Initiation la Recherche Atelier Scrtion Master de Microbiologie M1 (Biochimie et Biologie Cellulaire)

Dimension: px
Commencer à balayer dès la page:

Download "Initiation la Recherche Atelier Scrtion Master de Microbiologie M1 (Biochimie et Biologie Cellulaire)"

Transcription

1 1 Initiation la Recherche Atelier Scrtion Master de Microbiologie M1 (Biochimie et Biologie Cellulaire) Sophie Bleves, Amel Latifi, et Aurlia Battesti. Introduction Pseudomonas aeruginosa est une bactérie à Gram-négatif, pathogène opportuniste de l homme. Elle est notamment redoutée dans le milieu hospitalier (infections nosocomiales) chez les malades immunodéprimés et les grands brûlés. Cette bactérie est aussi connue pour les complications, souvent fatales, qu elle entraîne chez les patients atteints de mucoviscidose. Sa virulence est multifactorielle: elle est liée d une part à des facteurs associés aux bactéries, tels que le flagelle, les pili ou l alginate (un exopolysacharide muqueux), ou à la sécrétion de diverses toxines et enzymes dégradatives dans le milieu extracellulaire. Figure 1 : Les facteurs de virulence de P. aeruginosa * r ésistance AB pompes efflux* Alginate (biofilm*, adh ésine, antiphagocytose anticompl ément) * * Sécrétion d'enzymes dégradatives et de toxines pigments fluorescents Squestration du fer Flagelle (mobilit, biofilm) Pili (mobilité, adhésion,biofilm)

2 2 La sécrétion chez les bactéries à Gram-négatif implique pour les protéines à sécréter (exoprotéines) la traversée de deux membranes (interne et externe) et d un compartiment aqueux, le périplasme. Cinq voies principales de sécrétion sont conservées au sein des bactéries à Gram-négatif et vous ont été détaillées en cours. Quatre d entre elles sont présentes chez P. aeruginosa (figure 2), cette caractéristique en faisant un modèle particulièrement intéressant pour l étude des mécanismes de sécrétion. Voie Gnrale de Scrtion Type II Elastase ( LasB) Exotoxine A Protase Las A Phospholipases Lipase Phosphatase alcaline Transporteur ABC Type I Protase alcaline, HasAp, AprX Type III Contact dpendant Exoenzymes S, T, U, Y Membrane plasmique cellule eucaryote cible AprF Membrane externe Xcp AprE Psc Périplasme Sec Tat AprD Membrane interne Cytoplasme Mcanismes Sec-indpendants Figure 2 : Schma de 3 voies de scrtion prsentes chez P. aeruginosa. NB la voie de scrtion de type V n est pas prsente La machinerie de sécrétion de type II est composée de 12 protéines Xcp (extracellular protein deficient) qui s associeraient en un complexe multiprotéique reliant les deux membranes. Elle est nécessaire entre autre à la sécrétion de l élastase qui se déroule en deux étapes : traversée de la membrane interne par la voie Sec ou la voie Tat (selon les exoprotéines), puis traversée de la membrane externe par la voie Xcp. Les 12 gènes xcp sont organisés sur un même locus, en deux opérons divergents, xcppq, et xcpr-z, alors que les gènes codant pour les protéines sécrétées sont à différents loci du chromosome. Les protéines

3 3 XcpT, U, V, W et X sont appelées pseudopilines, de part leur homologie avec la piline des pili de type IV, et s assemblent pour former un pseudopilus transmembranaire. La machinerie de sécrétion de type I est la plus simple et comprend 3 protéines Apr (alkaline protease). Elle permet notamment la sécrétion en une étape de la protéase alcaline. Le gène structural de celle-ci (apra) appartient à l opéron arpa-f qui code aussi pour les composants de la machinerie de sécrétion. Enfin la machinerie de sécrétion de type III se compose d une trentaine de protéines Psc (Pseudomonas secretion component), qui forment un conduit permettant le transport des protéines à sécréter directement du cytoplasme bactérien dans le cytosol de la cellule eucaryote cible. In vivo c est le contact avec la cellule cible qui induit l expression des gènes psc et des gènes exos, T, U, et Y codant pour les effecteurs. ExoU est associée à une chaperonne cytoplasmique. Un activateur transcriptionnel de la famille AraC, appelé ExsA, est requis pour l activation du régulon de type III. Cet atelier a pour but d initier les tudiants aux techniques classiques des laboratoires tudiant les mcanismes de scrtion et de leur rgulation, en plus des techniques de base de microbiologie molculaire. Quels sont les objectifs de cet atelier? Partie A Nous allons chercher à déterminer s il existe un quelconque lien, ou «cross-talk», entre les différentes machineries de sécrétion présentes chez P. aeruginosa. Aucune donnée n a jamais été publiée à ce sujet chez P. aeruginosa, mais quelques exemples sont décrits dans la littérature chez d autres bactéries. Nous avons choisi de vous limiter aux machineries de type I et II, et souhaitons que vous abordiez cette question à deux niveaux : - phnotype de la scrtion: une voie de sécrétion influence-t-elle la sécrétion des exoprotéines transitant par une autre voie de sécrétion? - rgulation de l expression des gnes: si le «cross-talk» existe, à quel niveau se situe-t-il? Nous vous demandons d envisager les manipulations que vous entreprendriez pour rpondre ces questions. Dans les annexes, vous trouverez un tableau récapitulatif des souches bactériennes (sauvage et mutantes), des plasmides, des oligonucléotides et des anticorps dont vous disposez, ainsi que d un panel de techniques. Parallèlement à cette étude, vous allez vérifier le génotype d une des souches que vous aurez utilisées lors de cette partie (voir annexe). Partie B Nous étudierons plus particulièrement une protéine, XcpY, qui est un composant de la membrane interne de la machinerie de sécrétion de type II.

4 4 Par une analyse bio-informatique de sa séquence, vous obtiendrez toutes les prédictions de topologie la présentant comme une protéine de membrane interne : nombre de segments transmembranaires (certains et putatifs), orientations possibles du polypeptide (extrémité N-terminale dans le cytoplasme ou dans le périplasme). Ces prédictions de topologies seront confirmées par une approche in vivo qui consiste à étudier le phénotype de fusions traductionnelles de XcpY avec des enzymes rapporteurs (voir le principe en annexe). Vous étudierez l interaction de XcpY avec une autre protéine de membrane interne de la machinerie, XcpZ. Pour ce faire, vous disposerez d un plasmide (pgm ) qui porte le gène codant pour XcpY et un gène codant une forme étiquetée 6 His de XcpZ. Comment pourriez-vous mettre en vidence l interaction entre ces 2 protines grce ce plasmide? Quelles seront les diffrentes tapes de cette exprience? Consultez les annexes pour vous aider, et ne perdez pas de vue qu il s agit de protéines membranaires. Partie C Nous étudierons la production par Pseudomonas aeruginosa de facteurs de virulence autres que ceux sécrétés ( shearing -rasage- d appendices extracellulaires, adhsion sur support inerte, mobilit swiming et twitching-). Programme Lun20/02 M Mar21/02 M Mer22/02 Jeu23/02 Ven24/02 M+ Lun27/02 M SB SB AB AL SB SB SB SB 1 re confrence Tutorat (binme 1-14h-, 2-15h-,3-16h-) Introduction au FIL ROUGE Prparations (milieux, tampons et autres solutions) Bactries comptentes et transformation Prparation de plasmides (lyse alcaline) Comparaison des protocoles lyse alcaline et semi-boiling Prparation de protines scrtes Montage SDS-PAGE Fin prparation chantillons protiques, Electrophorse, Transfert Conjugaison Carte restriction (salle TD) 2 me confrence Analyse topologie XcpY (salle Info)

5 5 Mar28/02 M+ Mer01/03 M Jeu02/03 M (CNRS) Ven03/03 Lun06/03 M Mar07/03 M Mer08/03 M Jeu09/03 M Ven10/03 Lun13/03 M Jeu16/03 M Ven17/03 M+ SB AB AL SB AL AB AL AL AL SB AB AL AL AL ALSB Immunodtection, Analyse restriction, Electrophorse ADN Croissance (prparation cellules pour interaction XcpZ-Y) Bio-Informatique Type III- (salle Info) Prparations (milieux, tampons et autres solutions) Protocoles (salle TD) Sonication, Solubilisation dtergent, Colonne affinit(interaction XcpZ-Y) Prlvements chantillons (dosage galactosidase) PCR sur colonies, Electrophorse ADN 3 me confrence RT-PCR (salle TD) Prparation ARN SDS-PAGE & Coomassie (interaction XcpZ-Y), Dosages protiques et galactosidase FIL ROUGE Travail thorique FIL ROUGE Botes swiming twithching, test adhsion, shearing RT-PCR, Electrophorse ADN, test adhsion (lecture 6h) Test adhsion (lecture ON), SDS-PAGE & Western-Blot ( lecture botes, photos ME 4 me confrence Bilan final (salle TD) ECRIT Comptes-rendus rendre ORAL Shearing), AB : Aurlia Battesti ) SB : Sophie Bleves ) AL : Amel Latifi

