GénoToul 2010, Hôtel de Région Midi Pyrénées, Toulouse, 10 décembre 2010

Dimension: px
Commencer à balayer dès la page:

Download "GénoToul 2010, Hôtel de Région Midi Pyrénées, Toulouse, 10 décembre 2010"

Transcription

1 GénoToul 2010, Hôtel de Région Midi Pyrénées, Toulouse, 10 décembre 2010 Analyse de la diversité moléculaire des régions génomiques de 30 gènes du développement méristématique dans une core collection de 96 accessions de tomate par combinaison de long range PCR et séquençage 454 Stéphane Muños Projet FLOMEDIV

2 La tomate, espèce modèle pour la famille des solanacées

3 Objectif de la sélection de la tomate de frais : des attentes multiples La tomate : légume le plus consommé au monde La France : 27 ème rang mondial pour la production ( tonnes, source FAO 2008) producteur distributeur acheteur consommateur stabilité rendement, précocité adaptation, résistances fermeté conservation couleur aspect saveur sucre acide arôme. volatils texture parois santé pigments, pg vitamines, antioxydants qualité commerciale qualité organoleptique qualité nutritionnelle

4 L aspect des fruits est nécessaire pour le choix des consommateurs La forme et la couleur pour se distinguer des autres Des QTL clonés chez la tomate : sun, ovate, fw2.2, fasciated, lc

5 La taille du fruit : un mécanisme précoce lors du développement Méristème floral Nombre de carpelles Nombre de loges Taille du fruit Wild type Processing type Large fresh type Source: Barreroet et al, 2006 Source: Cong et al, 2008 Quels gènes du développement méristématique floral sont impliqués dans la taille et la forme du fruit?

6 Valoriser la diversité naturelle par la génétique d association Populations naturelles Développée pour la génétique humaine, appliquée aux plantes (Norborg,2006) Variabilité naturelle (plus d allèles et d évènements de recombinaison) Source: Ranc N., thèse 2010

7 Construction d une core collection Centre national de ressources pour la tomate 2752 accessions entretenues et caractérisées 340 accessions phenotypées and génotypées (20 SSR) 180 accessions phénotypées plus finement Core collection de 96 accessions 98 % de la diversité Thèse Nicolas Ranc, 2010

8 Contexte et objectifs du projet FLOMEDIV FLOMEDIV : projet INRA Syngenta Seeds Séquençage de gènes candidats du développement méristématique (core collection de 96 accessions) Génétique d association pour la forme et le poids du fruit Objectifs : Stage de Master de Guillaume Bauchet (15/01 au 15/07/201, Université de Wageningen Hollande) identifier les locus impliqués dans la forme et le poids du fruit (génétique d association) Comprendre l histoire évolutive de la forme des fruits chez la tomate et identifier des traces de sélection.

9 Matériel et méthodes

10 Matériel végétal Core collection de 96 accessions 11 écotypes sauvages (S. pimpinellifolium, p S. chmielewskii,, S. habrochaites,, S. pennellii, S. cheesmaniae) 65 type intermédiaires (S. lycopersicum var cerasiforme) 16 cultivars (S. lycopersicum var esculentum) 600 Nombre de SNPs S. pimpi cerise S. lyco

11 Caractérisation phénotypique de la core collection Caractères généraux des fruits Morphologie des fruits Morphologie florale Nombre de loges Poids Acidité Teneur en sucres Fermeté Couleur Metabolites Activitée enzymatique Analyse des images Forme des fruits: Tomato Analyzer (Esther Van Der Knaap) analyzer htm Forme des fleurs : ImageJ

12 RESULTATS 1. Procédures expérimentales

13 Sélection des gènes candidats Etude bibliographique Sélection de 80 gènes candidats Gènes décrits chez les espèces modèles du développement méristématique: Arabidopsis, Petunia, Antirrhinum Gènes responsables de QTL de la forme et du poids du fruit chez la tomate

14

15 Long range PCR Recherche des orthologues chez la tomate (stratégie Blast) Définition des couples d amorces Test de 2 3 couples/fragment 5-7 Kb Long range PCR

16 30 gènes candidats sélectionnés Gènes sélectionnés sur la base de: leur rôle fonctionnel des résultats d amplification PCR

17 Pooling des fragments et dosage Pooling: 96 accessions X 30 fragments g g g 1 pool/ accession X 96 Dosage: Picogreen and slingshot titration X 30 Mesure de la qualité des échantillons après fragmentation (nébulisation)

18 Séquençage 454 accession 1 accession 2 accession 12 accession 85 accession fragments 30 fragments 30 fragments 30 fragments 30 fragments pool1 pool2 pool12 pool85 pool96 MID1 MID2 MID12 MID1 MID12 pool1 pool8 Génopole de Toulouse Séquenceur Roche FLX Tagging de chacun des 96 pools 1 run= 300 Mb Données de séquençage obtenues le 18 juin 2010

19 RESULTATS 2. Détection du Polymorphisme et Génétique d association

20 Descriptif du run 454 Taille moyenne des séquences : 350 nucléotides Quantité totale de séquences : 322 Mb Nombre total de séquences : Référence (30 fragments) : 170Kb Profondeur moyenne : 19X

21 Des taux de profondeur variables entre pools 9603 séquences/pool en moyenne (19X) 3968 séquences minimum (8X) séquences maximum (44X) Le pooling entraine des variations malgré une quantification précise

22 Principe de l assemblage des séquences Séquence de référence (Heinz1706) pour chaque fragment Annotation (Artemis) Assemblage pour les 96 accessions de la core collection (Seqman Ngen) sur les séquences de référence (Heinz 1706) Couverture variable au sein d un même fragment 92.6% des séquences assemblées en moyenne Moins bon assemblage pour les espèces sauvages (61.2% pour S. pennellii)

23 Le problème des INDELs INDELs: fort taux de faux polymorphisme (problème connu des homopolymères) Non traités

24 Identification des SNPs Filtre: Profondeur > 2x SNP sur plus de 90% des séquences alignées Redondance entre accession SNPs 4320 SNPs Ref.Seq. Read 1 Read 2 Read 3 Read 4 Read 5 Read 6 Read 7 Read 8 Read 9 Read 10 Ref.Seq. Read 1 Read 2 Read 3 Read 4 Read 5 Read 6 Read 7 Read 8 Read 9 Read 10 TCTCCCTCGCCGTGATCC TCTCCCTCGCCGTGATCC TCTCCCTCGCCGTGATCC TCTCCCTCGCCGTGATCC TCTCCCTCGCTGTGATCC TCTCCCTCGCCGTGATCC TCTCCCTCGCCGTGATCC TCTCCCTCGCCGTGATCC TCTCCCTCGCCGTGATCC TCTCCCTCGCCGTGATCC TCTCCCTCGCCGTGATCC Not OK ATTGTGTACAATGTGGTT ATTGTGTACGATGTGGTT ATTGTGTACGATGTGGTT ATTGTGTACGATGTGGTT ATTGTGTACGATGTGGTT ATTGTGTACGATGTGGTT ATTGTGTACGATGTGGTT ATTGTGTACGATGTGGTT ATTGTGTACGATGTGGTT ATTGTGTACGATGTGGTT ATTGTGTACGATGTGGTT OK

25 Des taux de polymorphisme cohérents cultivars modernes peu polymorphes du polymorphisme dans la référence Espèces sauvages plus polymorphes

26 Distribution des SNPs en fonction des fragments SNPs au total

27 Génétique d association Génétique d association: TASSEL (Bradbury et al, 2007) Minimum allele frequency treshold: MAF=5% ; = set de 533 markers; sauvages exclus (6 access.) 66 associations potentielles Validité des associations?

