Initiation la Recherche Atelier Scrtion Master de Microbiologie M1 (Biochimie et Biologie Cellulaire)

Dimension: px
Commencer à balayer dès la page:

Download "Initiation la Recherche Atelier Scrtion Master de Microbiologie M1 (Biochimie et Biologie Cellulaire)"

Transcription

1 1 Initiation la Recherche Atelier Scrtion Master de Microbiologie M1 (Biochimie et Biologie Cellulaire) Sophie Bleves, Amel Latifi, et Aurlia Battesti. Introduction Pseudomonas aeruginosa est une bactérie à Gram-négatif, pathogène opportuniste de l homme. Elle est notamment redoutée dans le milieu hospitalier (infections nosocomiales) chez les malades immunodéprimés et les grands brûlés. Cette bactérie est aussi connue pour les complications, souvent fatales, qu elle entraîne chez les patients atteints de mucoviscidose. Sa virulence est multifactorielle: elle est liée d une part à des facteurs associés aux bactéries, tels que le flagelle, les pili ou l alginate (un exopolysacharide muqueux), ou à la sécrétion de diverses toxines et enzymes dégradatives dans le milieu extracellulaire. Figure 1 : Les facteurs de virulence de P. aeruginosa * r ésistance AB pompes efflux* Alginate (biofilm*, adh ésine, antiphagocytose anticompl ément) * * Sécrétion d'enzymes dégradatives et de toxines pigments fluorescents Squestration du fer Flagelle (mobilit, biofilm) Pili (mobilité, adhésion,biofilm)

2 2 La sécrétion chez les bactéries à Gram-négatif implique pour les protéines à sécréter (exoprotéines) la traversée de deux membranes (interne et externe) et d un compartiment aqueux, le périplasme. Cinq voies principales de sécrétion sont conservées au sein des bactéries à Gram-négatif et vous ont été détaillées en cours. Quatre d entre elles sont présentes chez P. aeruginosa (figure 2), cette caractéristique en faisant un modèle particulièrement intéressant pour l étude des mécanismes de sécrétion. Voie Gnrale de Scrtion Type II Elastase ( LasB) Exotoxine A Protase Las A Phospholipases Lipase Phosphatase alcaline Transporteur ABC Type I Protase alcaline, HasAp, AprX Type III Contact dpendant Exoenzymes S, T, U, Y Membrane plasmique cellule eucaryote cible AprF Membrane externe Xcp AprE Psc Périplasme Sec Tat AprD Membrane interne Cytoplasme Mcanismes Sec-indpendants Figure 2 : Schma de 3 voies de scrtion prsentes chez P. aeruginosa. NB la voie de scrtion de type V n est pas prsente La machinerie de sécrétion de type II est composée de 12 protéines Xcp (extracellular protein deficient) qui s associeraient en un complexe multiprotéique reliant les deux membranes. Elle est nécessaire entre autre à la sécrétion de l élastase qui se déroule en deux étapes : traversée de la membrane interne par la voie Sec ou la voie Tat (selon les exoprotéines), puis traversée de la membrane externe par la voie Xcp. Les 12 gènes xcp sont organisés sur un même locus, en deux opérons divergents, xcppq, et xcpr-z, alors que les gènes codant pour les protéines sécrétées sont à différents loci du chromosome. Les protéines

3 3 XcpT, U, V, W et X sont appelées pseudopilines, de part leur homologie avec la piline des pili de type IV, et s assemblent pour former un pseudopilus transmembranaire. La machinerie de sécrétion de type I est la plus simple et comprend 3 protéines Apr (alkaline protease). Elle permet notamment la sécrétion en une étape de la protéase alcaline. Le gène structural de celle-ci (apra) appartient à l opéron arpa-f qui code aussi pour les composants de la machinerie de sécrétion. Enfin la machinerie de sécrétion de type III se compose d une trentaine de protéines Psc (Pseudomonas secretion component), qui forment un conduit permettant le transport des protéines à sécréter directement du cytoplasme bactérien dans le cytosol de la cellule eucaryote cible. In vivo c est le contact avec la cellule cible qui induit l expression des gènes psc et des gènes exos, T, U, et Y codant pour les effecteurs. ExoU est associée à une chaperonne cytoplasmique. Un activateur transcriptionnel de la famille AraC, appelé ExsA, est requis pour l activation du régulon de type III. Cet atelier a pour but d initier les tudiants aux techniques classiques des laboratoires tudiant les mcanismes de scrtion et de leur rgulation, en plus des techniques de base de microbiologie molculaire. Quels sont les objectifs de cet atelier? Partie A Nous allons chercher à déterminer s il existe un quelconque lien, ou «cross-talk», entre les différentes machineries de sécrétion présentes chez P. aeruginosa. Aucune donnée n a jamais été publiée à ce sujet chez P. aeruginosa, mais quelques exemples sont décrits dans la littérature chez d autres bactéries. Nous avons choisi de vous limiter aux machineries de type I et II, et souhaitons que vous abordiez cette question à deux niveaux : - phnotype de la scrtion: une voie de sécrétion influence-t-elle la sécrétion des exoprotéines transitant par une autre voie de sécrétion? - rgulation de l expression des gnes: si le «cross-talk» existe, à quel niveau se situe-t-il? Nous vous demandons d envisager les manipulations que vous entreprendriez pour rpondre ces questions. Dans les annexes, vous trouverez un tableau récapitulatif des souches bactériennes (sauvage et mutantes), des plasmides, des oligonucléotides et des anticorps dont vous disposez, ainsi que d un panel de techniques. Parallèlement à cette étude, vous allez vérifier le génotype d une des souches que vous aurez utilisées lors de cette partie (voir annexe). Partie B Nous étudierons plus particulièrement une protéine, XcpY, qui est un composant de la membrane interne de la machinerie de sécrétion de type II.

4 4 Par une analyse bio-informatique de sa séquence, vous obtiendrez toutes les prédictions de topologie la présentant comme une protéine de membrane interne : nombre de segments transmembranaires (certains et putatifs), orientations possibles du polypeptide (extrémité N-terminale dans le cytoplasme ou dans le périplasme). Ces prédictions de topologies seront confirmées par une approche in vivo qui consiste à étudier le phénotype de fusions traductionnelles de XcpY avec des enzymes rapporteurs (voir le principe en annexe). Vous étudierez l interaction de XcpY avec une autre protéine de membrane interne de la machinerie, XcpZ. Pour ce faire, vous disposerez d un plasmide (pgm ) qui porte le gène codant pour XcpY et un gène codant une forme étiquetée 6 His de XcpZ. Comment pourriez-vous mettre en vidence l interaction entre ces 2 protines grce ce plasmide? Quelles seront les diffrentes tapes de cette exprience? Consultez les annexes pour vous aider, et ne perdez pas de vue qu il s agit de protéines membranaires. Partie C Nous étudierons la production par Pseudomonas aeruginosa de facteurs de virulence autres que ceux sécrétés ( shearing -rasage- d appendices extracellulaires, adhsion sur support inerte, mobilit swiming et twitching-). Programme Lun20/02 M Mar21/02 M Mer22/02 Jeu23/02 Ven24/02 M+ Lun27/02 M SB SB AB AL SB SB SB SB 1 re confrence Tutorat (binme 1-14h-, 2-15h-,3-16h-) Introduction au FIL ROUGE Prparations (milieux, tampons et autres solutions) Bactries comptentes et transformation Prparation de plasmides (lyse alcaline) Comparaison des protocoles lyse alcaline et semi-boiling Prparation de protines scrtes Montage SDS-PAGE Fin prparation chantillons protiques, Electrophorse, Transfert Conjugaison Carte restriction (salle TD) 2 me confrence Analyse topologie XcpY (salle Info)

5 5 Mar28/02 M+ Mer01/03 M Jeu02/03 M (CNRS) Ven03/03 Lun06/03 M Mar07/03 M Mer08/03 M Jeu09/03 M Ven10/03 Lun13/03 M Jeu16/03 M Ven17/03 M+ SB AB AL SB AL AB AL AL AL SB AB AL AL AL ALSB Immunodtection, Analyse restriction, Electrophorse ADN Croissance (prparation cellules pour interaction XcpZ-Y) Bio-Informatique Type III- (salle Info) Prparations (milieux, tampons et autres solutions) Protocoles (salle TD) Sonication, Solubilisation dtergent, Colonne affinit(interaction XcpZ-Y) Prlvements chantillons (dosage galactosidase) PCR sur colonies, Electrophorse ADN 3 me confrence RT-PCR (salle TD) Prparation ARN SDS-PAGE & Coomassie (interaction XcpZ-Y), Dosages protiques et galactosidase FIL ROUGE Travail thorique FIL ROUGE Botes swiming twithching, test adhsion, shearing RT-PCR, Electrophorse ADN, test adhsion (lecture 6h) Test adhsion (lecture ON), SDS-PAGE & Western-Blot ( lecture botes, photos ME 4 me confrence Bilan final (salle TD) ECRIT Comptes-rendus rendre ORAL Shearing), AB : Aurlia Battesti ) SB : Sophie Bleves ) AL : Amel Latifi