6 6 Annexes Souches bactriennes P. aeruginosa PAO1 PAO1 xcpy PAO1 apre PAO1 xcpyz PAO1 flic PAO1 pila PAK pila flic E. coli DH5 Plasmides AB pgm ped psb4 psb52 psb3 pplasb ppapr ppxcp prk2013 Ap, Cb Ap, Cb Ap Ap Km Ap, Cb Tc Tc Km Anticorps polyclonaux (de lapins) Caractristiques Sauvage Délétion du gène xcpy dans la souche PAO1 Insertion Tn dans le gène apre de la souche PAO1 Délétion des gènes xcpz et xcpy dans souche PAO1 Délétion du gène flic codant pour la flagelline non flagélée Délétion du gène pila codant pour la piline des pili de type IV non piliée Mutations ponctuelles dans les gènes pila et flic dans la souche PAK F-, f80dlaczdm15, D(lacZYA-argF)U169, deor, reca1, enda1, hsdr17(rk-, mk+), phoa, supe44, l-, thi-1, gyra96, rela1 Production forme étiquetée de XcpZ 6His et XcpY (expression à partir ptac) Surproduction pseudopiline XcpT (expression à partir ptac) Fusion traductionnelle XcpY avec la phosphatase alcaline au résidu 232 Fusion traductionnelle XcpY avec la phosphatase alcaline au résidu 278 Fusion traductionnelle XcpY avec la -lactamase au résidu 363 Fusion transcriptionnelle promoteur lasb-lacz(lasb code pour l élastase) Fusion transcriptionnelle promoteur apradef-lacz Fusion transcriptionnelle promoteur xcpr-z-lacz Plasmide mobilisateur Anti élastase, Anti protéase alcaline, Anti XcpT, Anti XcpY, Anti 6 His Oligonuclotides lasb amont lasb aval rpoa amont rpoa aval L1 L2 R1 R2 5 TGGCGGCCACGAGGTCA 3 5 TTACAACGCGCTCGGGC 3 5 CATCGTTCAGCCCGGTC 3 5 AGGCAGTGGCCTTGTCGT 3 5 GAGAGGGCCCTAGGAGGTTGA3 5 CGCCTGCTGAAATTGTCGGAAG3 5 CCCTGCCCGTTCAACTGCTCCA3 5 TATACCCGGGACTCCACTCA3

7 7 Protocoles exprimentaux Croissances bactriennes Milieux de culture: P. aeruginosa est cultivé en milieu PIA (Pseudomonas Isolation Agar) ou milieu riche LB (Luria broth) supplémenté en cas de besoin par les antibiotiques suivants : carbénicilline (Cb) 500 g /ml, tétracycline (Tc) 200 g/ml. En milieu liquide, la Cb est utilisée à 300 g/ml, et la Tc à 50 g/ml.. E. coli est cultivée en milieu riche LB supplémenté en cas de besoin par les antibiotiques suivants : ampicilline (Ap) 50 g /ml, tétracycline (Tc) 15 g/ml, kanamycine (Km) 25 g /ml. Milieux d identification: A/ L lastase et la protase alcaline sont deux protéases, et leur activité enzymatique peut être mise en évidence sur deux types de boîtes, contenant de la caséine (boîte au lait ou skim-milk) ou de l élastine. L élastase utilise comme substrats l élastine et la caséine alors que la protéase alcaline n utilise que la caséine. Ces activités se traduisent par un halot d hydrolyse autour des colonies de Pseudomonas après 24 à 48h de croissance à 37 C. B/ Botes mobilit swiming (flagelle) et twitching (pili de type IV) Milieu LB semi-solide à 0.3% d agar (swiming). Milieu agar (1,5%) innoculé au cure-dent en traversant la gélose, puis coloration au cristal violet (twitching). C/ Botes activit phosphatase alcaline Milieu LB supplémenté de BCIP (5-bromo-4-chloro-3-indolyl phosphate) à 0,4mg/ml.

8 8 Techniques de gntique Transformation voir Fascicule principes techniques Conjugaison 3 partenaires _ - Déposer sur une boîte LB sans antibiotiques, 10 l de la souche donnatrice et de la souche mobilisatrice NB Penser à réaliser tous les témoins Incuber 2h à 37 C (1 er contact= mobilisation) - Mettre la souche réceptrice pendant ces 2h à 42 C (inhibition des systèmes de restrictionmodification de l ADN) - Rajouter alors 10 l de la souche réceptrice Incuber au moins 4h à 37 C (2 ème contact) - Resuspendre le «patch» de bactéries dans 500 l de LB Etaler 200 l sur milieu sélectif PIA + antibiotiques et incuber O/N à 37 C NB1 les conjugants peuvent n apparaître qu après 24 à 48h. NB2 Réisoler les conjugants sur LB +antibiotiques, le milieu PIA n étant utilisé que pour la sélection des Pseudomonas.

9 9 Techniques de biochimie Prparation de protines scrtes - prendre la DO 600 des cultures de nuit * DO 600 inoculum de nuit quoi faut-il penser? - ensemencer 50 ml de milieu LB à une DO 600 initiale de 0,1 - incuber à 37 C sous agitation - prendre la DO 600 de chaque culture après une heure, puis suivre la croissance toutes les 30 minutes pendant la phase exponentielle de croissance puis toutes les heures jusqu à DO 600 = 4 Prélever et transvaser dans un eppendorf de 1,5 ml, 1 ml de culture à DO 600 1, 2 et 4 * tracer au fur et mesure sur papier semi-logarithmique la DO 600 en fonction du temps pour chaque souche - centrifugation de chaque prélèvement (10, 8000RPM) inutile de manipuler stérilement * le surnageant de culture contenant les protéines sécrétées est soigneusement transvasé dans un nouvel eppendorf, placé dans la glace puis 150 l de TCA 75% (acide trichloroacétique) sont ajoutés pour précipiter les protéines toute la nuit (ON) à 4 C * le culot cellulaire est repris à 1 U DO 600 par 50 l de tampon de charge SDS-PAGE puis conservé à 20 C (= C) - centrifuger les surnageants de culture que vous avez précipité ON à 4 C (30, 13000RPM), le surnageant est éliminé et le culot est lavé par 1 ml d acétone 90% - centrifugation (10, 13000RPM), éliminer tout l acétone et évaporer le reste d acétone en laissant les eppendorfs ouverts 5 min à 37 C. - le culot est repris à 1 U DO 600 par 10 l de tampon de charge SDS-PAGE (= SN) - dénaturer tous vos échantillons (C et SN) pendant 8 au bain marie bouillant * fermer soigneusement vos eppendorfs et veiller ce qu ils ne se remplissent pas d eau du Bain Marie! NB les centrifuger 5 secondes avant de les charger SDS-PAGE (Mini ProteanIII Biorad-) - monter le système (présenté dans le fascicule de principes techniques) - délimiter par un trait de marqueur la hauteur du gel de séparation ( 5 cm) * vrifier que le systme ne fuit pas en ralisant un essai avec de l eau Tant que l acrylamide n a pas polymris, il est toxique : MANIPULER AVEC DES GANTS - préparer dans 2 béchers (volume pour 2 gels)

10 10 gel de séparation (10%) gel de séparation (12%) gel de concentration Acrylamide 30% 6,6 ml 8 ml 0,8 ml H 2 0 8,4 ml 7 ml 4,8 ml Lower Tris 5 ml 5 ml Upper Tris 2 ml - QUAND VOUS ETES PRETS A COULER LE GEL de sparation ajouter 800 l d APS 1% et 25 l de TEMED dans le bcher correspondant, mélanger doucement et couler le gel à la pipette Pasteur jusqu au trait et vérifier le niveau (la surface doit être horizontale). Déposer délicatement à l aide d une pipette Pasteur de l eau distillée à la surface du gel. - quand le gel a polymérisé (vérifier avec ce qu il reste dans le bécher), éliminer l eau en retournant le système - ajouter 400 l d APS 1% et 8 l de TEMED dans le bécher du gel de concentration, mélanger doucement et couler le gel à la pipette Pasteur. Mettre immédiatement les peignes en évitant autant que possible de faire des bulles. - monter la chambre d électrophorèse, la placer dans la cuve et remplir les 2 compartiments de tampon d électrophorèse - enlever délicatement le peigne - charger la gamme étalon protéine, la protéase alcaline et l élastase pures, ainsi que l équivalent de 0,2 U DO 600 de cellules (C) et de 1 U DO 600 surnageant (SN) - appliquer 80V par système pour le gel de concentration, puis migrer à 150V - suivre la migration par l avancée du front du bleu et l arrêter avant qu il ne sorte ( 1h30) Tampon de charge SDS-PAGE : 2% SDS, 10% glycérol, 5% -mercapthoéthanol, 62,5mM Tris-HCl, ph 6,8, bout de spatule de BBP (Bromophénol Blue) Lower Tris : 1,5M Tris-HCl, 0,4% SDS, ph 8,8 Upper Tris : 0,5M Tris-HCl, 0,4% SDS, ph 6,8 Tampon d électrophorèse : 250mM Tris, 1,9M Glycine, 35mM SDS Western-blot - placer le gel dans du tampon de transfert ainsi qu un feuille de nitrocellulose et 6 feuilles de papier Whatman

11 11 - mettre dans l ordre sur la plaque de l appareil à blot (transfert semi-sec) en prenant soin d éliminer les bulles (en faisant rouler une pipette) : 3 feuilles de papier Whatman, la membrane de nitrocellulose, le gel, et enfin encore 3 feuilles de papier Whatman (voir schéma) * ne jamais toucher la feuille de nitrocellulose avec ses doigts --> des pinces mtalliques sont votre disposition 3 feuilles de papier Whatman le gel (attention aux bulles) la nitrocellulose 3 feuilles de papier Whatman Plaque appareil à blot - fermer le capot de l appareil à blot - transférer 35 min en se plaçant à 15 V limitant - quand le transfert est terminé, placer la feuille de nitrocellulose dans un bain de rouge ponceau (coloration temporaire des protéines), puis la transférer immédiatement dans un bain d eau. Agiter doucement, les protéines apparaissent en rouge. Quand la gamme étalon se détecte bien, repasser au stylo à bille les différentes bandes (94, 67, 43, 30, 20 et 14 kda), faire un point au niveau de la protéase alcaline (48 kda) ou de l élastase (30 kda) purifiée, puis venir me voir pour découper la membrane. Conserver les 2 morceaux de nitrocellulose dans du papier d aluminium à 4 C après décoloration totale dans de l eau. - immunodétection : incuber la membrane de nitrocellulose sous agitation - 30 min en TBS lait 5% Tween 20 0,1% - 1h30 en TBS lait 5% Tween 20 0,1% contenant soit Ac élastase (1/500), soit protéase alcaline (1/1000), XcpT (1/1000). - 3 lavages de 5 min en TBS Tween 20 0,1% - 1h en TBS lait 5% Tween 20 0,1% contenant Ac secondaire anti IgG de lapins marqué à la phosphatase alcaline (1/5000) - 3 lavages de 5 min en TBS Tween 20 0,1% - Placer la membrane dans 5 ml du kit de détection de l activité phosphatase alcaline (Western Blue( Stabilized substrate for alkaline phophatase Promega-). Agiter et laisser la coloration se développer et l arrêter en plaçant la membrane dans de l eau. La sécher dans du papier absorbant. Tampon de transfert : 48mM Tris, 40mM Glycine, 20% Et-OH TBS (10x) : 0,5M Tris-HCl, 1,5M NaCl, ph8