28 Analyse du locus ovate ovate est un locus responsable de l allongement des fruits Tomato accession Genotype Fruit shape index code CR102 C 0,6122 CR136 C 0,6327 CR321 C 0,6418 CR134 C 0,7041 CR155 C 0,7049 CR133 C 0,7208 CR288 C 0,7505 CR156 C 0,7519 CR152 N 0,7592 CR130 C 0,76 CR101 C 0,7787 CR256 C 0,7867 CR129 C 0,7893 CR274 C 0,7901 CR093 C 0,7908 CR341 N 0,7926 CR117 C 0,7936 Logiciel Tomato Analyzer CR002 C 0,7959 CR359 C 0,8088 CR097 N 0,8131 CR118 C 0,8141 CR079 c 0,8292 CR077 C 0,8364 CR354 C 0,8398 CR032 C 0,8409 Fruit shape index CR058 C 0,8483 CR150 C 0,8518 CR078 C 0,8565 CR149 C 0,8612 CR250 N 0,8671 CR153 N 0,8699 CR258 C 0,8732 CR186 C 0,874 CR287 C 0,8742 CR001 C 0,8752 CR031 C 0,8761 CR236 C 0,8764 CR076 C 0,8765 CR293 C 0,8772 CR003 C 0,8806 CR253 C 0,8812 Fruit CR280 C 0,8816 CR249 C 0,884 CR267 C 0,8867 CR098 C 0,8917 CR203 C 0,8996 CR125 C 0,9018 CR123 C 0,9056 CR163 C 0,9062 CR273 C 0,9093 CR202 C 0,91 CR106 C 0,9139 CR173 C 0,9174 CR164 C 0,9176 CR094 C 0,9184 CR284 C 0,9276 CR158 C 0,9392 CR254 C 0,9394 CR124 C 0,9402 CR240 C 0,9402 CR199 C 0,9472 CR292 N 0,9473 CR108 C 0,9525 CR110 C 0,9598 CR279 N 0,9619 CR169 C 0,9639 CR056 A 0,9684 CR072 C 0,9724 CR062 C 0,9736 shape ind dex <1 CR234 C 0,9738 CR238 C 0,9843 CR159 C 0,9958 CR014 A 0,9989 CR068 C 1,0114 CR004 C 1,0552 CR122 C 1,0645 CR028 C 1,094 CR294 C 1,1248 CR205 C 1,1253 CR070 A 1,1414 CR275 N 1,1476 CR075 A 1,2388 CR020 A 1,2742 CR291 A 1,3245 CR317 A 1,3732 CR145 A 1,3821 CR252 A 1,4354 CR296 A 1,5153 CR244 N 1,5405 CR271 a 1,6728 >1 Fruits allongés

29 Validation du SNP causal de ovate Transition C to A Même SNP que celui décrit comme responsable du phénotype. SNP = codon stop (protéine tronquée).

30 Validation du locus lc contrôlant le nombre de loges des fruits de tomate Tomato accession code Genotype Locule number Validation du SNP causal: Transition de vers A G CR075 A 1, CR068 A 1, CR250 N 2, CR173 A 2, CR159 N 2, CR122 A 2, CR158 A 2, CR271 A 2, CR072 A 2, CR124 A 2, CR123 N 2, CR291 A 2, CR169 A 2, CR028 A 2, CR070 A 2, CR199 A 2, CR236 A 2, CR163 A 2, CR203 A 2, CR202 N 2, CR258 A 2, CR106 A 2, CR056 A 2, CR186 A 2, CR076 A 2, CR280 A 2, CR205 A 2, CR145 A 2, CR164 A 2, CR110 A 2, CR240 A 2, CR108 A 2, CR001 N 2, CR252 A 2, CR292 A 2, CR253 A 2, CR294 A 2, CR296 A 2, CR155 A 2, CR003 A 2,23837 CR020 A 2, CR014 A 2, CR279 A 2, CR077 N 2, CR062 A 2, CR125 A 2, CR244 A 2, CR287 A 2, CR097 A 2, CR004 a 2, CR032 A 2, CR317 A 2, CR234 A 2, CR249 N 2,55622 CR275 A 2, CR058 G 2, CR284 A 2, CR267 G 2, CR153 N 2, CR094 G 2, CR254 N 3, CR238 G 3, CR293 N 3, CR031 G 3, CR274 N 3, CR152 G 3, CR078 G 3, CR101 G 3, CR130 G 3, CR093 G 3, CR149 G 3, CR288 G 3, CR098 a 3, CR079 G 3, CR002 N 3, CR129 G 3, CR117 N 4, CR273 G 4, CR156 G 4, CR354 A 4,15622 CR256 G 4, CR150 G 4, CR118 G 5, CR341 N 5, CR359 A 5, CR102 G 7, CR136 G 9, CR321 G 11, CR134 G 12, CR133 G 15, Nom bre de log ges des fru uits <3 >3

31 Résumé 30 gènes (5kb) séquencés chez 96 accessions de tomate 322 Mb de séquences obtenus 4320 SNPs 66 associations 2 loci validés: ovate and lc Les données obtenues sont fiables Méthodologie validatée

32 Perspectives Approfondir o et valider les 64 associations at o s restantes tes Explorer le polymorphisme de type INDELs Analyser la diversité moléculaire des 30 gènes: Identifier les polymorphismes codant, rechercher des traces de sélection Nécessité d améliorer l assemblage des accessions sauvages (de novo)

33 Merci à INRA Avignon Génopole Toulouse Syngenta seeds Guillaume Bauchet Jean Paul Bouchet Yolande Carretero Mathilde Causse Jean Luc Gallois Sophie Rolland Jérôme Lluch Olivier Bouchez Cécile Donnadieu Julien Bonnet Laurent tgi Grivet Nicolas Ranc

Le séquençage haut-débit

Le séquençage haut-débit Nouveaux outils en biologie Le séquençage haut-débit DES d hématologie 16 janvier 2015 Paris Alice Marceau-Renaut Laboratoire d hématologie CHRU Lille NGS = Next-Generation Sequencing Whole-genome Whole-exome

