Développement, utilisation et comparaison de différents types de marqueurs pour étudier la diversité parmi une collection de blé tendre

Dimension: px
Commencer à balayer dès la page:

Download "Développement, utilisation et comparaison de différents types de marqueurs pour étudier la diversité parmi une collection de blé tendre"

Transcription

1 Les Actes du BRG, 6 (2006) BRG, 2006 Article original Développement, utilisation et comparaison de différents types de marqueurs pour étudier la diversité parmi une collection de blé tendre François BALFOURIER (1)*, Catherine RAVEL (1), Anne-Marie BOCHARD (2), Florence EXBRAYAT-VINSON (1), Gilles BOUTET (1), Pierre SOURDILLE (1), Philippe DUFOUR (2), Gilles CHARMET (1) (1) INRA - UMR Amélioration et Santé des Plantes, 234 avenue du Brézet, Clermont-Ferrand, France (2) Limagrain Agro-Industrie, site ULICE, ZAC les Portes de Riom, BP173, Riom Cedex, France Abstract: Generation, use and comparison of different molecular markers for diversity analyses in bread wheat collection. In order to determine the interest of different types of molecular markers for genetic diversity analyses, molecular polymorphism was studied in a set of 731 bread wheat accessions using 38 genomic microsatellites (SSRg), 44 EST-derived microsatellites (SSRest) and SNPs from 16 genes. The total of 98 markers covers the whole bread wheat genome. SSRg present the highest level of polymorphism (900 alleles) compared to SSRest and SNPs (183 alleles and 69 haplotypes, respectively). Among SSRest markers, those with dinucleotide repeats are significantly more polymorphic than the others with tri and tetra nucleotide repeats. Whatever markers we consider, no significant difference appears in the level of diversity between the different A, B and D genome of bread wheat. The three genetic matrices distances between pairs of accessions, calculated for each type of markers in a sub-sample of 41 accessions with no missing data, are not significantly different. However, SSRg appear to be more efficient than SSRest to estimate these distances. The two types of microsatellites offer the same capacity to restore the topology of a given hierarchical tree. The three hierarchical trees, obtained from the sub-sample of 41 accessions individually analysed by the three types of markers, show a common topological structure. This structure, which clearly separates the European wheat accessions from the Asian ones, may be both explained by historical process of wheat germplasm migration and selective adaptation to environmental conditions. The whole results are discussed according to the nature and the level of neutrality of the different markers in relation to selection. bread wheat/ genetic structure/ microsatellite/ SNP/ phylogenic tree * Correspondance et tirés à part : 129

2 F. Balfourier et al. Résumé : Afin d analyser l intérêt de différents marqueurs moléculaires pour des études de diversité génétique, le polymorphisme a été étudié dans un échantillon de 731 blés tendres à l aide de 38 microsatellites génomiques (SSRg), 44 microsatellites issus d EST (SSRest) et de SNP détectés sur 16 gènes, soit 98 locus également répartis sur le génome. Les SSRg apparaissent comme les plus polymorphes (900 allèles) comparés aux SSRest (183 allèles) et aux SNP (69 haplotypes). Parmi les SSRest, ceux au motif di-nucléotique sont significativement plus polymorphes que les autres. Les matrices de distance génétique, calculées entre paires d accessions pour chaque type de marqueur dans un sous échantillon de 41 accessions, ne sont pas significativement différentes, mais les SSRg s avèrent plus efficaces que les SSRest pour estimer ces distances. Les deux types de microsatellites présentent la même cinétique de reconstruction de la topologie d un arbre donné. Les trois arbres, obtenus à partir du sous échantillon de 41 accessions analysé par les trois types de marqueurs pris individuellement, montrent une structure commune en terme de topologie qui est liée à l origine géographique des accessions. Ces résultats sont discutés en fonction de la nature et du niveau de neutralité des marqueurs vis-à-vis de la sélection. blé tendre/ structuration génétique/ microsatellite/ SNP/ arbre phylogénétique 1. INTRODUCTION L analyse des variations de séquence de l ADN est aujourd hui abondamment exploitée pour la cartographie génétique, l étiquetage de gènes ou encore l analyse de populations (analyse de diversité génétique, étude d évolution, ). De nombreux marqueurs moléculaires tels que les RFLP (Restriction Fragment Length polymorphism), les RAPD (Random Amplified Polymorphic DNA), les AFLP (Amplified Fragment Length polymorphism ) ou encore les SSR (Simple Sequence Repeat) ont été récemment utilisés pour conduire ce dernier type d analyse chez le blé tendre [13], [18], [21]. Parmi ces marqueurs, les microsatellites ou SSR sont réputés être les plus performants pour des analyses de diversité dans de vastes collections de ressources génétiques. Ce sont des séquences de quelques nucléotides (1 à 6) répétées en tandem, abondamment dispersées à travers tout le génome, multi-alléliques, co-dominantes et facilement amplifiables par PCR (Polymorphism Chain Reaction). Parmi ceux-ci, on distingue les SSR génomiques (SSRg), issus de banques enrichies en ADN génomique, des SSR développés à partir d EST (Expressed Sequence Tag) représentant les régions exprimées du génome (SSRest). Il a été démontré qu environ 10 % des contigs d EST de blé contiennent un microsatellite [9]. De par leur origine, les SSRg sont supposés présenter une neutralité plus importante vis-à-vis de la sélection que les SSRest possédant potentiellement une valeur sélective non nulle. Plus récemment, un nouveau type de marqueurs basés sur des changements ponctuels d une base dans une séquence donnée et appelés SNP (Single 130