12 12 Coloration des gels de protines au bleu de Coomassie: Tampon de coloration Bleu de Coomassie 0.25% Ethanol Acide acétique H2O QSP 1 g 125ml 40ml 500ml Tampon de Décoloration 250ml d éthanol et 80ml d acide acétique, H2O QSP 1 litre. Solubilisation de protines de membrane interne - prendre la DO 600 des cultures de nuit - ensemencer 50 ml de milieu LB +AB à une DO 600 initiale de 0,1 - incuber à 37 C sous agitation - à DO 600 = 0,5-0,6 ajouter de l IPTG 2mM - incuber à 37 C pendant 3h 45 ml de culture (10, 5000RPM) - culot repris dans 6 ml de tampon NaPi + 60 l inhibiteur de protéases (campus J. Aiguier) - sonication 5X15 arrêts de 45 en glace 6 ml, 10, 3000RPM (élimination des débris cellulaires et bactéries non cassées) surnageant, 30, RPM campus J. Aiguier) NB culot de membranes totales est orangé culot repris dans 1,5 ml de tampon NaPi + DM (n-dodecyl-_-d-maltoside) 1% 30 en glace ajouter 375 l glycérol 30, RPM campus J. Aiguier) les protéines de membrane interne solubilisées se retrouvent dans le surnageant NB culot de membrane externe est translucide Tampon NaPi: NaH 2 PO 4 50mM, ph8 (ajuster avec NaOH) Purification de protines tiquette 6 His 1. Rincer la colonne avec 5 ml d H 2 O 2. Charger 0.5ml de 0.1M NiSO 4 3. Rincer avec 5ml d H 2 O 4. Rincer avec 10ml de tampon A 5. Passer l échantillon (Solubilisation de protines de membrane interne) 11. Rincer avec 10 ml de Buffer A + 50mM Imidazole

13 Elution : 1ml Buffer A + 100mM Imidazole 1ml Buffer A + 200mM Imidazole 1ml Buffer A + 300mM Imidazole 1ml tampon A + 400mM Imidazole 1ml tampon A +500mM Imidazole 13. Dosage des protéines et analyse sur gel SDS-PAGE (12%) du contenu de chaque fraction. Tampon A : 0.02M de tampon phosphate Na 2 HPO 4, 0.5M NaCl, glycérol 10%, ph 7.4. Dosage des protines totales Mthode Lowry: voir Fascicule de principes techniques Mthode Bradford: Gamme talon : Diluer 40 l d albumine bovine (BSA) 10mg/ml dans 960 l d H 2 O soit solution à 400 g/ml Faire la gamme (5 6 points ) dans les cuvettes : 200 l de BSA, 600 l d H 2 O et 200 l de réactif Bradford Mlanger 800 l d chantillon et 200 l de ractif Bradford. Incuber 5minutes temprature ambiante. Lire la densit optique 595. Penser raliser une courbe talon avec la BSA (albumine bovine). Dosage de la -galactosidase: Voir Fascicule de principes techniques pour connaître le principe 0.1ml de culture est dilu dans 0.9ml de tampon Z plus Mercaptothanol (27 l de Mercaptothanol pour 10 ml de tampon Z) plus deux gouttes de chloroforme et une goutte de SDS 0,1%. Vortexer 2 min, et placer dans un bain 28 C Incuber 10 minutes 28 C Prendre la DO 600 des cellules 0.2ml d ONPG (4mg/ml) est ajout pour dbuter la raction, le temps est alors not. Lorsque la couleur devient jaune, la raction est stoppe par adjonction de 0.5ml de Na 2 CO 3 1M. Le temps auquel le Na 2 CO 3 est ajout est not. La DO 420 est dtermine. Si le mlange est trouble, centrifuger au pralable afin d liminer les dbris cellulaires. NB Tmoins raliser?

14 14 L activit galactosidase est calcule partir de l quation suivante : Units Miller = (DO 420 *1000) / (t* v * DO 600 ) T = Temps coul entre l addition ONPG et addition de Na 2 CO 3 en min V = volume des cellules utilises en ml Tampon Z (ph7) 60mM Na 2 HPO 4 40mM NaH 2 PO 4 Conserver 4 C 10mM KCl 1mM MgSO 4 7H 2 O Na 2 CO 3 1M ONPG 4mg/ml prparer extemporanment en tampon phosphate 0.1M, ph 7,4 Tampon phosphate 0.1M ph 7,4 : 77,4 ml de Na 2 HPO4 1M et 22.6ml de NaH 2 PO4 1M, qsp 1 litre avec H 2 O distille.

15 15 Techniques de biologie molculaire Miniprparation lyse alcaline Centrifuger 1,5 ml de culture O/N Resuspendre le culot dans 100 l de Solution I Ajouter 200 l de Solution II vortexer brièvement et incuber 5 minutes à température ambiante Ajouter 150 l de Solution III, Vortexer Centrifuger 5 minutes Précipiter le surnageant par 270 l (0.6 vol) d isopropanol, vortexer Centrifuger 10 minutes Rincer le culot par 500 l d éthanol 70% Centrifuger 5 min éliminer le surnageant, laisser sécher 5-10 minutes et resuspendre dans 25 à 50 l d eau plus Rnase (1mg/ml) Solution I : 50mM glucose, 25mM Tris ph8, 10mM EDTA Solution II : 0.2N NaOH, 1%SDS Solution III : 2.55M KAcetate, ph 4.8 Miniprparation semi boiling Centrifuger 1,5 ml de culture O/N Resuspendre le culot dans 1ml de STET + 2 l RNase (1mg/ml préalablement bouillie) + 20 l Lysozyme (20mg/ml) Mettre les tubes à 95 C 7min Les remettre immédiatement en glace min, 13000RPM Enlever le culot (visqueux) au cure-dents Incuber 15 min à 37 C (action RNase) Ajouter 0,4ml AcNH4, 5M, ph5,5 et 0,9ml Isopropanol Mélanger par retournements min, 13000tr/min Eliminer le surngeant Laver avec 500 l Et-OH 70% min, 13000RPM Eliminer le surnageant et laisser sécher 5-10min, et resuspendre dans 20 à 50 l H 2 O

16 16 STET : Tris-HCl 0,1M, ph8, EDTA 50mM, sucrose 8%, Triton X100 0,5% Prparation d ARN NB : La lyse sera adaptée à Pseudomonas 3. Add 350 l Buffer RLT to the sample. Mix thoroughly by vortexing vigorously. If insoluble material is visible, centrifuge for 2 min in a microcentrifuge at maximum speed, and use only the supernatant in subsequent steps. If more than 5 x 108 bacteria are processed, additional homogenization with a QIAshredder homogenizer or a syringe and needle may increase RNA yield (see pages 20 24). Note: Ensure that ME is added to Buffer RLT before use (see Important notes before starting ). 4. Add 250 l ethanol (96 100%) to the lysate. Mix thoroughly by pipetting. Do not centrifuge. A precipitate may form after the addition of ethanol, but this will not affect the RNeasy procedure. 5. Apply the sample (usually 700 l), including any precipitate that may have formed, to an RNeasy mini column placed in a 2 ml collection tube (supplied). Close the tube gently, and centrifuge for 15 s at 8000 x g ( 10,000 rpm). Discard the flow-through. Reuse the collection tube in step 6. If the volume exceeds 700 l, load aliquots successively onto the RNeasy column, and centrifuge as above. Discard the flow-through after each centrifugation step.* 6. Add 700 l Buffer RW1 to the RNeasy column. Close the tube gently, and centrifuge for 15 s at 8000 x g ( 10,000 rpm) to wash the column. Discard the flow-through and collection tube.* Skip this step if performing the optional on-column DNase digestion (page 99). 7. Transfer the RNeasy column into a new 2 ml collection tube (supplied). Pipet 500 l Buffer RPE onto the RNeasy column. Close the tube gently, and centrifuge for 15 s at 8000 x g ( 10,000 rpm) to wash the column. Discard the flow-through. Reuse the collection tube in step 8. Note: Buffer RPE is supplied as a concentrate. Ensure that ethanol is added to Buffer RPE before use (see Important notes before starting ). 8. Add another 500 l Buffer RPE to the RNeasy column. Close the tube gently, and centrifuge for 2 min at 8000 x g ( 10,000 rpm) to dry the RNeasy silica-gel membrane. Continue directly with step 9, or, to eliminate any chance of possible Buffer RPE carryover, continue first with step 8a. It is important to dry the RNeasy silica-gel membrane since residual ethanol may interfere with downstream reactions. This centrifugation ensures that no ethanol is carried over during elution. Note: Following the centrifugation, remove the RNeasy mini column from the collection tube carefully so the column does not contact the flow-through as this will result in carryover of ethanol. 8a. Optional: Place the RNeasy column in a new 2 ml collection tube (not supplied), and