Plus en détail

Marc DELPECH. CORATA La Rochelle le 21 mai 2008

Marc DELPECH. CORATA La Rochelle le 21 mai 2008 Marc DELPECH CORATA La Rochelle le 21 mai 2008 En 24 ans les progrès ont été considérables Premières utilisation des techniques de génétique moléculaire en diagnostic : 1984 Une palette de techniques très

Plus en détail

Génotypage et Séquençage. Pierre Mournet

Génotypage et Séquençage. Pierre Mournet Génotypage et Séquençage Pierre Mournet Plan Séquençage/Génotypage Classique (usat, Sanger) Séquençage NGS (Next Generation Sequencing) Séquenceur Préparation Pré-NGS Exemple 1 NGS Exemple 2 NGS Génotypage

Plus en détail

Place et avenir du séquençage haut-débit

Place et avenir du séquençage haut-débit Place et avenir du séquençage haut-débit Olivier Bouchez genomique@toulouse.inra.fr La Plateforme GeT Expertise et mise à disposition d une plateforme technologique en génomique : Séquençage Génotypage

Plus en détail

Influence du nombre de réplicats dans une analyse différentielle de données RNAseq

Influence du nombre de réplicats dans une analyse différentielle de données RNAseq Influence du nombre de réplicats dans une analyse différentielle de données RNAseq Statisticiens: Sophie Lamarre Steve Van Ginkel Sébastien Déjean - Magali San Cristobal Matthieu Vignes Biologistes: Stéphane

Plus en détail

Génétique et génomique Pierre Martin

Génétique et génomique Pierre Martin Génétique et génomique Pierre Martin Principe de la sélections Repérage des animaux intéressants X Accouplements Programmés Sélection des meilleurs mâles pour la diffusion Index diffusés Indexation simultanée

Plus en détail

Recherche et analyse de polymorphismes SNP

Recherche et analyse de polymorphismes SNP Recherche et analyse de polymorphismes SNP 1- Tablet : Détection visuelle de SNP avec Tablet Tablet est un outil graphique de visualisation d assemblage et d alignement de séquences issues de NGS (Next

Plus en détail

Le séquençage à haut débit Mars 2011

Le séquençage à haut débit Mars 2011 Atelier Epigénétique Université Pierre et Marie Curie Le séquençage à haut débit Mars 2011 Stéphane Le Crom (lecrom@biologie.ens.fr) Institut de Biologie de l École normale supérieure (IBENS) de la Montagne

Plus en détail

A la rencontre du séquençage haut-débit nouvelle génération. Infosys Building, Kuwait

A la rencontre du séquençage haut-débit nouvelle génération. Infosys Building, Kuwait A la rencontre du séquençage haut-débit nouvelle génération Infosys Building, Kuwait 2001 : Aboutissement du projet Génome Humain Ancêtres & Renouveau 2010 Hélicos, Ion torrent, Pacbio, Oxford Nanopore

Plus en détail

Gènes Diffusion - EPIC 2010

Gènes Diffusion - EPIC 2010 Gènes Diffusion - EPIC 2010 1. Contexte. 2. Notion de génétique animale. 3. Profil de l équipe plateforme. 4. Type et gestion des données biologiques. 5. Environnement Matériel et Logiciel. 6. Analyses

Plus en détail

CHAPITRE 3 LA SYNTHESE DES PROTEINES

CHAPITRE 3 LA SYNTHESE DES PROTEINES CHAITRE 3 LA SYNTHESE DES ROTEINES On sait qu un gène détient dans sa séquence nucléotidique, l information permettant la synthèse d un polypeptide. Ce dernier caractérisé par sa séquence d acides aminés

Plus en détail

Les Evolutions techniques. Marc Delpech Laboratoire de Génétique et Biologie moléculaires de l hôpital Cochin

Les Evolutions techniques. Marc Delpech Laboratoire de Génétique et Biologie moléculaires de l hôpital Cochin Les Evolutions techniques Marc Delpech Laboratoire de Génétique et Biologie moléculaires de l hôpital Cochin 1 Les principales étapes de l évolution technologique 1975 Southern blot 1977 Séquençage Sanger

Plus en détail

Les technologies de séquençage à haut débit. Patrick Wincker, Genoscope, Institut de Génomique du CEA

Les technologies de séquençage à haut débit. Patrick Wincker, Genoscope, Institut de Génomique du CEA Les technologies de séquençage à haut débit Patrick Wincker, Genoscope, Institut de Génomique du CEA CNG, 12.05.2009 Séquençage Sanger (méthode des dididéoxy terminateurs) : a permis les progrès de la

Plus en détail

Détection de mutations somatiques par NGS sur GAIIx

Détection de mutations somatiques par NGS sur GAIIx Détection de mutations somatiques par NGS sur GAIIx Aude Lamy Laboratoire de Génétique Somatique des Tumeurs CHU de Rouen Inserm U1079 Faculté de Médecine et Pharmacie de Rouen La médecine personalisée

Plus en détail

Détermination de gènes candidats par séquençage d exome dans une famille présentant des calcifications idiopathiques des noyaux gris centraux

Détermination de gènes candidats par séquençage d exome dans une famille présentant des calcifications idiopathiques des noyaux gris centraux Service de Neurologie U614 Génétique médicale et fonctionnelle des cancers et des maladies neuropsychiatriques Pr Frébourg Dr Campion Pr Hannequin Détermination de gènes candidats par séquençage d exome

Plus en détail

exemple de végétaux exposés au benzène atmosphérique Sylvain Dumez sylvain.dumez@univ-lille2.fr

exemple de végétaux exposés au benzène atmosphérique Sylvain Dumez sylvain.dumez@univ-lille2.fr Approches écotoxicogénomiques et application à la biosurveillance exemple de végétaux exposés au benzène atmosphérique Sylvain Dumez sylvain.dumez@univ-lille2.fr Laboratoire des Sciences végétales et fongiques,

Plus en détail

Séquençage. Bérénice Batut, berenice.batut@udamail.fr. DUT Génie Biologique Option Bioinformatique Année 2014-2015

Séquençage. Bérénice Batut, berenice.batut@udamail.fr. DUT Génie Biologique Option Bioinformatique Année 2014-2015 Séquençage Bérénice Batut, berenice.batut@udamail.fr DUT Génie Biologique Option Bioinformatique Année 2014-2015 Séquençage Séquençage ADN Détermination de l ordre d enchainement des nucléotides d un fragment

Plus en détail

Obtention de données génétiques à grande échelle

Obtention de données génétiques à grande échelle Obtention de données génétiques à grande échelle Stéphanie FERREIRA Ph.D. Campus de l Institut Pasteur de Lille 1, rue du Professeur Calmette 59000 LILLE Tel : 03 20 87 71 53 Fax : 03 20 87 72 64 contact@genoscreen.fr