3 Comparaison de marqueurs chez le blé tendre Nucleotide Polymorphism) a été développé. Ces marqueurs sont général e- ment bi-alléliques et permettent d appréhender des variations de gènes impliqués dans le contrôle de caractères d intérêts. Plusieurs études ont contr i- bué à la mise en évidence de SNP soit par séquençage de gènes sur collection [2], [11], soit par bioanalyse de séquences d EST regroupées en contigs et issues des bases de données [17]. Jusqu à présent, la recherche systémat i- que de SNP chez le blé a été conduite sur une cinquantaine de gènes env i- ron, ce qui a permis de mener quelques travaux de cartographie génétique et des études de génétique d association [3], [12]. Néanmoins, ces marqueurs, qui à l instar des SSRest révèlent un polymorphisme dans des gènes d intérêts, n ont encore jamais été utilisés à grande échelle pour décrire la diversité parmi de larges collections de ressources génétiques et analyser la façon dont ils peuvent structurer cette diversité. Dans l étude présentée ici, nous avons évalué la diversité génétique d un large échantillon de blé tendre déjà décrit pour un jeu de microsatellites g é- nomiques (SSRg), en utilisant un second jeu des microsatellites issus cette fois d EST (SSRest) ainsi qu un panel de SNP développés par ailleurs. Le but est d analyser l intérêt de ces types de marqueurs pour des études de diversité en comparant les différents niveaux de polymorphismes neutres et sélectionnés qu ils révèlent, ainsi que la façon dont ils permettent individuellement de structurer la diversité parmi les collections de ressources génétiques. En effet, pour une conservation optimale (non biaisée) de la diversité dans les collections il peut être préférable de se baser à priori sur la diversité neutre. Cependant, le développement récent de nouveaux marqueurs issus de parties codantes (SSRest, SNP) et destinés au départ plutôt à la recherche de gènes candidats ou d associations, doit nous amener à nous interroger aussi sur leur int é- rêt pour décrire, structurer et donc potentiellement servir de base dans des méthodes d optimisation pour la conservation de la diversité. L objet de cet article est de tenter de répondre à certaines de ces questions. 2. MATÉRIEL ET MÉTHODES 2.1. Choix du matériel d étude Un échantillon de 731 accessions de blé tendre, issues de la collection INRA conservées à Clermont-Ferrand, a été utilisé pour cette étude. Cet échantillon, composé de variétés de pays et de lignées fixées issues de plus de 60 origines géographiques différentes, a été choisi parmi plus de blés de la collection globale de manière à contenir la totalité des allèles microsatellites observés à l aide d un jeu de SSRg [13]. Il a en outre été choisi de façon à représenter un optimum de la diversité en terme d origine géo- 131

4 F. Balfourier et al. graphique et de périodes décennales d inscription au catalogue (lignées) ou de culture (variétés de pays) entre les années 1840 et L extraction d ADN a été réalisée à partir de plantules issues de semences de plantes autofécondées. Les feuilles de cinq à six plantes par accessions ont été mélangées, puis broyées avant d en extraire l ADN en mélange selon la méthode d extraction au métabisulfite [13] Microsatellites Le jeu de SSRg considéré pour la présente étude correspond à celui utilisé précédemment pour décrire la collection globale de blés [13], [14], [15]. Il s agit d un jeu de 37 SSRg donnant 38 loci polymorphes. Ces microsatellites ont été choisis selon leur répartition sur le génome (locus gwm et cfd sur fig. 1). Ce sont en majorité des microsatellites à motif dinucléotidique parfait. gpw7072 cfe167 gwm135 gwm11 gwm413 gpw7082 gwm337 gwm372 gwm312 gpw7438 gwm257 Gogat cfe68 gpw7325 gwm261 cfe78 gwm120 gwm539 cfe175 gwm480 BPGIPBM gwm664 gwm99 gpw7577 gpw7570 gwm642 cfe52 gpw7213 GaMyb cfe189 Aap Glu gpw7443 Glu gpw7335 1A 1B 1D 2A 2B 2D 3A 3B 3D gwm234 gwm469 cfe8 cfe273 gwm190 cfe214 cfd71 gpw7795 gpw7218 Pin B gwm325 gwm415 gpw7592 gwm610 gwm626 gpw7241 cfd71 Pbf Pbf Pbf gpw7574 gwm186 Gdh cfe300 gwm149 cfe186 cfe95 Gdh cfe301 gpw7666 Gdh gpw7425 gpw7107 gpw7384 gwm251 gwm408 gwm272 gwm427 gwm219 gpw7433 4A 4B 4D 5A 5B 5D 6A 6B 6D gwm46 gpw7288 gpw7185 gwm260 gpw7320 gpw7342 gwm400 gwm044 cfe135 Sal1 Sal1 gwm437 cfe248 gpw7596 Sal1 gpw7386 7A 7B 7D gwm2 gpw7553 gpw7452 gwm341 gwm566 cfe172 gpw7586 Figure 1 : Assignation des différents marqueurs aux différents bras chromosomiques du génome du blé tendre (SSRg, SSRest, gènes). Près de SSRest ont été développés ces dernières années au sein du laboratoire INRA de Clermont-Ferrand (885 gpw [9] ; 301 cfe [22]). Les conditions d exploitation de ceux-ci sont décrites dans la base de données Graingenes (http://wheat.pw.usda.gov). Pour notre étude, nous avons s é- lectionné 44 SSRest selon des critères de position sur le génome (compl é- mentaire au jeu de SSRg), de type de motif (di-, tri- ou tétranucléotides) et 132