6 6 Annexes Souches bactriennes P. aeruginosa PAO1 PAO1 xcpy PAO1 apre PAO1 xcpyz PAO1 flic PAO1 pila PAK pila flic E. coli DH5 Plasmides AB pgm ped psb4 psb52 psb3 pplasb ppapr ppxcp prk2013 Ap, Cb Ap, Cb Ap Ap Km Ap, Cb Tc Tc Km Anticorps polyclonaux (de lapins) Caractristiques Sauvage Délétion du gène xcpy dans la souche PAO1 Insertion Tn dans le gène apre de la souche PAO1 Délétion des gènes xcpz et xcpy dans souche PAO1 Délétion du gène flic codant pour la flagelline non flagélée Délétion du gène pila codant pour la piline des pili de type IV non piliée Mutations ponctuelles dans les gènes pila et flic dans la souche PAK F-, f80dlaczdm15, D(lacZYA-argF)U169, deor, reca1, enda1, hsdr17(rk-, mk+), phoa, supe44, l-, thi-1, gyra96, rela1 Production forme étiquetée de XcpZ 6His et XcpY (expression à partir ptac) Surproduction pseudopiline XcpT (expression à partir ptac) Fusion traductionnelle XcpY avec la phosphatase alcaline au résidu 232 Fusion traductionnelle XcpY avec la phosphatase alcaline au résidu 278 Fusion traductionnelle XcpY avec la -lactamase au résidu 363 Fusion transcriptionnelle promoteur lasb-lacz(lasb code pour l élastase) Fusion transcriptionnelle promoteur apradef-lacz Fusion transcriptionnelle promoteur xcpr-z-lacz Plasmide mobilisateur Anti élastase, Anti protéase alcaline, Anti XcpT, Anti XcpY, Anti 6 His Oligonuclotides lasb amont lasb aval rpoa amont rpoa aval L1 L2 R1 R2 5 TGGCGGCCACGAGGTCA 3 5 TTACAACGCGCTCGGGC 3 5 CATCGTTCAGCCCGGTC 3 5 AGGCAGTGGCCTTGTCGT 3 5 GAGAGGGCCCTAGGAGGTTGA3 5 CGCCTGCTGAAATTGTCGGAAG3 5 CCCTGCCCGTTCAACTGCTCCA3 5 TATACCCGGGACTCCACTCA3

7 7 Protocoles exprimentaux Croissances bactriennes Milieux de culture: P. aeruginosa est cultivé en milieu PIA (Pseudomonas Isolation Agar) ou milieu riche LB (Luria broth) supplémenté en cas de besoin par les antibiotiques suivants : carbénicilline (Cb) 500 g /ml, tétracycline (Tc) 200 g/ml. En milieu liquide, la Cb est utilisée à 300 g/ml, et la Tc à 50 g/ml.. E. coli est cultivée en milieu riche LB supplémenté en cas de besoin par les antibiotiques suivants : ampicilline (Ap) 50 g /ml, tétracycline (Tc) 15 g/ml, kanamycine (Km) 25 g /ml. Milieux d identification: A/ L lastase et la protase alcaline sont deux protéases, et leur activité enzymatique peut être mise en évidence sur deux types de boîtes, contenant de la caséine (boîte au lait ou skim-milk) ou de l élastine. L élastase utilise comme substrats l élastine et la caséine alors que la protéase alcaline n utilise que la caséine. Ces activités se traduisent par un halot d hydrolyse autour des colonies de Pseudomonas après 24 à 48h de croissance à 37 C. B/ Botes mobilit swiming (flagelle) et twitching (pili de type IV) Milieu LB semi-solide à 0.3% d agar (swiming). Milieu agar (1,5%) innoculé au cure-dent en traversant la gélose, puis coloration au cristal violet (twitching). C/ Botes activit phosphatase alcaline Milieu LB supplémenté de BCIP (5-bromo-4-chloro-3-indolyl phosphate) à 0,4mg/ml.

8 8 Techniques de gntique Transformation voir Fascicule principes techniques Conjugaison 3 partenaires _ - Déposer sur une boîte LB sans antibiotiques, 10 l de la souche donnatrice et de la souche mobilisatrice NB Penser à réaliser tous les témoins Incuber 2h à 37 C (1 er contact= mobilisation) - Mettre la souche réceptrice pendant ces 2h à 42 C (inhibition des systèmes de restrictionmodification de l ADN) - Rajouter alors 10 l de la souche réceptrice Incuber au moins 4h à 37 C (2 ème contact) - Resuspendre le «patch» de bactéries dans 500 l de LB Etaler 200 l sur milieu sélectif PIA + antibiotiques et incuber O/N à 37 C NB1 les conjugants peuvent n apparaître qu après 24 à 48h. NB2 Réisoler les conjugants sur LB +antibiotiques, le milieu PIA n étant utilisé que pour la sélection des Pseudomonas.

9 9 Techniques de biochimie Prparation de protines scrtes - prendre la DO 600 des cultures de nuit * DO 600 inoculum de nuit quoi faut-il penser? - ensemencer 50 ml de milieu LB à une DO 600 initiale de 0,1 - incuber à 37 C sous agitation - prendre la DO 600 de chaque culture après une heure, puis suivre la croissance toutes les 30 minutes pendant la phase exponentielle de croissance puis toutes les heures jusqu à DO 600 = 4 Prélever et transvaser dans un eppendorf de 1,5 ml, 1 ml de culture à DO 600 1, 2 et 4 * tracer au fur et mesure sur papier semi-logarithmique la DO 600 en fonction du temps pour chaque souche - centrifugation de chaque prélèvement (10, 8000RPM) inutile de manipuler stérilement * le surnageant de culture contenant les protéines sécrétées est soigneusement transvasé dans un nouvel eppendorf, placé dans la glace puis 150 l de TCA 75% (acide trichloroacétique) sont ajoutés pour précipiter les protéines toute la nuit (ON) à 4 C * le culot cellulaire est repris à 1 U DO 600 par 50 l de tampon de charge SDS-PAGE puis conservé à 20 C (= C) - centrifuger les surnageants de culture que vous avez précipité ON à 4 C (30, 13000RPM), le surnageant est éliminé et le culot est lavé par 1 ml d acétone 90% - centrifugation (10, 13000RPM), éliminer tout l acétone et évaporer le reste d acétone en laissant les eppendorfs ouverts 5 min à 37 C. - le culot est repris à 1 U DO 600 par 10 l de tampon de charge SDS-PAGE (= SN) - dénaturer tous vos échantillons (C et SN) pendant 8 au bain marie bouillant * fermer soigneusement vos eppendorfs et veiller ce qu ils ne se remplissent pas d eau du Bain Marie! NB les centrifuger 5 secondes avant de les charger SDS-PAGE (Mini ProteanIII Biorad-) - monter le système (présenté dans le fascicule de principes techniques) - délimiter par un trait de marqueur la hauteur du gel de séparation ( 5 cm) * vrifier que le systme ne fuit pas en ralisant un essai avec de l eau Tant que l acrylamide n a pas polymris, il est toxique : MANIPULER AVEC DES GANTS - préparer dans 2 béchers (volume pour 2 gels)

10 10 gel de séparation (10%) gel de séparation (12%) gel de concentration Acrylamide 30% 6,6 ml 8 ml 0,8 ml H 2 0 8,4 ml 7 ml 4,8 ml Lower Tris 5 ml 5 ml Upper Tris 2 ml - QUAND VOUS ETES PRETS A COULER LE GEL de sparation ajouter 800 l d APS 1% et 25 l de TEMED dans le bcher correspondant, mélanger doucement et couler le gel à la pipette Pasteur jusqu au trait et vérifier le niveau (la surface doit être horizontale). Déposer délicatement à l aide d une pipette Pasteur de l eau distillée à la surface du gel. - quand le gel a polymérisé (vérifier avec ce qu il reste dans le bécher), éliminer l eau en retournant le système - ajouter 400 l d APS 1% et 8 l de TEMED dans le bécher du gel de concentration, mélanger doucement et couler le gel à la pipette Pasteur. Mettre immédiatement les peignes en évitant autant que possible de faire des bulles. - monter la chambre d électrophorèse, la placer dans la cuve et remplir les 2 compartiments de tampon d électrophorèse - enlever délicatement le peigne - charger la gamme étalon protéine, la protéase alcaline et l élastase pures, ainsi que l équivalent de 0,2 U DO 600 de cellules (C) et de 1 U DO 600 surnageant (SN) - appliquer 80V par système pour le gel de concentration, puis migrer à 150V - suivre la migration par l avancée du front du bleu et l arrêter avant qu il ne sorte ( 1h30) Tampon de charge SDS-PAGE : 2% SDS, 10% glycérol, 5% -mercapthoéthanol, 62,5mM Tris-HCl, ph 6,8, bout de spatule de BBP (Bromophénol Blue) Lower Tris : 1,5M Tris-HCl, 0,4% SDS, ph 8,8 Upper Tris : 0,5M Tris-HCl, 0,4% SDS, ph 6,8 Tampon d électrophorèse : 250mM Tris, 1,9M Glycine, 35mM SDS Western-blot - placer le gel dans du tampon de transfert ainsi qu un feuille de nitrocellulose et 6 feuilles de papier Whatman

11 11 - mettre dans l ordre sur la plaque de l appareil à blot (transfert semi-sec) en prenant soin d éliminer les bulles (en faisant rouler une pipette) : 3 feuilles de papier Whatman, la membrane de nitrocellulose, le gel, et enfin encore 3 feuilles de papier Whatman (voir schéma) * ne jamais toucher la feuille de nitrocellulose avec ses doigts --> des pinces mtalliques sont votre disposition 3 feuilles de papier Whatman le gel (attention aux bulles) la nitrocellulose 3 feuilles de papier Whatman Plaque appareil à blot - fermer le capot de l appareil à blot - transférer 35 min en se plaçant à 15 V limitant - quand le transfert est terminé, placer la feuille de nitrocellulose dans un bain de rouge ponceau (coloration temporaire des protéines), puis la transférer immédiatement dans un bain d eau. Agiter doucement, les protéines apparaissent en rouge. Quand la gamme étalon se détecte bien, repasser au stylo à bille les différentes bandes (94, 67, 43, 30, 20 et 14 kda), faire un point au niveau de la protéase alcaline (48 kda) ou de l élastase (30 kda) purifiée, puis venir me voir pour découper la membrane. Conserver les 2 morceaux de nitrocellulose dans du papier d aluminium à 4 C après décoloration totale dans de l eau. - immunodétection : incuber la membrane de nitrocellulose sous agitation - 30 min en TBS lait 5% Tween 20 0,1% - 1h30 en TBS lait 5% Tween 20 0,1% contenant soit Ac élastase (1/500), soit protéase alcaline (1/1000), XcpT (1/1000). - 3 lavages de 5 min en TBS Tween 20 0,1% - 1h en TBS lait 5% Tween 20 0,1% contenant Ac secondaire anti IgG de lapins marqué à la phosphatase alcaline (1/5000) - 3 lavages de 5 min en TBS Tween 20 0,1% - Placer la membrane dans 5 ml du kit de détection de l activité phosphatase alcaline (Western Blue( Stabilized substrate for alkaline phophatase Promega-). Agiter et laisser la coloration se développer et l arrêter en plaçant la membrane dans de l eau. La sécher dans du papier absorbant. Tampon de transfert : 48mM Tris, 40mM Glycine, 20% Et-OH TBS (10x) : 0,5M Tris-HCl, 1,5M NaCl, ph8

