banding") Bandes G: riches en AT, pauvres en gènes Bandes R: riches en GC, riches en gènes Le chromosome 1 contient le plus grand nombre de gènes estimés (environ 3000) tandis que le chromosome Y en a le moins (231) Moins de 3% de l ADN code pour des protéines Les séquences répétées composent environ 50% de la totalité du génome

16 Le génome humain Le nombre total de gènes se situe entre et La taille moyenne d un gène est de 3000 bases, 9 exons, mais la taille varie beaucoup (ex : le gène de la dystrophine a une taille de 2,4 millions bp) 99.9% des nucléotides sont identiques entre deux personnes. Il existe donc 0,1% de différences (soit environ 3,5 millions de différences par génome) Plus de 50% des gènes ont une fonction inconnue

17 Organisation du Génome Vitesse de réassociation du génome On dénature l'adn par chauffage On mesure la vitesse de réhybridation L'ADN d'e. coli se réhybride suivant une courbe sigmoïde simple quand un fragment d'adn trouve son fragment complémentaire, les séquences adjacentes se réhybrident rapidement de façon coopérative, comme une fermeture éclair

18 Vitesse de réassociation du génome % de réhybridation E. Coli H. Sapiens Rapide Lente Vitesse de réassociation

19 Le génome est hétérogène Zones fortement répétitives 10 à 15% du génome, non codées en protéines Centromères, Télomères, Mégasatellites, Minisatéllites, Microsatellites Zones moyennement répétitives 20 à 40 % du génome, non codées en protéines Transposons, séquences SINE (Alu) et LINE, Rétrovirus endogènes Quelques gènes codant des rrna, trna, RNA5S et 7SL Séquences uniques ~50% du génome, contiennent la plupart des gènes codant pour des protéines (ARNm)

20 Les zones répétitives Les minisatellites ou VNTR (Variable Numbers of Tandem Repeats): - séquences de 11 à 16 pb - répétées parfois jusqu'à 1000 fois - Localisations surtout télomériques (ou centromériques) - peu utilisés en pratique Les microsatellites - séquences de 1 à 4 pb - souvent (CA) n, n variant de 12 à répartition homogène sur tout le génome, tous les 25 à 100 kb - très variables donc informatifs - facilement amplifiés par PCR - utilisation pour les analyses de liaison - utilisation en diagnostic moléculaire («indirect») et pour les empreintes génétiques

21 Marqueurs génétiques Les MARQUEURS génétiques: Variations polymorphes de la séquence d ADN - répartis uniformément sur le génome - localisation connue - PAS d effet direct sur le phénotype Marqueur Gène ADN Microsatellites (utilisés ++) : Polymorphismes de répétition Exple: répétitions de motif «CA» - séquences répétées NON codantes - réparties uniformément dans le génome - polymorphes = à un même endroit du génome, des individus pris au hasard (pop.gén.) présentent un nombre différent de répétitions sur chaque chromosome Exemple: chromosome 4 8 répétitions CA 12 répétitions CA ATCGTCTCACACACACACACACATGTCGTAT ATCGTCTCACACACACACACACACACACACATGTCGTAT

22 Et maintenant?

23 Et maintenant?

24 Et maintenant?

25 Et maintenant? Clonage positionnel révolu gènes localisés Agronomie dopée OGM par analyse QTL Catalogue des gènes: GenAtlas, OMIM, Genome Browser, bases de données de SNP, de miarn Séquençage en masse d'autres organismes Cartes de synténie inter-espèces, évolution Séquençage personnalisé possible Nouvelles technologies mêlant bioinformatique, robotique et nanobiologie Thérapie génique, pharmacologique ou cellulaire utilisant les données acquises

26 Analyses génomiques en pathologie humaine

27 Anomalies du Génome et Pathologie humaine MACROLESIONS Echelle du Chromosome MICROLESIONS Echelle du Gène?

28 Anomalies du Génome et Pathologie humaine MACROLESIONS Echelle du Chromosome Délétions Duplications Amplifications Translocations Inversions Insertions (...) MICROLESIONS Echelle du Gène Mutations ponctuelles Insertions/délétions de qques nucléotides Insertions/délétions de qques 10aines ou 100aines de nt Mutations dynamiques/amplifications (...) Maladies génétiques: anomalies génétiques causales Maladies polyfactorielles: prédisposition génétique

29 Anomalies du Génome et Pathologie humaine MACROLESIONS MICROLESIONS Echelle du Chromosome METHODES D ANALYSE Echelle du Gène?

30 Anomalies du Génome et Pathologie humaine MACROLESIONS MICROLESIONS CARYOTYPE Echelle du Chromosome Echelle du Gène METHODES D ANALYSE CGH CRIBLAGE MUTATIONNEL FISH SEQUENCAGE

31 Rappel: Mutations «classiques» Exon Intron 5 GT AG 3 CAAT TATA ATG Site donneur Site accepteur TAA TAG TGA AATAAA Région 5 UTR Région 3 UTR Mutations en séquence non codante: perturbations d éléments régulateurs mutations perturbant l épissage Mutations en séquence codante: faux sens non sens insertions/délétions décalage du cadre de lecture mutations perturbant l épissage => perte/gain de fonction

32 Problématiques des études moléculaires en génétique humaine Stratégies de Diagnostic génétique Problèmes d interprétation de données mutationnelles Perspectives de criblage mutationnel à haut débit

33 Les avancées méthodologiques qui ont révolutionné la génétique moléculaire 1970: Endonucléases de restriction : Ligases 1975: Séquençage (Sanger&Coulon, Maxam&Gilbert, Hood) 1985: PCR (Karry Mullis) 1998: Puces à ADN ( microarrays ) Années 1990 à aujourd hui: Développement +++ de nouvelles techniques Les applications/progrès réalisées grâce aux techniques de Biologie moléculaire: Meilleure connaissance des mécanismes physiopathologiques des maladies: - Identification et études fonctionnelles de gènes impliqués dans des maladies humaines, création et analyse de modèles animaux, séquençage du génome humain,, Généralisation des applications diagnostiques en routine hospitalière

34 Principes des Études Moléculaires en Génétique Humaine Transcription Traduction Réplication ADN Génome ARN Transcriptome Protéines Protéome Reverse Transcription Analyses génétiques/ Biologie moléculaire Biochimie

35 Principes des Études Moléculaires en Génétique Humaine En principe identique pour toutes les cellules d un individu Spécifiques d un tissu d un type cellulaire d un état ADN Génome ARN Transcriptome Protéines Protéome Analyses génétiques/ Biologie moléculaire Biochimie

36 Principes des Études Moléculaires en Génétique Humaine En principe identique pour toutes les cellules d un individu Spécifiques d un tissu d un type cellulaire d un état ADN Génome ARN Transcriptome Protéines Protéome Prélèvement de «base» en Génétique = prélèvement sanguin Extraction d ADN périphérique génomique à partir de LYMPHOCYTES du sang ATTENTION: Toujours avec CONSENTEMENT de l individu Analyses en Génétique moléculaire: Directes ou Indirectes Autres prélèvements: Tissus embryonnaires/fœtaux (villosités choriales, liquide amniotique, ) pour DPN Autres tissus: analyses complémentaires dans certaines pathologies (surtout analyses d expression du ARNm)

37 Notions essentielles Stratégies de Diagnostic génétique - Diagnostic direct vs indirect - Précriblage mutationnel Problèmes d interprétation de données mutationnelles - Bases de données mutationnelles - Variants «nouveaux» => recueil d arguments de pathogénicité - Outils bioinformatiques ++ Perspectives de criblage mutationnel à haut débit

38 Stratégie diagnostique dans les maladies génétiques CONSULTATION DIAGNOSTIQUE: Interrogatoire et examen clinique Histoire de la maladie Arbre généalogique/mode de transmission Examen clinique ciblé Examen clinique général EXAMENS COMPLEMENTAIRES: Analyses biologiques selon le contexte Imagerie Examens ciblés selon orientation DIAGNOSTIC CLINIQUE