5 Comparaison de marqueurs chez le blé tendre de facilité de lecture, de façon à couvrir in fine la totalité du génome avec autant que possible quatre microsatellites par chromosome (2 SSRg + 2 SSRest) (locus gpw et cfe sur fig. 1). Les conditions d amplification PCR et de lecture des allèles ont été celles décrites par Roussel et al. [14]. Les opérations de génotypage des microsatellites ont été réalisées sur la plate-forme de génotypage haut-débit INRA de Clermont-Ferrand SNP Les gènes étudiés concernent : le métabolisme azoté (AAP, Amino Acid Permease ; 2,3 BPGIPGM, 2,3 BiphosphoGlycerate Independant Phosphoglycerate Mutase; GDH, Glutamate-deshydrogenase; Gogat, glutamate synthase), la synthèse de protéines de réserve (Glu-A3 et Glu-D1-1, codant respectivement pour des gluténines de faible et de haut poids moléculaires), deux facteurs régulant l expression de gènes codants pour les protéines de réserve (wpbf et Gamyb), la dureté (PinB) et le nombre de couches d aleurone (Sal1, Super Aleurone Layer). Des SNP ont été détectés au sein de ces gènes par séquençage direct d un sous-échantillon de 42 lignées représentatives de la diversité dans le blé tendre (13 kb séquencées par lignée). Les informations nécessaires à l utilisation de ces SNP seront accessibles dans la base de SNP développée par l Unité de Recherche Génomique et Informatique (INRA, Evry) sur le site genoplante-info.infobiogen.fr. En tenant compte des copies homéologues, les gènes étudiés correspondent à 16 locus (fig. 1). Le génotypage des SNP candidats a été réalisé à l'aide de la technologie MassArray (Sequenom Inc., San Diego, CA). Après une amplification PCR, les produits issus de l'extension d'amorce ont été analysés par spe ctrométrie de masse MALDI-TOF Analyse des données La comparaison entre les trois types de marqueurs a tout d abord été réalisée à l aide d indices de diversité simples que sont le nombre de locus polymorphes, la richesse allélique (ou nombre d allèles) et la valeur PIC (Polymorphism Information Content = indice de diversité de Nei), indices calculés par locus, sur l ensemble des 731 individus. Les moyennes de ces indices ont été comparées à l aide d un test non paramétrique de Mann Whitney. Dans un second temps, l aptitude des différents marqueurs à structurer la diversité a été comparée par calcul de la distance génétique de Sokal et Michener entre paires d accessions pour les trois types de marqueurs (SSRg, SSRest 133

6 F. Balfourier et al. et SNP). Cette distance est définie dans Perrier et al. [10] comme étant égale à 1-P, où P est la proportion d allèles communs aux deux accessions. Les matrices de distances ont d abord été comparées deux à deux par le test de Mantel [8]. Puis elles ont permis de construire des arbres de classification hiérarchique selon la méthode du Neighbor-Joining [16]. Les coefficients de corrélation de Pearson entre ces matrices de distances prises deux à deux, puis entre les matrices de topologie caractérisant la structure de ch a- que arbre, ont également été calculés. Ces coefficients de corrélation ont été comparés deux à deux par la méthode de Lapointe et Legendre [7]. Enfin, les trois arbres obtenus ont été comparés deux à deux selon la méthode du MAST (Maximum Agreement Sub-Tree). Cette méthode repose sur l identification des accessions qui présentent une structuration commune dans chacun des deux arbres. On recherche l échantillon d accessions de taille maximale qui donne la même structure dans les deux arbres comparés ; ces accessions forment alors le MAST. La recherche de cet échantillon fait appel à un algorithme développé par Kubicka et al. [6] et proposé dans le logiciel DARwin [10]. Dans ce cas, le nombre d unités conservées dans le MAST, appelé l ordre «o» est considéré comme une mesure de ressemblance entre les deux arbres. La distribution statistique de ce critère «o» sous l hypothèse d indépendance des arbres n est pas connue mais a été approchée par simulation. Compte tenu de la taille des matrices et des arbres à manipuler, ces calculs ont été réalisés sur un échantillon plus restreint de 41 blés correspondant aux accessions ne présentant aucune donnée manquante, échantillon néanmoins bien représentatif des différentes origines géographiques prése n- tes dans les 731 accessions. 3. RÉSULTATS 3.1. Capacité des différents marqueurs à exprimer du polymorphisme Avec un total de 900 allèles, calculé sur l ensemble des 731 individus, les SSRg apparaissent de loin les marqueurs les plus polymorphes, co mparés aux SSRest (183 allèles) et aux SNP (69 haplotypes) (tabl. I); le nombre d allèles par locus varie ainsi de 7 à 45 pour les SSRg et seulement de 1 à 14 pour les SSRest, tandis que le nombre d haplotypes par locus étudié pour les SNP varie de 2 à 11 dans notre échantillon (un haplotype correspondant ici à la combinaison de différents SNP au même locus). Neuf locus SSRest apparaissent ici non polymorphes. Ramenés aux seuls locus polymorphes, les calculs du nombre moyen d allèles et de la valeur PIC moyenne indiquent 134

