GénoToul 2010, Hôtel de Région Midi Pyrénées, Toulouse, 10 décembre 2010

Dimension: px
Commencer à balayer dès la page:

Download "GénoToul 2010, Hôtel de Région Midi Pyrénées, Toulouse, 10 décembre 2010"


1 GénoToul 2010, Hôtel de Région Midi Pyrénées, Toulouse, 10 décembre 2010 Analyse de la diversité moléculaire des régions génomiques de 30 gènes du développement méristématique dans une core collection de 96 accessions de tomate par combinaison de long range PCR et séquençage 454 Stéphane Muños Projet FLOMEDIV

2 La tomate, espèce modèle pour la famille des solanacées

3 Objectif de la sélection de la tomate de frais : des attentes multiples La tomate : légume le plus consommé au monde La France : 27 ème rang mondial pour la production ( tonnes, source FAO 2008) producteur distributeur acheteur consommateur stabilité rendement, précocité adaptation, résistances fermeté conservation couleur aspect saveur sucre acide arôme. volatils texture parois santé pigments, pg vitamines, antioxydants qualité commerciale qualité organoleptique qualité nutritionnelle

4 L aspect des fruits est nécessaire pour le choix des consommateurs La forme et la couleur pour se distinguer des autres Des QTL clonés chez la tomate : sun, ovate, fw2.2, fasciated, lc

5 La taille du fruit : un mécanisme précoce lors du développement Méristème floral Nombre de carpelles Nombre de loges Taille du fruit Wild type Processing type Large fresh type Source: Barreroet et al, 2006 Source: Cong et al, 2008 Quels gènes du développement méristématique floral sont impliqués dans la taille et la forme du fruit?

6 Valoriser la diversité naturelle par la génétique d association Populations naturelles Développée pour la génétique humaine, appliquée aux plantes (Norborg,2006) Variabilité naturelle (plus d allèles et d évènements de recombinaison) Source: Ranc N., thèse 2010

7 Construction d une core collection Centre national de ressources pour la tomate 2752 accessions entretenues et caractérisées 340 accessions phenotypées and génotypées (20 SSR) 180 accessions phénotypées plus finement Core collection de 96 accessions 98 % de la diversité Thèse Nicolas Ranc, 2010

8 Contexte et objectifs du projet FLOMEDIV FLOMEDIV : projet INRA Syngenta Seeds Séquençage de gènes candidats du développement méristématique (core collection de 96 accessions) Génétique d association pour la forme et le poids du fruit Objectifs : Stage de Master de Guillaume Bauchet (15/01 au 15/07/201, Université de Wageningen Hollande) identifier les locus impliqués dans la forme et le poids du fruit (génétique d association) Comprendre l histoire évolutive de la forme des fruits chez la tomate et identifier des traces de sélection.

9 Matériel et méthodes

10 Matériel végétal Core collection de 96 accessions 11 écotypes sauvages (S. pimpinellifolium, p S. chmielewskii,, S. habrochaites,, S. pennellii, S. cheesmaniae) 65 type intermédiaires (S. lycopersicum var cerasiforme) 16 cultivars (S. lycopersicum var esculentum) 600 Nombre de SNPs S. pimpi cerise S. lyco

11 Caractérisation phénotypique de la core collection Caractères généraux des fruits Morphologie des fruits Morphologie florale Nombre de loges Poids Acidité Teneur en sucres Fermeté Couleur Metabolites Activitée enzymatique Analyse des images Forme des fruits: Tomato Analyzer (Esther Van Der Knaap) analyzer htm Forme des fleurs : ImageJ

12 RESULTATS 1. Procédures expérimentales

13 Sélection des gènes candidats Etude bibliographique Sélection de 80 gènes candidats Gènes décrits chez les espèces modèles du développement méristématique: Arabidopsis, Petunia, Antirrhinum Gènes responsables de QTL de la forme et du poids du fruit chez la tomate


15 Long range PCR Recherche des orthologues chez la tomate (stratégie Blast) Définition des couples d amorces Test de 2 3 couples/fragment 5-7 Kb Long range PCR

16 30 gènes candidats sélectionnés Gènes sélectionnés sur la base de: leur rôle fonctionnel des résultats d amplification PCR

17 Pooling des fragments et dosage Pooling: 96 accessions X 30 fragments g g g 1 pool/ accession X 96 Dosage: Picogreen and slingshot titration X 30 Mesure de la qualité des échantillons après fragmentation (nébulisation)

18 Séquençage 454 accession 1 accession 2 accession 12 accession 85 accession fragments 30 fragments 30 fragments 30 fragments 30 fragments pool1 pool2 pool12 pool85 pool96 MID1 MID2 MID12 MID1 MID12 pool1 pool8 Génopole de Toulouse Séquenceur Roche FLX Tagging de chacun des 96 pools 1 run= 300 Mb Données de séquençage obtenues le 18 juin 2010

19 RESULTATS 2. Détection du Polymorphisme et Génétique d association

20 Descriptif du run 454 Taille moyenne des séquences : 350 nucléotides Quantité totale de séquences : 322 Mb Nombre total de séquences : Référence (30 fragments) : 170Kb Profondeur moyenne : 19X

21 Des taux de profondeur variables entre pools 9603 séquences/pool en moyenne (19X) 3968 séquences minimum (8X) séquences maximum (44X) Le pooling entraine des variations malgré une quantification précise

22 Principe de l assemblage des séquences Séquence de référence (Heinz1706) pour chaque fragment Annotation (Artemis) Assemblage pour les 96 accessions de la core collection (Seqman Ngen) sur les séquences de référence (Heinz 1706) Couverture variable au sein d un même fragment 92.6% des séquences assemblées en moyenne Moins bon assemblage pour les espèces sauvages (61.2% pour S. pennellii)

23 Le problème des INDELs INDELs: fort taux de faux polymorphisme (problème connu des homopolymères) Non traités


25 Des taux de polymorphisme cohérents cultivars modernes peu polymorphes du polymorphisme dans la référence Espèces sauvages plus polymorphes

26 Distribution des SNPs en fonction des fragments SNPs au total

27 Génétique d association Génétique d association: TASSEL (Bradbury et al, 2007) Minimum allele frequency treshold: MAF=5% ; = set de 533 markers; sauvages exclus (6 access.) 66 associations potentielles Validité des associations?