12 12 Coloration des gels de protines au bleu de Coomassie: Tampon de coloration Bleu de Coomassie 0.25% Ethanol Acide acétique H2O QSP 1 g 125ml 40ml 500ml Tampon de Décoloration 250ml d éthanol et 80ml d acide acétique, H2O QSP 1 litre. Solubilisation de protines de membrane interne - prendre la DO 600 des cultures de nuit - ensemencer 50 ml de milieu LB +AB à une DO 600 initiale de 0,1 - incuber à 37 C sous agitation - à DO 600 = 0,5-0,6 ajouter de l IPTG 2mM - incuber à 37 C pendant 3h 45 ml de culture (10, 5000RPM) - culot repris dans 6 ml de tampon NaPi + 60 l inhibiteur de protéases (campus J. Aiguier) - sonication 5X15 arrêts de 45 en glace 6 ml, 10, 3000RPM (élimination des débris cellulaires et bactéries non cassées) surnageant, 30, RPM campus J. Aiguier) NB culot de membranes totales est orangé culot repris dans 1,5 ml de tampon NaPi + DM (n-dodecyl-_-d-maltoside) 1% 30 en glace ajouter 375 l glycérol 30, RPM campus J. Aiguier) les protéines de membrane interne solubilisées se retrouvent dans le surnageant NB culot de membrane externe est translucide Tampon NaPi: NaH 2 PO 4 50mM, ph8 (ajuster avec NaOH) Purification de protines tiquette 6 His 1. Rincer la colonne avec 5 ml d H 2 O 2. Charger 0.5ml de 0.1M NiSO 4 3. Rincer avec 5ml d H 2 O 4. Rincer avec 10ml de tampon A 5. Passer l échantillon (Solubilisation de protines de membrane interne) 11. Rincer avec 10 ml de Buffer A + 50mM Imidazole

13 Elution : 1ml Buffer A + 100mM Imidazole 1ml Buffer A + 200mM Imidazole 1ml Buffer A + 300mM Imidazole 1ml tampon A + 400mM Imidazole 1ml tampon A +500mM Imidazole 13. Dosage des protéines et analyse sur gel SDS-PAGE (12%) du contenu de chaque fraction. Tampon A : 0.02M de tampon phosphate Na 2 HPO 4, 0.5M NaCl, glycérol 10%, ph 7.4. Dosage des protines totales Mthode Lowry: voir Fascicule de principes techniques Mthode Bradford: Gamme talon : Diluer 40 l d albumine bovine (BSA) 10mg/ml dans 960 l d H 2 O soit solution à 400 g/ml Faire la gamme (5 6 points ) dans les cuvettes : 200 l de BSA, 600 l d H 2 O et 200 l de réactif Bradford Mlanger 800 l d chantillon et 200 l de ractif Bradford. Incuber 5minutes temprature ambiante. Lire la densit optique 595. Penser raliser une courbe talon avec la BSA (albumine bovine). Dosage de la -galactosidase: Voir Fascicule de principes techniques pour connaître le principe 0.1ml de culture est dilu dans 0.9ml de tampon Z plus Mercaptothanol (27 l de Mercaptothanol pour 10 ml de tampon Z) plus deux gouttes de chloroforme et une goutte de SDS 0,1%. Vortexer 2 min, et placer dans un bain 28 C Incuber 10 minutes 28 C Prendre la DO 600 des cellules 0.2ml d ONPG (4mg/ml) est ajout pour dbuter la raction, le temps est alors not. Lorsque la couleur devient jaune, la raction est stoppe par adjonction de 0.5ml de Na 2 CO 3 1M. Le temps auquel le Na 2 CO 3 est ajout est not. La DO 420 est dtermine. Si le mlange est trouble, centrifuger au pralable afin d liminer les dbris cellulaires. NB Tmoins raliser?

14 14 L activit galactosidase est calcule partir de l quation suivante : Units Miller = (DO 420 *1000) / (t* v * DO 600 ) T = Temps coul entre l addition ONPG et addition de Na 2 CO 3 en min V = volume des cellules utilises en ml Tampon Z (ph7) 60mM Na 2 HPO 4 40mM NaH 2 PO 4 Conserver 4 C 10mM KCl 1mM MgSO 4 7H 2 O Na 2 CO 3 1M ONPG 4mg/ml prparer extemporanment en tampon phosphate 0.1M, ph 7,4 Tampon phosphate 0.1M ph 7,4 : 77,4 ml de Na 2 HPO4 1M et 22.6ml de NaH 2 PO4 1M, qsp 1 litre avec H 2 O distille.

15 15 Techniques de biologie molculaire Miniprparation lyse alcaline Centrifuger 1,5 ml de culture O/N Resuspendre le culot dans 100 l de Solution I Ajouter 200 l de Solution II vortexer brièvement et incuber 5 minutes à température ambiante Ajouter 150 l de Solution III, Vortexer Centrifuger 5 minutes Précipiter le surnageant par 270 l (0.6 vol) d isopropanol, vortexer Centrifuger 10 minutes Rincer le culot par 500 l d éthanol 70% Centrifuger 5 min éliminer le surnageant, laisser sécher 5-10 minutes et resuspendre dans 25 à 50 l d eau plus Rnase (1mg/ml) Solution I : 50mM glucose, 25mM Tris ph8, 10mM EDTA Solution II : 0.2N NaOH, 1%SDS Solution III : 2.55M KAcetate, ph 4.8 Miniprparation semi boiling Centrifuger 1,5 ml de culture O/N Resuspendre le culot dans 1ml de STET + 2 l RNase (1mg/ml préalablement bouillie) + 20 l Lysozyme (20mg/ml) Mettre les tubes à 95 C 7min Les remettre immédiatement en glace min, 13000RPM Enlever le culot (visqueux) au cure-dents Incuber 15 min à 37 C (action RNase) Ajouter 0,4ml AcNH4, 5M, ph5,5 et 0,9ml Isopropanol Mélanger par retournements min, 13000tr/min Eliminer le surngeant Laver avec 500 l Et-OH 70% min, 13000RPM Eliminer le surnageant et laisser sécher 5-10min, et resuspendre dans 20 à 50 l H 2 O

16 16 STET : Tris-HCl 0,1M, ph8, EDTA 50mM, sucrose 8%, Triton X100 0,5% Prparation d ARN NB : La lyse sera adaptée à Pseudomonas 3. Add 350 l Buffer RLT to the sample. Mix thoroughly by vortexing vigorously. If insoluble material is visible, centrifuge for 2 min in a microcentrifuge at maximum speed, and use only the supernatant in subsequent steps. If more than 5 x 108 bacteria are processed, additional homogenization with a QIAshredder homogenizer or a syringe and needle may increase RNA yield (see pages 20 24). Note: Ensure that ME is added to Buffer RLT before use (see Important notes before starting ). 4. Add 250 l ethanol (96 100%) to the lysate. Mix thoroughly by pipetting. Do not centrifuge. A precipitate may form after the addition of ethanol, but this will not affect the RNeasy procedure. 5. Apply the sample (usually 700 l), including any precipitate that may have formed, to an RNeasy mini column placed in a 2 ml collection tube (supplied). Close the tube gently, and centrifuge for 15 s at 8000 x g ( 10,000 rpm). Discard the flow-through. Reuse the collection tube in step 6. If the volume exceeds 700 l, load aliquots successively onto the RNeasy column, and centrifuge as above. Discard the flow-through after each centrifugation step.* 6. Add 700 l Buffer RW1 to the RNeasy column. Close the tube gently, and centrifuge for 15 s at 8000 x g ( 10,000 rpm) to wash the column. Discard the flow-through and collection tube.* Skip this step if performing the optional on-column DNase digestion (page 99). 7. Transfer the RNeasy column into a new 2 ml collection tube (supplied). Pipet 500 l Buffer RPE onto the RNeasy column. Close the tube gently, and centrifuge for 15 s at 8000 x g ( 10,000 rpm) to wash the column. Discard the flow-through. Reuse the collection tube in step 8. Note: Buffer RPE is supplied as a concentrate. Ensure that ethanol is added to Buffer RPE before use (see Important notes before starting ). 8. Add another 500 l Buffer RPE to the RNeasy column. Close the tube gently, and centrifuge for 2 min at 8000 x g ( 10,000 rpm) to dry the RNeasy silica-gel membrane. Continue directly with step 9, or, to eliminate any chance of possible Buffer RPE carryover, continue first with step 8a. It is important to dry the RNeasy silica-gel membrane since residual ethanol may interfere with downstream reactions. This centrifugation ensures that no ethanol is carried over during elution. Note: Following the centrifugation, remove the RNeasy mini column from the collection tube carefully so the column does not contact the flow-through as this will result in carryover of ethanol. 8a. Optional: Place the RNeasy column in a new 2 ml collection tube (not supplied), and