39 Stratégie diagnostique dans les maladies génétiques CONSULTATION DIAGNOSTIQUE: Interrogatoire et examen clinique Histoire de la maladie Arbre généalogique/mode de transmission Examen clinique ciblé Examen clinique général EXAMENS COMPLEMENTAIRES: Analyses biologiques selon le contexte Imagerie Examens ciblés selon orientation DIAGNOSTIC CLINIQUE DIAGNOSTIC GENETIQUE ANALYSES GENETIQUES: Cytogénétique: Caryotype constitutionnel standard FISH, (Cf cours) Génétique moléculaire: Diagnostic direct: Recherche de l anomalie génétique primaire Diagnostic indirect: Analyses de liaison

40 Diagnostic moléculaire des maladies génétiques Objectif: établir un diagnostic précis par l identification de l anomalie génétique Intérêt: certitude diagnostique prise en charge adaptée conseil génétique 2 approches: DIAGNOSTIC DIRECT: Recherche de l anomalie génétique primaire identification de Mutations constitutionnelles délétères DIAGNOSTIC INDIRECT: Analyses de liaison Utilisation de marqueurs pour analyser la coségrégation d un phénotype avec un allèle particulier dans une famille

41 Rappel: le rôle central de la PCR ADN du patient en faible quantité Région d intérêt PCR Exon 1 Région d intérêt AMPLIFIEE en grande quantité ANALYSE de la région d intérêt Analyse de la SEQUENCE Recherche de MUTATIONS dans la région d intérêt Gène de 3 exons Exon 2 Exon 3 Analyse de la TAILLE Applications diverses Analyse de Microsatellites

42 Séquençage complet Exon 1 Exon 2 Mutation ponctuelle Gène de 3 exons Exon 3 PRECRIBLAGE puis Séquençage ciblé - Différentes technologies: SSCP, DHPLC, HRM, - Intérêt: détecter les exons porteurs d une variation de séquence => réduction du temps d analyse et des coûts Exon 1 Profil NORMAL Exon 2 Exon 3 Profil ANORMAL Profil NORMAL Mutation ponctuelle

43 Diagnostic direct et Diagnostic indirect Analyses en Génétique moléculaire DIAGNOSTIC DIRECT CAACANNNNNNNNNNNNN Patient atteint Phénotype: diagnostic clinique Ou suspicion diagnostique Forw. Identification de mutation(s) dans le gène impliqué Analyses en Génétique moléculaire DIAGNOSTIC INDIRECT Patient atteint Phénotype: diagnostic clinique (certitude diagnostique nécessaire) Coségrégation familiale phénotype/marqueur

44 Diagnostic indirect Utilisation de marqueurs pour analyser la coségrégation marqueur/maladie Marqueur Gène morbide on connaît la localisation du gène morbide on connaît des marqueurs localisés à proximité étude de la Coségrégation familiale phénotype/marqueur Permet de suivre INDIRECTEMENT la transmission d une mutation Analyses en Génétique moléculaire DIAGNOSTIC INDIRECT Patient atteint Avec Diagnostic clinique CERTAIN Coségrégation familiale phénotype/marqueur

45 Diagnostic indirect Utilisation de marqueurs pour analyser la coségrégation marqueur/maladie Marqueur Gène morbide on connaît la localisation du gène morbide on connaît des marqueurs localisés à proximité étude de la Coségrégation familiale phénotype/marqueur Permet de suivre INDIRECTEMENT la transmission d une mutation Approche utilisée quand diagnostic direct non faisable, trop difficile Principaux problèmes posés: - nécessite de connaître le gène impliqué (ou le locus) pour choisir les marqueurs à utiliser (problème posé si hétérogénéité génétique) - nécessite une certitude du diagnostic clinique - nécessite une étude FAMILIALE - nécessite une famille «informative»: parfois non concluant - risque d erreur par recombinaison

46 Diagnostic moléculaire indirect Principes Étude de microsatellites. Exemple: étude familiale, maladie autosomique dominante Marqueur Gène morbide

47 Diagnostic moléculaire indirect Principes Étude de microsatellites. Exemple: étude familiale, maladie autosomique dominante Étude de la Coségrégation familiale phénotype/marqueur Marqueur Phénotype atteint Allèles 105 et Gène morbide Phénotype sain Allèles 105 et 115 NB: Diagnostic indirect nécessite - Certitude du diagnostic clinique - Étude familiale Phénotype atteint Allèles 113 et Phénotype sain Allèles 105 et L enfant atteint a reçu l allèle 113 de son père: Il y a COSEGREGATION entre le PHENOTYPE «atteint» et l allèle 113 paternel L allèle 113, d origine paternelle est lié à l allèle muté du gène en cause

48 Diagnostic moléculaire indirect Principes Étude de microsatellites. Exemple: étude familiale, maladie autosomique dominante Allèle 105 Allèle 115 Étude de la Coségrégation familiale phénotype/marqueur Marqueur Phénotype atteint Allèles 105 et Gène morbide Chez le père, l allèle 113 du marqueur est sur le même chromosome que la mutation impliquée dans la maladie Lorsque le père transmet le chromosome avec la mutation, il transmet AUSSI l allèle 113 Permet de suivre indirectement la transmission de la mutation Allèle 105 Allèle 113 * * Mutation dans le gène impliqué Allèle 105 Allèle 113 Phénotype atteint Allèles 113 et L enfant atteint a reçu l allèle 113 de son père: Il y a COSEGREGATION entre le PHENOTYPE «atteint» et l allèle 113 paternel L allèle 113, d origine paternelle est lié à l allèle muté du gène en cause Phénotype sain Allèles 105 et 115 Allèle Phénotype sain Allèles 105 et 115 Allèle 115

49 Diagnostic direct DIAGNOSTIC DIRECT: Recherche de l anomalie génétique primaire identification de mutations constitutionnelles délétères approche utilisée de préférence, permet un diagnostic de certitude principaux problèmes posés: - parfois lourd sur le plan technique - parfois non concluant - polymorphismes ou mutations constitutionnelles délétères? Analyses en Génétique moléculaire DIAGNOSTIC DIRECT CAACANNNNNNNNNNNNN Patient atteint Phénotype: diagnostic clinique Ou suspicion diagnostique Forw. Identification de mutation dans le gène impliqué

50 Diagnostic moléculaire direct Stratégie Patient atteint Phénotype: diagnostic clinique Ou suspicion diagnostique Gène impliqué de PETITE TAILLE et/ou mutations récurrentes Gène impliqué de GRANDE TAILLE +/- Spectre mutationnel large Précriblage mutationnel Séquençage complet trop lourd et trop coûteux techniques permettant d identifier les exons présentant des variations de séquence mais SANS préciser quelle est la variation de séquence Profil ANORMAL ORIENTATION Séquençage complet de la totalité de la séquence codante d intérêt (tous les exons codants) Séquençage ciblé des exons présentant des profils anormaux Identification de variations de séquence Mutation ponctuelle

51 Diagnostic moléculaire direct Exemple: gène de petite taille Gène de la cavéoline-3 (CAV3) : localisé en 3p25 séquence codante de 456 paires de bases (2 exons) ARNm d expression musculaire Protéine impliquée dans la réparation de la membrane musculaire (?) Mutations CAV3 : dystrophie musculaire des ceintures autosomique dominante

52 Diagnostic moléculaire direct Exemple: gène de petite taille Gène de la cavéoline-3 (CAV3) : localisé en 3p25 séquence codante de 456 paires de bases (2 exons) ARNm d expression musculaire Protéine impliquée dans la réparation de la membrane musculaire (?) Mutations CAV3 : dystrophie musculaire des ceintures autosomique dominante Gène de petite taille: analyse «facile» par séquençage direct Contrôle Patient Confirmation du diagnostic par IDENTIFICATION directe de la mutation For. For. c.298a>t hétérozygote p.ile100phe

53 Diagnostic moléculaire direct Exemple: gène de grande taille Gène de la dysferline (DYSF) : localisé en 2p séquence codante de 6243 paires de bases (55 exons) ARNm d expression musculaire (et autres tissus) Protéine impliquée dans la réparation de la membrane musculaire (?) Mutations DYSF : dystrophie musculaire des ceintures autosomique récessive > 400 mutations différentes rapportées réparties sur toute la longueur du gène = «Spectre mutationnel large» Gène de grande taille +/- spectre mutationnel large: Analyse par séquençage complet techniquement trop lourd et trop coûteux: NON faisable Utilisation de techniques de PREcriblage mutationnel

54 Diagnostic moléculaire direct Exemple: gène de grande taille Patient IVS 6 c.946-1g>a dhplc Séquençage Profil hétéroduplex évident Patient Exon 17 c.1979a>g dhplc Séquençage Profil hétéroduplex difficilement mis en évidence

55 Diagnostic moléculaire direct Identification de variations de séquence Comparaison à séquence de référence - UCSC Genome Browser genome.ucsc.edu - Ensembl Description précise du variant : NOMENCLATURE HGVS Nomenclature officielle Human Genome Variation Society Mutations délétères ou Variations de séquence non pathogènes?