28 Analyse du locus ovate ovate est un locus responsable de l allongement des fruits Tomato accession Genotype Fruit shape index code CR102 C 0,6122 CR136 C 0,6327 CR321 C 0,6418 CR134 C 0,7041 CR155 C 0,7049 CR133 C 0,7208 CR288 C 0,7505 CR156 C 0,7519 CR152 N 0,7592 CR130 C 0,76 CR101 C 0,7787 CR256 C 0,7867 CR129 C 0,7893 CR274 C 0,7901 CR093 C 0,7908 CR341 N 0,7926 CR117 C 0,7936 Logiciel Tomato Analyzer CR002 C 0,7959 CR359 C 0,8088 CR097 N 0,8131 CR118 C 0,8141 CR079 c 0,8292 CR077 C 0,8364 CR354 C 0,8398 CR032 C 0,8409 Fruit shape index CR058 C 0,8483 CR150 C 0,8518 CR078 C 0,8565 CR149 C 0,8612 CR250 N 0,8671 CR153 N 0,8699 CR258 C 0,8732 CR186 C 0,874 CR287 C 0,8742 CR001 C 0,8752 CR031 C 0,8761 CR236 C 0,8764 CR076 C 0,8765 CR293 C 0,8772 CR003 C 0,8806 CR253 C 0,8812 Fruit CR280 C 0,8816 CR249 C 0,884 CR267 C 0,8867 CR098 C 0,8917 CR203 C 0,8996 CR125 C 0,9018 CR123 C 0,9056 CR163 C 0,9062 CR273 C 0,9093 CR202 C 0,91 CR106 C 0,9139 CR173 C 0,9174 CR164 C 0,9176 CR094 C 0,9184 CR284 C 0,9276 CR158 C 0,9392 CR254 C 0,9394 CR124 C 0,9402 CR240 C 0,9402 CR199 C 0,9472 CR292 N 0,9473 CR108 C 0,9525 CR110 C 0,9598 CR279 N 0,9619 CR169 C 0,9639 CR056 A 0,9684 CR072 C 0,9724 CR062 C 0,9736 shape ind dex <1 CR234 C 0,9738 CR238 C 0,9843 CR159 C 0,9958 CR014 A 0,9989 CR068 C 1,0114 CR004 C 1,0552 CR122 C 1,0645 CR028 C 1,094 CR294 C 1,1248 CR205 C 1,1253 CR070 A 1,1414 CR275 N 1,1476 CR075 A 1,2388 CR020 A 1,2742 CR291 A 1,3245 CR317 A 1,3732 CR145 A 1,3821 CR252 A 1,4354 CR296 A 1,5153 CR244 N 1,5405 CR271 a 1,6728 >1 Fruits allongés

29 Validation du SNP causal de ovate Transition C to A Même SNP que celui décrit comme responsable du phénotype. SNP = codon stop (protéine tronquée).

30 Validation du locus lc contrôlant le nombre de loges des fruits de tomate Tomato accession code Genotype Locule number Validation du SNP causal: Transition de vers A G CR075 A 1, CR068 A 1, CR250 N 2, CR173 A 2, CR159 N 2, CR122 A 2, CR158 A 2, CR271 A 2, CR072 A 2, CR124 A 2, CR123 N 2, CR291 A 2, CR169 A 2, CR028 A 2, CR070 A 2, CR199 A 2, CR236 A 2, CR163 A 2, CR203 A 2, CR202 N 2, CR258 A 2, CR106 A 2, CR056 A 2, CR186 A 2, CR076 A 2, CR280 A 2, CR205 A 2, CR145 A 2, CR164 A 2, CR110 A 2, CR240 A 2, CR108 A 2, CR001 N 2, CR252 A 2, CR292 A 2, CR253 A 2, CR294 A 2, CR296 A 2, CR155 A 2, CR003 A 2,23837 CR020 A 2, CR014 A 2, CR279 A 2, CR077 N 2, CR062 A 2, CR125 A 2, CR244 A 2, CR287 A 2, CR097 A 2, CR004 a 2, CR032 A 2, CR317 A 2, CR234 A 2, CR249 N 2,55622 CR275 A 2, CR058 G 2, CR284 A 2, CR267 G 2, CR153 N 2, CR094 G 2, CR254 N 3, CR238 G 3, CR293 N 3, CR031 G 3, CR274 N 3, CR152 G 3, CR078 G 3, CR101 G 3, CR130 G 3, CR093 G 3, CR149 G 3, CR288 G 3, CR098 a 3, CR079 G 3, CR002 N 3, CR129 G 3, CR117 N 4, CR273 G 4, CR156 G 4, CR354 A 4,15622 CR256 G 4, CR150 G 4, CR118 G 5, CR341 N 5, CR359 A 5, CR102 G 7, CR136 G 9, CR321 G 11, CR134 G 12, CR133 G 15, Nom bre de log ges des fru uits <3 >3

31 Résumé 30 gènes (5kb) séquencés chez 96 accessions de tomate 322 Mb de séquences obtenus 4320 SNPs 66 associations 2 loci validés: ovate and lc Les données obtenues sont fiables Méthodologie validatée

32 Perspectives Approfondir o et valider les 64 associations at o s restantes tes Explorer le polymorphisme de type INDELs Analyser la diversité moléculaire des 30 gènes: Identifier les polymorphismes codant, rechercher des traces de sélection Nécessité d améliorer l assemblage des accessions sauvages (de novo)

33 Merci à INRA Avignon Génopole Toulouse Syngenta seeds Guillaume Bauchet Jean Paul Bouchet Yolande Carretero Mathilde Causse Jean Luc Gallois Sophie Rolland Jérôme Lluch Olivier Bouchez Cécile Donnadieu Julien Bonnet Laurent tgi Grivet Nicolas Ranc

Le séquençage haut-débit

Le séquençage haut-débit Nouveaux outils en biologie Le séquençage haut-débit DES d hématologie 16 janvier 2015 Paris Alice Marceau-Renaut Laboratoire d hématologie CHRU Lille NGS = Next-Generation Sequencing Whole-genome Whole-exome

Plus en détail

Plateforme de Recherche de Mutations

Plateforme de Recherche de Mutations Plateforme de Recherche de Mutations Jean-Marc Aury contact: pfm@genoscope.cns.fr 29 janvier 2009 Introduction Présentation des données produites par le GSFLX : type, qualité, Méthodes de détection de

Plus en détail

Génétique et génomique Pierre Martin

Génétique et génomique Pierre Martin Génétique et génomique Pierre Martin Principe de la sélections Repérage des animaux intéressants X Accouplements Programmés Sélection des meilleurs mâles pour la diffusion Index diffusés Indexation simultanée

Plus en détail

Marc DELPECH. CORATA La Rochelle le 21 mai 2008

Marc DELPECH. CORATA La Rochelle le 21 mai 2008 Marc DELPECH CORATA La Rochelle le 21 mai 2008 En 24 ans les progrès ont été considérables Premières utilisation des techniques de génétique moléculaire en diagnostic : 1984 Une palette de techniques très