7 Comparaison de marqueurs chez le blé tendre clairement que les SSRg sont signif icativement plus polymorphes (p < 0,0001), tandis que SSRest et SNP présentent un même niveau de polymorphisme. Tableau I : Indices de diversité, par type de marqueurs, calculés à partir des 731 individus. Type de marqueurs Nombre d allèles (SSRs) ou d haplotypes (SNPs) Nbre. de locus Nbre. moyen d allele/locus Valeur PIC moyenne/locus total mini-maxi polymorphes polymorphes polymorphes 38 SSRg ,68 0, SSRest ,97 0, gènes ,31 0,353 L analyse de la valeur PIC, moyennée par type de marqueur et par génome du blé tendre (tabl. II) confirme le niveau significativement plus élevé de diversité pour les SSRg et ce quel que soit le génome considéré, tandis que les SSRest et SNP ne semblent pas significativement différents dans notre échantillon. Enfin, que l on considère les marqueurs indépendamment ou en totalité, sans doute compte tenu de nos effectifs en locus, il n apparaît pas ici de différence significative de niveau de diversité entre les génomes A, B ou D. Tableau II : Indices de diversité par type de marqueurs et par génomes. Type de marqueur Nbre. locus poly. Genome A Genome B Genome D Valeur PIC Nbre. Valeur PIC Nbre. moyenne locus moyenne locus Valeur PIC moyenne poly. poly. SSRg 12 0, , ,775 SSRest 13 0, , ,205 SNP 4 0, , ,196 total/genome 29 0, , ,459 L analyse du niveau de polymorphisme des SSRest en fonction de leur motif de base (tabl. III) indique que les SSRest au motif di-nucléotidique sont significativement plus polymorphes (p<0.0012) que les tri- et tétranucléotidiques. Par ailleurs, sept parmi les neuf SSRest non polymorphes ont des motifs tri-nucléotidiques. Ainsi, il semble que le niveau global de polymorphisme d un SSRest décroisse avec la taille de son motif de base. Tableau III : Valeur PIC moyenne en fonction du motif microsatellite des SSRest. Motif microsatellite Di-nucléotidique Tri-nucléotidique Tétra-nucléotidique Nbre. locus total Nbre locus polymorphes Valeur PIC moyenne 0,532 0,224 0,

8 F. Balfourier et al Efficacité des marqueurs à estimer une distance génétique entre paire d accessions La distance génétique moyenne de Sokal et Michener entre paires d accessions est plus faible lorsqu elle est basée sur les SSRg (0,167) que lorsqu elle est calculée sur les SSRest (0,242) ou les SNP (0,267). Global e- ment, les différents tests de Mantel effectués montrent que les matrices de distances obtenues pour chaque type de marqueurs (SSRg, SSRest et SNP) ne sont pas significativement différentes au seuil de 1 %. Figure 2 : Évolution du coefficient de variation moyen de la distance génétique mesurée entre paires d accessions, en fonction du nombre de marqueurs utilisés. 136

9 Comparaison de marqueurs chez le blé tendre La figure 2 représente l évolution du coefficient de variation (CV) moyen de la distance génétique mesurée entre paires d accessions, en fonction du nombre de microsatellites utilisés, et ce pour les deux types de marqueurs microsatellites. Chaque point a été calculé à partir de 200 matrices de distance 41x41 obtenues par bootstraps sur les marqueurs. À effectif identique en marqueurs, on observe la moindre efficacité des SSRest par rapport aux SSRg ; ainsi, la figure 2 montre que le seuil de 10 % pour le CV sur la distance génétique entre paires d accessions serait atteint en utilisant une cinquantaine de marqueurs SSRg, tandis qu il faudrait plus d une centaine de SSRest pour atteindre ce même seuil. Les coefficients de corrélation de Pearson calculés deux à deux entre les trois matrices de distance, obtenues selon les trois types de marqueurs, sont indiqués dans le tableau IV (partie sous la diagonale). Ces trois coefficients sont significatifs au seuil de 1 %, c'est-à-dire supérieurs à la corrélation attendue avec une matrice de distance permutée au hasard. On observe que la corrélation la plus forte apparaît entre SSRg et SSRest, alors qu elle est la plus faible entre SSRg et SNP. Tableau IV : Coefficients de corrélation entre matrices de topologie (au dessus de la diagonale) et matrices de distance (en dessous de la diagonale) selon les différents types de marqueurs. Matrice SSRg Matrice SSRest Matrice SNP Matrice SSRg 0,520** 0,379** Matrice SSRest 0,417** 0,421** Matrice SNP 0,301** 0,322** 3.3. Efficacité des marqueurs à structurer la diversité Dans un premier temps, nous avons comparé la façon dont les deux types de SSR permettaient d obtenir un arbre de structure donnée, appelé ici arbre de référence. Nous avons considéré comme arbre de référence l arbre global obtenu sur les 41 individus avec la totalité des marqueurs SSR polymorphes (soit 30 et 38 pour les SSRest et les SSRg, respectivement). La figure 3 représente, pour les deux types de microsatellites, la distribution (sous forme de boxplots) de la valeur de l ordre o du MAST obtenue en comparant des arbres réalisés avec un nombre croissant de marqueurs, à l arbre de référence. Afin d avoir une idée de la distribution de o, quinze tirages sans remise ont été effectués pour chaque quantité de microsatellites utilisée. La valeur moyenne de o obtenue pour un tirage de cinq microsatellites apparaît significative au seuil de 5 % pour les deux types de marqueurs, ce qui signifie que l arbre obtenu avec cinq marqueurs présente une ressemblance non liée au hasard avec son arbre de référence. Par ailleurs, nous constatons qu une même proportion de marqueurs conduit, pour chaque type de microsatellites, à une valeur iden- 137