56 Problématiques des études moléculaires en génétique humaine Stratégies de Diagnostic génétique Problèmes d interprétation de données mutationnelles Perspectives de criblage mutationnel à haut débit

57 Diagnostic moléculaire direct Identification de variations de séquence Description précise du variant : NOMENCLATURE HGVS Comparaison à séquence de référence: Mutation délétère ou simple variation de la normale/polymorphisme? 2 situations: la variation de séquence est connue (consultation de bases de données) la variation de séquence N EST PAS connue

58 Diagnostic moléculaire direct Identification de variations de séquence Description précise du variant : NOMENCLATURE HGVS Comparaison à séquence de référence: Mutation délétère ou simple variation de la normale/polymorphisme? 2 situations: la variation de séquence est connue (consultation de bases de données) - Caractère délétère confirmé au préalable chez d autres patients Mutation constitutionnelle délétère - Présence sans effets pathologiques dans la population générale Polymorphisme la variation de séquence N EST PAS connue

59 Diagnostic moléculaire direct Identification de variations de séquence Description précise du variant : NOMENCLATURE HGVS Comparaison à séquence de référence: Mutation délétère ou simple variation de la normale/polymorphisme? 2 situations: Séance ED Analyses mutationnelles la variation de séquence est connue (consultation de bases de données) - Caractère délétère confirmé au préalable chez d autres patients Mutation en Génétique constitutionnelle Humaine délétère - Présence sans effets pathologiques dans la population générale Polymorphisme la variation de séquence N EST PAS connue

60 Consultation de bases de données Mutation rapportée au préalable? Human Genome Variation Society Porte d entrée pour les Bases de données mutationnelles Bases de données «locus-spécifiques» Listing disponible site HGVS Bases de données «centrales/globales» Human Gene Mutation Database SNP database UCSC Genome Browser genome.ucsc.edu Ensembl

61 Diagnostic moléculaire direct Identification de variations de séquence Description précise du variant : NOMENCLATURE HGVS Comparaison à séquence de référence: Mutation délétère ou simple variation de la normale/polymorphisme? 2 situations: la variation de séquence est connue (consultation de bases de données) la variation de séquence N EST PAS connue - Évaluation de différentes données pour conclure sur le caractère pathogène ou non de la variation de séquence - Saisie des résultats dans les bases de données

62 Diagnostic moléculaire direct Variation de séquence non connue au préalable Mutation délétère ou Polymorphisme??

63 Diagnostic moléculaire direct Variation de séquence non connue au préalable Mutation délétère ou Polymorphisme? (Consultation de bases de données) Nature de la mutation (non-sens, décalage cadre de lecture, épissage, faux-sens, isosémantique, ) Étude de la ségrégation de la variation de séquence à l intérieur de la famille Recherche de la variation dans une population de témoins sains - absence = en faveur du caractère délétère - présence = polymorphisme probable Études fonctionnelles: transcriptionnelles, protéiques, Plus difficile, parfois plutôt domaine de la recherche Modélisation bio-informatique: - de l effet sur l épissage/l ARNm - de la conservation du nucléotide impliqué (et AA correspondant) au cours de l évolution - de l effet au niveau de la protéine

64 Modélisation bio-informatique Analyse de l effet sur l épissage/l ARNm Epissage anormal, dégradation,.. Analyse de la conservation du nucléotide impliqué (et AA correspondant) au cours de l évolution => Surtout pour variants faux-sens, isosémantiques et introniques) - Conservé = important, donc une variation est susceptible d être délétère - Non conservé = moins important, une variation est possible sans effet majeur Analyse de l effet au niveau de la protéine Domaines fonctionnels, protéine tronquée,

65 Problématiques des études moléculaires en génétique humaine Stratégies de Diagnostic génétique Problèmes d interprétation de données mutationnelles Perspectives de criblage mutationnel à haut débit

66 Rappel: Mutations «classiques» Exon Intron 5 GT AG 3 CAAT TATA ATG Site donneur Site accepteur TAA TAG TGA AATAAA Région 5 UTR Région 3 UTR Mutations en séquence non codante: perturbations d éléments régulateurs mutations perturbant l épissage Mutations en séquence codante: faux sens non sens insertions/délétions décalage du cadre de lecture mutations perturbant l épissage => perte/gain de fonction

67 Séquençage complet Exon 1 Exon 2 Mutation ponctuelle Gène de 3 exons Exon 3 PRECRIBLAGE puis Séquençage ciblé - Différentes technologies: SSCP, DHPLC, HRM, - Intérêt: détecter les exons porteurs d une variation de séquence => réduction du temps d analyse et des coûts Exon 1 Profil NORMAL Exon 2 Exon 3 Profil ANORMAL Profil NORMAL Mutation ponctuelle

68 Suspicion d une pathologie particulière sans identification de mutations Exemple: Maladies autosomiques récessives Sensibilité insuffisante des techniques utilisées en routine Quelles mutations ne sont pas détectées par les stratégies «classiques»? Mutations introniques? Mutations de régions régulatrices? Mutations dans exons alternatifs? Réarrangements intragéniques de grande taille? ( ) Hétérozygotes symptomatiques, digénisme Mutations dans d autres gènes Même voie physiopathologique ++

69 Réarrangements intragéniques de grande taille Délétions/Amplifications exoniques Parfois détectées de manière fortuite (détection en PCR; variants de séquence pseudo-homozygotes; ) Non détectables de manière systématique avec les techniques «classiques» de criblage mutationnel de la séquence codante génique Exemple: délétion exonique Développement récent de techniques adaptées: - Quantitative multiplex PCR of short fluorescent fragments (QMPSF; Casilli et al., 2002) - Multiplex Ligand-dependant Probe Amplification (MLPA; Shouten et al., 2002) Analyse mono-allélique

70 Diagnostic moléculaire de routine Moyens actuels et Perspectives Techniques de criblage mutationnel «efficaces» Outils bio-informatiques : - Bases de données mutationnelles - Algorithmes d analyse de variants de séquence mais sensibilité insuffisante des techniques d analyse Mutations non détectées par les techniques actuelles de routine Développement de techniques complémentaires Mutations dans d autres gènes / gènes candidats ( ) Nouvelles technologies d analyse mutationnelle génomique à haut débit Exemples: CGH Microarrays Sequence Capture Arrays et Séquençage à haut débit

71 Nouvelles technologies d analyse mutationnelle génomique à haut débit CGH Arrays ADN patient ADN contrôle ADN génomique non amplifié Patient et contrôle Fragmentation aléatoire et Marquage avec «random 9mers» - 5 -Cy3 (ADN patient) - 5 -Cy5 (ADN contrôle) Hybridation sur lame (array) Analyse Capture des signaux fluorescents (Scanner) Analyse des données (Ratio Cy3/Cy5)

72 Nouvelles technologies d analyse mutationnelle génomique à haut débit CGH Arrays 385K 2.1M 4-plex 12-plex 4 x 70 K 12 x 135 K

73 DYSF CGH arrays Délétion homozygote exons 2 à Duplication hétérozygote exons (+39) Nimblegen-Roche

74 DYS et SGC CGH arrays γsarcoglycan LGMD2C Dystrophin DMD Saillour et al, 2008

75 Séquençage à haut débit ADN génomique Fragmentation Ligation d adaptateur Création de microréacteurs par émulsion (billes et fragments ADN) PCR en émulsion Séquençage et analyse lectures Fragments de bp 500Mb de séquence/run Couverture 15x/région 5Mb de séquence propre/run Nimblegen-Roche

76 Sequence Capture arrays et Séquençage à haut débit Régions cible Fragmentation et ligation d un «linker» Sélection/Enrichissement en séquence cible (alternative à PCR) Hybridation Élution de la Région d intérêt Amplification Lavages Séquençage à haut débit 5Mb de séquence interprétable / run Nimblegen-Roche