Plus en détail

Génotypage et Séquençage. Pierre Mournet

Génotypage et Séquençage. Pierre Mournet Génotypage et Séquençage Pierre Mournet Plan Séquençage/Génotypage Classique (usat, Sanger) Séquençage NGS (Next Generation Sequencing) Séquenceur Préparation Pré-NGS Exemple 1 NGS Exemple 2 NGS Génotypage

Plus en détail

Place et avenir du séquençage haut-débit

Place et avenir du séquençage haut-débit Place et avenir du séquençage haut-débit Olivier Bouchez genomique@toulouse.inra.fr La Plateforme GeT Expertise et mise à disposition d une plateforme technologique en génomique : Séquençage Génotypage

Plus en détail

Influence du nombre de réplicats dans une analyse différentielle de données RNAseq

Influence du nombre de réplicats dans une analyse différentielle de données RNAseq Influence du nombre de réplicats dans une analyse différentielle de données RNAseq Statisticiens: Sophie Lamarre Steve Van Ginkel Sébastien Déjean - Magali San Cristobal Matthieu Vignes Biologistes: Stéphane

Plus en détail

Génotypage par Séquençage (GBS) : Création d une carte génétique haute densité de Tournesol Population INEDI (RILs PSC8 x XRQ)

Génotypage par Séquençage (GBS) : Création d une carte génétique haute densité de Tournesol Population INEDI (RILs PSC8 x XRQ) Génotypage par Séquençage (GBS) : Création d une carte génétique haute densité de Tournesol Population INEDI (RILs PSC8 x XRQ) Baptiste Mayjonade (IE-CDD SUNRISE) Génétique et génomique des réponses aux

Plus en détail

Détection de mutations somatiques par NGS sur GAIIx

Détection de mutations somatiques par NGS sur GAIIx Détection de mutations somatiques par NGS sur GAIIx Aude Lamy Laboratoire de Génétique Somatique des Tumeurs CHU de Rouen Inserm U1079 Faculté de Médecine et Pharmacie de Rouen La médecine personalisée

Plus en détail

A la rencontre du séquençage haut-débit nouvelle génération. Infosys Building, Kuwait

A la rencontre du séquençage haut-débit nouvelle génération. Infosys Building, Kuwait A la rencontre du séquençage haut-débit nouvelle génération Infosys Building, Kuwait 2001 : Aboutissement du projet Génome Humain Ancêtres & Renouveau 2010 Hélicos, Ion torrent, Pacbio, Oxford Nanopore

Plus en détail

La génomique. Etude des génomes et de l ensemble de leurs gènes. Nécessite des outils bioinformatiques. Plusieurs étapes :

La génomique. Etude des génomes et de l ensemble de leurs gènes. Nécessite des outils bioinformatiques. Plusieurs étapes : La génomique Etude des génomes et de l ensemble de leurs gènes La structure Le fonctionnement L évolution Le polymorphisme, Plusieurs étapes : Nécessite des outils bioinformatiques 1 Chronologie sur le

Plus en détail

Recherche et analyse de polymorphismes SNP

Recherche et analyse de polymorphismes SNP Recherche et analyse de polymorphismes SNP 1- Tablet : Détection visuelle de SNP avec Tablet Tablet est un outil graphique de visualisation d assemblage et d alignement de séquences issues de NGS (Next

Plus en détail

Gènes Diffusion - EPIC 2010

Gènes Diffusion - EPIC 2010 Gènes Diffusion - EPIC 2010 1. Contexte. 2. Notion de génétique animale. 3. Profil de l équipe plateforme. 4. Type et gestion des données biologiques. 5. Environnement Matériel et Logiciel. 6. Analyses

Plus en détail

exemple de végétaux exposés au benzène atmosphérique Sylvain Dumez sylvain.dumez@univ-lille2.fr

exemple de végétaux exposés au benzène atmosphérique Sylvain Dumez sylvain.dumez@univ-lille2.fr Approches écotoxicogénomiques et application à la biosurveillance exemple de végétaux exposés au benzène atmosphérique Sylvain Dumez sylvain.dumez@univ-lille2.fr Laboratoire des Sciences végétales et fongiques,

Plus en détail


VI. L APPORT DES MARQUEURS MOLECULAIRES. A. Définitions VI. L APPORT DES MARQUEURS MOLECULAIRES Comme nous l avons vu précédemment, l étude des caractères quantitatifs est fondée sur l analyse statistique des performances mesurées des individus. Il en est de

Plus en détail

Génotypage par séquençage d une grande population (BCNAM) de sorgho.

Génotypage par séquençage d une grande population (BCNAM) de sorgho. Generation Challenge Programme Research Initiative II : Amélioration de la productivité et de la qualité du grain de sorgho dans les régions soudanosahéliennes. Génotypage par séquençage d une grande population

Plus en détail

Deuxième partie. Calcul de fréquences de génotypes multilocus dans des pédigrees complexes XXVII

Deuxième partie. Calcul de fréquences de génotypes multilocus dans des pédigrees complexes XXVII Deuxième partie Calcul de fréquences de génotypes multilocus dans des pédigrees complexes XXVII Présentation Les programmes informatiques MDM et grafgen L analyse de schémas de construction de génotypes

Plus en détail

Détermination de gènes candidats par séquençage d exome dans une famille présentant des calcifications idiopathiques des noyaux gris centraux

Détermination de gènes candidats par séquençage d exome dans une famille présentant des calcifications idiopathiques des noyaux gris centraux Service de Neurologie U614 Génétique médicale et fonctionnelle des cancers et des maladies neuropsychiatriques Pr Frébourg Dr Campion Pr Hannequin Détermination de gènes candidats par séquençage d exome

Plus en détail

Découverte de l analyse sensorielle et de son utilisation en production légumière

Découverte de l analyse sensorielle et de son utilisation en production légumière Découverte de l analyse sensorielle et de son utilisation en production légumière Anne-Blandine Hélias 28 juin 2007 BBV Nos objectifs Performance des variétés végétales Qualité : traçabilité génétique

Plus en détail

Les technologies de séquençage à haut débit. Patrick Wincker, Genoscope, Institut de Génomique du CEA

Les technologies de séquençage à haut débit. Patrick Wincker, Genoscope, Institut de Génomique du CEA Les technologies de séquençage à haut débit Patrick Wincker, Genoscope, Institut de Génomique du CEA CNG, 12.05.2009 Séquençage Sanger (méthode des dididéoxy terminateurs) : a permis les progrès de la