17 17 discard the old collection tube with the flow-through. Centrifuge in a microcentrifuge at full speed for 1 min. 9. To elute, transfer the RNeasy column to a new 1.5 ml collection tube (supplied). Pipet l RNase-free water directly onto the RNeasy silica-gel membrane. Close the tube gently, and centrifuge for 1 min at 8000 x g ( 10,000 rpm) to elute. Electrophorse d ADN - préparer un gel d'agarose 0,7% en TBE 0,5X faire bouillir au micro-ondes (salle de pesée) Laisser refroidir et ajouter une goutte de bromure d' éthydium (Bet) (0,625mg.ml -1 ) par 50ml de gel préparés * porter des gants: le Bet est mutagne chez les bactries et est souponn d tre cancrigne chez l homme Mettre les peignes et couler dans le support - rajouter 5 l de tampon de charge ADN dans chaque tube et charger 15 l de chaque échantillon sur le gel d'agarose Déposer 5 l de marqueur de taille (Smart ladder, Eurogentec) Tampon de charge ADN: 30% glycérol, 0,25% bleu de bromophénol, 0,25% - mercaptoéthanol TBE 20x 1,8M Tris, 40mM EDTA, 1,8M Acide Borique Vrification par PCR du gnotype d une souche La souche mutante de sécrétion de type II (PAO1 xcpy) utilisée lors de ce stage porte une délétion complète du gène xcpy, ce que vous allez vérifier par PCR avec les couples d'oligonucléotides appropriés sur colonies. L2 2,1kb R2 L1 1,4kb R1 xcpx xcpy XcpZ

18 18 Lyse des bactries - reprendre une colonie de PAOI ou PAO1 xcpy (une souche par groupe) dans100 l d'h 2 O et lyser les bactéries comme suit: 15' à -20 C, puis décongeler à 37 C, 15' à -20 C et 10' à 95 C (attention ce que l eau ne pntre pas dans les tubes!) centrifuger 5'' les échantillons PCR - préparer les mélanges réactionnels suivants dans des eppendorfs PCR sur la glace en ajoutant l enzyme quand tous les groupes sont prts lancer la PCR 5 l d'adn (bactéries lysées, PAOI ou PAO1 xcpy ) + oligonucléotide R1 ou R2 (20 pmol à partir solution à10pmol/ l) + oligonucléotide L1 ou L2 (20 pmol à partir solution à 10pmol/ l) + dntp (1mM final à partir solution 10mM) + tampon ADN polymérase (1X final) + MgCl 2 (1X final) + 1 l DMSO (limiter les structures secondaires ADN) H2O qsp 20 l +0,2 l ADN polymérase thermostable (Taq polymérase, 5U/ l) - programmation de l'appareil PCR ( 3h) 95 C 7' 95 C 1' 55 C 1' 30 cycles 72 C 1'30 72 C 10' Techniques de RT-PCR semi-quantitatives NB: Toutes les manipulations doivent tre ralises dans des tubes dpourvues de RNases 1/ Dcontamination la DNase : Pour chaque raction, raliser le mlange suivant : 1 g d ARN + 1 l de tampon DNase 10X + 1 l de DNase + 1 l d inhibiteurs de Rnases, H 2 O QSP 10 l.

19 19 Incuber minutes temprature ambiante. Inactiver la DNase par ajout de 1 l d EDTA 25mM. 2/ Raction de RT-PCR (en une tape) Pour chaque raction, raliser le mlange suivant : 25 l de tampon 2X + 1 g d ARN + 3 l du mlange des 2 amorces (10mM) + 1 l d enzyme + 1ml d inhibiteur de RNases QSP 50 l. Lancer le programme adquat. NB: Penser faire une raction dans les mmes conditions avec la polymrase afin de vrifier la non contamination avec de l ADN. Exemple de programmes Un cycle : 45 minutes 50 C (ceci correspond la raction de reverse transcription) 2 minutes 94 C Trente cinq cycles : 30 secondes 94 C 45 secondes 50 C 1 minute 70 C Un cycle : 5 minutes 72 C Taq NB: Rflchir aux cycles au quels devront tre faits les prlvements. Chaque prélèvement est analysé en chargeant 10_l de réaction plus 5 _l de tampon de charge ADN sur gel d agarose 1,5% en TBE 0,5X.

20 20 Test d adhrence en plaque polystyrne 24 puits - Remplir chaque puits par 1 ml de LB - A partir d une cultutre O/N en LB+/- antibiotique, inoculer chaque puits à 0,2 UDO 600 /ml (Penser à faire plusieurs puits pour une même souche : Contrôle DO 600 ; et à garder un puits sans bactérie : Contrôle négatif de contamination) - Incuber à 30 C, sans agitation, le temps voulu - Révéler en ajoutant 100µl de Crystal Violet (1X) dans chaque puits, sauf pour celui qui sert à mesurer le DO Laisser agir 10 à 15 min - Enlever le Crystal violet à l aide d une pipette non stérile - Rincer 2 fois à l H 2 0 sans toucher les parois - L anneau d adhérence violet s observe à l interface air-liquide - Quantification : Resuspendre l anneau avec 400µl d éthanol 95% ; Compléter avec 600µL d H 2 0!!!! et lire la DO à 600 nm Rasage (Shearing) " - Etaler les bactéries sur boîtes de Pétri carrées (LB +AB + IPTG frais 2mM) ON à 37 C - Re-suspendre les bactéries dans 1,8ml de LB, MgCl2 10mM NB DO 600 entre 5 et 10 - Les passer 3 fois dans une seringue équipée d une aiguille 19G RPM (centri eppendorf) - Récuperer 1,5ml de surnageant RPM - Récuperer 1,4ml de surnageant RPM - Récuperer 1,2ml de surnageant - Précipiter 1h dans la glace TCA (10% final) RPM - Laver le culot / 500 l acétone 90% RPM - sécher le culot à 37 C et resuspendre à 2UDO 600 /" l de SDS-PAGe loading buffer - 1U DO 600 sur gel Prdiction de la topologie d une protine transmembranaire, XcpY Les protéines intégrales de la membrane interne sont ancrées dans celle-ci par des segments d une vingtaine de résidus, dont la structure secondaire correspond à des hélices # hydrophobes. Une protéine possédant un segment transmembranaire est dite bitopique. Une

METHODES DE SEPARATION DE PROTEINES : PURIFICATION DE LA GST PAR AFFINITE AU GLUTATHION

METHODES DE SEPARATION DE PROTEINES : PURIFICATION DE LA GST PAR AFFINITE AU GLUTATHION Laboratoire de Physiologie Végétale Université de Neuchâtel (2005) Travaux pratiques METHODES DE SEPARATION DE PROTEINES : PURIFICATION DE LA PAR AFFINITE AU GLUTATHION INTRODUCTION: Les protéines tiennent

Plus en détail

Biochimie I. Extraction et quantification de l hexokinase dans Saccharomyces cerevisiae 1. Assistants : Tatjana Schwabe Marcy Taylor Gisèle Dewhurst

Biochimie I. Extraction et quantification de l hexokinase dans Saccharomyces cerevisiae 1. Assistants : Tatjana Schwabe Marcy Taylor Gisèle Dewhurst Biochimie I Extraction et quantification de l hexokinase dans Saccharomyces cerevisiae 1 Daniel Abegg Sarah Bayat Alexandra Belfanti Assistants : Tatjana Schwabe Marcy Taylor Gisèle Dewhurst Laboratoire

Plus en détail

POLASZEK André juin 2012. Rapport de stage La localisation intracellulaire des différents domaines de TPPP/p25 humaine

POLASZEK André juin 2012. Rapport de stage La localisation intracellulaire des différents domaines de TPPP/p25 humaine POLASZEK André juin 2012 Rapport de stage La localisation intracellulaire des différents domaines de TPPP/p25 humaine Sommaire RAPPORT DE STAGE 1 Sommaire 2 Introduction 3 Méthode 6 Migration sur gel d

Plus en détail

Travailler en toute sécurité dans un laboratoire de biologie moléculaire

Travailler en toute sécurité dans un laboratoire de biologie moléculaire VWR Tour 2012! Travailler en toute sécurité dans un laboratoire de biologie moléculaire Christian Siatka Directeur général Consultant qualité règlementations européennes Master BIOTIN Management de la

Plus en détail

TP DE BBSG M1 (2011-2012) Production de protéines recombinantes dans Escherichia. coli Etudes structurales et fonctionnelles (C. Bordi, M-S aschtgen)

TP DE BBSG M1 (2011-2012) Production de protéines recombinantes dans Escherichia. coli Etudes structurales et fonctionnelles (C. Bordi, M-S aschtgen) TP DE BBSG M1 (2011-2012) Production de protéines recombinantes dans Escherichia. coli Etudes structurales et fonctionnelles (C. Bordi, M-S aschtgen) Introduction Le vecteur d'expression procaryote pqe31-dsred3

Plus en détail

3: Clonage d un gène dans un plasmide

3: Clonage d un gène dans un plasmide 3: Clonage d un gène dans un plasmide Le clonage moléculaire est une des bases du génie génétique. Il consiste à insérer un fragment d'adn (dénommé insert) dans un vecteur approprié comme un plasmide par

Plus en détail

β-galactosidase A.2.1) à 37 C, en tampon phosphate de sodium 0,1 mol/l ph 7 plus 2-mercaptoéthanol 1 mmol/l et MgCl 2 1 mmol/l (tampon P)

β-galactosidase A.2.1) à 37 C, en tampon phosphate de sodium 0,1 mol/l ph 7 plus 2-mercaptoéthanol 1 mmol/l et MgCl 2 1 mmol/l (tampon P) bioch/enzymo/tp-betagal-initiation-michaelis.odt JF Perrin maj sept 2008-sept 2012 page 1/6 Etude de la β-galactosidase de E. Coli : mise en évidence d'un comportement Michaélien lors de l'hydrolyse du

Plus en détail

AGREGATION DE BIOCHIMIE GENIE BIOLOGIQUE

AGREGATION DE BIOCHIMIE GENIE BIOLOGIQUE AGREGATION DE BIOCHIMIE GENIE BIOLOGIQUE CONCOURS EXTERNE Session 2005 TRAVAUX PRATIQUES DE BIOCHIMIE PHYSIOLOGIE ALCOOL ET FOIE L éthanol, psychotrope puissant, est absorbé passivement dans l intestin

Plus en détail

Biologie cellulaire. Perfectionnement à la culture cellulaire. Programme. ParTIe PraTIQUe. ParTIe THÉorIQUe. durée : 4 jours

Biologie cellulaire. Perfectionnement à la culture cellulaire. Programme. ParTIe PraTIQUe. ParTIe THÉorIQUe. durée : 4 jours Biologie cellulaire Perfectionnement à la culture cellulaire durée : 4 jours ingénieurs, chercheurs et chefs de projet connaissances de base en culture cellulaire ou validation du module «initiation à

Plus en détail

TEST ELISA (ENZYME-LINKED IMMUNOSORBENT ASSEY)

TEST ELISA (ENZYME-LINKED IMMUNOSORBENT ASSEY) TEST ELISA (ENZYME-LINKED IMMUNOSORBENT ASSEY) Lise Vézina, technicienne de laboratoire Michel Lacroix, agronome-phytopathologiste Direction de l innovation scientifique et technologique Au Laboratoire

Plus en détail

RAPID Salmonella/Gélose 356-3961 356-3963 356-4705

RAPID Salmonella/Gélose 356-3961 356-3963 356-4705 356-3961 356-3963 356-4705 DOMAINE D APPLICATION La gélose RAPID Salmonella est un milieu chromogénique utilisé pour la recherche des Salmonella spp. lors de l'analyse des produits d alimentation humaine

Plus en détail

TD de Biochimie 4 : Coloration.