Plus en détail

Deux plateformes IBiSA et 3 plateaux techniques regroupés depuis 2010. Responsable scientifique Denis Milan. Coordination des nouveaux investissements

Deux plateformes IBiSA et 3 plateaux techniques regroupés depuis 2010. Responsable scientifique Denis Milan. Coordination des nouveaux investissements RNA-seq Olivier Bouchez Nathalie Marsaud Mercredi 28 mars 2012 Plateforme GeT : Génome et Transcriptome Deux plateformes IBiSA et 3 plateaux techniques regroupés depuis 2010 Responsable scientifique Denis

Plus en détail

Le séquençage à haut débit Juin 2012

Le séquençage à haut débit Juin 2012 Atelier Epigénétique Université Pierre et Marie Curie Le séquençage à haut débit Juin 2012 Stéphane Le Crom (stephane.le_crom@upmc.fr) Laboratoire de Biologie du Développement (UPMC) de la Montagne Sainte

Plus en détail

Les nouvelles technologies de séquençage au Genoscope. Jean-Marc Aury, France Denoeud

Les nouvelles technologies de séquençage au Genoscope. Jean-Marc Aury, France Denoeud Les nouvelles technologies de séquençage au Genoscope Jean-Marc Aury, France Denoeud Introduction Présentation du Genoscope et des activités liées aux NTS Séquençage et assemblage des génomes procaryotes

Plus en détail

La génomique. Etude des génomes et de l ensemble de leurs gènes. Nécessite des outils bioinformatiques. Plusieurs étapes :

La génomique. Etude des génomes et de l ensemble de leurs gènes. Nécessite des outils bioinformatiques. Plusieurs étapes : La génomique Etude des génomes et de l ensemble de leurs gènes La structure Le fonctionnement L évolution Le polymorphisme, Plusieurs étapes : Nécessite des outils bioinformatiques 1 Chronologie sur le

Plus en détail

Barcoding environnemental par séquençage haut débit

Barcoding environnemental par séquençage haut débit Barcoding environnemental par séquençage haut débit Potentiel et limites Jean-François Martin Échantillonnage Spécificités du barcoding environnemental Amplification (PCR) de marqueurs choisis Séquençage

Plus en détail

Cours d introduction à la génétique de la souris Notion de Souche

Cours d introduction à la génétique de la souris Notion de Souche Cours d introduction à la génétique de la souris Notion de Souche Introduction: - Réponse d un animal à l expérimentation (diapo 1) Facteurs environnementaux et propres à l animal - Notion d animal standardisé

Plus en détail

Bioinformatique en génomique évolutive

Bioinformatique en génomique évolutive Bioinformatique en génomique évolutive Elsa Petit Parcours 1997-2000: Ecole d Ingénieurs des Travaux Agricoles, Bordeaux Option pathologie végétale Eté 1999: Iowa State University, Prévision de l anthracnose

Plus en détail

RNAseq et NGS. Adriana Alberti Karine Labadie

RNAseq et NGS. Adriana Alberti Karine Labadie RNAseq et NGS Séquençage et Diversité LES ORGANISMES EUCARYOTES animaux plantes champignons protistes BACTERIES ARCHEES VIRUS METAGENOMES LES SOURCES ADN GENOMIQUE ARN / cdna AMPLICONS BACs ET FOSMIDES

Plus en détail

Rapport de l AERES sur l unité :

Rapport de l AERES sur l unité : Section des Unités de recherche Rapport de l AERES sur l unité : Génomique et Biotechnologie des fruits UMR 990 INRA/ INP-ENSA Toulouse sous tutelle des établissements et organismes : INRA INP-ENSAT Toulouse

Plus en détail

Bases de données des mutations

Bases de données des mutations Bases de données des mutations CFMDB CFTR2 CFTR-France / Registre Corinne THEZE, Corinne BAREIL Laboratoire de génétique moléculaire Montpellier Atelier Muco, Lille, 25-27 septembre 2014 Accès libre http://www.genet.sickkids.on.ca/app

Plus en détail

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq Présenté par Xi LIU ATCGCGCTAGCTGGTGTATCGCATCGCGCTAGCTGGTGTATCGCGCTAGCTGGTGTATCGCGCTAGCCTGGTGTATCGCCATCGCGCTAGCTGGCGCTAGCTGAATCGCGCATATG 17 Septembre 2013 Homéoallèles Génome Normalisation Analyse différentielle

Plus en détail

Séquençage massif en parallèle Défis technologiques et informatiques

Séquençage massif en parallèle Défis technologiques et informatiques Séquençage massif en parallèle Défis technologiques et informatiques Jean-Baptiste Rivière, PhD jean-baptiste.riviere@u-bourgogne.fr 10/09/2014 Séquençage massif en parallèle Défis technologiques de Sanger

Plus en détail

Le séquençage Roche 454

Le séquençage Roche 454 Le séquençage Roche 454 www.454.com Stéphane Fénart, Arnaud Mouchon Roscoff, Avril 2012 Systèmes Genome Sequencers Une stratégie unique en séquençage nouvelle génération Pionniers en séquençage de nouvelle

Plus en détail

Mariane ALLEAUME-BENHARIRA Sylvie ODDOU-MURATORIO François LEFEVRE. Ecologie des forêts méditerranéennes INRA AVIGNON - FRANCE

Mariane ALLEAUME-BENHARIRA Sylvie ODDOU-MURATORIO François LEFEVRE. Ecologie des forêts méditerranéennes INRA AVIGNON - FRANCE MODELISER L IMPACT DES CHANGEMENTS DEMOGRAPHIQUES ET ENVIRONNEMENTAUX SUR L EVOLUTION DES ARBRES Le module Luberon Version 2010 Mariane ALLEAUME-BENHARIRA Sylvie ODDOU-MURATORIO François LEFEVRE Ecologie

Plus en détail

CHAPITRE 4 - LA COMPLEXITÉ DES RELATIONS ENRE GÈNES, PHÉNOTYPES ET ENVIRONNEMENT

CHAPITRE 4 - LA COMPLEXITÉ DES RELATIONS ENRE GÈNES, PHÉNOTYPES ET ENVIRONNEMENT CHAPITRE 4 - LA COMPLEXITÉ DES RELATIONS ENRE GÈNES, PHÉNOTYPES ET ENVIRONNEMENT Introduction Tous les individus de la même espèce possèdent le même patrimoine génétique, cependant chaque individu est

Plus en détail

Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013

Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013 Sélectionner les propositions exactes Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013 QCM 1 La plupart des techniques de biologie moléculaire repose sur le principe de complémentarité

Plus en détail

Sommaire. Première partie Les concepts de base

Sommaire. Première partie Les concepts de base Sommaire Préface à la troisième édition... Préface à la deuxième édition... Avant-propos à la troisième édition... Avant-propos à la deuxième édition... Avant-propos à la première édition... XV XVII XIX