Plus en détail

THÈME 3 : DU GÉNOTYPE AU PHÉNOTYPE. CHAPITRE 1 : la relation entre ADN et protéines

THÈME 3 : DU GÉNOTYPE AU PHÉNOTYPE. CHAPITRE 1 : la relation entre ADN et protéines THÈME 3 : DU GÉNOTYPE AU PHÉNOTYPE CHAPITRE 1 : la relation entre ADN et protéines Les caractères d un individu dépendent de plusieurs facteurs : certains dépendent des caractères présents dans la famille

Plus en détail

Olivier Bouchez, GeT-PlaGe Responsable SéquenS. olivier.bouchez@toulouse.inra.fr

Olivier Bouchez, GeT-PlaGe Responsable SéquenS. olivier.bouchez@toulouse.inra.fr Séquençage Haut-Débit sur GeT Olivier Bouchez, GeT-PlaGe Responsable SéquenS quençage Haut-débit olivier.bouchez@toulouse.inra.fr Localisation des séquenceurss Plateforme Génomique INRA Auzeville Séquenceurs

Plus en détail

Les Evolutions techniques. Marc Delpech Laboratoire de Génétique et Biologie moléculaires de l hôpital Cochin

Les Evolutions techniques. Marc Delpech Laboratoire de Génétique et Biologie moléculaires de l hôpital Cochin Les Evolutions techniques Marc Delpech Laboratoire de Génétique et Biologie moléculaires de l hôpital Cochin 1 Les principales étapes de l évolution technologique 1975 Southern blot 1977 Séquençage Sanger

Plus en détail

De la biologie molécualire à la génomique

De la biologie molécualire à la génomique De la biologie molécualire à la génomique Pierre Neuvial École Nationale de la Statistique et de l Administration Économique Méthodes statistiques pour la biologie Plan du cours 1 Introduction à la biologie

Plus en détail

Polymorphismes de l ADN

Polymorphismes de l ADN Introduction Polymorphismes de l ADN Présentation et mise en évidence Recherche de gènes responsables de maladies génétiques : Analyse de pedigrees où la maladie est présente Sur quel chromosome? À quel

Plus en détail

AP SVT. Exercice 1. Exercice 2. Exercice 3.

AP SVT. Exercice 1. Exercice 2. Exercice 3. Exercice 1. AP SVT On cherche à comprendre le mode de transmission de deux caractères chez la Drosophile, organisme diploïde. Effectuez une analyse génétique pour expliquer les résultats des croisements

Plus en détail

La CGH-array : une nouvelle technique de diagnostic en cytogénétique

La CGH-array : une nouvelle technique de diagnostic en cytogénétique La CGH-array : une nouvelle technique de diagnostic en cytogénétique Olivier Pichon (Ingénieur) Laboratoire de cytogénétique de Nantes, Service de Génétique Médicale Les techniques classiques de cytogénétique

Plus en détail


CHAPITRE 3 LA SYNTHESE DES PROTEINES CHAITRE 3 LA SYNTHESE DES ROTEINES On sait qu un gène détient dans sa séquence nucléotidique, l information permettant la synthèse d un polypeptide. Ce dernier caractérisé par sa séquence d acides aminés

Plus en détail

RNAseq et NGS. Adriana Alberti Karine Labadie

RNAseq et NGS. Adriana Alberti Karine Labadie RNAseq et NGS Séquençage et Diversité LES ORGANISMES EUCARYOTES animaux plantes champignons protistes BACTERIES ARCHEES VIRUS METAGENOMES LES SOURCES ADN GENOMIQUE ARN / cdna AMPLICONS BACs ET FOSMIDES

Plus en détail

PERCIMAP. Oreochromis niloticus. Construction d une carte RH à haute densité du génome de Tilapia CNRS UMR 6061

PERCIMAP. Oreochromis niloticus. Construction d une carte RH à haute densité du génome de Tilapia CNRS UMR 6061 PERCIMAP Construction d une carte RH à haute densité du génome de Tilapia Oreochromis niloticus CIRAD UPR20 Aquaculture et gestion des ressources aquatiques, Montpellier H. D Cotta E. Pepey J.F. Baroiller

Plus en détail

TD Révision BIO57. Connaissance et Technique du gène

TD Révision BIO57. Connaissance et Technique du gène TD Révision BIO57 Connaissance et Technique du gène Novembre 2007 Cécile BAUDOT cecile.baudot@medecine.univ-mrs.fr INSERM 910 «Génétique Médicale et Génomique Fonctionnelle» Maladies Neuromusculaires Le

Plus en détail

Les outils bio-moléculaires en sélection

Les outils bio-moléculaires en sélection Les outils bio-moléculaires en sélection Vers l utilisation d outils de génotypage haut débit - FN3PT/ Inra UMR Igepp Vers l utilisation du génotypage haut débit en sélection Sélection assistée par marqueurs

Plus en détail

Chapitre 10 L isolement et la manipulation de gènes. Injection d ADN étranger dans une cellule animale

Chapitre 10 L isolement et la manipulation de gènes. Injection d ADN étranger dans une cellule animale Chapitre 10 L isolement et la manipulation de gènes Injection d ADN étranger dans une cellule animale Comment amplifier un gène d intérêt? Amplification in vivo à l aide du clonage d ADN L ensemble formé

Plus en détail

AutoGRAPH Un serveur pour automatiser et visualiser la comparaison de génomes: Application à l identification de nouveaux gènes chez le chien.

AutoGRAPH Un serveur pour automatiser et visualiser la comparaison de génomes: Application à l identification de nouveaux gènes chez le chien. AutoGRAPH Un serveur pour automatiser et visualiser la comparaison de génomes: Application à l identification de nouveaux gènes chez le chien. Thomas DERRIEN CNRS-UMR6061 Génétique et Développement Université

Plus en détail

I. TOUITOU (Mise ligne 15/10/08 LIPCOM-RM) Faculté de Médecine Montpellier-Nîmes

I. TOUITOU (Mise ligne 15/10/08 LIPCOM-RM) Faculté de Médecine Montpellier-Nîmes er cycle PCEM MI5 Génétique moléculaire et clinique Année Universitaire 008-009 Comment apprécier la composante héréditaire des maladies?. Excès de cas familiaux - Les études familiales - - La plupart

Plus en détail

Différences entre Homme et singes?

Différences entre Homme et singes? Différences entre Homme et singes? Différences entre Homme et singes? Apparition de l œil? Apparition du vol? Apparition des hémoglobines? Molécule d hémoglobine HEME Chaîne polypeptidique de type 2 Chaîne

Plus en détail

Comment rationaliser le stockage d échantillons dans les congélateurs - 80 C?