17 17 discard the old collection tube with the flow-through. Centrifuge in a microcentrifuge at full speed for 1 min. 9. To elute, transfer the RNeasy column to a new 1.5 ml collection tube (supplied). Pipet l RNase-free water directly onto the RNeasy silica-gel membrane. Close the tube gently, and centrifuge for 1 min at 8000 x g ( 10,000 rpm) to elute. Electrophorse d ADN - préparer un gel d'agarose 0,7% en TBE 0,5X faire bouillir au micro-ondes (salle de pesée) Laisser refroidir et ajouter une goutte de bromure d' éthydium (Bet) (0,625mg.ml -1 ) par 50ml de gel préparés * porter des gants: le Bet est mutagne chez les bactries et est souponn d tre cancrigne chez l homme Mettre les peignes et couler dans le support - rajouter 5 l de tampon de charge ADN dans chaque tube et charger 15 l de chaque échantillon sur le gel d'agarose Déposer 5 l de marqueur de taille (Smart ladder, Eurogentec) Tampon de charge ADN: 30% glycérol, 0,25% bleu de bromophénol, 0,25% - mercaptoéthanol TBE 20x 1,8M Tris, 40mM EDTA, 1,8M Acide Borique Vrification par PCR du gnotype d une souche La souche mutante de sécrétion de type II (PAO1 xcpy) utilisée lors de ce stage porte une délétion complète du gène xcpy, ce que vous allez vérifier par PCR avec les couples d'oligonucléotides appropriés sur colonies. L2 2,1kb R2 L1 1,4kb R1 xcpx xcpy XcpZ

18 18 Lyse des bactries - reprendre une colonie de PAOI ou PAO1 xcpy (une souche par groupe) dans100 l d'h 2 O et lyser les bactéries comme suit: 15' à -20 C, puis décongeler à 37 C, 15' à -20 C et 10' à 95 C (attention ce que l eau ne pntre pas dans les tubes!) centrifuger 5'' les échantillons PCR - préparer les mélanges réactionnels suivants dans des eppendorfs PCR sur la glace en ajoutant l enzyme quand tous les groupes sont prts lancer la PCR 5 l d'adn (bactéries lysées, PAOI ou PAO1 xcpy ) + oligonucléotide R1 ou R2 (20 pmol à partir solution à10pmol/ l) + oligonucléotide L1 ou L2 (20 pmol à partir solution à 10pmol/ l) + dntp (1mM final à partir solution 10mM) + tampon ADN polymérase (1X final) + MgCl 2 (1X final) + 1 l DMSO (limiter les structures secondaires ADN) H2O qsp 20 l +0,2 l ADN polymérase thermostable (Taq polymérase, 5U/ l) - programmation de l'appareil PCR ( 3h) 95 C 7' 95 C 1' 55 C 1' 30 cycles 72 C 1'30 72 C 10' Techniques de RT-PCR semi-quantitatives NB: Toutes les manipulations doivent tre ralises dans des tubes dpourvues de RNases 1/ Dcontamination la DNase : Pour chaque raction, raliser le mlange suivant : 1 g d ARN + 1 l de tampon DNase 10X + 1 l de DNase + 1 l d inhibiteurs de Rnases, H 2 O QSP 10 l.

19 19 Incuber minutes temprature ambiante. Inactiver la DNase par ajout de 1 l d EDTA 25mM. 2/ Raction de RT-PCR (en une tape) Pour chaque raction, raliser le mlange suivant : 25 l de tampon 2X + 1 g d ARN + 3 l du mlange des 2 amorces (10mM) + 1 l d enzyme + 1ml d inhibiteur de RNases QSP 50 l. Lancer le programme adquat. NB: Penser faire une raction dans les mmes conditions avec la polymrase afin de vrifier la non contamination avec de l ADN. Exemple de programmes Un cycle : 45 minutes 50 C (ceci correspond la raction de reverse transcription) 2 minutes 94 C Trente cinq cycles : 30 secondes 94 C 45 secondes 50 C 1 minute 70 C Un cycle : 5 minutes 72 C Taq NB: Rflchir aux cycles au quels devront tre faits les prlvements. Chaque prélèvement est analysé en chargeant 10_l de réaction plus 5 _l de tampon de charge ADN sur gel d agarose 1,5% en TBE 0,5X.

20 20 Test d adhrence en plaque polystyrne 24 puits - Remplir chaque puits par 1 ml de LB - A partir d une cultutre O/N en LB+/- antibiotique, inoculer chaque puits à 0,2 UDO 600 /ml (Penser à faire plusieurs puits pour une même souche : Contrôle DO 600 ; et à garder un puits sans bactérie : Contrôle négatif de contamination) - Incuber à 30 C, sans agitation, le temps voulu - Révéler en ajoutant 100µl de Crystal Violet (1X) dans chaque puits, sauf pour celui qui sert à mesurer le DO Laisser agir 10 à 15 min - Enlever le Crystal violet à l aide d une pipette non stérile - Rincer 2 fois à l H 2 0 sans toucher les parois - L anneau d adhérence violet s observe à l interface air-liquide - Quantification : Resuspendre l anneau avec 400µl d éthanol 95% ; Compléter avec 600µL d H 2 0!!!! et lire la DO à 600 nm Rasage (Shearing) " - Etaler les bactéries sur boîtes de Pétri carrées (LB +AB + IPTG frais 2mM) ON à 37 C - Re-suspendre les bactéries dans 1,8ml de LB, MgCl2 10mM NB DO 600 entre 5 et 10 - Les passer 3 fois dans une seringue équipée d une aiguille 19G RPM (centri eppendorf) - Récuperer 1,5ml de surnageant RPM - Récuperer 1,4ml de surnageant RPM - Récuperer 1,2ml de surnageant - Précipiter 1h dans la glace TCA (10% final) RPM - Laver le culot / 500 l acétone 90% RPM - sécher le culot à 37 C et resuspendre à 2UDO 600 /" l de SDS-PAGe loading buffer - 1U DO 600 sur gel Prdiction de la topologie d une protine transmembranaire, XcpY Les protéines intégrales de la membrane interne sont ancrées dans celle-ci par des segments d une vingtaine de résidus, dont la structure secondaire correspond à des hélices # hydrophobes. Une protéine possédant un segment transmembranaire est dite bitopique. Une

METHODES DE SEPARATION DE PROTEINES : PURIFICATION DE LA GST PAR AFFINITE AU GLUTATHION

METHODES DE SEPARATION DE PROTEINES : PURIFICATION DE LA GST PAR AFFINITE AU GLUTATHION Laboratoire de Physiologie Végétale Université de Neuchâtel (2005) Travaux pratiques METHODES DE SEPARATION DE PROTEINES : PURIFICATION DE LA PAR AFFINITE AU GLUTATHION INTRODUCTION: Les protéines tiennent

Plus en détail

Plasmid DNA purification

Plasmid DNA purification Plasmid DNA purification Excerpt from user manual - Français - NucleoBond Xtra NucleoBond Xtra NucleoBond Xtra Plus NucleoBond Xtra Plus January 2013 / Rev. 11 Plasmid DNA purification Français Introduction

Plus en détail

Département de biologie Page 1 sur 6

Département de biologie Page 1 sur 6 Département de biologie Page 1 sur 6 TP de Biologie Moléculaire : BIO 36 Marion Benoîst, Keith Dudley, Dominique Charmot Introduction Lors de ce TP vous allez cloner des molécules d ADN. L objectif est

Plus en détail

MLVA Streptococcus pneumoniae

MLVA Streptococcus pneumoniae H.I.A. Robert Picqué Bordeaux Laboratoire de Biologie moléculaire Version Internet 2 MLVA Streptococcus pneumoniae 1. DESCRIPTION DES OPERATIONS 1.1 Culture et extraction des ADN NB : prévoir dans la série

Plus en détail

Extraction de protéines (Western Blot) - tampon de lyse

Extraction de protéines (Western Blot) - tampon de lyse Extraction de protéines (Western Blot) - tampon de lyse Préparer tampon de lyse : - 0.3 ml NaCl 5M - 0.5 ml Tris-base ph 8-0.1 ml Nonidet P 40 (NP40) - 0.5 ml Desoxycholate 10 % - 0.1 ml SDS 10 % - 0.5

Plus en détail

Master ICMV 1 ére année. TP UE S8

Master ICMV 1 ére année. TP UE S8 1 Master ICMV 1 ére année. TP UE S8 PRODUCTION ET SELECTION DE BACULOVIRUS RECOMBINANTS DANS DES CELLULES D INSECTES EN CULTURE Présentation générale : les baculovirus d insectes, vecteurs d expression

Plus en détail

Biochimie I. Extraction et quantification de l hexokinase dans Saccharomyces cerevisiae 1. Assistants : Tatjana Schwabe Marcy Taylor Gisèle Dewhurst

Biochimie I. Extraction et quantification de l hexokinase dans Saccharomyces cerevisiae 1. Assistants : Tatjana Schwabe Marcy Taylor Gisèle Dewhurst Biochimie I Extraction et quantification de l hexokinase dans Saccharomyces cerevisiae 1 Daniel Abegg Sarah Bayat Alexandra Belfanti Assistants : Tatjana Schwabe Marcy Taylor Gisèle Dewhurst Laboratoire

Plus en détail

Manipulation des acides nucléiques

Manipulation des acides nucléiques Manipulation des acides nucléiques (voir chapitre 6 du Voet et Voet) - les acides nucléiques forment des polymères : ADN et ARN - ils sont composés de 4 nucléotides: A, C, G et T pour l ADN A, C, G et