77 Sequence Capture arrays 385K 2.1M 1-plex 1 x 385 K 4-plex 1-plex 12-plex 4 x 70 K 1 x 2.1 M 12 x 135 K Nimblegen-Roche

78 Nouvelles technologies d analyse mutationnelle génomique à haut débit PERSPECTIVES Criblage mutationnel à haut débit en routine Analyses de séquence - «Mutations classiques» Substitutions et ins/del de petite taille - Extension de l analyse aux régions introniques et/ou régions régulatrices (Epissage, 5 UTR, 3 UTR, CNGS, microrna, ) Anomalies génomiques quantitatives - Réarrangements intragéniques de grande taille Délétions/Amplifications exoniques - Copy Number Variations ( ) Analyse de gènes candidats et gènes modificateurs Étapes de validation par techniques complémentaires (Séq. direct, Q-PCR; RT-PCR et Q-RT-PCR, MLPA, Microarrays d expression, )

79 Diagnostic moléculaire PERSPECTIVES Procédure actuelle Orientation clinique anatomopathologique biochimique ( ) Approche «gène par gène» Un ou quelques gènes Long; 1 semaine à 1 an Coûteux Procédure future Orientation clinique anatomopathologique biochimique ( ) Approche «haut débit» Plusieurs dizaines de gènes Rapide; 72 heures à 1 semaine Réduction des coûts

80 Conclusion Notions essentielles Stratégies de Diagnostic génétique - Diagnostic direct vs indirect - Précriblage mutationnel Problèmes d interprétation de données mutationnelles - Bases de données mutationnelles - Variants «nouveaux» => recueil d arguments de pathogénicité - Outils bioinformatiques ++ Perspectives de criblage mutationnel à haut débit

Principe des études moléculaires en génétique médicale Méthodes d analyse des microlésions du génome

Principe des études moléculaires en génétique médicale Méthodes d analyse des microlésions du génome Mercredi 23 Octobre LECLERCQ Barbara L2 GM Pr Krahn 10 pages Principe des études moléculaires en génétique médicale Méthodes d analyse des microlésions du génome Plan A. Introduction B. Techniques courantes

Plus en détail

L'ADN peut être copié au travers des générations cellulaires successives de manière fidèle, c'est la réplication de l'adn.

L'ADN peut être copié au travers des générations cellulaires successives de manière fidèle, c'est la réplication de l'adn. 24/09/2014 REBOUL Nicolas L2 CR : Hamza BERGUIGUA Génétique Médicale Dr Martin KRAHN 8 pages Introduction à la Génétique Médicale : Les champs de la Génétique Médicale, La place de la Génétique Médicale

Plus en détail

Objectif : identifier la mutation responsable de la maladie parmi les millions de polymorphisme.

Objectif : identifier la mutation responsable de la maladie parmi les millions de polymorphisme. Identification de gènes morbides Analyses mutationnelles Maladies monogéniques Objectif : identifier la mutation responsable de la maladie parmi les millions de polymorphisme. Plan : Variations du nombre

Plus en détail

Professeur Joël LUNARDI

Professeur Joël LUNARDI Biochimie - Biologie moléculaire Chapitre 9 : Applications médicales Professeur Joël LUNARDI MED@TICE PCEM1 - Année 2006/2007 Faculté de Médecine de Grenoble - Tous droits réservés. Chapitre 9. APPLICATIONS

Plus en détail

LES MARQUEURS MOLECULAIRES

LES MARQUEURS MOLECULAIRES LES MARQUEURS MOLECULAIRES Il y a différents types de marqueurs : o Les caractères phénotypiques : limités, observations sur l arbre entier et sur différentes années o Les marqueurs biochimiques o Les

Plus en détail

PRINCIPALES TECHNIQUES UTILISEES EN GENOMIQUE

PRINCIPALES TECHNIQUES UTILISEES EN GENOMIQUE PRINCIPALES TECHNIQUES UTILISEES EN GENOMIQUE Définitions généralités Quelques chiffres 46 chromosomes 22 paires d autosomes (n=44) 1 paire de gonosomes (n=2) : XX/F et XY/H 300 bandes cytogénétiques =

Plus en détail

GENETIQUE MEDICALE- Étude de ségrégation, ED génétique moléculaire

GENETIQUE MEDICALE- Étude de ségrégation, ED génétique moléculaire 20/11/2013 GUIMERA Jordan L2 Génétique Médicale C. BEROUD 24 pages Relecteur n 3 Etude de ségrégation, ED génétique moléculaire (haplotype, interprétation des données mutationnelles, notion bio-informatique,

Plus en détail

Le monde des bio-puces

Le monde des bio-puces Le monde des bio-puces D1 Le «dogme central» de la biologie moléculaire Transcription Epissage Traduction ADN ARNpm ARNm Protéines Génome Transcriptome Protéome D2 Puces à ADN Techniques de génomique fonctionnelle

Plus en détail

Chapitre 1 Structure et diversité du génome humain

Chapitre 1 Structure et diversité du génome humain Chapitre 1 Structure et diversité du génome humain I. Préambule Le projet de séquençage du génome humain est certainement, après la conquête de la lune, l une des aventures humaines récentes les plus passionnantes

Plus en détail

Génome humain Polymorphismes Marqueurs génétiques. Dr Chrystelle COLAS Département de Génétique GH Pitié Salpêtrière.

Génome humain Polymorphismes Marqueurs génétiques. Dr Chrystelle COLAS Département de Génétique GH Pitié Salpêtrière. Génome humain Polymorphismes Marqueurs génétiques Dr Chrystelle COLAS Département de Génétique GH Pitié Salpêtrière Génome humain Génome Humain () Homme Cellules Noyaux 46 Chromosomes Protéines Gènes ADN

Plus en détail

Quelques caractéristiques des microsatellites : définition, densité et structure. P. Jarne CEFE - Montpellier

Quelques caractéristiques des microsatellites : définition, densité et structure. P. Jarne CEFE - Montpellier Quelques caractéristiques des microsatellites : définition, densité et structure P. Jarne CEFE - Montpellier Buts * Définitions * Méthodes d études de la distribution * Qques résultats : distribution dans

Plus en détail

DNA-seqciblé : principales méthodes d'enrichissement

DNA-seqciblé : principales méthodes d'enrichissement DNA-seqciblé : principales méthodes d'enrichissement DU de séquençage haut-débit Module 1 : Séquençage nouvelle génération - Technologies & applications 17 octobre 2013 Amélie PITON piton@igbmc.fr 1 Introduction

Plus en détail

Université Bordeaux Segalen - PACES 2011-2012 ED UE9s Mars 2012

Université Bordeaux Segalen - PACES 2011-2012 ED UE9s Mars 2012 Sélectionner les propositions exactes Université Bordeaux Segalen - PACES 2011-2012 ED UE9s Mars 2012 QCM 1. La température de fusion (Tm) d une molécule d ADN : A. est mise en évidence par l augmentation

Plus en détail

Les propriétés physicochimiques de l ADN Structure des génomes La chromatine

Les propriétés physicochimiques de l ADN Structure des génomes La chromatine Cours de Biologie Moléculaire L2S3 Structure de l ADN Organisation des génomes 2ème cours (1h30) Les propriétés physicochimiques de l ADN Structure des génomes La chromatine L ADN est chargé négativement

Plus en détail

GM- Support de l'information génétique ; structure et fonction du génome. Support de l'information génétique ; structure et fonction du génome

GM- Support de l'information génétique ; structure et fonction du génome. Support de l'information génétique ; structure et fonction du génome Mercredi 9 octobre ABECASSIS Anna L2 GM Pr Beroud 16 pages Support de l'information génétique ; structure et fonction du génome Plan A. Des gènes aux protéines I. Structure de l'adn II. Structure des gènes

Plus en détail

Les documents présentés dans ce cours sont issus : soit de travaux personnels soit de travaux présentés sur le web Leur utilisation ne doit donner

Les documents présentés dans ce cours sont issus : soit de travaux personnels soit de travaux présentés sur le web Leur utilisation ne doit donner Les documents présentés dans ce cours sont issus : soit de travaux personnels soit de travaux présentés sur le web Leur utilisation ne doit donner lieu à aucune exploitation commerciale D. LOCKER Professeur