Comment rationaliser le stockage d échantillons dans les congélateurs - 80 C? Comment rationaliser le stockage d échantillons dans les congélateurs - 80 C? Véronique Signoret 1, Esther Pelpoir 1, Elsa Desnoues 1 Résumé. Avant 2011, à l UGAFL (Unité de Génétique et Amélioration des

Plus en détail

La photoperception chez les plantes et son rôle dans le développement. Se dit d'un corps dont les propriétés varient suivant la direction

La photoperception chez les plantes et son rôle dans le développement. Se dit d'un corps dont les propriétés varient suivant la direction Anisotrope : Se dit d'un corps dont les propriétés varient suivant la direction Tropisme : réaction d'orientation des organes d'une plante à une anisotropie de milieu. Exemples : la lumière, la gravité,

Plus en détail

Obtention de données génétiques à grande échelle

Obtention de données génétiques à grande échelle Obtention de données génétiques à grande échelle Stéphanie FERREIRA Ph.D. Campus de l Institut Pasteur de Lille 1, rue du Professeur Calmette 59000 LILLE Tel : 03 20 87 71 53 Fax : 03 20 87 72 64 contact@genoscreen.fr

Plus en détail

Étude de la biodiversité fongique à l aide de techniques de pyroséquençage

Étude de la biodiversité fongique à l aide de techniques de pyroséquençage Étude de la biodiversité fongique à l aide de techniques de pyroséquençage Biodiversité fongique Biodiversité: diversité spécifique d une communauté écologique, correspondant au nombre d espèces et à leur

Plus en détail

Quentin Rougemont, Guillaume Evanno, Sophie Launey INRA Rennes UMR ESE

Quentin Rougemont, Guillaume Evanno, Sophie Launey INRA Rennes UMR ESE Quentin Rougemont, Guillaume Evanno, Sophie Launey INRA Rennes UMR ESE Rennes Le 19/02/2013 Evolution de l anadromie chez les lamproies Contexte général Objectifs Méthodologie Etats des connaissances Résultats

Plus en détail

QUALVIVOL QUALité des VIandes de VOLailles

QUALVIVOL QUALité des VIandes de VOLailles QUALVIVOL QUALité des VIandes de VOLailles C. Berri, E. le Bihan-Duval (INRA, URA), F. Pitel (INRA, LGC) V. Sibut (URA, ITAVI) AGENAVI VII Colloque AGENAE-GENANIMAL Du 21 au 23 octobre 2009 Tours Approche

Plus en détail

Diagnostic moléculaire des tumeurs solides,! l'expérience Rennaise!

Diagnostic moléculaire des tumeurs solides,! l'expérience Rennaise! Diagnostic moléculaire des tumeurs solides, l'expérience Rennaise Bioinformaticien, Biologiste moléculaire, Biostatisticien, Biologiste B. Ndiaye, M. de Tayrac, J. & A. Mosser Le#séquençage#à#haut#débit#NGS#dans#le#cadre#du#diagnos9c##

Plus en détail

Les documents présentés dans ce cours sont issus : soit de travaux personnels soit de travaux présentés sur le web Leur utilisation ne doit donner

Les documents présentés dans ce cours sont issus : soit de travaux personnels soit de travaux présentés sur le web Leur utilisation ne doit donner Les documents présentés dans ce cours sont issus : soit de travaux personnels soit de travaux présentés sur le web Leur utilisation ne doit donner lieu à aucune exploitation commerciale D. LOCKER Professeur

Plus en détail

Qualité des séquences produites par 454 : exemple de traitement

Qualité des séquences produites par 454 : exemple de traitement Qualité des séquences produites par 454 : exemple de traitement Eric PEYRETAILLADE Equipe d accueil CIDAM Faculté de Pharmacie, Université d Auvergne 1 La Technologie 454 (Roche) Etape 1 : Préparation

Plus en détail

Annales du Contrôle National de Qualité des Analyses de Biologie Médicale

Annales du Contrôle National de Qualité des Analyses de Biologie Médicale Annales du Contrôle National de Qualité des Analyses de Biologie Médicale Charge virale de l Hépatite C : ARN-VHC ARN-VHC 05VHC1 mars 2005 Edition : novembre 2006 Annales ARN-VHC 05VHC1 1 / 14 ARN-VHC

Plus en détail

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq Présenté par Xi LIU ATCGCGCTAGCTGGTGTATCGCATCGCGCTAGCTGGTGTATCGCGCTAGCTGGTGTATCGCGCTAGCCTGGTGTATCGCCATCGCGCTAGCTGGCGCTAGCTGAATCGCGCATATG 17 Septembre 2013 Homéoallèles Génome Normalisation Analyse différentielle

Plus en détail

Plate-forme Bio-informatique. Laboratoire de Bio-informatique et de Génomique intégratives. Utilisateurs (public, privé )

Plate-forme Bio-informatique. Laboratoire de Bio-informatique et de Génomique intégratives. Utilisateurs (public, privé ) Plate-forme Bio-informatique Valorisation et soutien Laboratoire de Bio-informatique et de Génomique intégratives Recherche et développement collaboration Utilisateurs (public, privé ) Proposer des solutions

Plus en détail

Génie de la biocatalyse et génie des procédés. «Production d enzymes industrielles»

Génie de la biocatalyse et génie des procédés. «Production d enzymes industrielles» Ministère de l Enseignement Supérieur et de la Recherche Scientifique Université Virtuelle de Tunis Génie de la biocatalyse et génie des procédés «Production d enzymes industrielles» Concepteur du cours:

Plus en détail

Barcoding environnemental par séquençage haut débit

Barcoding environnemental par séquençage haut débit Barcoding environnemental par séquençage haut débit Potentiel et limites Jean-François Martin Échantillonnage Spécificités du barcoding environnemental Amplification (PCR) de marqueurs choisis Séquençage

Plus en détail

Mise en place du NGS en routine diagnostic - Validation, Organisation, Développements

Mise en place du NGS en routine diagnostic - Validation, Organisation, Développements Mise en place du NGS en routine diagnostic - Validation, Organisation, Développements Atelier sur le Diagnostic Moléculaire de la Mucoviscidose 2014 - Lille Stratégie analytique Préparation library (1,5

Plus en détail

Le séquençage à haut débit Mars 2011

Le séquençage à haut débit Mars 2011 Atelier Epigénétique Université Pierre et Marie Curie Le séquençage à haut débit Mars 2011 Stéphane Le Crom (lecrom@biologie.ens.fr) Institut de Biologie de l École normale supérieure (IBENS) de la Montagne

Plus en détail

Génome humain Polymorphismes Marqueurs génétiques. Dr Chrystelle COLAS Département de Génétique GH Pitié Salpêtrière.