Plus en détail

Appli Ozyme Western Blot Protocole Complet

Appli Ozyme Western Blot Protocole Complet Appli Ozyme Western Blot Protocole Complet SOMMAIRE Matériel et réactifs nécessaires... P.2 Déroulement de l expérience... P.3 Préparation, électrophorèse et protocole de transfert... P.3 Protocole de

Plus en détail

Protocole d électrophorèse bidimensionnelle version1.0

Protocole d électrophorèse bidimensionnelle version1.0 Livret de PROTOCOLE Protocole d électrophorèse bidimensionnelle version1.0-1 SOMMAIRE Préparation des échantillons... 3 1-Extraction des protéines... 3 2-Dosage des protéines avec le kit Pharmacia, PlusOne

Plus en détail

Protocole de laboratoire pour la purification manuelle de l ADN d un échantillon de 0,5 ml

Protocole de laboratoire pour la purification manuelle de l ADN d un échantillon de 0,5 ml Protocole de laboratoire pour la purification manuelle de l ADN d un échantillon de 0,5 ml Pour la purification de l ADN génomique des kits de prélèvements Oragene et ORAcollect. Pour tout protocole et

Plus en détail

2: Les enzymes de restriction

2: Les enzymes de restriction 2: Les enzymes de restriction Les enzymes de restriction sont des protéines synthétisées par des bactéries pour se protéger des infections de virus (bactériophages). Ces enzymes coupent l ADN viral à des

Plus en détail

Approche pratique de la transgénèse :

Approche pratique de la transgénèse : Approche pratique de la transgénèse : Recherche et analyse fine d une modification génétique dans le génome murin octobre 2006 1) 2) 3) 7) 8) 9) 10) 11) 12) 13) 14) Plan / Introduction Extraction et Préparation

Plus en détail

POLASZEK André juin 2012. Rapport de stage La localisation intracellulaire des différents domaines de TPPP/p25 humaine

POLASZEK André juin 2012. Rapport de stage La localisation intracellulaire des différents domaines de TPPP/p25 humaine POLASZEK André juin 2012 Rapport de stage La localisation intracellulaire des différents domaines de TPPP/p25 humaine Sommaire RAPPORT DE STAGE 1 Sommaire 2 Introduction 3 Méthode 6 Migration sur gel d

Plus en détail

SESSION 2005. CAPET externe et CAFEP TRAVAUX PRATIQUES. Première partie : Techniques de biochimie

SESSION 2005. CAPET externe et CAFEP TRAVAUX PRATIQUES. Première partie : Techniques de biochimie SESSION 2005 CAPET externe et CAFEP Section : Biotechnologies Option : Biochimie - génie biologique TRAVAUX PRATIQUES Première partie : Techniques de biochimie Durée totale : 4 heures SUIVI DE LA PURIFICATION

Plus en détail

10b : La PCR (locus PV92)

10b : La PCR (locus PV92) 10b : La PCR (locus PV92) Cette expérience a été mise en place afin de remplacer le protocole intitulé "PCR (locus D1S80)". L amplification est en effet meilleure et les résultats plus simples à interpréter.

Plus en détail

Ecole Centrale Paris Année 2009-2010 1 ère année. Cours «Biologie». Vendredi 28 mai 2010

Ecole Centrale Paris Année 2009-2010 1 ère année. Cours «Biologie». Vendredi 28 mai 2010 Ecole Centrale Paris Année 2009-2010 1 ère année. Cours «Biologie». Vendredi 28 mai 2010 Contrôle des Connaissances. 2 ème session) (Durée : 1h30, tous documents autorisés, ordinateur interdit) Important

Plus en détail

Taq'Ozyme Purple Mix MANUEL D UTILISATION

Taq'Ozyme Purple Mix MANUEL D UTILISATION Taq'Ozyme Purple Mix OZYA003-40 - 40 réactions OZYA003-200 - 200 réactions (avec supplément de MgCl 2 ) OZYA003-200XL - 200 réactions (avec supplément de MgCl 2 ) OZYA003-1000 - 1000 réactions (avec supplément

Plus en détail

TP de Biochimie Groupe 4 Forestier Michèle 25.05.2010 Fournier Coralie Freyre Christophe Manipulation d ADN

TP de Biochimie Groupe 4 Forestier Michèle 25.05.2010 Fournier Coralie Freyre Christophe Manipulation d ADN MANIPULATION D ADN Clonage du gène «venus» dans des plasmides et expression de celui-ci chez les bactéries E.Coli. Assistants: U. Loizides M. Umebayashi C. Gehin - 1 - 1. Résumé Lors de notre expérience,

Plus en détail

STAGE EN MILIEU PROFESSIONNEL. Année scolaire 2006/2007

STAGE EN MILIEU PROFESSIONNEL. Année scolaire 2006/2007 STAGE EN MILIEU PROFESSIONNEL Année scolaire 2006/2007 Etablissement d accueil : ENSAIA, groupe GPBA (Génie des Procédés Biotechnologiques et Alimentaires) laboratoire de Jean-Louis Georgen (Jean-Louis.Goergen@ensaia.inpl-nancy.fr)

Plus en détail

10a: La PCR (locus D1S80)

10a: La PCR (locus D1S80) 10a: La PCR (locus D1S80) Pour des raisons techniques, ce protocole n'est plus utilisé. Il a été remplacé par le protocole "PCR locus PV92" ainsi que le nouveau protocole "PCR sensibilité au PTC". Il reste

Plus en détail

3. Biotechnologie de l ADN

3. Biotechnologie de l ADN 3. Biotechnologie de l ADN 3.1. Technologie de l ADN recombinant 3.1.1. Isolation d ADN et d ARN 3.1.2. Fragmentation de l ADN (les Endonucléases) 3.1.3. Analyse d ADN sur d agarose et d acrylamide 3.1.4.

Plus en détail

Technologie de l ADN recombinant. Complément de cours sur: «Les Méthodes d Etude de la Cellule»

Technologie de l ADN recombinant. Complément de cours sur: «Les Méthodes d Etude de la Cellule» Technologie de l ADN recombinant Complément de cours sur: «Les Méthodes d Etude de la Cellule» 1 Les techniques de l ADN Recombinant But: isoler des fragments d ADN de génomes complexes et les recombiner

Plus en détail

BACCALAURÉAT TECHNOLOGIQUE

BACCALAURÉAT TECHNOLOGIQUE BACCALAURÉAT TECHNOLOGIQUE Série : Sciences et Technologies de Laboratoire Spécialité : Biotechnologies SESSION 2013 Sous-épreuve écrite de Biotechnologies Coefficient de la sous-épreuve : 4 Ce sujet est

Plus en détail

CLONAGE D UN GÈNE DE MEDUSE BIOCHIMIE DE L ADN

CLONAGE D UN GÈNE DE MEDUSE BIOCHIMIE DE L ADN CLONAGE D UN GÈNE DE MEDUSE BIOCHIMIE DE L ADN But de la manipulation Le but de cette manipulation est l introduction d un gène de méduse codant pour une protéine fluorescente dans des bactéries par l

Plus en détail

Travailler en toute sécurité dans un laboratoire de biologie moléculaire

Travailler en toute sécurité dans un laboratoire de biologie moléculaire VWR Tour 2012! Travailler en toute sécurité dans un laboratoire de biologie moléculaire Christian Siatka Directeur général Consultant qualité règlementations européennes Master BIOTIN Management de la

Plus en détail

D après vous, à qui ces échantillons biologiques pourraient-ils appartenir? Comment va-t-on s y prendre pour procéder à leur identification?

D après vous, à qui ces échantillons biologiques pourraient-ils appartenir? Comment va-t-on s y prendre pour procéder à leur identification? TP Analyse de l ADN Sur la scène de crime, différents échantillons d origine humaine ont été retrouvés : du sang, un cheveu blond et un cheveu / poil coincé dans le couvercle du bocal de chlorure de calcium.

Plus en détail

REGULATION GLOBALE DE L EXPRESSION DES GENES

REGULATION GLOBALE DE L EXPRESSION DES GENES REGULATION GLOBALE DE L EXPRESSION DES GENES TP4 : Les puces à ADN -introduction 21 -réactifs et matériel 22 -protocoles extraction des ARN totaux de levure 23 purification des ARN messagers 24 synthèse

Plus en détail

Application à la caractérisation d actine dans du tissu de poisson

Application à la caractérisation d actine dans du tissu de poisson Séparation de protéines par électrophorèse SDS PAGE Application à la caractérisation d actine dans du tissu de poisson I-Principe 1-Principe de l électrophorèse SDS PAGE SDS PAGE = sodium dodecylsulfate

Plus en détail

L'ASSIMILATION DU NITRATE PAR LES PLANTES

L'ASSIMILATION DU NITRATE PAR LES PLANTES Université de Neuchâtel Laboratoire de Physiologie végétale Travaux pratiques de Physiologie végétale L'ASSIMILATION DU NITRATE PAR LES PLANTES En général, les plantes couvrent leur besoin en azote par

Plus en détail

Hybridation et marquage Affymetrix puce HU133 Plate-Forme. plus 2

Hybridation et marquage Affymetrix puce HU133 Plate-Forme. plus 2 PRECAUTIONS GENERALES : HYBRIDATION AFFYMETRIX - Toutes les manipulations se font avec des gants de façon à limiter le risque de dépôt de RNAses présentes en grande quantité sur notre peau. - Tout le matériel

Plus en détail

2: Les enzymes de restriction

2: Les enzymes de restriction 2: Les enzymes de restriction Les enzymes de restriction sont des protéines synthétisées par des bactéries pour se protéger des infections de virus (bactériophages). Ces enzymes coupent l ADN viral à des