10 F. Balfourier et al. tique de l ordre o ; la cinétique de reconstruction de l arbre de référence est donc identique pour les deux types de SSR. Enfin, nous observons que la valeur de l ordre o n est en moyenne que d environ 28 accessions pour respectivement 37 SSRg et 29 SSRest, comparée aux 41 accessions des arbres de référence. Nous constatons ici combien l apport d un dernier marqueur su p- plémentaire vient encore modifier les structures des arbres, ce qui traduit le fait qu il faudrait sans doute beaucoup plus de marqueurs, dans le cas de notre échantillon de blé, pour stabiliser la structure des arbres. Figure 3 : Distribution (sous forme de boxplots) et pour les deux types de marqueurs, de la valeur de l ordre o du MAST obtenue en comparant des arbres réalisés avec un nombre croissant de marqueurs, à l arbre de référence. 138

11 Comparaison de marqueurs chez le blé tendre Enfin la figure 4 représente les arbres de référence obtenus à partir des trois matrices de distance, selon les différents marqueurs. Les trois types de marqueurs permettent de différencier chacune des accessions les unes des autres. Le label utilisé pour caractériser les 41 accessions correspond ici au pays d origine de l accession (Iso3166), suivi éventuellement d un numéro d identification dans le pays considéré. Les coefficients de corrélation, calculés à partir des matrices de topologie de ces trois arbres, sont présentés dans le tableau IV (au dessus de la diagonale). Ces trois coefficients sont significatifs au seuil de 1 %, ce qui indique que les ressemblances topologiques de ces trois arbres, pris deux-à-deux, ne sont pas dues au hasard. Une fois encore la corrélation la plus forte est trouvée entre SSRg et SSRest, la plus faible étant entre SSRg et SNP. Sur la figure 4, compte tenu des échelles différentes de distances entre n uds, l arbre SSRg apparaît comme le plus compact. À un niveau élevé de coupure de l arbre, il permet de distinguer clairement deux classes : la classe de droite (E) regroupe uniquement des accessions provenant d Europe (FRA, DEU, GBR, BEL, NOR, ) et d Amérique du Nord, à l exception de l accessions AFG-2 provenant d Afghanistan. La classe de gauche (A), regroupe quant à elle une majorité d accessions issues d Asie (AFG, CHN, IND, JPN, NPL,..) d Afrique (DZA, MAR) et d Amérique du Sud (ARG, COL, CHL), en plus de quelques accessions européennes. Nous retrouvons ici la structuration en deux grands pools de materiel : le pool des blés européens (E), comprenant également les blés d Amérique du Nord et le pool des blés asiatiques (A) auxquels sont rattachés les blés issus de la révolution verte utilisés en Afrique et en Amérique du Sud. Cette structure forte en deux grandes classes se r e- trouve presque à l identique aussi bien dans l arbre issu des SSRest que dans celui issu des SNP. Par contre à l intérieur de ces deux classes, à un niveau plus faible de coupure de l arbre, il n est pas possible de mettre en évidence, dans notre échantillon, des structures ou regroupements vraiment stables d un arbre à l autre. 139

12 F. Balfourier et al. A E A E A E Figure 4 : Arbres de référence des 41 accessions de blé tendre, obtenus selon les trois types de marqueurs. 140

13 Comparaison de marqueurs chez le blé tendre 4. DISCUSSION 4.1. Détection du polymorphisme A notre connaissance, c est la première fois qu est rapportée une telle étude de diversité, menée sur un échantillon aussi large de blé tendre à l aide de marqueurs nouvellement développés comme les SSRest et surtout les SNP. La mise en évidence d un plus haut niveau de polymorphisme des SSRg par rapport aux SSRest (tabl. I) va dans le sens de résultats déjà publiés à propos des caractéristiques des marqueurs microsatellites issus d EST [1], [4]. Cette différence pourrait peut-être s expliquer par des taux de mutations différents pour ces deux types de microsatellites ; on sait en effet que les SSRg présentent de forts taux de mutation [19] qui sont probablement plus élevés que ceux des SSRest. Elle est sans doute aussi explicable par la nature même des SSRest qui sont issus de séquences exprimées, donc certainement plus conservées que les zones du génome dont proviennent les SSRg. Cette origine des SSRest expliquerait également qu ils présentent un niveau de polymorphisme équivalent à celui des SNP. Les SSRg au motif dinucléotidique sont connus pour être d une façon générale plus polymorphes, probablement parce que le nombre de répétitions de leur motif de base est plus grand. Il est cependant surprenant d observer ce même résultat chez les SSRest (tabl. III) puisque l ajout ou le retrait d un tel motif perturbe automatiquement le cadre de lecture. Nous n avons pas vérifié la localisation exacte (5 UTR, 3 UTR ou partie codante) de ce jeu précis de SSRest dans les séquences, mais ceci peut être fait à partir de la base Graingenes. Les résultats de Varshney et al. [20] selon lesquels les régions 3 UTR révèlent le plus de polymorphisme n ont pu donc être vérifiés. Cependant, d après les résultats de Nicot et al. [9] travaillant sur un échantillon plus large de marqueurs SSRest dont est issu notre jeu, il y avait la même proportion de marqueurs issus de chacune des trois régions Distances génétiques et matrices de distances Les plus fortes moyennes de distances génétiques observées pour les SSRest et les SNP, par rapport aux SSRg, sont sans doute liées au nombre de marqueurs utilisés. Toutes les comparaisons effectuées entre matrices de distance montrent que les différents marqueurs conduisent globalement à des structures identiques entre accessions (tabl. IV). Les tests, par ailleurs peu puissants, ne pe r- mettent donc pas de rendre compte de la nature différente des marqueurs. La valeur relative des corrélations entres les trois types de matrice rend sans doute mieux compte de ce phénomène. En effet, la corrélation la plus forte est trouvée entre les deux marqueurs de types microsatellites, la plus faible 141