Plus en détail

DAEU- cours de Sciences de la Nature et de la Vie- Marie Claire Garnier

DAEU- cours de Sciences de la Nature et de la Vie- Marie Claire Garnier Partie 3 : génétique Chapitre 1 : la transmission d un caractère au cours de la reproduction sexuée Rappel : la reproduction sexuée comprend 2 phénomènes fondamentaux successifs : La méiose lors de la

Plus en détail

Master de Bioinformatique et Biologie des Systèmes Toulouse http://m2pbioinfo.biotoul.fr Responsable : Pr. Gwennaele Fichant

Master de Bioinformatique et Biologie des Systèmes Toulouse http://m2pbioinfo.biotoul.fr Responsable : Pr. Gwennaele Fichant Master de Bioinformatique et Biologie des Systèmes Toulouse http://m2pbioinfo.biotoul.fr Responsable : Pr. Gwennaele Fichant Parcours: Master 1 : Bioinformatique et biologie des Systèmes dans le Master

Plus en détail

AutoGRAPH Un serveur pour automatiser et visualiser la comparaison de génomes: Application à l identification de nouveaux gènes chez le chien.

AutoGRAPH Un serveur pour automatiser et visualiser la comparaison de génomes: Application à l identification de nouveaux gènes chez le chien. AutoGRAPH Un serveur pour automatiser et visualiser la comparaison de génomes: Application à l identification de nouveaux gènes chez le chien. Thomas DERRIEN CNRS-UMR6061 Génétique et Développement Université

Plus en détail

Séquençage haut débit (Next Generation Sequencing) 12/03/2012 Pascal Le Bourgeois, M1BBT, EM8BTGM 1

Séquençage haut débit (Next Generation Sequencing) 12/03/2012 Pascal Le Bourgeois, M1BBT, EM8BTGM 1 Séquençage haut débit (Next Generation Sequencing) 1 Pyroséquençage (454) Margulies M. et al. (2005). Genome sequencing in microfabricated high-density picolitre reactors. Nature 437:376-80 Pas de banques

Plus en détail

PLAN. Atelier Puces à ADN IRB Hôpiital St Eloi Mardi 27 mars 2007 En collaboration avec la Génopole de Montpellier

PLAN. Atelier Puces à ADN IRB Hôpiital St Eloi Mardi 27 mars 2007 En collaboration avec la Génopole de Montpellier PLAN Atelier Puces à ADN IRB Hôpiital St Eloi Mardi 27 mars 2007 En collaboration avec la Génopole de Montpellier 8h45 Accueil des participants - café 9h00-9h45 John DE VOS : Introduction à la journée

Plus en détail

Les microarrays: technologie pour interroger le génome

Les microarrays: technologie pour interroger le génome Les microarrays: technologie pour interroger le génome Patrick DESCOMBES patrick.descombes@frontiers-in-genetics.org Plate forme génomique NCCR Frontiers in Genetics Université de Genève http://genomics.frontiers-in-genetics.org

Plus en détail

TD1 : Traitement d'un Fichier Brut de Séquences Transcrites.

TD1 : Traitement d'un Fichier Brut de Séquences Transcrites. TD1 : Traitement d'un Fichier Brut de Séquences Transcrites. Dans le cadre de cette formation, nous allons utiliser des données Illumina (75-bases 'pair-ends') issues du transcriptome de plusieurs individus

Plus en détail

Introduction, présentation de la plateforme South Green. h"p://southgreen.cirad.fr/

Introduction, présentation de la plateforme South Green. hp://southgreen.cirad.fr/ Introduction, présentation de la plateforme South Green. h"p://southgreen.cirad.fr/ SupAgro, Montpellier, 10 février 2014 Le déluge de données NGS Next-generation sequencing Rappel: synthèse de l ADN 5

Plus en détail

DIAGNOSTIC PRÉNATAL NON INVASIF : LE SANG MATERNEL

DIAGNOSTIC PRÉNATAL NON INVASIF : LE SANG MATERNEL 6 LE TEST DIAGNOSTIC PRÉNATAL NON INVASIF : LE SANG MATERNEL Source : les cellules trophoblastiques Fetal cell Cell isolation Détection 5-6SA Disparition rapide après accouchement Pas de persistance après

Plus en détail

Différences entre Homme et singes?

Différences entre Homme et singes? Différences entre Homme et singes? Différences entre Homme et singes? Apparition de l œil? Apparition du vol? Apparition des hémoglobines? Molécule d hémoglobine HEME Chaîne polypeptidique de type 2 Chaîne

Plus en détail

PLATEFORME GÉNOME TRANSCRIPTOME DE BORDEAUX

PLATEFORME GÉNOME TRANSCRIPTOME DE BORDEAUX PLATEFORME GÉNOME TRANSCRIPTOME DE BORDEAUX Catalogue des prestations et services CONTACTS Site internet de la Plateforme : https://www4.bordeaux-aquitaine.inra.fr/pgtb Direction : Pascal SIRAND-PUGNET

Plus en détail

Etude transcriptomique de la dégradation des parois lignocellulosiques de son et paille de blé durant la croissance de Thermobacillus xylanilyticus

Etude transcriptomique de la dégradation des parois lignocellulosiques de son et paille de blé durant la croissance de Thermobacillus xylanilyticus Journées SFR condorcet Compiègne 8-9 juillet 2015 Projet Hydroseq : UMR FARE-CRRBM Etude transcriptomique de la dégradation des parois lignocellulosiques de son et paille de blé durant la croissance de

Plus en détail

Les principes du sequençage haut-débit

Les principes du sequençage haut-débit Les principes du sequençage haut-débit Mardi 23 avril 2013 Dr H. EL HOUSNI Organisation Génomique Podhala'et'al.'Trends'in'genetics'2012' Costa V et al. J BioMed BioTech 2010 32 ans Costa V et al. J BioMed

Plus en détail

BIOLOGIE MOLECULAIRE

BIOLOGIE MOLECULAIRE BIOLOGIE MOLECULAIRE I. Eléments importants de la structure des génomes eucaryotes 1. Chromosomes et chromatines a) Caractéristiques générales d'un chromosome Les chromosomes des eucaryotes sont des grosses

Plus en détail

Utilisation de la métagénomique 16S pour la surveillance de l émergence de zoonoses bactériennes dans les populations animales

Utilisation de la métagénomique 16S pour la surveillance de l émergence de zoonoses bactériennes dans les populations animales Utilisation de la métagénomique 16S pour la surveillance de l émergence de zoonoses bactériennes dans les populations animales Réunion Rongeur 2014 CBGP Maxime Galan Métagénomique 16S: Pourquoi? Identification

Plus en détail

Recherche de parenté entre les vertébrés

Recherche de parenté entre les vertébrés 1 CHAPITRE A Recherche de parenté entre les vertébrés 2 Chapitre A : Recherche de parentés entre les êtres vivants Tous les êtres vivants présentent des structures cellulaires et un fonctionnement commun