Plus en détail

Guide d utilisation des kits Perfect Master Mix SYBR Green

Guide d utilisation des kits Perfect Master Mix SYBR Green Guide d utilisation des kits Perfect Master Mix SYBR Green Pour les produits AnyGenes : Cat # PMSX-F2S Cat # PMSX-F4S Cat # PMSX-F8S Cat # PMSX-F12S Cat # PMSX-F24S (* Cat # pour toutes les références

Plus en détail

Travaux pratiques d immunologie

Travaux pratiques d immunologie Travaux pratiques d immunologie I. Introduction Ces manipulations ont pour but d étudier certaines techniques immunologiques, de comprendre les mécanismes moléculaires mis en jeu dans chacune, d en tirer

Plus en détail

3: Clonage d un gène dans un plasmide

3: Clonage d un gène dans un plasmide 3: Clonage d un gène dans un plasmide Le clonage moléculaire est une des bases du génie génétique. Il consiste à insérer un fragment d'adn (dénommé insert) dans un vecteur approprié comme un plasmide par

Plus en détail

MASTER 1 TRAVAUX PRATIQUES DE MICROBIOLOGIE. UNITE D ENSEIGNEMENT DE CHIMIOTHERAPIES ANTI-INFECTIEUSES (UE-S7-5a) ANNEE 2005-2006

MASTER 1 TRAVAUX PRATIQUES DE MICROBIOLOGIE. UNITE D ENSEIGNEMENT DE CHIMIOTHERAPIES ANTI-INFECTIEUSES (UE-S7-5a) ANNEE 2005-2006 MASTER 1 TRAVAUX PRATIQUES DE MICROBIOLOGIE UNITE D ENSEIGNEMENT DE CHIMIOTHERAPIES ANTI-INFECTIEUSES (UE-S7-5a) ANNEE 2005-2006 I - CONJUGAISON - INCOMPATIBILITE PLASMIDIQUE (J1 à J6) II - CURE PLASMIDIQUE

Plus en détail

TP DE BBSG M1 (2011-2012) Production de protéines recombinantes dans Escherichia. coli Etudes structurales et fonctionnelles (C. Bordi, M-S aschtgen)

TP DE BBSG M1 (2011-2012) Production de protéines recombinantes dans Escherichia. coli Etudes structurales et fonctionnelles (C. Bordi, M-S aschtgen) TP DE BBSG M1 (2011-2012) Production de protéines recombinantes dans Escherichia. coli Etudes structurales et fonctionnelles (C. Bordi, M-S aschtgen) Introduction Le vecteur d'expression procaryote pqe31-dsred3

Plus en détail

Clonage de Vénus et transformation de E.Coli.

Clonage de Vénus et transformation de E.Coli. Clonage de Vénus et transformation de E.Coli. Samueal Joseph, Romain Laverrière, Elias Laudato, Noé Mage Assisstants : Gisele Dewhurst, Charlotte Gehin, Miwa Umebayashi Résumé [1] L expérience consiste

Plus en détail

ANALYSE DE PROTEINE DANS LES

ANALYSE DE PROTEINE DANS LES ANALYSE DE PROTEINE DANS LES CELLULES Assistants: K. Umebayashi G. Dewhurst A. Santos L. Pineau 1. Introduction Lors de cette expérience, nous avons réalisé l extraction de protéines à partir de deux souches

Plus en détail

Principales techniques utilisées en génie génétique Ces différentes techniques peuvent également se combiner entre elles. Séquençage de l ADN

Principales techniques utilisées en génie génétique Ces différentes techniques peuvent également se combiner entre elles. Séquençage de l ADN Principales techniques utilisées en génie génétique Ces différentes techniques peuvent également se combiner entre elles Séquençage de l ADN 1- Un brin complémentaire de l ADN à séquencer est fabriqué

Plus en détail

KIT REALISATION DE LA PCR A RECEPTION DU COLIS : COMPOSITION (pour 5 gels de 8 puits et 10 réactions de PCR)

KIT REALISATION DE LA PCR A RECEPTION DU COLIS : COMPOSITION (pour 5 gels de 8 puits et 10 réactions de PCR) : 0033 (0)169922672 : 0033 (0)169922674 : @ :sordalab@wanadoo.fr KIT REALISATION DE LA PCR Ref: PCRREA A RECEPTION DU COLIS : Vérifier la composition du colis indiquée ci-dessous en page 1 Stocker les

Plus en détail

Spectrophotométrie appliquée aux biomolécules

Spectrophotométrie appliquée aux biomolécules UNIVERSITE FRANCOIS RABELAIS FACULTE DES SCIENCES ET TECHNIQUES TOURS Licence L1 Science et Technologies Mention Sciences du Vivant TRAVAUX PRATIQUES: BIOCHIMIE STRUCTURALE Spectrophotométrie appliquée

Plus en détail

Les outils du génie génétique.

Les outils du génie génétique. Les outils du génie génétique. I\ Les enzymes. On va se servir des enzymes pour couper, coller et synthétiser des acides nucléiques. A\ Les polymérases. Toutes les polymérases agissent de 5 vers 3. En

Plus en détail

Examen BIO 231 : Novembre 2009 Nom: Prénom :

Examen BIO 231 : Novembre 2009 Nom: Prénom : Examen BIO 231 : Novembre 2009 Nom: Prénom : 1- On dispose de 3 cultures bactériennes d'une même souche de bacillus subtilis qui ont été obtenues par ensemencement de milieu LB à partir de 3 pré-cultures

Plus en détail

Génétique II. A) Transformation d'e.scherichia coli par l'adn plasmidique. 1- Principe :

Génétique II. A) Transformation d'e.scherichia coli par l'adn plasmidique. 1- Principe : Génétique II A) Transformation d'e.scherichia coli par l'adn plasmidique. 1- Principe : La transformation bactérienne survient dans les conditions naturelles et concerne un changement dans les caractères

Plus en détail

EPREUVE ECRITE D'ADMISSIBILITE

EPREUVE ECRITE D'ADMISSIBILITE CAPET BIOTECHNOLOGIES option biochimie - génie biologique concours interne Session 2002 EPREUVE ECRITE D'ADMISSIBILITE ETUDE SCIENTIFIQUE ET TECHNOLOGIQUE Durée : 6 heures Calculatrice interdite Aucun

Plus en détail

AGREGATION DE BIOCHIMIE GENIE BIOLOGIQUE

AGREGATION DE BIOCHIMIE GENIE BIOLOGIQUE AGREGATION DE BIOCHIMIE GENIE BIOLOGIQUE CONCOURS EXTERNE Session 2005 TRAVAUX PRATIQUES DE BIOCHIMIE PHYSIOLOGIE ALCOOL ET FOIE L éthanol, psychotrope puissant, est absorbé passivement dans l intestin

Plus en détail

TP 8 Détermination de l activité spécifique d une enzyme.

TP 8 Détermination de l activité spécifique d une enzyme. TP 8 Détermination de l activité spécifique d une enzyme. Les objectifs de cette séance : - Apprendre à faire une réaction enzymatique. - Adapter les manipulations de chimie en TP de biologie. - Savoir

Plus en détail

β-galactosidase A.2.1) à 37 C, en tampon phosphate de sodium 0,1 mol/l ph 7 plus 2-mercaptoéthanol 1 mmol/l et MgCl 2 1 mmol/l (tampon P)

β-galactosidase A.2.1) à 37 C, en tampon phosphate de sodium 0,1 mol/l ph 7 plus 2-mercaptoéthanol 1 mmol/l et MgCl 2 1 mmol/l (tampon P) bioch/enzymo/tp-betagal-initiation-michaelis.odt JF Perrin maj sept 2008-sept 2012 page 1/6 Etude de la β-galactosidase de E. Coli : mise en évidence d'un comportement Michaélien lors de l'hydrolyse du

Plus en détail

TRAVAUX PRATIQUES BIOLOGIE MOLECULAIRE BIOCHIMIE STRUCTURALE

TRAVAUX PRATIQUES BIOLOGIE MOLECULAIRE BIOCHIMIE STRUCTURALE 2007-2008 TRAVAUX PRATIQUES BIOLOGIE MOLECULAIRE BIOCHIMIE STRUCTURALE Ce TP se rapporte, en terme de connaissance, aux unités de Biologie moléculaire (BIO12) et de Biochimie (BIO4), cependant la note

Plus en détail

Biologie cellulaire. Perfectionnement à la culture cellulaire. Programme. ParTIe PraTIQUe. ParTIe THÉorIQUe. durée : 4 jours

Biologie cellulaire. Perfectionnement à la culture cellulaire. Programme. ParTIe PraTIQUe. ParTIe THÉorIQUe. durée : 4 jours Biologie cellulaire Perfectionnement à la culture cellulaire durée : 4 jours ingénieurs, chercheurs et chefs de projet connaissances de base en culture cellulaire ou validation du module «initiation à

Plus en détail

Biologie Appliquée. Dosages Immunologiques TD9 Mai 2015. Stéphanie Sigaut INSERM U1141 stephanie.sigaut@inserm.fr

Biologie Appliquée. Dosages Immunologiques TD9 Mai 2015. Stéphanie Sigaut INSERM U1141 stephanie.sigaut@inserm.fr Biologie Appliquée Dosages Immunologiques TD9 Mai 2015 Stéphanie Sigaut INSERM U1141 stephanie.sigaut@inserm.fr 1 ELISA 2 3 4 [Ac] 5 6 7 8 9 Correction : Faire la moyenne D0-1 et D0-2 pour toute les valeurs

Plus en détail

Génétique kits. Kit de précipitation de l ADN. Réf : 117 029. Français p 1. Version : 8003

Génétique kits. Kit de précipitation de l ADN. Réf : 117 029. Français p 1. Version : 8003 kits Français p 1 Kit de précipitation de l ADN Version : 8003 1 Composition Quantité nécessaire pour 25 tests. - 25 ml de solution d ADN (de saumon) à 1mg/mL (tampon Tris-HCI 0,010 M, ph 8,0 en présence

Plus en détail

TEST ELISA (ENZYME-LINKED IMMUNOSORBENT ASSEY)

TEST ELISA (ENZYME-LINKED IMMUNOSORBENT ASSEY) TEST ELISA (ENZYME-LINKED IMMUNOSORBENT ASSEY) Lise Vézina, technicienne de laboratoire Michel Lacroix, agronome-phytopathologiste Direction de l innovation scientifique et technologique Au Laboratoire

Plus en détail

TD de Biochimie 4 : Coloration.