TD de Biochimie 4 : Coloration. TD de Biochimie 4 : Coloration. Synthèse de l expérience 2 Les questions posées durant l expérience 2 Exposé sur les méthodes de coloration des molécules : Générique Spécifique Autres Questions Pourquoi

Plus en détail

Biologie Appliquée. Dosages Immunologiques TD9 Mai 2015. Stéphanie Sigaut INSERM U1141 stephanie.sigaut@inserm.fr

Biologie Appliquée. Dosages Immunologiques TD9 Mai 2015. Stéphanie Sigaut INSERM U1141 stephanie.sigaut@inserm.fr Biologie Appliquée Dosages Immunologiques TD9 Mai 2015 Stéphanie Sigaut INSERM U1141 stephanie.sigaut@inserm.fr 1 ELISA 2 3 4 [Ac] 5 6 7 8 9 Correction : Faire la moyenne D0-1 et D0-2 pour toute les valeurs

Plus en détail

AGRÉGATION DE SCIENCES DE LA VIE - SCIENCES DE LA TERRE ET DE L UNIVERS

AGRÉGATION DE SCIENCES DE LA VIE - SCIENCES DE LA TERRE ET DE L UNIVERS AGRÉGATION DE SCIENCES DE LA VIE - SCIENCES DE LA TERRE ET DE L UNIVERS CONCOURS EXTERNE ÉPREUVES D ADMISSION session 2010 TRAVAUX PRATIQUES DE CONTRE-OPTION DU SECTEUR A CANDIDATS DES SECTEURS B ET C

Plus en détail

Isolement automatisé d ADN génomique à partir de culots de cellules sanguines à l aide de l appareil Tecan Freedom EVO -HSM Workstation

Isolement automatisé d ADN génomique à partir de culots de cellules sanguines à l aide de l appareil Tecan Freedom EVO -HSM Workstation PROTOCOLE AUTOMATISÉ Isolement automatisé d ADN génomique à partir de culots de cellules sanguines à l aide de l appareil Tecan Freedom EVO -HSM Workstation Mode d emploi des produits A1751 et A2751 Réservé

Plus en détail

TRAVAUX PRATIQUESDE BIOCHIMIE L1

TRAVAUX PRATIQUESDE BIOCHIMIE L1 TRAVAUX PRATIQUESDE BICHIMIE L1 PRINTEMPS 2011 Les acides aminés : chromatographie sur couche mince courbe de titrage Etude d une enzyme : la phosphatase alcaline QUELQUES RECMMANDATINS IMPRTANTES Le port

Plus en détail

SEQUENÇAGE LI-COR DNA 4200

SEQUENÇAGE LI-COR DNA 4200 SEQUENÇAGE LI-COR DNA 4200 Le gel de séquence contient 64 puits au maximum soit 16 clones traités en parallèle. Les oligos utilisés (modifiés en 5 ) fluorescent à 700/800 nm. Une amorce permet de séquencer

Plus en détail

Production d une protéine recombinante

Production d une protéine recombinante 99 Production d une protéine recombinante Lic. B. PIRSON Lic. J-M. SERONT ISICHt - Mons Production de la protéine recombinante GFP (Green Fluorescent Protein d Aequoria victoria) par une bactérie ( E.

Plus en détail

KIT ELISA dosage immunologique anti-bsa REF : ELISA A RECEPTION DU COLIS : Vérifier la composition du colis indiquée ci-dessous en pages 1 et 2

KIT ELISA dosage immunologique anti-bsa REF : ELISA A RECEPTION DU COLIS : Vérifier la composition du colis indiquée ci-dessous en pages 1 et 2 KIT ELISA dosage immunologique anti-bsa REF : ELISA : 0033 (0)169922672 : 0033 (0)169922674 : www.sordalab.com @ : sordalab@wanadoo.fr A RECEPTION DU COLIS : Vérifier la composition du colis indiquée ci-dessous

Plus en détail

33-Dosage des composés phénoliques

33-Dosage des composés phénoliques 33-Dosage des composés phénoliques Attention : cette manip a été utilisée et mise au point pour un diplôme (Kayumba A., 2001) et n a plus été utilisée depuis au sein du labo. I. Principes Les composés

Plus en détail

POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA

POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA Amplification spécifique Détection spécifique Clonage dans des vecteurs Amplification in vitro PCR Hybridation moléculaire - hôte cellulaire

Plus en détail

Atelier : Détection de la mort cellulaire par apoptose en réponse à un agent anti-tumoral.

Atelier : Détection de la mort cellulaire par apoptose en réponse à un agent anti-tumoral. - La cytométrie en flux est une méthode d analyse de cellules en suspension, véhiculées à grande vitesse jusqu à une chambre d analyse traversée par des faisceaux lasers. L interaction des cellules avec

Plus en détail

Test d immunofluorescence (IF)

Test d immunofluorescence (IF) Test d immunofluorescence (IF) 1.1 Prélèvement du cerveau et échantillonnage Avant toute manipulation, il est fondamental de s assurer que tout le personnel en contact avec un échantillon suspect soit

Plus en détail

Manuel du PAXgene Blood RNA Kit

Manuel du PAXgene Blood RNA Kit Manuel du PAXgene Blood RNA Kit Version 2 Le système PAXgene Blood RNA est composé d un tube à prélèvement sanguin (PAXgene Blood RNA tube) et d une trousse de purification d acides nucléiques (PAXgene

Plus en détail

TP3 Test immunologique et spécificité anticorps - déterminant antigénique

TP3 Test immunologique et spécificité anticorps - déterminant antigénique TP3 Test immunologique et spécificité anticorps - déterminant antigénique Partie 1 : Spécificité d'un anticorps pour un déterminant antigénique du VIH La séropositivité pour le VIH correspond à la présence

Plus en détail

La PCR en temps réel

La PCR en temps réel La PCR en temps réel Hôpital La Rabta Tunis 6 juin 2013 Dr Sabine Favre-Bonté Maître de Conférences, Université Claude Bernard Lyon 1 UMR CNRS 5557 Ecologie Microbienne Equipe Multi-résistance environnementale

Plus en détail

ANTICORPS POLYCLONAUX ANTI IMMUNOGLOBULINES

ANTICORPS POLYCLONAUX ANTI IMMUNOGLOBULINES L OUTIL IDEAL POUR TOUTES LES DETECTIONS IMMUNOCHIMIQUES pour toutes les techniques immunodosages (EIA/ELISA) dot/ westernblot immunohistochimie immunocytochimie cytométrie en flux quel que soit le système

Plus en détail

AGRÉGATION DE SCIENCES DE LA VIE - SCIENCES DE LA TERRE ET DE L UNIVERS

AGRÉGATION DE SCIENCES DE LA VIE - SCIENCES DE LA TERRE ET DE L UNIVERS AGRÉGATION DE SCIENCES DE LA VIE - SCIENCES DE LA TERRE ET DE L UNIVERS CONCOURS EXTERNE ÉPREUVES D ADMISSION session 2010 TRAVAUX PRATIQUES DE SPECIALITÉ DU SECTEUR A Durée totale : 6 heures Quelques

Plus en détail

Méthodes d études. Chapitre 8 : Professeur Joël LUNARDI. UE1 : Biochimie Biologie moléculaire

Méthodes d études. Chapitre 8 : Professeur Joël LUNARDI. UE1 : Biochimie Biologie moléculaire Chapitre 8 : UE1 : Biochimie Biologie moléculaire Méthodes d études Professeur Joël LUNARDI Année universitaire 2011/2012 Université Joseph Fourier de Grenoble - Tous droits réservés. Chapitre 8. 8. Méthodes

Plus en détail

L immunoenzymologie. Technique puissante couramment utilisée e en recherche et en diagnostic cificité des anticorps pour leurs nes

L immunoenzymologie. Technique puissante couramment utilisée e en recherche et en diagnostic cificité des anticorps pour leurs nes L immunoenzymologie Technique puissante couramment utilisée e en recherche et en diagnostic Basée e sur la très s grande spécificit cificité des anticorps pour leurs antigènes nes Test qualitatif Détection

Plus en détail

Maxwell 16 Blood DNA Purification System

Maxwell 16 Blood DNA Purification System Manuel Technique Maxwell 16 Blood DNA Purification System Attention, cartouches à manipuler avec précaution, les bords scellés peuvent être tranchants. 2800 Woods Hollow Rd. Madison, WI USA Dispositif