Plus en détail

«Biotechnologies et nouvelles stratégies diagnostiques du retard mental.» Colloque médical du Jeudi 26 Avril 2012

«Biotechnologies et nouvelles stratégies diagnostiques du retard mental.» Colloque médical du Jeudi 26 Avril 2012 «Biotechnologies et nouvelles stratégies diagnostiques du retard mental.» Colloque médical du Jeudi 26 Avril 2012 COUTTON Charles Etude du Génome Cytogénétique Cytogénétique moléculaire Biologie moléculaire

Plus en détail

La médecine personnalisée Daniel Locker Professeur honoraire Université Orléans

La médecine personnalisée Daniel Locker Professeur honoraire Université Orléans La médecine personnalisée Daniel Locker Professeur honoraire Université Orléans Introduction En 1992, l introduction d'un anticorps monoclonal, l herceptine, pour le traitement du cancer du sein a donné

Plus en détail

La CGH-array : une nouvelle technique de diagnostic en cytogénétique

La CGH-array : une nouvelle technique de diagnostic en cytogénétique La CGH-array : une nouvelle technique de diagnostic en cytogénétique Olivier Pichon (Ingénieur) Laboratoire de cytogénétique de Nantes, Service de Génétique Médicale Les techniques classiques de cytogénétique

Plus en détail

Quelques définitions

Quelques définitions Quelques définitions Sandrine Lagarrigue et Pascale Le Roy 1 Journée Technique SYSAAF La mise en œuvre des outils de la génomique : enjeux pour le SYSAAF et ses adhérents. 03 juin 2015. Rennes Le génome

Plus en détail

Bioinformatique dans l IUP

Bioinformatique dans l IUP Bioinformatique dans l IUP Intervenants Equipe Bioinfo (Laboratoire d Informatique Fondamentale de Lille) Cours : Jean-Stéphane Varré (jean-stephane.varre@lifl.fr) TD sur machine : Jean-Stéphane Varré,

Plus en détail

FORMATION POSTGRADUÉE POUR SPÉCIALISTE EN MÉDECINE DE LABORATOIRE FAMH. Impression 1 face!!! Cahier des stages

FORMATION POSTGRADUÉE POUR SPÉCIALISTE EN MÉDECINE DE LABORATOIRE FAMH. Impression 1 face!!! Cahier des stages FORMATION POSTGRADUÉE POUR SPÉCIALISTE EN MÉDECINE DE LABORATOIRE FAMH Impression 1 face!!! Cahier des stages Formation postgraduée monodisciplinaire Génétique médicale Version 2013.G.1 de «Vorname» «Nachname»

Plus en détail

Recherche des causes génétiques de génodermatoses chez le chien. Catherine André. Heuzé. Catherine André CNRS Rennes Mars 2007.

Recherche des causes génétiques de génodermatoses chez le chien. Catherine André. Heuzé. Catherine André CNRS Rennes Mars 2007. Recherche des causes génétiques de génodermatoses chez le chien Catherine André CNRS André Eric Guaguere Lille Emmanuel Bensignor Rennes Mathieu Heuzé Thè Heuzé Thèse vé vétérinaire Guillaume Queney, Queney,

Plus en détail

VI. L APPORT DES MARQUEURS MOLECULAIRES. A. Définitions

VI. L APPORT DES MARQUEURS MOLECULAIRES. A. Définitions VI. L APPORT DES MARQUEURS MOLECULAIRES Comme nous l avons vu précédemment, l étude des caractères quantitatifs est fondée sur l analyse statistique des performances mesurées des individus. Il en est de

Plus en détail

De la biologie molécualire à la génomique

De la biologie molécualire à la génomique De la biologie molécualire à la génomique Pierre Neuvial École Nationale de la Statistique et de l Administration Économique Méthodes statistiques pour la biologie Plan du cours 1 Introduction à la biologie

Plus en détail

I. TOUITOU (Mise ligne 15/10/08 LIPCOM-RM) Faculté de Médecine Montpellier-Nîmes

I. TOUITOU (Mise ligne 15/10/08 LIPCOM-RM) Faculté de Médecine Montpellier-Nîmes er cycle PCEM MI5 Génétique moléculaire et clinique Année Universitaire 008-009 Comment apprécier la composante héréditaire des maladies?. Excès de cas familiaux - Les études familiales - - La plupart

Plus en détail

Apport du séquençage à haut débit d un panel de gènes dans le diagnostic d'une cohorte marseillaise de myopathies distales

Apport du séquençage à haut débit d un panel de gènes dans le diagnostic d'une cohorte marseillaise de myopathies distales Apport du séquençage à haut débit d un panel de gènes dans le diagnostic d'une cohorte marseillaise de myopathies distales Thèse de médecine SEVY Amandine, JNIN décembre 2014 I. Myopathies distales Définition

Plus en détail

CGH array. Alain AURIAS INSERM U509 Institut Curie-Paris

CGH array. Alain AURIAS INSERM U509 Institut Curie-Paris CGH array Alain AURIAS INSERM U509 Institut Curie-Paris Caryotype normal Environ 300 bandes Résolution: 10Mb Ewing Translocation réciproque avec gène de fusion 11 22 EWS FLI1 Nouvelle protéine chimérique,

Plus en détail

Introduction à la Bio-Informatique IFT3295/IFT6291/BIN6000. Nadia El-Mabrouk DIRO, Université de Montréal

Introduction à la Bio-Informatique IFT3295/IFT6291/BIN6000. Nadia El-Mabrouk DIRO, Université de Montréal Introduction à la Bio-Informatique IFT3295/IFT6291/BIN6000 Nadia El-Mabrouk DIRO, Université de Montréal Qu est-ce que la Bioinformatique? Qu est-ce que la Bio-informatique? Champs multi-disciplinaire

Plus en détail

Bases moléculaires des mutations et Bases moléculaires du mode de transmission des maladies génétiques

Bases moléculaires des mutations et Bases moléculaires du mode de transmission des maladies génétiques Bases moléculaires des mutations et Bases moléculaires du mode de transmission des maladies génétiques Collège National des Enseignants et Praticiens de Génétique Médicale Martin Krahn Département de Génétique

Plus en détail

Le marquage moléculaire

Le marquage moléculaire Le marquage moléculaire Le marquage moléculaire regroupe un ensemble de techniques révélant des différences de séquences d (acide désoxyribonucléique) entre individus. Les marqueurs moléculaires permettent

Plus en détail

L'apport de l'étude des génomes : les innovations génétiques.

L'apport de l'étude des génomes : les innovations génétiques. Introduction : L'apport de l'étude des génomes : les innovations génétiques. Au sein du vivant, les espèces se différencient les unes des autres par l existence de gènes différents. Au sein d une espèce,

Plus en détail

TD Révision BIO57. Connaissance et Technique du gène

TD Révision BIO57. Connaissance et Technique du gène TD Révision BIO57 Connaissance et Technique du gène Novembre 2007 Cécile BAUDOT cecile.baudot@medecine.univ-mrs.fr INSERM 910 «Génétique Médicale et Génomique Fonctionnelle» Maladies Neuromusculaires Le

Plus en détail

Diagnostic prénatal des maladies génétiques

Diagnostic prénatal des maladies génétiques Diagnostic prénatal des maladies génétiques Collège National des Enseignants et Praticiens de Génétique Médicale C. Coutton, V. Satre, F. Amblard et F. Devillard Date de création du document 2010-2011

Plus en détail

Les microarrays: technologie pour interroger le génome

Les microarrays: technologie pour interroger le génome Les microarrays: technologie pour interroger le génome Patrick DESCOMBES patrick.descombes@frontiers-in-genetics.org Plate forme génomique NCCR Frontiers in Genetics Université de Genève http://genomics.frontiers-in-genetics.org

Plus en détail

BACCALAURÉAT TECHNOLOGIQUE

BACCALAURÉAT TECHNOLOGIQUE BACCALAURÉAT TECHLGIQUE Série : Sciences et Technologies de Laboratoire Spécialités : - Biotechnologies - Sciences physiques et chimiques en laboratoire SESSI 2014 Sous-épreuve écrite de Chimie biochimie

Plus en détail

La Génétique pour les Nuls

La Génétique pour les Nuls La Génétique pour les Nuls Marie Pierre AUDREZET Laboratoire de Génétique Moléculaire INSERM U1078 - CHRU BREST La Génétique pour les nuls Mutations Référence : Base de données HGMD Différents types de

Plus en détail

Génétique. Compléments au cours de 3 ème.