TD de Biochimie 4 : Coloration. TD de Biochimie 4 : Coloration. Synthèse de l expérience 2 Les questions posées durant l expérience 2 Exposé sur les méthodes de coloration des molécules : Générique Spécifique Autres Questions Pourquoi

Plus en détail

Concours du second degré Rapport de jury. Session 2014 AGREGATION SECTION : BIOCHIMIE GENIE BIOLOGIQUE

Concours du second degré Rapport de jury. Session 2014 AGREGATION SECTION : BIOCHIMIE GENIE BIOLOGIQUE Secrétariat Général Direction générale des ressources humaines Sous-direction du recrutement Concours du second degré Rapport de jury Session 2014 AGREGATION SECTION : BIOCHIMIE GENIE BIOLOGIQUE Rapport

Plus en détail

Interprétation des résultats et troubleshooting

Interprétation des résultats et troubleshooting Interprétation des résultats et troubleshooting Le Service de séquençage du Centre d innovation Génome Québec et Université McGill utilise des appareils 3730xl DNA Analyzer d Applied Biosystems. Cette

Plus en détail

Approfondissement des connaissances en biologie moléculaire

Approfondissement des connaissances en biologie moléculaire Approfondissement des connaissances en biologie moléculaire nicolas.glaichenhaus@unice.fr Master IADE Année 2013-2014 Plan du cours Rappels de biologie moléculaire et de biologie cellulaire Les molécules

Plus en détail

METABOLISME DES VEGETAUX TD N 1

METABOLISME DES VEGETAUX TD N 1 METABOLISME DES VEGETAUX TD N 1 Exercice n 1 Les séquences nucléotidiques des gènes sont proches. 1 Production ATPase: On part de l'adnc de la levure pour savoir si la régulation se fait par la protéine

Plus en détail

ATELIER TECHNIQUE L'ELECTROPHORESE DES PROTEINES SUR GEL DE POLYACRYLAMIDE EN PRESENCE DE SDS (SDS PAGE) proposé par

ATELIER TECHNIQUE L'ELECTROPHORESE DES PROTEINES SUR GEL DE POLYACRYLAMIDE EN PRESENCE DE SDS (SDS PAGE) proposé par ATELIER TECHNIQUE L'ELECTROPHORESE DES PROTEINES SUR GEL DE POLYACRYLAMIDE EN PRESENCE DE SDS (SDS PAGE) proposé par La Faculté des Sciences Exactes et Naturelles (UFR SEN) (Campus de Fouillole, Pointe

Plus en détail

MICROBIOLOGIE ET GÉNIE FERMENTAIRE

MICROBIOLOGIE ET GÉNIE FERMENTAIRE Sujet zéro BREVET DE TECHNICIEN SUPÉRIEUR BIOTECHNOLOGIES MICROBIOLOGIE ET GÉNIE FERMENTAIRE Durée de l'épreuve : 2 heures Coefficient : 1 Le sujet comporte 8 pages numérotées de 1/8 à 8/8 L usage d un

Plus en détail

Thème 4 Chapitre 1 Activité 2

Thème 4 Chapitre 1 Activité 2 Thème 4 Chapitre 1 Activité 2 EXTRACTION ET ANALYSE DE L HEXOKINASE DE SACCHAROMYCES CEREVISIAE Éléments de réponse ANALYSE DES RÉSULTATS 1.1. Cela permet de faciliter la lyse alcaline de la membrane de

Plus en détail

TP ENZYMES DE RESTRICTION, OUTILS DE LA BIOLOGIE MOLECULAIRE

TP ENZYMES DE RESTRICTION, OUTILS DE LA BIOLOGIE MOLECULAIRE THÈME : Des débuts de la génétique aux enjeux actuels des biotechnologies Niveau : Spécialité terminale S TP ENZYMES DE RESTRICTION, OUTILS DE LA BIOLOGIE MOLECULAIRE EXTRAIT DU BO: Notions et contenus

Plus en détail

Lettres: A, T, G, C. Mots: à 3 lettres (codons) Phrase: gène (information pour synthétiser une protéine). Ponctuation

Lettres: A, T, G, C. Mots: à 3 lettres (codons) Phrase: gène (information pour synthétiser une protéine). Ponctuation 2- Les molécules d ADN constituent le génome 2-1 La séquence d ADN représente l information génétique Lettres: A, T, G, C Mots: à 3 lettres (codons) Phrase: gène (information pour synthétiser une protéine).

Plus en détail

Microbiologie Biologie des micro-organismes

Microbiologie Biologie des micro-organismes Microbiologie Biologie des micro-organismes 7bactéries procaryotes "avant le noyau" 2 groupes taxonomiques de procaryotes eubactries archobactries 7levures, moisissures, champignons (mycètes) 7algues 7protozoaires

Plus en détail

ECUE 2 (L 1 -S 2 ) : Microbiologie générale Microbiologie générale

ECUE 2 (L 1 -S 2 ) : Microbiologie générale Microbiologie générale Unité d enseignement UE 8 : Biologie Moléculaire - Microbiologie ECUE 2 (L 1 -S 2 ) : Microbiologie générale Microbiologie générale 1h30 de cours et 1h15 de Travaux pratiques Un examen écrit ; un examen

Plus en détail

EZRATY Benjamin Laboratoire Chimie Bactérienne, CNRS ezraty@ibsm.cnrs-mrs.fr. Cursus: 1994: Bac D. 1999: maîtrise microbiologie 2000: DEA

EZRATY Benjamin Laboratoire Chimie Bactérienne, CNRS ezraty@ibsm.cnrs-mrs.fr. Cursus: 1994: Bac D. 1999: maîtrise microbiologie 2000: DEA EZRATY Benjamin Laboratoire Chimie Bactérienne, CNRS ezraty@ibsm.cnrs-mrs.fr Cursus: 1994: Bac D 1999: maîtrise microbiologie 2000: DEA Mars 2004: thèse Avril 2004 Septembre 2005: Post-Doc Octobre 2005:

Plus en détail

Nouveau protocole Affymetrix (1 er juin 2004)

Nouveau protocole Affymetrix (1 er juin 2004) Nouveau protocole Affymetrix (1 er juin 2004) Important : pipettez toujours un volume égal ou supérieur à 2 µl. Étape 1 : préparation des ARN poly-a contrôles Quantité d ARN Dilutions en série à ajouter

Plus en détail

Licence-Master Bioinformatique Contrôle continu 06/03/06. Correction

Licence-Master Bioinformatique Contrôle continu 06/03/06. Correction Licence-Master Bioinformatique Contrôle continu 06/03/06 Correction -«Vraies» questions de cours -«fausses» questions de cours: questions pour voir si pouviez imaginer une réponse crédible qui n était

Plus en détail

Rapport de Stage d Excellence :

Rapport de Stage d Excellence : VASSEUR Julien UJF- L1 Rapport de Stage d Excellence : Caractérisation de la structure du Pilus Maître de stage : Anne-Marie Di Guilmi Directeur de Laboratoire : Thierry Vernet 1 Remerciements En premier

Plus en détail

CONCOURS EXTERNE D ACCES AU CORPS DES TECHNICIENS DE RECHERCHE ET FORMATION

CONCOURS EXTERNE D ACCES AU CORPS DES TECHNICIENS DE RECHERCHE ET FORMATION Concours Externe Technicien en SVT et Biotechnologies CONCOURS ITRF 2014 BAP A : science du vivant Biologie et recherche médicale Durée de l épreuve : 3h NUMERO DU CANDIDAT :. (Numéro indiqué sur l étiquette

Plus en détail

TD Révision BIO57. Connaissance et Technique du gène

TD Révision BIO57. Connaissance et Technique du gène TD Révision BIO57 Connaissance et Technique du gène Novembre 2007 Cécile BAUDOT cecile.baudot@medecine.univ-mrs.fr INSERM 910 «Génétique Médicale et Génomique Fonctionnelle» Maladies Neuromusculaires Le

Plus en détail

Synthèse du premier brin d ADNc

Synthèse du premier brin d ADNc Synthèse du premier brin d ADNc (1 er juin 2004) L ARN total doit avoir une concentration d au moins 2 µg/µl pour la synthèse du premier brin d ADNc. Si la concentration d ARN total est inférieure à 2

Plus en détail

RAPID Salmonella/Gélose 356-3961 356-3963 356-4705

RAPID Salmonella/Gélose 356-3961 356-3963 356-4705 356-3961 356-3963 356-4705 DOMAINE D APPLICATION La gélose RAPID Salmonella est un milieu chromogénique utilisé pour la recherche des Salmonella spp. lors de l'analyse des produits d alimentation humaine

Plus en détail

D après vous, à qui pourraient appartenir ce(s) sang(s)? Comment pourrait-on le(s) identifier?