Génome humain Polymorphismes Marqueurs génétiques. Dr Chrystelle COLAS Département de Génétique GH Pitié Salpêtrière. Génome humain Polymorphismes Marqueurs génétiques Dr Chrystelle COLAS Département de Génétique GH Pitié Salpêtrière Génome humain Génome Humain () Homme Cellules Noyaux 46 Chromosomes Protéines Gènes ADN

Plus en détail

Aujourd hui, il y a plus de consortium, ce qui permet des avancées plus rapides.

Aujourd hui, il y a plus de consortium, ce qui permet des avancées plus rapides. GFMOM 20/01/2012 Cours 2 partie 2 T. Bourgeron II. LA CYTOGENETIQUE Nous allons étudier les anomalies chromosomiques des plus grossières aux plus fines. Ces anomalies peuvent être retrouvées dans la population

Plus en détail

Séquençage. Bérénice Batut, berenice.batut@udamail.fr. DUT Génie Biologique Option Bioinformatique Année 2014-2015

Séquençage. Bérénice Batut, berenice.batut@udamail.fr. DUT Génie Biologique Option Bioinformatique Année 2014-2015 Séquençage Bérénice Batut, berenice.batut@udamail.fr DUT Génie Biologique Option Bioinformatique Année 2014-2015 Séquençage Séquençage ADN Détermination de l ordre d enchainement des nucléotides d un fragment

Plus en détail

Objectif : identifier la mutation responsable de la maladie parmi les millions de polymorphisme.

Objectif : identifier la mutation responsable de la maladie parmi les millions de polymorphisme. Identification de gènes morbides Analyses mutationnelles Maladies monogéniques Objectif : identifier la mutation responsable de la maladie parmi les millions de polymorphisme. Plan : Variations du nombre

Plus en détail

Anagène. Démarrer avec le logiciel. Ressources. Traitements courants. Aller plus loin

Anagène. Démarrer avec le logiciel. Ressources. Traitements courants. Aller plus loin Anagène Anagène est un logiciel conçu par le CNDP et INRP. Il est destiné à l'exploitation pédagogique de données moléculaires : séquences de gènes et de protéines. L'élève peut ainsi travailler sur des

Plus en détail

Deux plateformes IBiSA et 3 plateaux techniques regroupés depuis 2010. Responsable scientifique Denis Milan. Coordination des nouveaux investissements

Deux plateformes IBiSA et 3 plateaux techniques regroupés depuis 2010. Responsable scientifique Denis Milan. Coordination des nouveaux investissements RNA-seq Olivier Bouchez Nathalie Marsaud Mercredi 28 mars 2012 Plateforme GeT : Génome et Transcriptome Deux plateformes IBiSA et 3 plateaux techniques regroupés depuis 2010 Responsable scientifique Denis

Plus en détail

Post-traitement et analyse des données

Post-traitement et analyse des données V. Garcia J. Dupiot Post-traitement et analyse des données PAGE 1 Post-traitement et analyse des données Post-traitement. Production des séquences Evaluation de la qualité de séquençage Analyse / pipeline

Plus en détail

Comparaison et alignement de séquences 2

Comparaison et alignement de séquences 2 Comparaison et alignement de séquences 2 LV348 -BI Sophie Pasek sophie.pasek@upmc.fr Comment comparer une séquence contre une banque? Comparaison séquence/banque Pourquoi? : Réunir un échantillon taxonomique

Plus en détail

Les nouvelles technologies de séquençage au Genoscope. Jean-Marc Aury, France Denoeud

Les nouvelles technologies de séquençage au Genoscope. Jean-Marc Aury, France Denoeud Les nouvelles technologies de séquençage au Genoscope Jean-Marc Aury, France Denoeud Introduction Présentation du Genoscope et des activités liées aux NTS Séquençage et assemblage des génomes procaryotes

Plus en détail

Annales du Contrôle National de Qualité des Analyses de Biologie Médicale

Annales du Contrôle National de Qualité des Analyses de Biologie Médicale Annales du Contrôle National de Qualité des Analyses de Biologie Médicale ARN du virus de l hépatite C : ARN-VHC ARN-VHC 03VHC1 Novembre 2003 Edité : mars 2006 Annales ARN-VHC 03VHC1 1 / 8 ARN-VHC 03VHC1

Plus en détail

L utilisation de la SPIR au service de l entretien l parcours de golf : intérêts et limites. CIRAD, Montpellier (France)

L utilisation de la SPIR au service de l entretien l parcours de golf : intérêts et limites. CIRAD, Montpellier (France) L utilisation de la SPIR au service de l entretien l des parcours de golf : intérêts et limites L. Thuriès,, D. Bastianelli CIRAD, Montpellier (France) SPIR gazon : pour quoi faire? Suivi des sols : Teneur

Plus en détail

Bioinformatique en génomique évolutive

Bioinformatique en génomique évolutive Bioinformatique en génomique évolutive Elsa Petit Parcours 1997-2000: Ecole d Ingénieurs des Travaux Agricoles, Bordeaux Option pathologie végétale Eté 1999: Iowa State University, Prévision de l anthracnose

Plus en détail

Intégration de données multiéchelles pour caractériser la. qualité des fruits

Intégration de données multiéchelles pour caractériser la. qualité des fruits Intégration de données multiéchelles pour caractériser la qualité des fruits Workshop IN-OVIVE - PAFIA 02/07/2013 Julie Bourbeillon et François Vallée Contexte La pomme 1er fruit dans le panier de la ménagère

Plus en détail


CARACTERISATION DE LA LENTILLE DE CILAOS CARACTERISATION DE LA LENTILLE DE CILAOS ////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////

Plus en détail

Inertys Pressurage sous gaz inerte. UFOE Provence 12 mars 2009 Page 1

Inertys Pressurage sous gaz inerte. UFOE Provence 12 mars 2009 Page 1 Inertys Pressurage sous gaz inerte UFOE Provence 12 mars 2009 Page 1 Gestion de l oxygène Les travaux scientifique ont mis en évidence l importance de la maîtrise de l oxygène dans l élaboration d un vin

Plus en détail

Procédés appliqués à l agro-alimentaire Vs Santé du consommateur

Procédés appliqués à l agro-alimentaire Vs Santé du consommateur Procédés appliqués à l agro-alimentaire Vs Santé du consommateur 2ièmes Journées Scientifiques du Réseau de Chercheurs GP3A de l'agence Universitaire de la Francophonie Université Laval, Québec, Canada

Plus en détail

Bases de données des mutations

Bases de données des mutations Bases de données des mutations CFMDB CFTR2 CFTR-France / Registre Corinne THEZE, Corinne BAREIL Laboratoire de génétique moléculaire Montpellier Atelier Muco, Lille, 25-27 septembre 2014 Accès libre http://www.genet.sickkids.on.ca/app

Plus en détail

Chapitre 2. La synthèse protéique : la relation entre le génotype et le phénotype.