Génétique. Compléments au cours de 3 ème. Génétique Compléments au cours de 3 ème. Plan: Le codage de l information génétique. L utilisation de la génétique. Les limites actuelles de la génétique. Le codage de l information génétique. La structure

Plus en détail

Caryotype humain : Technique - Indications

Caryotype humain : Technique - Indications Caryotype humain : Technique - Indications Collège National des Enseignants et Praticiens de Génétique Médicale Dr Cédric Le Caignec Service de génétique médicale, CHU Nantes, France Date de création du

Plus en détail

Etude du transcriptome et du protéome en Neurooncologie

Etude du transcriptome et du protéome en Neurooncologie Etude du transcriptome et du protéome en Neurooncologie Principes, aspects pratiques, applications cliniques François Ducray Neurologie Mazarin, Unité Inserm U711 Groupe hospitalier Pitié-Salpêtrière Etude

Plus en détail

TD 5 : Génétique humaine

TD 5 : Génétique humaine TD 5 : Génétique humaine Exercice 1 (pour se mettre en forme...). Une femme de vision normale dont le père est daltonien (maladie héréditaire récessive, caractérisée par un défaut de vision des couleurs,

Plus en détail

LE SEQUENCAGE DU GENOME HUMAIN. Historique Séquençage Résultats

LE SEQUENCAGE DU GENOME HUMAIN. Historique Séquençage Résultats LE SEQUENCAGE DU GENOME HUMAIN Historique Séquençage Résultats Séquençage de Macromolécules Enchaînement d unités répétitives Petite molécule Couper de façon précise en sous-ensemble 50 25 25 reconstruire

Plus en détail

Polymorphismes de l ADN

Polymorphismes de l ADN Introduction Polymorphismes de l ADN Présentation et mise en évidence Recherche de gènes responsables de maladies génétiques : Analyse de pedigrees où la maladie est présente Sur quel chromosome? À quel

Plus en détail

Aujourd hui, il y a plus de consortium, ce qui permet des avancées plus rapides.

Aujourd hui, il y a plus de consortium, ce qui permet des avancées plus rapides. GFMOM 20/01/2012 Cours 2 partie 2 T. Bourgeron II. LA CYTOGENETIQUE Nous allons étudier les anomalies chromosomiques des plus grossières aux plus fines. Ces anomalies peuvent être retrouvées dans la population

Plus en détail

Différents types de chromosomes en Giemsa

Différents types de chromosomes en Giemsa Différents types de chromosomes en Giemsa Marquage Giemsa simple - Comptage d une mitose: 45, 46 ou 47 - Reconnaissance des groupes et certains chromosomes dans les groupes, mais pas dans leur structure,

Plus en détail

Jean-Louis Bergé-Lefranc

Jean-Louis Bergé-Lefranc Apport du séquençage du génome humain à la toxicologie: Toxicogénomique Jean-Louis Bergé-Lefranc QuickTime et un décompresseur TIFF (LZW) sont requis pour visionner cette image. QuickTime et un décompresseur

Plus en détail

GLOSSAIRE. Aperto libro

GLOSSAIRE. Aperto libro GLOSSAIRE Aperto libro 1089 1090 GLOSSAIRE Acide désoxyribonucléique ou ADN (angl. DNA) : dimère constitué de deux brins hélicoïdaux composés de nucléotides dont les bases azotées sont la thymine, l adénine,

Plus en détail

1953 : double hélice d ADN

1953 : double hélice d ADN 1953 : double hélice d ADN 1956 : nombre de chromosomes dans le caryotype humain (46) Années 70 : boîte à outils : couper, coller, cloner, premières techniques de séquençage d ADN technique du Southern

Plus en détail

Nouveaux outils de cytogénétique moléculaire (MLPA et CGH) utilisés en constitutionnel COUTTON Charles

Nouveaux outils de cytogénétique moléculaire (MLPA et CGH) utilisés en constitutionnel COUTTON Charles Nouveaux outils de cytogénétique moléculaire (MLPA et CGH) utilisés en constitutionnel COUTTON Charles EC Génétique Jeudi 12 Janvier 2012 Remaniements génomiques Regroupent les duplications, les délétions,

Plus en détail

LE GÉNIE GÉNÉTIQUE ET LA BIOLOGIE MOLÉCULAIRE

LE GÉNIE GÉNÉTIQUE ET LA BIOLOGIE MOLÉCULAIRE LE GÉNIE GÉNÉTIQUE ET LA BIOLOGIE MOLÉCULAIRE Plan Introduction I - Qu est ce Que le génie génétique? II - Quels sont les outils du génie génétique? II.1- Les Enzymes II.1.1- Enzymes de restriction II.1.2-

Plus en détail

ED Biologie moléculaire. E. Turpin J. Lehmann-Che 5-6 novembre 2007

ED Biologie moléculaire. E. Turpin J. Lehmann-Che 5-6 novembre 2007 ED Biologie moléculaire E. Turpin J. Lehmann-Che 5-6 novembre 2007 PCR 1983: Kary Mullis Amplification in vitro par une méthode enzymatique d'un fragmentd'adn en présence de deux oligonucléotides spécifiques

Plus en détail

Etapes générales. Polonator. Protocole. Préparation des échantillons. Dover. Séquençage par hybridation/ligation de nonamères. Mise en service en 2009

Etapes générales. Polonator. Protocole. Préparation des échantillons. Dover. Séquençage par hybridation/ligation de nonamères. Mise en service en 2009 Next Generation DNA Sequencing Pourquoi? Séquençage par la méthode de Sanger est pour l instant le «gold standard» Besoins de séquencer toujours plus, plus vite et moins cher But: Séquencer 1 génome humain

Plus en détail

Objectif 6 : Conforter l avance de la France dans la médecine personnalisée

Objectif 6 : Conforter l avance de la France dans la médecine personnalisée Objectif 6 : Conforter l avance de la France dans la médecine personnalisée Si les conditions physiques telles que l âge, les antécédents, mais aussi des facteurs sociaux, psychiques et culturels influencent

Plus en détail

Structure de l'adn & Polymorphisme

Structure de l'adn & Polymorphisme UNIVERSITE D ALGER Faculté de Médecine et de Médecine Dentaire ZIANIA (Château Neuf) Structure de l'adn & Polymorphisme COURS DE GENETIQUE -2014-2015- L ADN : l acide désoxyribonucléique L ADN est: Un

Plus en détail

Cytogénétique et biologie moléculaire

Cytogénétique et biologie moléculaire Cytogénétique et biologie moléculaire apport au diagnostic, à l évaluation pronostique et au suivi des hémopaties malignes C Bastard, DESC, 21 septembre 2009 Pourquoi est-ce possible? Parce que les anomalies

Plus en détail

Du microscope. aux microarrays. le "saut de puce" de la cytogénétique

Du microscope. aux microarrays. le saut de puce de la cytogénétique Du microscope le "saut de puce" aux microarrays de la cytogénétique ARL 13 mars 2008 Dr Danielle Martinet Spéc. FAMH en analyses de génétique médicale Laboratoire de cytogénétique constitutionnelle Service

Plus en détail

Activité Intitulé de l'activité Volume horaire

Activité Intitulé de l'activité Volume horaire Informations de l'unité d'enseignement Implantation Cursus de Institut Paul Lambin Bachelier en chimie Intitulé Biotechnologie 2 C2120 Cycle 1 Bloc 2 Quadrimestre 2 Pondération 1 Nombre de crédits 5 Nombre

Plus en détail

UNION INTERNATIONALE POUR LA PROTECTION DES OBTENTIONS VÉGÉTALES

UNION INTERNATIONALE POUR LA PROTECTION DES OBTENTIONS VÉGÉTALES ORIGINAL : anglais DATE : 21 octobre 2010 UNION INTERNATIONALE POUR LA PROTECTION DES OBTENTIONS VÉGÉTALES GENÈVE F DIRECTIVES CONCERNANT LES PROFILS D ADN : CHOIX DES MARQUEURS MOLECULAIRES ET CONSTRUCTION