Plus en détail

Filière BCPST BIOLOGIE. Epreuve commune aux ENS de Paris, Lyon et Cachan. Durée : 6 heures

Filière BCPST BIOLOGIE. Epreuve commune aux ENS de Paris, Lyon et Cachan. Durée : 6 heures 74.01B SESSION 2007 Filière BCPST BIOLOGIE Epreuve commune aux ENS de Paris, Lyon et Cachan Durée : 6 heures L usage de calculatrices électroniques de poche à alimentation autonome, non imprimantes et

Plus en détail

L utilisation de la SPIR au service de l entretien l parcours de golf : intérêts et limites. CIRAD, Montpellier (France)

L utilisation de la SPIR au service de l entretien l parcours de golf : intérêts et limites. CIRAD, Montpellier (France) L utilisation de la SPIR au service de l entretien l des parcours de golf : intérêts et limites L. Thuriès,, D. Bastianelli CIRAD, Montpellier (France) SPIR gazon : pour quoi faire? Suivi des sols : Teneur

Plus en détail

Vers l individualisation des prescriptions en oncologie : rôle du génome constitutionnel

Vers l individualisation des prescriptions en oncologie : rôle du génome constitutionnel Vers l individualisation des prescriptions en oncologie : rôle du génome constitutionnel Jacques Robert I NSERM U916 I nstitut Bergonié Université de Bordeaux Le génome constitutionnel 3 milliards de paires

Plus en détail

Evaluation de cépages résistants ou tolérants aux principales maladies cryptogamiques de la vigne

Evaluation de cépages résistants ou tolérants aux principales maladies cryptogamiques de la vigne VITICULTURE 27 Evaluation de cépages résistants ou tolérants aux principales maladies cryptogamiques de la vigne Marc Chovelon Grab Mathieu Combier Chambre d Agriculture du Var Gilles Masson Centre du

Plus en détail

Les débuts de la génétique

Les débuts de la génétique HPITRE 9 DES DÉBTS DE L ÉNÉTIQE X ENJEX TELS DES BIOTEHNOLOIES 1 Les débuts de la génétique est avec les travaux de regor Mendel vers la fin du XIX e siècle que furent posées les bases de la génétique.

Plus en détail

Réunion du réseau de génétique du Département EFPA

Réunion du réseau de génétique du Département EFPA 17 19 novembre 2014 Centre INRA de Nancy Lorraine Programme Lundi 17 novembre Salle Tilleul 13:00 Bus pour l'inra depuis la gare de Nancy 14:00 14:30 Introduction de la réunion tour de table 14:30 14:45

Plus en détail

CERTIFICAT DE COMPÉTENCES EN BIO-INFORMATIQUE

CERTIFICAT DE COMPÉTENCES EN BIO-INFORMATIQUE CERTIFICAT DE COMPÉTENCES EN BIO-INFORMATIQUE Organisé par l équipe pédagogique : Statistique bioinformatique du département IMATH Responsable de la formation : Pr. Jean-François Zagury Coordinateur des

Plus en détail

Intégration des approches métagénomiques dans l'étude de la diversité des coléoptères saproxyliques : progrès et perspectives

Intégration des approches métagénomiques dans l'étude de la diversité des coléoptères saproxyliques : progrès et perspectives Intégration des approches métagénomiques dans l'étude de la diversité des coléoptères saproxyliques : progrès et perspectives Rodolphe Rougerie (1), Christophe Bouget (2) & Carlos Lopez-Vaamonde (1) (1)

Plus en détail

Analyse des génomes. Module de Bioinformatique Appliquée. A. Les projets Génome : a) Qu est-ce qu un projet génome? Cours Analyse des génomes

Analyse des génomes. Module de Bioinformatique Appliquée. A. Les projets Génome : a) Qu est-ce qu un projet génome? Cours Analyse des génomes Module de Bioinformatique Appliquée GB3-2012 Cours Analyse des génomes 0 Analyse des génomes 1 Les objectifs des projets génomes sont : Assemblagedes cartes physiques et génétiques sur le génome de l organisme

Plus en détail

Vendredi 6 décembre 2013 Rouen

Vendredi 6 décembre 2013 Rouen Séminaire danimation d Animation de l Axe laxe 1 Vendredi 6 décembre 2013 Rouen «Le Séquençage de Nouvelle Génération dans le Cancéropôle Nord Ouest: Evolution, Résultats, projets» Diagnostic 0,5 2 Gb

Plus en détail

Lettre d information N 3 Juin 2015

Lettre d information N 3 Juin 2015 Lettre d information N 3 Juin 2015 Au sommaire Tour d horizon d AMAIZING en 2014 p. 2 Zoom sur quelques résultats et faits marquants : Effet de la sélection moderne sur la diversité génétique chez le maïs

Plus en détail

Groupe de travail : Bioinformatique, plateformes, séquençage et génotypage

Groupe de travail : Bioinformatique, plateformes, séquençage et génotypage Groupe de travail : Bioinformatique, plateformes, séquençage et génotypage Les questions biologiques auxquelles s intéresse l ITMO ont traditionnellement fait appel à la génétique, à la génétique des populations,

Plus en détail

Conférence technique internationale de la FAO

Conférence technique internationale de la FAO Décembre 2009 ABDC-10/7.2 F Conférence technique internationale de la FAO Biotechnologies agricoles dans les pays en développement: choix et perspectives pour les cultures, les forêts, l élevage, les pêches

Plus en détail

Anomalies chromosomiques

Anomalies chromosomiques Master bioinformatique, Université de Rouen Janvier 2013 Sylvain Mareschal [@etu.univ-rouen.fr] Anomalies chromosomiques Speicher & Carter (2005) Nat Rev Genet. Oct;6(10):782-92. The new cytogenetics:

Plus en détail

Big data et sciences du Vivant L'exemple du séquençage haut débit

Big data et sciences du Vivant L'exemple du séquençage haut débit Big data et sciences du Vivant L'exemple du séquençage haut débit C. Gaspin, C. Hoede, C. Klopp, D. Laborie, J. Mariette, C. Noirot, MS. Trotard bioinfo@genopole.toulouse.inra.fr INRA - MIAT - Plate-forme

Plus en détail

1A 01 Brassage génétique et sa contribution à la diversité génétique Ex 2.1 SUJET 1

1A 01 Brassage génétique et sa contribution à la diversité génétique Ex 2.1 SUJET 1 SUJET 1 On réalise deux croisements expérimentaux chez la drosophile afin d étudier le devenir de deux caractères : la couleur du corps et l aspect des ailes au cours de la reproduction sexuée La longueur

Plus en détail

Atelier 5/11/2013. Structure de la chromatine et marques épigénétiques

Atelier 5/11/2013. Structure de la chromatine et marques épigénétiques Atelier 5/11/2013 Structure de la chromatine et marques épigénétiques La chromatine ADN ADN + Histones = Nucleosome ADN + Protéines + ARNs = Chromatine Niveau extrême de condensation = Chromosome métaphasique