14 F. Balfourier et al. étant entre SSRg et SNP : ceci peut sans doute s expliquer par le niveau de neutralité des marqueurs vis-à-vis de la sélection. Par ailleurs, la moindre efficacité des SSRest à estimer une distance génétique avec précision (fig. 2) s explique probablement par le plus faible polymorphisme de ces marqueurs, comparés aux SSRg. Vu le faible nombre de marqueurs SNP (16) la même analyse statistique du CV n a pu être conduite pour ces marqueurs mais il est vraisemblable qu ils auraient, du fait du faible nombre d haplotypes, conduits à des résultats similaires aux SSRest Matrices de topologie et reconstruction d arbres L étude de la cinétique de reconstruction des arbres de référence (fig. 3) ne permet pas de mettre en évidence des différences entre les deux types de SSR. Dans les deux cas, les arbres restent très instables jusqu au dern ier marqueur introduit. Ce résultat est assez surprenant ; il doit être lié à la nature de notre échantillon d accessions de blé tendre. En effet, celui-ci est constitué, par construction, d accessions très diversifiées, appartenant toutes à la même espèce et en même temps non récemment apparentées. Il faudrait sans doute beaucoup plus de marqueurs pour conduire à des structures d arbre plus stables. Peu d études ont, jusqu à présent, eu pour objet de comparer des arbres de diversité génétique obtenus par les différents marqueurs utilisés ici. Une étude de pedigrees menée sur sept orges à l aide de SSRest et de SNP [5] montre que les deux types de marqueurs conduisent à des résultats similaires mais non identiques. Il existe diverses méthodes de comparaisons d arbres [10]. Ainsi, par exemple, les méthodes consensus supposent que toutes les accessions d un arbre soient correctement représentées, c'est-à-dire que leurs n uds d embranchement présentent de fortes valeurs de bootstraps. Dans les méthodes consensus, toutes les accessions ont le même poids ; les quelques unes au comportement plus erratique peuvent alors masquer une stru c- ture commune. Dans notre étude, les valeurs (non représentées) des bootstraps sont faibles à cause de la nature même de l échantillon et du nombre de marqueurs utilisés. Cependant les trois arbres de la figure 4 semblent avoir globalement une structure commune, excepté pour quelques accessions. C est pourquoi nous avons utilisé d autres approches de comparaison comme les méthodes purement topologiques qui ne tiennent pas compte de la longueur des branches ou la méthode du MAST qui permet d éliminer les accessions les plus fluctuantes pour mettre en évidence une structure co m- mune. Ici, la structure commune aux trois arbres est celle liée à l origine géographique des accessions, structure larg ement décrite par Roussel [13] et qui sépare grossièrement le pool des blés «européens» de celui des blés «asiatiques». Cette structure, d origine démographique et évolutive, qui 142

Les documents présentés dans ce cours sont issus : soit de travaux personnels soit de travaux présentés sur le web Leur utilisation ne doit donner

Les documents présentés dans ce cours sont issus : soit de travaux personnels soit de travaux présentés sur le web Leur utilisation ne doit donner Les documents présentés dans ce cours sont issus : soit de travaux personnels soit de travaux présentés sur le web Leur utilisation ne doit donner lieu à aucune exploitation commerciale D. LOCKER Professeur

Plus en détail

Polymorphismes de l ADN

Polymorphismes de l ADN Introduction Polymorphismes de l ADN Présentation et mise en évidence Recherche de gènes responsables de maladies génétiques : Analyse de pedigrees où la maladie est présente Sur quel chromosome? À quel

Plus en détail

I. TOUITOU (Mise ligne 15/10/08 LIPCOM-RM) Faculté de Médecine Montpellier-Nîmes

I. TOUITOU (Mise ligne 15/10/08 LIPCOM-RM) Faculté de Médecine Montpellier-Nîmes er cycle PCEM MI5 Génétique moléculaire et clinique Année Universitaire 008-009 Comment apprécier la composante héréditaire des maladies?. Excès de cas familiaux - Les études familiales - - La plupart

Plus en détail

Modélisation coalescente pour la détection précoce d un cancer

Modélisation coalescente pour la détection précoce d un cancer Modélisation coalescente pour la détection précoce d un cancer Mathieu Emily 27 Novembre 2007 Bioinformatics Research Center - Université d Aarhus Danemark Mathieu Emily Coalescence et cancer 1 Introduction

Plus en détail

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq Présenté par Xi LIU ATCGCGCTAGCTGGTGTATCGCATCGCGCTAGCTGGTGTATCGCGCTAGCTGGTGTATCGCGCTAGCCTGGTGTATCGCCATCGCGCTAGCTGGCGCTAGCTGAATCGCGCATATG 17 Septembre 2013 Homéoallèles Génome Normalisation Analyse différentielle