Plus en détail

Tumeurs du sein triple négatif: Biologie moléculaire et projets de recherche

Tumeurs du sein triple négatif: Biologie moléculaire et projets de recherche 64 ème réunion du GERM Tumeurs du sein triple négatif: Biologie moléculaire et projets de recherche Tumeurs du sein triple négatif (TN) 12-17% des cancers du sein Contexte familial porteuses des mutations

Plus en détail

Analyse Chromosomique sur Puce à ADN Applications en Prénatal

Analyse Chromosomique sur Puce à ADN Applications en Prénatal Analyse Chromosomique sur Puce à ADN Applications en Prénatal Véronique Satre, Charles Coutton, Gaëlle Vieville, Françoise Devillard et Florence Amblard Maladies génétiques Anomalies chromosomiques Cytogénétique

Plus en détail

Structure des génomes bactériens / systèmes de mutagénèse / génomique comparative

Structure des génomes bactériens / systèmes de mutagénèse / génomique comparative Master 1 Bactério 10/01/09 8h30-10h30 RT : Stéphanie Ripert-Bernusset RL: Benjamin de Sainte Marie Structure des génomes bactériens / systèmes de mutagénèse / génomique comparative PLAN DU COURS : I- GENOME

Plus en détail

Examen de Mi-d'année. Exercice I: L albinisme et ses causes.

Examen de Mi-d'année. Exercice I: L albinisme et ses causes. Class: 3 ème. Secondaire (S.V.) Matière: Biologie Exercice I: L albinisme et ses causes. Examen de Mi-d'année Points: 20 pts. Durée: 180 min. (4.5 pts.) L albinisme résulte d un manque général de la pigmentation

Plus en détail

LES BASES GENETIQUES DE LA SEP

LES BASES GENETIQUES DE LA SEP LES BASES GENETIQUES DE LA SEP Deux hypothèses sont possibles. Ou bien la SEP est liée à une anomalie génétique unique directement responsable de la maladie (dans ce cas il existe un gène de la SEP) ou

Plus en détail

Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013

Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013 Sélectionner les propositions exactes Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013 QCM 1 La plupart des techniques de biologie moléculaire repose sur le principe de complémentarité

Plus en détail

Biologie moléculaire et Génie génétique

Biologie moléculaire et Génie génétique Module 1 : Biologie moléculaire et Génie génétique Section 1 : STRUCTURES ET FONCTIONS DES ACIDES NUCLEIQUES Plutôt que de rechercher l'exhaustivité, on s'attachera à la clarification et la structuration

Plus en détail

PRINCIPES DE BASES DE L ANALYSE DES CHROMOSOMES HUMAINS

PRINCIPES DE BASES DE L ANALYSE DES CHROMOSOMES HUMAINS PRINCIPES DE BASES DE L ANALYSE DES CHROMOSOMES HUMAINS Dr Sylvie Taviaux Laboratoire de cytogénétique Hôpital Arnaud de Villeneuve CHU Montpellier S-taviaux@chu-montpellier.fr Septembre 2014 PRINCIPES

Plus en détail

Vers l assignation de parenté par SNP

Vers l assignation de parenté par SNP Vers l assignation de parenté par SNP Journée Génomique Sysaaf 3 juin 2015, Rennes Marc VANDEPUTTE INRA UMR Génétique Animale et Biologie Intégrative Ifremer Laboratoire 3AS L assignation de parenté Pour

Plus en détail

Pathologies et génétique moléculaire

Pathologies et génétique moléculaire Biochimie - Biologie moléculaire Pathologies et génétique moléculaire Julien Fauré Institut de Formation en Soins Infirmiers 1 ère Année Année universitaire 2014-2015 Plan Les outils de la génétique moléculaire

Plus en détail

GENETIQUE MEDICALE - Principe des études moléculaires en Génétique Médicale, Méthodes d analyse des microlésions du Génome

GENETIQUE MEDICALE - Principe des études moléculaires en Génétique Médicale, Méthodes d analyse des microlésions du Génome 29/10/2014 Crévits Léna L2 Génétique médicale Dr Martin Krahn 14 pages Principe des études moléculaires en Génétique Médicale - Méthodes d analyse des microlésions du Génome Plan A. Rappels et généralités

Plus en détail

Les biobanques pour les débutants

Les biobanques pour les débutants Les biobanques pour les débutants C Dubourg B Turlin 14 octobre 2010 CHU de Rennes Définition Collection d échantillons biologiques humains Réunion, à des fins scientifiques, de prélèvements biologiques

Plus en détail

Marc DELPECH. CORATA La Rochelle le 21 mai 2008

Marc DELPECH. CORATA La Rochelle le 21 mai 2008 Marc DELPECH CORATA La Rochelle le 21 mai 2008 En 24 ans les progrès ont été considérables Premières utilisation des techniques de génétique moléculaire en diagnostic : 1984 Une palette de techniques très

Plus en détail

Ingénierie des protéines

Ingénierie des protéines Ingénierie des protéines Stéphane Delbecq EA 4558 Vaccination antiparasitaire Laboratoire de Biologie Cellulaire et Moléculaire Faculté de Pharmacie - Montpellier Rappel: transcription et traduction Universalité

Plus en détail

Série : STL Spécialité biotechnologies SESSION 2014 BACCALAURÉAT TECHNOLOGIQUE

Série : STL Spécialité biotechnologies SESSION 2014 BACCALAURÉAT TECHNOLOGIQUE BACCALAURÉAT TECHNLGIQUE Série : STL Spécialité biotechnologies SESSIN 2014 CBSV : sous épreuve coefficient 4 Biotechnologies : sous épreuve coefficient 4 Durée totale de l épreuve: 4 heures Les sujets

Plus en détail

COURS 10 : Génétique des Maladies Multifactorielles

COURS 10 : Génétique des Maladies Multifactorielles UE5: Génétique Médicale 10/12/13 8h30 à 10h30 Stéphanie Debette RT: Aude Renaud RF: Zahra Rahnema COURS 10 : Génétique des Maladies Multifactorielles Ronéo 11 1 I. Utilisation des connaissances des Maladies

Plus en détail

Biologie Moléculaire 6 GT SG FWB Leçon n 5

Biologie Moléculaire 6 GT SG FWB Leçon n 5 Biologie Moléculaire 6 GT SG FWB Leçon n 5 Tests de paternité (fin labo électrophorèse) Un test de paternité consiste à analyser l'adn de deux personnes dans le but d'établir un lien de parenté génétique.

Plus en détail

génomes Présentation La biologie à l'heure du séquençage des génomes Séquençage de génomes: Pourquoi? Comment? Annotation des génomes

génomes Présentation La biologie à l'heure du séquençage des génomes Séquençage de génomes: Pourquoi? Comment? Annotation des génomes Présentation Bioinformatique: analyse des génomes Céline Brochier-Armanet (Laurent Duret) Université Claude Bernard, Lyon 1 Laboratoire de Biométrie et Biologie évolutive (UMR 5558) Celine.brochier-armanet@univ-lyon1.fr

Plus en détail

Leçon 1 : Les caractères d un individu Date : Chaque être humain possède de nombreux caractères.

Leçon 1 : Les caractères d un individu Date : Chaque être humain possède de nombreux caractères. Leçon 1 : Les caractères d un individu Date : Chaque être humain possède de nombreux caractères. Certains caractères sont communs à tous les individus de notre espèce et permettent de nous distinguer des

Plus en détail

Détermination de gènes candidats par séquençage d exome dans une famille présentant des calcifications idiopathiques des noyaux gris centraux

Détermination de gènes candidats par séquençage d exome dans une famille présentant des calcifications idiopathiques des noyaux gris centraux Service de Neurologie U614 Génétique médicale et fonctionnelle des cancers et des maladies neuropsychiatriques Pr Frébourg Dr Campion Pr Hannequin Détermination de gènes candidats par séquençage d exome

Plus en détail

1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16.

1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 1. Indiquer ce qu est un gène. 2. Décrire la structure de la molécule d ADN. 3. Indiquer ce que sont les allèles d un gène. 4. Indiquer ce qu est le génotype. 5. Indiquer ce qu est le phénotype. 6. Citer

Plus en détail

Epigénétique. «pourquoi toutes les cellules d'un organisme ne sont-elles pas identiques» Alors qu elles ont toutes les mêmes gènes.