Plus en détail

MABioVis. Bio-informatique et la

MABioVis. Bio-informatique et la MABioVis Modèles et Algorithmes pour la Bio-informatique et la Visualisation Visite ENS Cachan 5 janvier 2011 MABioVis G GUY MELANÇON (PR UFR Maths Info / EPI GRAVITE) (là, maintenant) - MABioVis DAVID

Plus en détail

Enjeux de la biologie haut débit en oncologie

Enjeux de la biologie haut débit en oncologie Enjeux de la biologie haut débit en oncologie Pascal BARBRY, CNRS, Sophia Antipolis o Les technologies haut-débit ont enrichi considérablement nos approches quantitatives en biologie. o Des applications

Plus en détail

DÉFIS DU SÉQUENÇAGE NOUVELLE GÉNÉRATION

DÉFIS DU SÉQUENÇAGE NOUVELLE GÉNÉRATION DÉFIS DU SÉQUENÇAGE NOUVELLE GÉNÉRATION PRINCIPES DE BASE SUR LES DONNEES ET LE CALCUL HAUTE PERFORMANCE Lois de Gray sur l ingénierie des données 1 : Les calculs scientifiques traitent des volumes considérables

Plus en détail

Dépistage Prénatal Non Invasif

Dépistage Prénatal Non Invasif Dépistage Prénatal Non Invasif Dr Mélanie JIMENEZ POCQUET Biologiste - Cytogéneticien L ABOcaryo+ L ABO+ - Chambray les Tours Les patientes connectées Les forums La presse Le presse DPNI : pourquoi

Plus en détail

De GenoSol à GenoBiome, mise en place d une structure analytique pour évaluer l état biologique du sol

De GenoSol à GenoBiome, mise en place d une structure analytique pour évaluer l état biologique du sol De GenoSol à GenoBiome, mise en place d une structure analytique pour évaluer l état biologique du sol Lionel RANJARD, Samuel Dequiedt, Pierre-Alain Maron, Anne-Laure Blieux. UMR Agroécologie-plateforme

Plus en détail

La PCR en temps réel

La PCR en temps réel La PCR en temps réel Hôpital La Rabta Tunis 6 juin 2013 Dr Sabine Favre-Bonté Maître de Conférences, Université Claude Bernard Lyon 1 UMR CNRS 5557 Ecologie Microbienne Equipe Multi-résistance environnementale

Plus en détail

Outils de gestion des ressources biologiques

Outils de gestion des ressources biologiques Le Cahier des Techniques de l INRA 2015 (84) N 1 Outils de gestion des ressources biologiques Frédéric Sanchez 1 *, Tou Cheu Xiong 1 Résumé. Les recherches en biologie génèrent un grand nombre d échantillons

Plus en détail

ETUDE D'ECOBIOS VIGNE

ETUDE D'ECOBIOS VIGNE Centre de Recherches de Bordeaux Unité Mixte de Recherches en Santé Végétale Equipe "Epidémiologie de la Pourriture grise" 71, avenue E. Bourleaux - B.P. 81 33883 VILLENAVE D'ORNON Cedex ETUDE D'ECOBIOS

Plus en détail

Institut Français de Bioinformatique (IFB) : mettre en place une infrastructure informatique dédiée aux sciences de la vie

Institut Français de Bioinformatique (IFB) : mettre en place une infrastructure informatique dédiée aux sciences de la vie 1 / 1 Institut Français de Bioinformatique (IFB) : mettre en place une infrastructure informatique dédiée aux sciences de la vie J-F. Gibrat Unité Mathématique, Informatique et Génome, INRA, Jouy-en-Josas

Plus en détail

Automatisation de la plateforme MicroScope avec l API JBPM. Engelen. CEA/DSV/IG/Genoscope Métabolique Laboratoire (Atelier) de Génomique.

Automatisation de la plateforme MicroScope avec l API JBPM. Engelen. CEA/DSV/IG/Genoscope Métabolique Laboratoire (Atelier) de Génomique. Atelier «BioWorkFlow» - 25/09/08 Automatisation de la plateforme MicroScope avec l API JBPM David Vallenet & Stéfan Engelen CEA/DSV/IG/Genoscope CNRS-UMR Génomique Métabolique Laboratoire (Atelier) de

Plus en détail

Les besoins de la communauté des sciences de la vie en termes d infrastructure informatique

Les besoins de la communauté des sciences de la vie en termes d infrastructure informatique 1 / 31 Les besoins de la communauté des sciences de la vie en termes d infrastructure informatique J-F. Gibrat Unité Mathématique, Informatique et Génome, INRA, Jouy-en-Josas Séminaire IDRIS, Orsay, 14

Plus en détail

Catalogue des prestations et services

Catalogue des prestations et services PLATEFORME GÉNOME-TRANSCRIPTOME DE BORDEAUX Catalogue des prestations et services CONTACTS Site internet de la Plateforme : https://www4.bordeaux-aquitaine.inra.fr/pgtb Responsables des sites : Cestas

Plus en détail

L INSTITUT DE RECHERCHE EN

L INSTITUT DE RECHERCHE EN 1 L INSTITUT DE RECHERCHE EN IMMUNOLOGIE ET EN CANCÉROLOGIE COMMERCIALISATION DE LA RECHERCHE VISION Être un centre reconnu internationalement pour ses activités de maximisation de la valeur de la recherche

Plus en détail

Présentation ADN Fishbase. Jolien Bamps

Présentation ADN Fishbase. Jolien Bamps Présentation ADN Fishbase Jolien Bamps Les lois de Mendel et la transmission de l hérédité Gregor Mendel Moine et botaniste hongrois (1822-1884), en charge de maintenir le potager de son monastère Considéré

Plus en détail

Analyses bioinformatiques pour le PCIM

Analyses bioinformatiques pour le PCIM Analyses bioinformatiques pour le PCIM Journée de rencontre des utilisateurs du Pôle de calcul intensif pour la mer 17 janvier 2014 La bioinfo, késaco? Approche in silico de la biologie L'organisation,

Plus en détail

Bionformatique. D. Puthier Inserm U1090 Polytech Biotech III, 2014

Bionformatique. D. Puthier Inserm U1090 Polytech Biotech III, 2014 Bionformatique D. Puthier Inserm U1090 Polytech Biotech III, 2014 L informatique est omniprésente dans notre sociéte. La biologie ne fait pas exception Bioinformatique? Utiliser l information numérisée

Plus en détail

Annales du Contrôle National de Qualité des Analyses de Biologie Médicale

Annales du Contrôle National de Qualité des Analyses de Biologie Médicale Annales du Contrôle National de Qualité des Analyses de Biologie Médicale ARN du virus de l hépatite C : ARN-VHC ARN-VHC 03VHC1 Novembre 2003 Edité : mars 2006 Annales ARN-VHC 03VHC1 1 / 8 ARN-VHC 03VHC1

Plus en détail

GENETIQUE MEDICALE - Principe des études moléculaires en Génétique Médicale, Méthodes d analyse des microlésions du Génome

GENETIQUE MEDICALE - Principe des études moléculaires en Génétique Médicale, Méthodes d analyse des microlésions du Génome 29/10/2014 Crévits Léna L2 Génétique médicale Dr Martin Krahn 14 pages Principe des études moléculaires en Génétique Médicale - Méthodes d analyse des microlésions du Génome Plan A. Rappels et généralités

Plus en détail

TEPZZ 874Z85A_T EP 2 874 085 A1 (19) (11) EP 2 874 085 A1 (12) DEMANDE DE BREVET EUROPEEN. (51) Int Cl.: G06F 19/18 (2011.01) G06F 19/22 (2011.