Plus en détail

TEST MMR POUR TUMEURS COLIQUES EN PRATIQUE COURANTE? Karen LEROY Hôpital Henri Mondor, Créteil

TEST MMR POUR TUMEURS COLIQUES EN PRATIQUE COURANTE? Karen LEROY Hôpital Henri Mondor, Créteil TEST MMR POUR TUMEURS COLIQUES EN PRATIQUE COURANTE? Karen LEROY Hôpital Henri Mondor, Créteil 47 Définition du phénotype MSI (MicroSatellite Instability) Environ 15% des cancers colo-rectaux présentent

Plus en détail

Les outils bio-moléculaires en sélection

Les outils bio-moléculaires en sélection Les outils bio-moléculaires en sélection Vers l utilisation d outils de génotypage haut débit - FN3PT/ Inra UMR Igepp Vers l utilisation du génotypage haut débit en sélection Sélection assistée par marqueurs

Plus en détail

TD Bioinformatique : Sequence Alignment. Pourquoi faire une recherche par similarité?

TD Bioinformatique : Sequence Alignment. Pourquoi faire une recherche par similarité? TD Bioinformatique : Sequence lignment Pourquoi faire une recherche par similarité? - Savoir si ma séquence ressemble à d'autres déjà connues. - Trouver toutes les séquences d'une même famille. - Rechercher

Plus en détail

Kit d extraction PicoPure RNA

Kit d extraction PicoPure RNA Isoler des ARN même à partir d une cellule Le kit d extraction PicoPure RNA a été développé pour obtenir une haute qualité des ARNs totaux à partir d un minimum de dix cellules. Le haut rendement obtenu

Plus en détail

Quelques définitions

Quelques définitions Quelques définitions Sandrine Lagarrigue et Pascale Le Roy 1 Journée Technique SYSAAF La mise en œuvre des outils de la génomique : enjeux pour le SYSAAF et ses adhérents. 03 juin 2015. Rennes Le génome

Plus en détail

Kit d extraction PicoPure DNA

Kit d extraction PicoPure DNA Directement à la PCR Le kit PicoPure DNA permet une extraction simple et rapide de l ADN génomique prêt à l utilisation en PCR. Extraire et amplifier l ADN dans le même tube, sans phase d extraction organique

Plus en détail

Cours d introduction à la génétique de la souris Notion de Souche

Cours d introduction à la génétique de la souris Notion de Souche Cours d introduction à la génétique de la souris Notion de Souche Introduction: - Réponse d un animal à l expérimentation (diapo 1) Facteurs environnementaux et propres à l animal - Notion d animal standardisé

Plus en détail

Les simulations dans l enseignement des sondages Avec le logiciel GENESIS sous SAS et la bibliothèque Sondages sous R

Les simulations dans l enseignement des sondages Avec le logiciel GENESIS sous SAS et la bibliothèque Sondages sous R Les simulations dans l enseignement des sondages Avec le logiciel GENESIS sous SAS et la bibliothèque Sondages sous R Yves Aragon, David Haziza & Anne Ruiz-Gazen GREMAQ, UMR CNRS 5604, Université des Sciences

Plus en détail

Interprétation des résultats et troubleshooting

Interprétation des résultats et troubleshooting Interprétation des résultats et troubleshooting Le Service de séquençage du Centre d innovation Génome Québec et Université McGill utilise des appareils 3730xl DNA Analyzer d Applied Biosystems. Cette

Plus en détail

Maladies communes (multifactorielles)

Maladies communes (multifactorielles) Maladies communes (multifactorielles) Des variations individuelles (polymorphismes) au niveau de certains gènes peuvent prédisposer (ou protéger) à une maladie en interaction avec des facteurs de l environnement

Plus en détail

Introduction à l analyse statistique et bioinformatique des puces à ADN

Introduction à l analyse statistique et bioinformatique des puces à ADN Formation INSERM 10 février 2004 Introduction à l analyse statistique et bioinformatique des puces à ADN Gaëlle Lelandais lelandais@biologie.ens.fr 1 Première Partie Analyse d une puce à ADN : Le recherche

Plus en détail

Quentin Rougemont, Guillaume Evanno, Sophie Launey INRA Rennes UMR ESE

Quentin Rougemont, Guillaume Evanno, Sophie Launey INRA Rennes UMR ESE Quentin Rougemont, Guillaume Evanno, Sophie Launey INRA Rennes UMR ESE Rennes Le 19/02/2013 Evolution de l anadromie chez les lamproies Contexte général Objectifs Méthodologie Etats des connaissances Résultats

Plus en détail

Approche pour le suivi de l évolution des données d usage du Web : application sur un jeu de données en marketing

Approche pour le suivi de l évolution des données d usage du Web : application sur un jeu de données en marketing Approche pour le suivi de l évolution des données d usage du Web : application sur un jeu de données en marketing Alzennyr Da Silva, Yves Lechevallier Projet AxIS, INRIA Paris-Rocquencourt Domaine de Voluceau,

Plus en détail

Deuxième partie. Calcul de fréquences de génotypes multilocus dans des pédigrees complexes XXVII

Deuxième partie. Calcul de fréquences de génotypes multilocus dans des pédigrees complexes XXVII Deuxième partie Calcul de fréquences de génotypes multilocus dans des pédigrees complexes XXVII Présentation Les programmes informatiques MDM et grafgen L analyse de schémas de construction de génotypes

Plus en détail

Génotypage par séquençage d une grande population (BCNAM) de sorgho.