Epigénétique. «pourquoi toutes les cellules d'un organisme ne sont-elles pas identiques» Alors qu elles ont toutes les mêmes gènes. Epigénétique Introduction «pourquoi toutes les cellules d'un organisme ne sont-elles pas identiques» Alors qu elles ont toutes les mêmes gènes. Deux périodes successives récentes dans l étude des génomes

Plus en détail

Souris phosphorescente

Souris phosphorescente Les techniques d''étude Du génome humain I_ L'évolution de la génétique La notion de maladie génétique était déjà connue autour de 1872 ; Mr Huntington avait remarqué que, pour certaines maladies, lorsque

Plus en détail

L anatomopathologiste : un lien entre les différents intervenants. Françoise Collin

L anatomopathologiste : un lien entre les différents intervenants. Françoise Collin L anatomopathologiste : un lien entre les différents intervenants Françoise Collin Les grands classiques Microbiopsie Biopsie chirurgicale Pièce opératoire Diagnostic AP classification OMS 2002 > 50 types

Plus en détail

UE 2V311 - TD3-2015. Analyses de méioses, ségrégation et cartographie.

UE 2V311 - TD3-2015. Analyses de méioses, ségrégation et cartographie. Buts du TD : UE 2V311 - TD3-2015 Analyses de méioses, ségrégation et cartographie. - connaître la méiose et ses conséquences sur la transmission et la recombinaison de l information génétique à travers

Plus en détail

TP BC : ADN recombinant BCPST1, ENCPB

TP BC : ADN recombinant BCPST1, ENCPB TP BC : principe et analyse de résultats des technologies de l ADN recombinant = clonage moléculaire = génie génétique Sources des illustrations : Analyse génétique moderne, Griffith et al., De Boeck,

Plus en détail

Chapitre 1. Histoire de la biologie moléculaire

Chapitre 1. Histoire de la biologie moléculaire Chapitre 1. Histoire de la biologie moléculaire 1. L idée que les caractères observables (le phénotype) d un individu puissent se transmettre de génération en génération par des «unités» héritées (le génotype)

Plus en détail

Extrait cours svt 3e. semaine 3

Extrait cours svt 3e. semaine 3 Extrait cours svt 3e semaine 3 Chapitre 1 : Tous parents, tous différents Le titre du chapitre est «tous pareils, tous différents». Le même chapitre, repris plus en détails en Terminale est «tous parents,

Plus en détail

Le séquençage haut-débit

Le séquençage haut-débit Nouveaux outils en biologie Le séquençage haut-débit DES d hématologie 16 janvier 2015 Paris Alice Marceau-Renaut Laboratoire d hématologie CHRU Lille NGS = Next-Generation Sequencing Whole-genome Whole-exome

Plus en détail

Plateforme de Recherche de Mutations

Plateforme de Recherche de Mutations Plateforme de Recherche de Mutations Jean-Marc Aury contact: pfm@genoscope.cns.fr 29 janvier 2009 Introduction Présentation des données produites par le GSFLX : type, qualité, Méthodes de détection de

Plus en détail

PRINCIPES DE BASES DE L ANALYSE DES CHROMOSOMES HUMAINS

PRINCIPES DE BASES DE L ANALYSE DES CHROMOSOMES HUMAINS PRINCIPES DE BASES DE L ANALYSE DES CHROMOSOMES HUMAINS II. Outils CONTEXTE CLINIQUE Jonction entre chromosomique et moléculaire Dr G. Lefort II. TECHNIQUE 1) Le caryotype conventionnel en bandes Nécessite

Plus en détail

Chromosome et caryotype

Chromosome et caryotype Chromosome et caryotype Définition et généralités L étude du caryotype «classique» humain est l étude des chromosomes à un stade maximum de condensation (chromosomes mitotiques en métaphase). Caryotype

Plus en détail

Mlle ImaneSmaili SVI4. Encadré par: Responsable du cours de Biologie Moléculaire Pr. B. BELKADI

Mlle ImaneSmaili SVI4. Encadré par: Responsable du cours de Biologie Moléculaire Pr. B. BELKADI Mlle ImaneSmaili SVI4 Encadré par: Responsable du cours de Biologie Moléculaire Pr. B. BELKADI PLAN 1. Introduction 2.Définition 3. Principe 4.Les applications de la PCR Introduction La PCR «Polymerase

Plus en détail

GUYANE. Ces fiches présentent des activités spécifiques qui demandent des infrastructures, un savoir-faire et des autorisations particulières.

GUYANE. Ces fiches présentent des activités spécifiques qui demandent des infrastructures, un savoir-faire et des autorisations particulières. Cette nouvelle édition des fiches régionales relatives à l activité 2013 des centres pluridisciplinaires de diagnostic prénatal (CPDPN), des laboratoires de diagnostic prénatal (DPN) et de l activité 2014

Plus en détail

Analyses moléculaires des tumeurs conjonctives Expérience de l Institut Bergonié Bordeaux. Activité FISH/CGH et présentation de cas

Analyses moléculaires des tumeurs conjonctives Expérience de l Institut Bergonié Bordeaux. Activité FISH/CGH et présentation de cas Analyses moléculaires des tumeurs conjonctives Expérience de l Institut Bergonié Bordeaux Activité FISH/CGH et présentation de cas Gaëlle Pérot Institut Bergonié Département de Biopathologie Bordeaux Département

Plus en détail

Les examens de laboratoire : comment les interpreter? Exemple : les marqueurs tumoraux. Michèle BERTHIER : SCOR GLOBAL LIFE

Les examens de laboratoire : comment les interpreter? Exemple : les marqueurs tumoraux. Michèle BERTHIER : SCOR GLOBAL LIFE Les examens de laboratoire : comment les interpreter? Exemple : les marqueurs tumoraux Michèle BERTHIER : SCOR GLOBAL LIFE Présentation faite en collaboration avec le Dr Gabriela BUFFET, Médecin-Conseil

Plus en détail

SEMIOLOGIE- Applications de la biologie moléculaire à la médecine. Applications de la biologie moléculaire à la médecine.

SEMIOLOGIE- Applications de la biologie moléculaire à la médecine. Applications de la biologie moléculaire à la médecine. 30/04/12 Camille Garbarino Sémiologie Pr Barlier 6 pages SEMIOLOGIE- Applications de la biologie moléculaire à la médecine. Applications de la biologie moléculaire à la médecine. Plan : A) Principales

Plus en détail

Obtention de données génétiques à grande échelle

Obtention de données génétiques à grande échelle Obtention de données génétiques à grande échelle Stéphanie FERREIRA Ph.D. Campus de l Institut Pasteur de Lille 1, rue du Professeur Calmette 59000 LILLE Tel : 03 20 87 71 53 Fax : 03 20 87 72 64 contact@genoscreen.fr

Plus en détail

Diagnostic prénatal non-invasif. Les arguments plaident en faveur de Prendia

Diagnostic prénatal non-invasif. Les arguments plaident en faveur de Prendia Diagnostic prénatal non-invasif Les arguments plaident en faveur de Prendia Diagnostic prénatal non-invasif Diagnostic prénatal en général 4 Types de diagnostics prénataux: graphique 6 La famille de produits

Plus en détail

POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA

POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA Amplification spécifique Détection spécifique Clonage dans des vecteurs Amplification in vitro PCR Hybridation moléculaire - hôte cellulaire

Plus en détail

Méthodes diagnostiques en génétique moléculaire

Méthodes diagnostiques en génétique moléculaire Méthodes diagnostiques en génétique moléculaire P. Latour Praticien Hospitalier Responsable UF 3427 Neurogénétique Moléculaire Laboratoire de Neurochimie Pr Renaud HCL Centre de Biologie Est DES Neurologie

Plus en détail

Approfondissement des connaissances en biologie moléculaire

Approfondissement des connaissances en biologie moléculaire Approfondissement des connaissances en biologie moléculaire nicolas.glaichenhaus@unice.fr Master IADE Année 2013-2014 Plan du cours Rappels de biologie moléculaire et de biologie cellulaire Les molécules

Plus en détail