TEPZZ 874Z85A_T EP 2 874 085 A1 (19) (11) EP 2 874 085 A1 (12) DEMANDE DE BREVET EUROPEEN. (51) Int Cl.: G06F 19/18 (2011.01) G06F 19/22 (2011. (19) TEPZZ 874Z8A_T (11) EP 2 874 08 A1 (12) DEMANDE DE BREVET EUROPEEN (43) Date de publication:.0.1 Bulletin 1/21 (1) Int Cl.: G06F 19/18 (11.01) G06F 19/22 (11.01) (21) Numéro de dépôt: 14193738.3 (22)

Plus en détail

Transformée de Burrows-Wheeler et mapping de données RNA-seq

Transformée de Burrows-Wheeler et mapping de données RNA-seq Transformée de Burrows-Wheeler et mapping de données RNA-seq MAPPI, journée indexation 6 juin 2011 Introduction Indexation But : Recherche rapide d'une information dans de grands volumes de données Indexation

Plus en détail

Domaine de Melgueil, 34130 Mauguio, France (3)

Domaine de Melgueil, 34130 Mauguio, France (3) Les Actes du BRG, 6 (2006) 57-74 BRG, 2006 Article original Analyse et prédiction des patrons de déséquilibre de liaison dans les collections de ressources génétiques de plantes pérennes ou annuelles,

Plus en détail

RÉPERTOIRE RELÈVE SCIENTIFIQUE AU SERVICE DES ENTREPRISES AGROALIMENTAIRES. 2 e édition

RÉPERTOIRE RELÈVE SCIENTIFIQUE AU SERVICE DES ENTREPRISES AGROALIMENTAIRES. 2 e édition RELÈVE SCIENTIFIQUE AU SERVICE 2 e édition Juin 2011 Réalisé par : Partenaire financier du CQVB : Objectif : Ce répertoire vise à faciliter le maillage entre les étudiants-chercheurs universitaires et

Plus en détail

Pertes et gaspillages alimentaires

Pertes et gaspillages alimentaires Pertes et gaspillages alimentaires Un phénomène aux multiples facettes Barbara REDLINGSHÖFER Mission d anticipation Recherche&Société Pour le développement durable (MaR/S) de l INRA Plan de la présentation

Plus en détail

Titre: Domaine scientifique : Mots clés : Directeurs de thèse : Institution des directeurs de thèse : Adresse email des directeurs de thèse :

Titre: Domaine scientifique : Mots clés : Directeurs de thèse : Institution des directeurs de thèse : Adresse email des directeurs de thèse : Titre: Détermination de l ensemble des ARNs non codants chez Ostreococcus, un modèle d algue unicellulaire marine infectée par des virus à ADN double brin Domaine scientifique : Génomique Mots clés : ARN

Plus en détail

Influence du fonctionnement de la vigne sur la qualité du vin

Influence du fonctionnement de la vigne sur la qualité du vin Influence du fonctionnement de la vigne sur la qualité du vin G. BARBEAU I NRA Unité expérimentale Vigne et Vin, 42 rue Georges Morel, 49071 Beaucouzé-Cédex, Tel. (33) 2 41 22 56 60, Fax (33) 2 41 22 56

Plus en détail

Tolérance au jeûne chez le loup de mer : Recherche des déterminants génomiques grâce aux NGS

Tolérance au jeûne chez le loup de mer : Recherche des déterminants génomiques grâce aux NGS Tolérance au jeûne chez le loup de mer : Recherche des déterminants génomiques grâce aux NGS E. Desmarais J.C. Avarre, C. Breton, K. Belkhir et B. Guinand Institut des Sciences de l Evolution - Montpellier

Plus en détail

La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST.

La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST. La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST. Gaël Le Mahec - p. 1/12 L algorithme BLAST. Basic Local Alignment Search Tool est un algorithme de recherche

Plus en détail

Forces agissant sur le polymorphisme synonyme et la composition en bases dans les génomes d angiospermes

Forces agissant sur le polymorphisme synonyme et la composition en bases dans les génomes d angiospermes Forces agissant sur le polymorphisme synonyme et la composition en bases dans les génomes d angiospermes Yves Clément, Jacques David & Sylvain Glémin Journées ARCAD 28/10/2014 Outline Sélection sur l usage

Plus en détail

Mode d'emploi du plugin Grayscale_Granulometry

Mode d'emploi du plugin Grayscale_Granulometry Mode d'emploi du plugin Grayscale_Granulometry D. Legland 27 mars 2013 Mode d'emploi rapide du plugin Grayscale Granulometry pour ImageJ. Le plugin permet de calculer des courbes de granulométrie en niveaux

Plus en détail

L'analyse protéomique et les sciences -omiques: des données massives à interpréter et sauvegarder

L'analyse protéomique et les sciences -omiques: des données massives à interpréter et sauvegarder L'analyse protéomique et les sciences -omiques: des données massives à interpréter et sauvegarder Christine CARAPITO, Alexandre BUREL, Patrick GUTERL, Alexandre WALTER, Jérôme PANSANEL, Fabrice VARRIER,

Plus en détail

15 septembre 2010. Démo #2 MySQL Séquençage

15 septembre 2010. Démo #2 MySQL Séquençage 15 septembre 2010 Démo #2 MySQL Séquençage SQL et MySQL SQL: structured query language langage pour manipuler des données dans des bases de données relationnelles MySQL: Implantation de SQL Ajout à SQL

Plus en détail

MASTER (LMD) PARCOURS MICROORGANISMES, HÔTES, ENVIRONNEMENTS (MHE)

MASTER (LMD) PARCOURS MICROORGANISMES, HÔTES, ENVIRONNEMENTS (MHE) MASTER (LMD) PARCOURS MICROORGANISMES, HÔTES, ENVIRONNEMENTS (MHE) RÉSUMÉ DE LA FORMATION Type de diplôme : Master (LMD) Domaine ministériel : Sciences, Technologies, Santé Mention : BIOLOGIE DES PLANTES

Plus en détail