Plus en détail

Régulation GAL4 chez S. cerevisiae. Annie Sainsard-Chanet

Régulation GAL4 chez S. cerevisiae. Annie Sainsard-Chanet Régulation GAL4 chez S. cerevisiae Annie Sainsard-Chanet Contrôle de l expression génique Mécanismes qui régulent, augmentent ou diminuent l expression d un gène donné suivant le milieu, le tissu, le stade

Plus en détail

Analyse d échantillons alimentaires pour la présence d organismes génétiquement modifiés

Analyse d échantillons alimentaires pour la présence d organismes génétiquement modifiés Analyse d échantillons alimentaires pour la présence d organismes génétiquement modifiés Module 4 Extraction et purification de l ADN M. Somma WORLD HEALTH ORGANIZATION REGIONAL OFFICE FOR EUROPE ORGANISATION

Plus en détail

Dosages à réactifs marqués

Dosages à réactifs marqués Dosages à réactifs marqués Principe = réaction Ag-Ac un des deux réactifs (Ag ou Ac) est marqué par un traceur Différentes méthodes selon que le traceur est radioactif (RIA), enzymatique (EIA) ou luminescent

Plus en détail

Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013

Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013 Sélectionner les propositions exactes Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013 QCM 1 La plupart des techniques de biologie moléculaire repose sur le principe de complémentarité

Plus en détail

Biotechnology Explorer

Biotechnology Explorer Biotechnology Explorer Kit de purification de la Green Fluorescent Protein (GFP) Référence 166-0005-EDU http://explorer.bio-rad.fr Pour le service technique, composez le 01.47.95.69.64 Un guide d'enseignement

Plus en détail

1.3 Recherche de contaminants au cours de la production de Saccharomyces boulardii

1.3 Recherche de contaminants au cours de la production de Saccharomyces boulardii Série STL Biochimie génie biologique EPREUVE PRATIQUE 1. CONTROLE MICROBIOLOGIQUE DE PROBIOTIQUES Les préparations de probiotiques sont utilisées préventivement comme additifs dans l alimentation humaine

Plus en détail

Indicateur d'unité Voyant Marche/Arrêt

Indicateur d'unité Voyant Marche/Arrêt Notice MESURACOLOR Colorimètre à DEL Réf. 22020 Indicateur d'unité Voyant Marche/Arrêt Indicateur Etalonnage Bouton Marche/Arrêt Indicateur de sélection de la longueur d'onde Indicateur de mode chronomètre

Plus en détail

www.gbo.com/bioscience 1 Culture Cellulaire Microplaques 2 HTS- 3 Immunologie/ HLA 4 Microbiologie/ Bactériologie Containers 5 Tubes/ 6 Pipetage

www.gbo.com/bioscience 1 Culture Cellulaire Microplaques 2 HTS- 3 Immunologie/ HLA 4 Microbiologie/ Bactériologie Containers 5 Tubes/ 6 Pipetage 2 HTS 3 Immunologie / Immunologie Informations Techniques 3 I 2 ELISA 96 Puits 3 I 4 ELISA 96 Puits en Barrettes 3 I 6 en Barrettes de 8 Puits 3 I 7 en Barrettes de 12 Puits 3 I 8 en Barrettes de 16 Puits

Plus en détail

SERVICES DE SEQUENÇAGE

SERVICES DE SEQUENÇAGE MARCH 16, 2014 SERVICES DE SEQUENÇAGE Centre d innovation Génome Québec et Université McGill Services de Validation et détection de SNP Technologie de Séquençage de Nouvelle Génération Guide de l utilisateur

Plus en détail

Spectrophotométrie - Dilution 1 Dilution et facteur de dilution. 1.1 Mode opératoire :

Spectrophotométrie - Dilution 1 Dilution et facteur de dilution. 1.1 Mode opératoire : Spectrophotométrie - Dilution 1 Dilution et facteur de dilution. 1.1 Mode opératoire : 1. Prélever ml de la solution mère à la pipette jaugée. Est-ce que je sais : Mettre une propipette sur une pipette

Plus en détail

TECHNIQUES: Principes de la chromatographie

TECHNIQUES: Principes de la chromatographie TECHNIQUES: Principes de la chromatographie 1 Définition La chromatographie est une méthode physique de séparation basée sur les différentes affinités d un ou plusieurs composés à l égard de deux phases

Plus en détail

ELISA PeliClass human IgG subclass kit REF M1551

ELISA PeliClass human IgG subclass kit REF M1551 Sanquin Reagents Plesmanlaan 5 0 CX Amsterdam The Netherlands Phone: +.0.5.599 Fax: +.0.5.570 Email: reagents@sanquin.nl Website: www.sanquinreagents.com M55/ November 007 ELISA PeliClass human IgG subclass

Plus en détail

TD DOSAGE DE PROTEINES ET ELECTROPHORESE : PARTIE THÉORIQUE BST1 SVT

TD DOSAGE DE PROTEINES ET ELECTROPHORESE : PARTIE THÉORIQUE BST1 SVT TD DOSAGE DE PROTEINES ET ELECTROPHORESE : PARTIE THÉORIQUE BST1 SVT Daniela LENER IBMC Texte conseillé pour consultation : Biochimie, Voet & Voet, ed. De Boeck. Dosage des protéines Pendant une purification

Plus en détail

Méthode automatisée de dosage colorimétrique du dioxyde de soufre total dans les vins

Méthode automatisée de dosage colorimétrique du dioxyde de soufre total dans les vins Méthode automatisée de dosage colorimétrique du dioxyde de soufre total dans les vins Marc DUBERNET* et Françoise GRASSET* Laboratoire DUBERNET - 9, quai d Alsace - 11100 Narbonne France 1. Objet Méthode

Plus en détail

CODEX ŒNOLOGIQUE INTERNATIONAL. Mesure de la viscosité COEI-2-VISCPE : 2009

CODEX ŒNOLOGIQUE INTERNATIONAL. Mesure de la viscosité COEI-2-VISCPE : 2009 DETERMINATION DE LA CAPACITE D'UNE PREPARATION ENZYMATIQUE A COUPER LES CHAINES PECTIQUES PAR LA MESURE DE LA VISCOSITE (OIV-Oeno 351-2009) 1. PRINCIPE On se propose ici de mesurer la quantité d'enzyme

Plus en détail

altona altona RealStar CMV PCR Kit 1.0 always a drop ahead. 04/2015 altona Diagnostics GmbH Mörkenstr. 12 22767 Hamburg Germany

altona altona RealStar CMV PCR Kit 1.0 always a drop ahead. 04/2015 altona Diagnostics GmbH Mörkenstr. 12 22767 Hamburg Germany altona DIAGNOSTICS altona DIAGNOSTICS RealStar CMV PCR Kit 1.0 04/2015 altona Diagnostics GmbH Mörkenstr. 12 22767 Hamburg Germany phone +49 40 548 06 76-0 fax +49 40 548 06 76-10 e-mail info@altona-diagnostics.com

Plus en détail

Techniques d étude des Gènes et de leur Régulation. A. Galmiche, 2011-2012

Techniques d étude des Gènes et de leur Régulation. A. Galmiche, 2011-2012 Techniques d étude des Gènes et de leur Régulation A. Galmiche, 2011-2012 1. Introduction et techniques de base 2. Détection des acides nucléiques et mesure de l expression des gènes: Hybridations PCR

Plus en détail

Les techniques de préparation des coupes pour les microscopies optique et électronique

Les techniques de préparation des coupes pour les microscopies optique et électronique Université Mohammed V-Agdal Faculté des Sciences de Rabat Laboratoire de Zoologie et de Biologie générale Les techniques de préparation des coupes pour les microscopies optique et électronique Histologie-Embryologie

Plus en détail

L ADN dans le diagnostic médical

L ADN dans le diagnostic médical Valise Pédagogique: À la découverte de l ADN Une collaboration entre l Université de Fribourg et le Musée d histoire naturelle de Fribourg L ADN dans le diagnostic médical Protocole pour l enseignant Léonard

Plus en détail

NOTE : Les cellules de ce kit nécessitent une attention immédiate. Suivez scrupuleusement les instructions du protocole

NOTE : Les cellules de ce kit nécessitent une attention immédiate. Suivez scrupuleusement les instructions du protocole Kit Protocole Code produit : ZHA-4000 De la vasculogenèse à l angiogenèse NOTE : Les cellules de ce kit nécessitent une attention immédiate Suivez scrupuleusement les instructions du protocole Contenu

Plus en détail

CHROMATOGRAPHIE SUR COUCHE MINCE

CHROMATOGRAPHIE SUR COUCHE MINCE CHROMATOGRAPHIE SUR COUCHE MINCE I - PRINCIPE La chromatographie est une méthode physique de séparation de mélanges en leurs constituants; elle est basée sur les différences d affinité des substances à

Plus en détail

Planches pour le Diagnostic microscopique du paludisme

Planches pour le Diagnostic microscopique du paludisme République Démocratique du Congo Ministère de la Santé Programme National de Lutte Contre le Paludisme Planches pour le Diagnostic microscopique du paludisme Ces planches visent à améliorer le diagnostic

Plus en détail

HRP H 2 O 2. O-nitro aniline (λmax = 490 nm) O-phénylène diamine NO 2 NH 2

HRP H 2 O 2. O-nitro aniline (λmax = 490 nm) O-phénylène diamine NO 2 NH 2 ! #"%$'&#()"*!(,+.-'/0(,()1)2"%$ Avant d effectuer le dosage en IR de la biotine, il est nécessaire de s assurer de la reconnaissance du traceur par la streptavidine immobilisée sur les puits. Pour cela,

Plus en détail

(aq) sont colorées et donnent à la solution cette teinte violette, assimilable au magenta.»

(aq) sont colorées et donnent à la solution cette teinte violette, assimilable au magenta.» Chapitre 5 / TP 1 : Contrôle qualité de l'eau de Dakin par dosage par étalonnage à l'aide d'un spectrophotomètre Objectif : Vous devez vérifier la concentration massique d'un désinfectant, l'eau de Dakin.