Chapitre 2. La synthèse protéique : la relation entre le génotype et le phénotype. Chapitre 2. La synthèse protéique : la relation entre le génotype et le phénotype. Les maladies génétiques comme la drépanocytose ou l'albinisme sont liées à des modifications du génotype des individus

Plus en détail

Modalités d exécution des prestations NGS réalisées via l UMR 8199-2013

Modalités d exécution des prestations NGS réalisées via l UMR 8199-2013 Modalités d exécution des prestations NGS réalisées via l UMR 8199-2013 I. Préparation des librairies en vue du séquençage Haut débit via HiSeq et MiSeq 1.1 Points communs à toutes préparations de librairies

Plus en détail

Chapitre 2 La diversification du vivant

Chapitre 2 La diversification du vivant Chapitre 2 La diversification du vivant 1 Introduction Méiose et fécondation : sources de diversité Mutations germinales : processus fondamental de diversification génétique, générateur de biodiversité

Plus en détail


ECOLE NATIONALE SUPERIEURE AGRONOMIQUE DE MONTPELLIER SUPAGRO ECOLE NATIONALE SUPERIEURE AGRONOMIQUE DE MONTPELLIER SUPAGRO Ecole Doctorale SIBAGHE - Systèmes Intégrés en Biologie, Agronomie, Géosciences, Hydrosciences, Environnement Formation doctorale EERPG - Evolution,

Plus en détail

Les microarrays: technologie pour interroger le génome

Les microarrays: technologie pour interroger le génome Les microarrays: technologie pour interroger le génome Patrick DESCOMBES patrick.descombes@frontiers-in-genetics.org Plate forme génomique NCCR Frontiers in Genetics Université de Genève http://genomics.frontiers-in-genetics.org

Plus en détail

GENOPARFUM. Création de ressources moléculaires pour l amélioration de la lavande (L. angustifolia) Berline Fopa Fomeju

GENOPARFUM. Création de ressources moléculaires pour l amélioration de la lavande (L. angustifolia) Berline Fopa Fomeju GENOPARFUM Création de ressources moléculaires pour l amélioration de la lavande (L. angustifolia) 2015-2017 Berline Fopa Fomeju La lavande, espèce orpheline Peu d information sur la génétique et le génome

Plus en détail

Etude transcriptomique de la dégradation des parois lignocellulosiques de son et paille de blé durant la croissance de Thermobacillus xylanilyticus

Etude transcriptomique de la dégradation des parois lignocellulosiques de son et paille de blé durant la croissance de Thermobacillus xylanilyticus Journées SFR condorcet Compiègne 8-9 juillet 2015 Projet Hydroseq : UMR FARE-CRRBM Etude transcriptomique de la dégradation des parois lignocellulosiques de son et paille de blé durant la croissance de

Plus en détail

Génétique classique Génétique inverse. Le clonage positionnel De la pathologie au gène. Applications du clonage positionnel. I- Cartographie génomique

Génétique classique Génétique inverse. Le clonage positionnel De la pathologie au gène. Applications du clonage positionnel. I- Cartographie génomique Le clonage positionnel De la pathologie au gène Définition Cartographie génomique Etapes du clonage positionnel Génétique classique Génétique inverse traitement diagnostic phénotypique ( AC ) fonction

Plus en détail

Caractérisation de SNPs par RAD-seq pour l'étude de la coloration d'un oiseau insulaire. Yann BOURGEOIS Le 30/09/2013

Caractérisation de SNPs par RAD-seq pour l'étude de la coloration d'un oiseau insulaire. Yann BOURGEOIS Le 30/09/2013 Caractérisation de SNPs par RAD-seq pour l'étude de la coloration d'un oiseau insulaire Yann BOURGEOIS Le 30/09/2013 VARIATIONS DE COLORATION ET ÉVOLUTION 2 ZOSTEROPS BORBONICUS, OISEAU ENDÉMIQUE DE LA

Plus en détail

DNA-seqciblé : principales méthodes d'enrichissement

DNA-seqciblé : principales méthodes d'enrichissement DNA-seqciblé : principales méthodes d'enrichissement DU de séquençage haut-débit Module 1 : Séquençage nouvelle génération - Technologies & applications 17 octobre 2013 Amélie PITON piton@igbmc.fr 1 Introduction

Plus en détail

Mariane ALLEAUME-BENHARIRA Sylvie ODDOU-MURATORIO François LEFEVRE. Ecologie des forêts méditerranéennes INRA AVIGNON - FRANCE


Plus en détail

L aventure génétique, Le cas du lapin

L aventure génétique, Le cas du lapin Histoire de lapins... Le lapin européen (Oryctolagus Cuniculus) De la Renaissance au XIXème siècle : Des élevages de production apparaissent (Olivier de Serres), les lapins sont élevés en clapier et les

Plus en détail

Vers l assignation de parenté par SNP

Vers l assignation de parenté par SNP Vers l assignation de parenté par SNP Journée Génomique Sysaaf 3 juin 2015, Rennes Marc VANDEPUTTE INRA UMR Génétique Animale et Biologie Intégrative Ifremer Laboratoire 3AS L assignation de parenté Pour

Plus en détail

Introduction au GBS. Hueber Yann, Alexis Dereeper, Gautier Sarah, François Sabot, Vincent Ranwez, Jean-François Dufayard 9-13 février 2015

Introduction au GBS. Hueber Yann, Alexis Dereeper, Gautier Sarah, François Sabot, Vincent Ranwez, Jean-François Dufayard 9-13 février 2015 Introduction au GBS Hueber Yann, Alexis Dereeper, Gautier Sarah, François Sabot, Vincent Ranwez, Jean-François Dufayard 9-13 février 2015 Sommaire Définition Les différentes méthodologies Exemple du RADseq

Plus en détail

Tumeurs du sein triple négatif: Biologie moléculaire et projets de recherche

Tumeurs du sein triple négatif: Biologie moléculaire et projets de recherche 64 ème réunion du GERM Tumeurs du sein triple négatif: Biologie moléculaire et projets de recherche Tumeurs du sein triple négatif (TN) 12-17% des cancers du sein Contexte familial porteuses des mutations