D après vous, à qui pourraient appartenir ce(s) sang(s)? Comment pourrait-on le(s) identifier? TP Etude du sang Sur la scène de crime, nous avons retrouvé différents échantillons de sang (sur la victime, à côté d elle, sur la lame de scie, dans des tubes à essai). On se propose de déterminer la

Plus en détail

TP1 Spécificité enzymatique

TP1 Spécificité enzymatique TP1 Spécificité enzymatique L'approvisionnement en glucose commence par la digestion de macromolécules glucidiques comme l'amidon. Cette digestion s'effectue grâce à enzymes digestives. Les enzymes sont

Plus en détail

Mallette «Chromatographie sur colonne»

Mallette «Chromatographie sur colonne» 1 MATERIEL 1.1 Contenu de la mallette 1.2 Description du matériel VANNE D INJECTION COLONNE SERINGUE D INJECTION RÉSERVE D ÉLUANT POMPE MISE SOUS TENSION SÉLECTEUR DE LA GAMME DE VITESSE X1 X10 MAX RÉGLAGE

Plus en détail

AGRÉGATION DE SCIENCES DE LA VIE - SCIENCES DE LA TERRE ET DE L UNIVERS

AGRÉGATION DE SCIENCES DE LA VIE - SCIENCES DE LA TERRE ET DE L UNIVERS AGRÉGATION DE SCIENCES DE LA VIE - SCIENCES DE LA TERRE ET DE L UNIVERS CONCOURS EXTERNE ÉPREUVES D ADMISSION session 2010 TRAVAUX PRATIQUES DE CONTRE-OPTION DU SECTEUR A CANDIDATS DES SECTEURS B ET C

Plus en détail

Procédure normalisée de fonctionnement du RCBT Dérivés de tissus Extraction d ARN

Procédure normalisée de fonctionnement du RCBT Dérivés de tissus Extraction d ARN Procédure normalisée de fonctionnement du RCBT Dérivés de tissus Extraction d ARN Numéro de PNF: 08.03.009 Version: f2.0 Remplace: 8.3.009 f1.0 Catégorie: Manipulation et documentation du matériel Tissu

Plus en détail

Cours M1-2011. Introduction aux techniques de biologie moléculaire

Cours M1-2011. Introduction aux techniques de biologie moléculaire Cours M1-2011 Introduction aux techniques de biologie moléculaire ADN ARNm Protéine Expression des gènes Analyse des protéines Analyse des ARNm Expression des protéines Western-blot Immunoprécipitation

Plus en détail

Préparation d'une suspension cellulaire à partir de sang humain et d'un organe murin

Préparation d'une suspension cellulaire à partir de sang humain et d'un organe murin Préparation d'une suspension cellulaire à partir de sang humain et d'un organe murin Séparation de cellule sur coussin de Ficoll 1. Intérêt de la séparation des lymphocytes des autres éléments figurés

Plus en détail

Kits de travaux pratiques. Génétique - Biotechnologie CATALOGUE 2009-2010

Kits de travaux pratiques. Génétique - Biotechnologie CATALOGUE 2009-2010 Kits de travaux pratiques Génétique - Biotechnologie CATALOGUE 2009-2010 L École de l ADN est un centre de formation et d information sur les avancées des sciences biologiques. Sa mission principale consiste

Plus en détail

LE METABOLISME DU GLUTATHION (GSH):

LE METABOLISME DU GLUTATHION (GSH): Laboratoire de Physiologie végétale Université de Neuchâtel Travaux pratiques de Physiologie végétale 2009 LE METABOLISME DU GLUTATHION (GSH): ETUDE DES EFFETS DES ANTIDOTES DES HERBICIDES INTRODUCTION

Plus en détail

DANS LES EAUX DE DISTRIBUTION D ABIDJAN,

DANS LES EAUX DE DISTRIBUTION D ABIDJAN, RECHERCHE DE LEGIONELLA SPP. DANS LES EAUX DE DISTRIBUTION D ABIDJAN, CÔTE D IVOIRE KOUADIO K 1,OULAI A 1,4, KAKOU-NGAZOA S 2,, KALPY C 3, MANIZAN P 1,COULIBALY E 1,3, NIAMKE S 4 et DOSSO M 1,2,3. 1. Unité

Plus en détail

Comment se manifeste cette maladie? Comment repérer la séropositivité au SIDA? -> Discussion préparatoire.

Comment se manifeste cette maladie? Comment repérer la séropositivité au SIDA? -> Discussion préparatoire. I.7 Immunologie 1/4. Le SIDA Le système immunitaire est l ensemble des cellules et tissus d un individu pouvant s opposer à la pénétration et à l infection par des micro-organismes. Les moyens «de défense»

Plus en détail

Documents de travail Lycée Senghor Evreux - http://biotech.spip.ac-rouen.fr 1

Documents de travail Lycée Senghor Evreux - http://biotech.spip.ac-rouen.fr 1 T BTK AT de biotechnologies Analyses et contrôles sur le lait cru Contexte : Le lait cru, ou lait de ferme, est un lait animal (le plus souvent de vache) non transformé qui conserve donc toutes ses qualités

Plus en détail

BACCALAURÉAT TECHNOLOGIQUE

BACCALAURÉAT TECHNOLOGIQUE BACCALAURÉAT TECHNOLOGIQUE Série : STL Spécialité biotechnologies SESSION 2014 CBSV : sous épreuve coefficient 4 Biotechnologies : sous épreuve coefficient 4 Durée totale de l épreuve: 4 heures Les sujets

Plus en détail

Quelques aspects de la contraction musculaire (20 points)

Quelques aspects de la contraction musculaire (20 points) Quelques aspects de la contraction musculaire (20 points) Dispositif expérimental et principe La préparation musculaire est placée dans une cuve contenant du liquide physiologique, oxygéné grâce à un tube

Plus en détail

UFR Sciences et Techniques. Module S4B0100 Biologie Cellulaire 3-Immunologie 1

UFR Sciences et Techniques. Module S4B0100 Biologie Cellulaire 3-Immunologie 1 UFR Sciences et Techniques Licence 2 ème année BiologieBiochimie Module S4B0100 Biologie Cellulaire 3Immunologie 1 TD de Biologie Cellulaire Joelle Gaschet (joelle.gaschet@univnantes.fr) Xavier Saulquin

Plus en détail

Techniques de base de la biologie moléculaire

Techniques de base de la biologie moléculaire Techniques de base de la biologie moléculaire Présenté par : Addoun Hadjer Ait Saadi Taous Plan: Introduction Purification des acides nucléiques 1-extraction à partir de matériels biologiques 2-estimation

Plus en détail

Épreuve B (durée 3h) La membrane plasmique des globules rouges

Épreuve B (durée 3h) La membrane plasmique des globules rouges Épreuve B (durée 3h) La membrane plasmique des globules rouges Les globules rouges ou hématies sont des cellules sanguines qui contiennent l hémoglobine, et par conséquent transportent l O 2 dans le sang.

Plus en détail

Méthodes et techniques de la biologie du développement

Méthodes et techniques de la biologie du développement Méthodes et techniques de la biologie du développement 1. Etude de l expression des gènes : Détecter les transcrits et les protéines au cours de l ontogenèse l outil anticorps 1.1. La RT-PCR La réaction

Plus en détail

Université Joseph Fourier Département Licence Sciences & Technologie RAPPORT DE STAGE. Jennifer JOLIVOT

Université Joseph Fourier Département Licence Sciences & Technologie RAPPORT DE STAGE. Jennifer JOLIVOT Université Joseph Fourier Département Licence Sciences & Technologie RAPPORT DE STAGE «Les protéines impliquées dans la morphogenèse des chloroplastes.» Jennifer JOLIVOT Laboratoire d accueil : Laboratoire

Plus en détail

1 But de la manipulation

1 But de la manipulation LA DIGESTION ENZYMATIQUE La digestion consiste essentiellement en une transformation chimique que subissent les aliments ingérés sous l'action d'enzymes sécrétés par les glandes digestives. Ces phénomènes

Plus en détail

Analyses de protéines dans la levure

Analyses de protéines dans la levure Analyses de protéines dans la levure Romain Laverrière, Noé Mage, Elias Laudato, Samuel Joseph Introduction Le but de ce travail pratique est la détermination de la concentration d une sorte de protéine,

Plus en détail

TECHNIQUES BIOLOGIE MOLÉCULAIRE

TECHNIQUES BIOLOGIE MOLÉCULAIRE TECHNIQUES DE BIOLOGIE MOLÉCULAIRE Instabilité des Extrémités des Chromosomes Humains (I.E.C.H.) Institut de Génétique et Microbiologie Université Paris-Sud ORSAY et Laboratoire de Biologie et Génétique

Plus en détail

SOMMAIRE STRUCTURE D'ACCUEIL : LE CENTRE DE GENETIQUE MOLECULAIRE... 2

SOMMAIRE STRUCTURE D'ACCUEIL : LE CENTRE DE GENETIQUE MOLECULAIRE... 2 SOMMAIRE INTRODUCTION... 1 STRUCTURE D'ACCUEIL : LE CENTRE DE GENETIQUE MOLECULAIRE... 2 1.1 LE C.N.R.S... 2 1.2 LE CENTRE DE GENETIQUE MOLECULAIRE... 3 1.2.1 Historique... 3 1.2.2 Moyens financiers...

Plus en détail

Western Blot Introduction et Optimisation. Guillaume Boucher, PhD Superviseur - Support Scientifique

Western Blot Introduction et Optimisation. Guillaume Boucher, PhD Superviseur - Support Scientifique Western Blot Introduction et Optimisation 20 février 2013 Guillaume Boucher, PhD Superviseur - Support Scientifique Western Blot Qu est-ce que le Western Blot? Comment ça marche? Egalement appelé immunoblot

Plus en détail

TRAVAUX PRATIQUESDE BIOCHIMIE L1

TRAVAUX PRATIQUESDE BIOCHIMIE L1 TRAVAUX PRATIQUESDE BICHIMIE L1 PRINTEMPS 2011 Les acides aminés : chromatographie sur couche mince courbe de titrage Etude d une enzyme : la phosphatase alcaline QUELQUES RECMMANDATINS IMPRTANTES Le port

Plus en détail