Plus en détail

Critères pour les méthodes de quantification des résidus potentiellement allergéniques de protéines de collage dans le vin (OIV-Oeno 427-2010)

Critères pour les méthodes de quantification des résidus potentiellement allergéniques de protéines de collage dans le vin (OIV-Oeno 427-2010) Méthode OIV- -MA-AS315-23 Type de méthode : critères Critères pour les méthodes de quantification des résidus potentiellement allergéniques de protéines de collage (OIV-Oeno 427-2010) 1 Définitions des

Plus en détail

altona altona RealStar EBV PCR Kit 1.0 always a drop ahead. 11/2012 altona Diagnostics GmbH Mörkenstr. 12 22767 Hamburg Germany

altona altona RealStar EBV PCR Kit 1.0 always a drop ahead. 11/2012 altona Diagnostics GmbH Mörkenstr. 12 22767 Hamburg Germany altona DIAGNOSTICS altona DIAGNOSTICS RealStar EBV PCR Kit 1.0 11/2012 altona Diagnostics GmbH Mörkenstr. 12 22767 Hamburg Germany phone +49 40 548 06 76-0 fax +49 40 548 06 76-10 e-mail info@altona-diagnostics.com

Plus en détail

Filière BCPST BIOLOGIE. Epreuve commune aux ENS de Paris, Lyon et Cachan. Durée : 6 heures

Filière BCPST BIOLOGIE. Epreuve commune aux ENS de Paris, Lyon et Cachan. Durée : 6 heures 74.01B SESSION 2007 Filière BCPST BIOLOGIE Epreuve commune aux ENS de Paris, Lyon et Cachan Durée : 6 heures L usage de calculatrices électroniques de poche à alimentation autonome, non imprimantes et

Plus en détail

3. L'ARN: Structure, Diffférents Types Et Propriétés tructure assification des ARN ARN ribosoinaux (ARNr) synthétisés dans le noyau

3. L'ARN: Structure, Diffférents Types Et Propriétés tructure assification des ARN ARN ribosoinaux (ARNr) synthétisés dans le noyau 3. L'ARN: Structure, Diffférents Types Et Propriétés Structure Les ARN sont des polymères de RiboNucléotides liés par des liaisons phosophodiester 5'-3'. Les bases azotées sont A-U, C-G. Le sucre est le

Plus en détail

4. Conditionnement et conservation de l échantillon

4. Conditionnement et conservation de l échantillon 1. Objet S-II-3V1 DOSAGE DU MERCURE DANS LES EXTRAITS D EAU RÉGALE Description du dosage du mercure par spectrométrie d absorption atomique de vapeur froide ou par spectrométrie de fluorescence atomique

Plus en détail

ATELIER IMAGEJ. Différentes applications vous sont proposées pour apprendre à utiliser quelques fonctions d ImageJ :

ATELIER IMAGEJ. Différentes applications vous sont proposées pour apprendre à utiliser quelques fonctions d ImageJ : Différentes applications vous sont proposées pour apprendre à utiliser quelques fonctions d ImageJ : 1. ANALYSE QUANTITATIVE D UN GEL D ELECTROPHORESE... 2 2. NUMERATION DE COLONIES BACTERIENNES SUR UNE

Plus en détail

FICHE DE TRAVAIL EN LABORATOIRE POUR L'ÉLÈVE EXPÉRIENCE A : NANOMATÉRIAUX NATURELS

FICHE DE TRAVAIL EN LABORATOIRE POUR L'ÉLÈVE EXPÉRIENCE A : NANOMATÉRIAUX NATURELS FICHE DE TRAVAIL EN LABORATOIRE POUR L'ÉLÈVE EXPÉRIENCE A : Nom de l'élève : Date :.. NANOMATÉRIAUX NATURELS OBJECTIF : - Découvrir l'existence des nanomatériaux naturels. - Procéder à une légère interaction

Plus en détail

COUSIN Fabien KERGOURLAY Gilles. 19 octobre 2007. de l hôte par les. Master 2 MFA Responsable : UE Incidence des paramètres environnementaux

COUSIN Fabien KERGOURLAY Gilles. 19 octobre 2007. de l hôte par les. Master 2 MFA Responsable : UE Incidence des paramètres environnementaux COUSIN Fabien KERGOURLAY Gilles 19 octobre 2007 Inhibition des défenses de l hôte par les bactéries pathogènes Master 2 MFA Responsable : UE Incidence des paramètres environnementaux Gwennola ERMEL I Détection

Plus en détail

Exemple de cahier de laboratoire : cas du sujet 2014

Exemple de cahier de laboratoire : cas du sujet 2014 Exemple de cahier de laboratoire : cas du sujet 2014 Commentaires pour l'évaluation Contenu du cahier de laboratoire Problématique : Le glucose est un nutriment particulièrement important pour le sportif.

Plus en détail

génomique - protéomique acides nucléiques protéines microbiologie instrumentation

génomique - protéomique acides nucléiques protéines microbiologie instrumentation génomique - protéomique acides nucléiques protéines microbiologie instrumentation Génomique, protéomique - Acides nucléiques Extraction d acides nucléiques ADN... Kit de filtration par colonnes... ADN

Plus en détail

AT/ TD n 8 Détermination de l action des agents anti-microbien sur Escherichia coli

AT/ TD n 8 Détermination de l action des agents anti-microbien sur Escherichia coli AT/ TD n 8 Détermination de l action des agents anti-microbien sur Escherichia coli Contexte de la situation et activités à réaliser Afin d étudier l action de différents agents antibactérien sur l espèce

Plus en détail

MISE EN EVIDENCE D'UN PROCESSUS DE DELETION CLONALE AU. Les antigènes Mls (Minor lymphocyte stimulating antigen) sont

MISE EN EVIDENCE D'UN PROCESSUS DE DELETION CLONALE AU. Les antigènes Mls (Minor lymphocyte stimulating antigen) sont 1 TRAVAUX PRATIQUES D'IMMUNOGENETIQUE 1997 MISE EN EVIDENCE D'UN PROCESSUS DE DELETION CLONALE AU NIVEAU DU REPERTOIRE T CHEZ LA SOURIS Les antigènes Mls (Minor lymphocyte stimulating antigen) sont responsables

Plus en détail

pka D UN INDICATEUR COLORE

pka D UN INDICATEUR COLORE TP SPETROPHOTOMETRIE Lycée F.BUISSON PTSI pka D UN INDIATEUR OLORE ) Principes de la spectrophotométrie La spectrophotométrie est une technique d analyse qualitative et quantitative, de substances absorbant

Plus en détail

259 VOLUMETRIE ET TITRATION DOSAGE DU NaOH DANS LE DESTOP

259 VOLUMETRIE ET TITRATION DOSAGE DU NaOH DANS LE DESTOP 259 VOLUMETRIE ET TITRATION DOSAGE DU NaOH DANS LE DESTOP A d a p t a t i o n : A. - M. F o u r n i e r ( C o p a d ), M. C a s a n o v a & H. J e n n y ( C d C ) 2 0 0 1 C o n c e p t i o n D. M a r g

Plus en détail

Diagnostic biologique de la toxoplasmose

Diagnostic biologique de la toxoplasmose COURS DE COLLEGE DE MALADIES INFECTIEUSES MICROBIOLOGIE PARASITOLOGIE Diagnostic biologique de la toxoplasmose 26 Janvier 2012 Faculté de Médecine de Sousse Principes des techniques utilisées dans le diagnostic

Plus en détail

TP 3 diffusion à travers une membrane

TP 3 diffusion à travers une membrane TP 3 diffusion à travers une membrane CONSIGNES DE SÉCURITÉ Ce TP nécessite la manipulation de liquides pouvant tacher les vêtements. Le port de la blouse est fortement conseillé. Les essuie tout en papier

Plus en détail

2D-Differential Differential Gel Electrophoresis & Applications en neurosciences

2D-Differential Differential Gel Electrophoresis & Applications en neurosciences 2D-Differential Differential Gel Electrophoresis & Applications en neurosciences Jean-Etienne Poirrier Centre de Neurobiologie Cellulaire et Moléculaire Centre de Recherches du Cyclotron Université de

Plus en détail

Science et technique. La température et la durée de stockage sont des facteurs déterminants. Viande bovine et micro-organisme pathogène

Science et technique. La température et la durée de stockage sont des facteurs déterminants. Viande bovine et micro-organisme pathogène Science et technique Viande bovine et micro-organisme pathogène La température et la durée de stockage sont des facteurs déterminants La contamination des carcasses lors des opérations d abattage et la

Plus en détail

Le vivant est complexe: - 30 millions de types d organismes - 100 000 protéines différentes chez l homme

Le vivant est complexe: - 30 millions de types d organismes - 100 000 protéines différentes chez l homme Introduction Le vivant est complexe: - 30 millions de types d organismes - 100 000 protéines différentes chez l homme Informatique: - stocker les données - éditer les données - analyser les données (computational

Plus en détail

Cônes PureSpeed. Pureté et concentration optimisées Cônes pour purification de Protéines

Cônes PureSpeed. Pureté et concentration optimisées Cônes pour purification de Protéines Cônes PureSpeed Cônes pour protéine PureSpeed Pureté et concentration optimales Rapide moins de 15 minutes Traitement simultané de plusieurs échantillons Pureté et concentration optimisées Cônes pour purification

Plus en détail

Marquage laser des métaux

Marquage laser des métaux 62 Colorer Marquage laser des métaux TherMark Produit à base aqueuse pour un nettoyage rapide. Appliquer une fine couche de produit sur le métal, laisser sécher moins de 2 minutes et graver au laser. L

Plus en détail

SERVICES DE SÉQUENÇAGE DE NOUVELLE GÉNÉRATION

SERVICES DE SÉQUENÇAGE DE NOUVELLE GÉNÉRATION 2015-09-29 SERVICES DE SÉQUENÇAGE DE NOUVELLE GÉNÉRATION Centre d innovation Génome Québec et Université McGill Guide de l utilisateur: Technologies de séquençage Illumina Version 5.6 Copyright 2015 Centre