Plus en détail

Séquençage haut débit (Next Generation Sequencing) 12/03/2012 Pascal Le Bourgeois, M1BBT, EM8BTGM 1

Séquençage haut débit (Next Generation Sequencing) 12/03/2012 Pascal Le Bourgeois, M1BBT, EM8BTGM 1 Séquençage haut débit (Next Generation Sequencing) 1 Pyroséquençage (454) Margulies M. et al. (2005). Genome sequencing in microfabricated high-density picolitre reactors. Nature 437:376-80 Pas de banques

Plus en détail

Lettres: A, T, G, C. Mots: à 3 lettres (codons) Phrase: gène (information pour synthétiser une protéine). Ponctuation

Lettres: A, T, G, C. Mots: à 3 lettres (codons) Phrase: gène (information pour synthétiser une protéine). Ponctuation 2- Les molécules d ADN constituent le génome 2-1 La séquence d ADN représente l information génétique Lettres: A, T, G, C Mots: à 3 lettres (codons) Phrase: gène (information pour synthétiser une protéine).

Plus en détail

Plateforme de Recherche de Mutations. Vincent MEYER contact: pfm@genoscope.cns.fr

Plateforme de Recherche de Mutations. Vincent MEYER contact: pfm@genoscope.cns.fr Plateforme de Recherche de Mutations contact: pfm@genoscope.cns.fr La plateforme recherche de mutations La plateforme mutation: - Gis Institut des maladies rares et IbiSA. - Les instituts thématiques de

Plus en détail

Les recherches menées sur le virus Y de la pomme de terre (PVY)

Les recherches menées sur le virus Y de la pomme de terre (PVY) Action 1.1 : Développer et renforcer des outils d identification et de caractérisation des parasites majeurs du plant de pomme de terre Les recherches menées sur le virus Y de la pomme de terre (PVY) mieux

Plus en détail


CHAPITRE 4 - LA COMPLEXITÉ DES RELATIONS ENRE GÈNES, PHÉNOTYPES ET ENVIRONNEMENT CHAPITRE 4 - LA COMPLEXITÉ DES RELATIONS ENRE GÈNES, PHÉNOTYPES ET ENVIRONNEMENT Introduction Tous les individus de la même espèce possèdent le même patrimoine génétique, cependant chaque individu est

Plus en détail

Mise en place de serveurs Galaxy dans le cadre du réseau CATI BBRIC

Mise en place de serveurs Galaxy dans le cadre du réseau CATI BBRIC Mise en place de serveurs Galaxy dans le cadre du réseau CATI BBRIC {Sebastien.Carrere, Ludovic.Legrand,Jerome.Gouzy}@toulouse.inra.fr {Fabrice.Legeai,Anthony.Bretaudeau}@rennes.inra.fr CATI BBRIC 35 bioinformaticiens

Plus en détail

Cours d introduction à la génétique de la souris Notion de Souche

Cours d introduction à la génétique de la souris Notion de Souche Cours d introduction à la génétique de la souris Notion de Souche Introduction: - Réponse d un animal à l expérimentation (diapo 1) Facteurs environnementaux et propres à l animal - Notion d animal standardisé

Plus en détail

Le projet de recherche QualiTomFil

Le projet de recherche QualiTomFil Le projet de recherche QualiTomFil Elaboration et valorisation de la qualité organoleptique et nutritionnelle de la tomate tout au long de la filière M. Causse, UR GAFL Avignon Programme National de Recherche

Plus en détail

Réunion du réseau de génétique du Département EFPA

Réunion du réseau de génétique du Département EFPA 17 19 novembre 2014 Centre INRA de Nancy Lorraine Programme Lundi 17 novembre Salle Tilleul 13:00 Bus pour l'inra depuis la gare de Nancy 14:00 14:30 Introduction de la réunion tour de table 14:30 14:45

Plus en détail



Plus en détail

Nouveaux outils de cytogénétique moléculaire (MLPA et CGH) utilisés en constitutionnel COUTTON Charles

Nouveaux outils de cytogénétique moléculaire (MLPA et CGH) utilisés en constitutionnel COUTTON Charles Nouveaux outils de cytogénétique moléculaire (MLPA et CGH) utilisés en constitutionnel COUTTON Charles EC Génétique Jeudi 12 Janvier 2012 Remaniements génomiques Regroupent les duplications, les délétions,

Plus en détail

Les expériences françaises en analyse de «l exome» CFTR Laboratoire de Géné:que Moléculaire Inserm U827 MONTPELLIER Anne Bergougnoux Caroline Raynal

Les expériences françaises en analyse de «l exome» CFTR Laboratoire de Géné:que Moléculaire Inserm U827 MONTPELLIER Anne Bergougnoux Caroline Raynal Les expériences françaises en analyse de «l exome» CFTR Laboratoire de Géné:que Moléculaire Inserm U827 MONTPELLIER Anne Bergougnoux Caroline Raynal I. CFTR MASTR TM v2 Dx performance evalua:on study (Mul$plicom)

Plus en détail

A- Exploiter des animations pour repérer une mutation et étudier son mécanisme de réparation.

A- Exploiter des animations pour repérer une mutation et étudier son mécanisme de réparation. THEME 1A : Expression, stabilité et variation du patrimoine génétique Chapitre 2 : Variabilité Génétique et Mutation de l ADN TP-3-: Réparation de l ADN, mutations et polyallélisme Les mutations de l ADN

Plus en détail

Le séquençage à haut débit Juin 2012

Le séquençage à haut débit Juin 2012 Atelier Epigénétique Université Pierre et Marie Curie Le séquençage à haut débit Juin 2012 Stéphane Le Crom (stephane.le_crom@upmc.fr) Laboratoire de Biologie du Développement (UPMC) de la Montagne Sainte

Plus en détail

Cahier de texte de la classe 1 ère 3 - SVT

Cahier de texte de la classe 1 ère 3 - SVT Cahier de texte de la classe 1 ère 3 - SVT DATE SEQUENCE jeudi 8 : revoir la fiche méthodologique «utiliser le microscope optique» (disponible sur le site du lycée) Jeudi 8 1 er contact avec les élèves.

Plus en détail

Atelier 5/11/2013. Structure de la chromatine et marques épigénétiques

Atelier 5/11/2013. Structure de la chromatine et marques épigénétiques Atelier 5/11/2013 Structure de la chromatine et marques épigénétiques La chromatine ADN ADN + Histones = Nucleosome ADN + Protéines + ARNs = Chromatine Niveau extrême de condensation = Chromosome métaphasique

Plus en détail