Plus en détail

Démonstration par l enseignante ou l enseignant/activité par les élèves Le chou rouge comme indicateur

Démonstration par l enseignante ou l enseignant/activité par les élèves Le chou rouge comme indicateur SNC2D/SNC2P Réactions chimiques/réactions chimiques Démonstration par l enseignante ou l enseignant/activité par les élèves Le chou rouge comme indicateur Sujets propriétés des acides et des bases échelle

Plus en détail

Diagnostic de la rage en laboratoire. Christine Fehlner-Gardiner, Ph.D. Chercheuse scientifique, Centre d expertise de la rage - ACIA

Diagnostic de la rage en laboratoire. Christine Fehlner-Gardiner, Ph.D. Chercheuse scientifique, Centre d expertise de la rage - ACIA Diagnostic de la rage en laboratoire Christine Fehlner-Gardiner, Ph.D. Chercheuse scientifique, Centre d expertise de la rage - ACIA Structure de gouvernance - ACIA L ACIA relève du ministre de l Agriculture,

Plus en détail

Développement d un traitement pour l ataxie de Friedreich. Dr. Jacques P. Tremblay Université Laval Québec, Canada

Développement d un traitement pour l ataxie de Friedreich. Dr. Jacques P. Tremblay Université Laval Québec, Canada Développement d un traitement pour l ataxie de Friedreich Dr. Jacques P. Tremblay Université Laval Québec, Canada Ataxie de Friedreich Maladie héréditaire Transmission récessive Liée au chromosome 9 Due

Plus en détail

TP N 3 La composition chimique du vivant

TP N 3 La composition chimique du vivant Thème 1 : La Terre dans l'univers, la vie et l'évolution du vivant : une planète habitée Chapitre II : La nature du vivant TP N 3 La composition chimique du vivant Les conditions qui règnent sur terre

Plus en détail

Développement de la cytométrie en flux pour le suivi microbiologique des vins

Développement de la cytométrie en flux pour le suivi microbiologique des vins Développement de la cytométrie en flux pour le suivi microbiologique des vins 88 Virginie SERPAGGI Laurent MASSINI Patrick VUCHOT Inter Rhône 2260 route du Grès 84100 Orange vserpaggi@inter-rhone. com

Plus en détail

TYPAGE HLA CROSSMATCH ANTICORPS ANTI-HLA

TYPAGE HLA CROSSMATCH ANTICORPS ANTI-HLA 16/11/12 TYPAGE HLA CROSSMATCH ANTICORPS ANTI-HLA Chantal GAUTREAU LABORATOIRE HLA S E R V I C E D I M M U N O L O G I E E T D H I S T O C O M PAT I B I L I T É, A P - H P, HÔPITAL SAINT LOUIS, PARIS,

Plus en détail

Les thérapies ciblées du cancer. Dictionnaire anglais-français autorisé. Calculatrice autorisée.

Les thérapies ciblées du cancer. Dictionnaire anglais-français autorisé. Calculatrice autorisée. Les thérapies ciblées du cancer Dictionnaire anglais-français autorisé. Calculatrice autorisée. Une thérapie ciblée est un traitement qui agit par un mécanisme spécifique sur des altérations biologiques

Plus en détail

Table des matières. Renseignements importants sur la sécurité 2. Nettoyage et élimination 4. Spécifications 4

Table des matières. Renseignements importants sur la sécurité 2. Nettoyage et élimination 4. Spécifications 4 Système FlashGel TM Lonza Rockland, Inc. www.lonza.com scientific.support@lonza.com Assistance scientifique : 800-521-0390 Service à la clientèle : 800-638-8174 Rockland, ME 04841 Table des matières Renseignements

Plus en détail

I. Principe des dosages :

I. Principe des dosages : Dans les cours d'eau, notamment canalisés, et dans les régions densément habitées ou d'agriculture intensive, les nitrites sont souvent un paramètre important de déclassement des cours d'eau. Chez l'homme

Plus en détail

1 er sujet : ancre GPI et association aux rafts (64 points)

1 er sujet : ancre GPI et association aux rafts (64 points) Université Joseph Fourier - Grenoble I Année 2007-2008 Epreuve de BIO121 1 ère session mai 2008 Durée : 2 heures Les documents, la calculette et le téléphone portable ne sont pas autorisés. Total des points

Plus en détail

Peroxyacide pour l'hygiène dans les industries agroalimentaires

Peroxyacide pour l'hygiène dans les industries agroalimentaires P3-oxonia active Description Peroxyacide pour l'hygiène dans les industries agroalimentaires Qualités Le P3-oxonia active est efficace à froid. Il n'est ni rémanent ni polluant. Il ne contient pas d'acide

Plus en détail

10. Instruments optiques et Microscopes Photomètre/Cuve

10. Instruments optiques et Microscopes Photomètre/Cuve 0. Instruments s et Microscopes GENERAL CATALOGUE 00/ Cuve à usage unique pour spectrophotomètre Cuve jetable, moulée en et en pour UV. Avec parois traitées Kartell ment pour une transparence optimale

Plus en détail

Comment suivre l évolution d une transformation chimique? + S 2 O 8 = I 2 + 2 SO 4

Comment suivre l évolution d une transformation chimique? + S 2 O 8 = I 2 + 2 SO 4 Afin d optimiser leurs procédés, les industries chimiques doivent contrôler le bon déroulement de la réaction de synthèse menant aux espèces voulues. Comment suivre l évolution d une transformation chimique?

Plus en détail

CELLINE. Bioréacteur à usage unique pour une expression efficace des protéines

CELLINE. Bioréacteur à usage unique pour une expression efficace des protéines CELLINE Bioréacteur à usage unique pour une expression efficace des protéines Une technologie à double compartiment Nutriments Déchets Glucose Glutamine Lactate Ammonium Compartiment du milieu de culture

Plus en détail

Dr E. CHEVRET UE2.1 2013-2014. Aperçu général sur l architecture et les fonctions cellulaires

Dr E. CHEVRET UE2.1 2013-2014. Aperçu général sur l architecture et les fonctions cellulaires Aperçu général sur l architecture et les fonctions cellulaires I. Introduction II. Les microscopes 1. Le microscope optique 2. Le microscope à fluorescence 3. Le microscope confocal 4. Le microscope électronique

Plus en détail

Liquides oraux : et suspensions. Préparations liquides pour usage oral. Solutions

Liquides oraux : et suspensions. Préparations liquides pour usage oral. Solutions Préparations pharmaceutique Cours de en 2ème petites Année quantités de Master en Pharmacie Liquides oraux : solutions, Préparation sirops pharmaceutique et suspensions en petites quantités Section des

Plus en détail

SVE 222 & PCL-442. Fascicule de Travaux Pratiques

SVE 222 & PCL-442. Fascicule de Travaux Pratiques SVE 222 & PCL-442 Fascicule de Travaux Pratiques 2014-2015 Institut Supérieur de l Education et de la Formation Continue Bassem Jamoussi & Radhouane Chakroun 1 Sommaire PCL 442/SVE222 - TP N 1 : Etude

Plus en détail

Sérodiagnostic de la polyarthrite rhumatoïde

Sérodiagnostic de la polyarthrite rhumatoïde 1 ETSL Sérodiagnostic de la polyarthrite rhumatoïde TP 1 GABIN-GAUTHIER 13/11/2009 I. LA MALADIE... 2 II. TECHNIQUES QUALITATIVES... 2 1. PRINCIPE... 2 2. MODE OPERATOIRE... 3 2.1. WRST ou Waaler Rose

Plus en détail

Intérêt diagnostic du dosage de la CRP et de la leucocyte-estérase dans le liquide articulaire d une prothèse de genou infectée

Intérêt diagnostic du dosage de la CRP et de la leucocyte-estérase dans le liquide articulaire d une prothèse de genou infectée Intérêt diagnostic du dosage de la CRP et de la leucocyte-estérase dans le liquide articulaire d une prothèse de genou infectée C. Rondé-Oustau, JY. Jenny,J.Sibilia, J. Gaudias, C. Boéri, M. Antoni Hôpitaux

Plus en détail

Produire une protéine recombinante. Principes et Méthodes. de Biologie Moléculaire

Produire une protéine recombinante. Principes et Méthodes. de Biologie Moléculaire Produire une protéine recombinante Principes et Méthodes de Biologie Moléculaire Gabrielle Potocki-Veronese INSA-Laboratoire Biotechnologie-Bioprocédés Toulouse Equipe Ingénierie Enzymatique Moléculaire

Plus en détail

SALLE DE BAIN, DOUCHE, PLAN DE TRAVAIL CUISINE, PISCINE... Collage et jointoiement. L Epoxy facile

SALLE DE BAIN, DOUCHE, PLAN DE TRAVAIL CUISINE, PISCINE... Collage et jointoiement. L Epoxy facile SALLE DE BAIN, DOUCHE, PLAN DE TRAVAIL CUISINE, PISCINE... Collage et jointoiement L Epoxy facile DOMAINES D EMPLOI Recommandé pour salle de bain, douche, plan de travail cuisine, piscine, bassins thermaux,

Plus en détail

EXERCICE II. SYNTHÈSE D UN ANESTHÉSIQUE : LA BENZOCAÏNE (9 points)

EXERCICE II. SYNTHÈSE D UN ANESTHÉSIQUE : LA BENZOCAÏNE (9 points) Bac S 2015 Antilles Guyane http://labolycee.org EXERCICE II. SYNTHÈSE D UN ANESTHÉSIQUE : LA BENZOCAÏNE (9 points) La benzocaïne (4-aminobenzoate d éthyle) est utilisée en médecine comme anesthésique local

Plus en détail

Sommaire. Première partie Les concepts de base

Sommaire. Première partie Les concepts de base Sommaire Préface à la troisième édition... Préface à la deuxième édition... Avant-propos à la troisième édition... Avant-propos à la deuxième édition... Avant-propos à la première édition... XV XVII XIX

Plus en détail