Génotypage par séquençage d une grande population (BCNAM) de sorgho. Generation Challenge Programme Research Initiative II : Amélioration de la productivité et de la qualité du grain de sorgho dans les régions soudanosahéliennes. Génotypage par séquençage d une grande population

Plus en détail

Statistique en grande dimension pour la génomique Projets 2014-2015 L. Jacob, F. Picard, N. Pustelnik, V. Viallon

Statistique en grande dimension pour la génomique Projets 2014-2015 L. Jacob, F. Picard, N. Pustelnik, V. Viallon Statistique en grande dimension pour la génomique Projets 2014-2015 L. Jacob, F. Picard, N. Pustelnik, V. Viallon Table des matières 1 Graph Kernels for Molecular Structure-Activity Relationship Analysis

Plus en détail

Plan. Comparaison de 2 séquences. Dotplot, alignement optimal Recherche de similarité. Alignement multiple. Phylogénie moléculaire

Plan. Comparaison de 2 séquences. Dotplot, alignement optimal Recherche de similarité. Alignement multiple. Phylogénie moléculaire Plan 1 Banques de données 2 Comparaison de 2 séquences Dotplot, alignement optimal Recherche de similarité 3 Alignement multiple l 4 Phylogénie moléculaire Recherche de similarité 1 séquence (Query) comparée

Plus en détail

Gènes Diffusion - EPIC 2010

Gènes Diffusion - EPIC 2010 Gènes Diffusion - EPIC 2010 1. Contexte. 2. Notion de génétique animale. 3. Profil de l équipe plateforme. 4. Type et gestion des données biologiques. 5. Environnement Matériel et Logiciel. 6. Analyses

Plus en détail

Lettres: A, T, G, C. Mots: à 3 lettres (codons) Phrase: gène (information pour synthétiser une protéine). Ponctuation

Lettres: A, T, G, C. Mots: à 3 lettres (codons) Phrase: gène (information pour synthétiser une protéine). Ponctuation 2- Les molécules d ADN constituent le génome 2-1 La séquence d ADN représente l information génétique Lettres: A, T, G, C Mots: à 3 lettres (codons) Phrase: gène (information pour synthétiser une protéine).

Plus en détail

Nos Métiers. Historique. Notre Vision. Notre Mission

Nos Métiers. Historique. Notre Vision. Notre Mission Historique 1958 : Création de la SMMO : Minoterie de blé tendre à Oujda. Première minoterie cotée en bourse entre 1972 et 1980. 1989 : Création de la société COPATES ; première unité industrielle de production

Plus en détail

Résumé de thèse de David Kieffer. Titre : Études Bio-informatiques et statistiques des mécanismes de l infidélité de la transcription.

Résumé de thèse de David Kieffer. Titre : Études Bio-informatiques et statistiques des mécanismes de l infidélité de la transcription. Résumé de thèse de David Kieffer Titre : Études Bio-informatiques et statistiques des mécanismes de l infidélité de la transcription. Dans le cadre de la lutte contre le cancer, l'entreprise Genclis (Genomic

Plus en détail

Domaine de Melgueil, 34130 Mauguio, France (3)

Domaine de Melgueil, 34130 Mauguio, France (3) Les Actes du BRG, 6 (2006) 57-74 BRG, 2006 Article original Analyse et prédiction des patrons de déséquilibre de liaison dans les collections de ressources génétiques de plantes pérennes ou annuelles,

Plus en détail

Barcoding environnemental par séquençage haut débit

Barcoding environnemental par séquençage haut débit Barcoding environnemental par séquençage haut débit Potentiel et limites Jean-François Martin Échantillonnage Spécificités du barcoding environnemental Amplification (PCR) de marqueurs choisis Séquençage

Plus en détail

Arbres binaires. Hélène Milhem. Institut de Mathématiques de Toulouse, INSA Toulouse, France IUP SID, 2011-2012

Arbres binaires. Hélène Milhem. Institut de Mathématiques de Toulouse, INSA Toulouse, France IUP SID, 2011-2012 Arbres binaires Hélène Milhem Institut de Mathématiques de Toulouse, INSA Toulouse, France IUP SID, 2011-2012 H. Milhem (IMT, INSA Toulouse) Arbres binaires IUP SID 2011-2012 1 / 35 PLAN Introduction Construction

Plus en détail

Chapitre 1. L algorithme génétique

Chapitre 1. L algorithme génétique Chapitre 1 L algorithme génétique L algorithme génétique (AG) est un algorithme de recherche basé sur les mécanismes de la sélection naturelle et de la génétique. Il combine une stratégie de survie des

Plus en détail

IDENTIFICATION DES PERSONNES PAR TESTS GENETIQUES

IDENTIFICATION DES PERSONNES PAR TESTS GENETIQUES IDENTIFICATION DES PERSONNES PAR TESTS GENETIQUES DIFFERENTES SITUATIONS - Pénal: affaires criminelles FNAEG (950000 individus actuellement) individus associés aux affaires - Civil: tests de paternité

Plus en détail

Marketing Authorization for Gluten-free Oats and Foods Containing Glutenfree

Marketing Authorization for Gluten-free Oats and Foods Containing Glutenfree CANADA CONSOLIDATION CODIFICATION Marketing Authorization for Gluten-free Oats and Foods Containing Glutenfree Oats Autorisation de mise en marché d avoine sans gluten et d aliments contenant de l avoine

Plus en détail

Sélection de variables groupées avec les forêts aléatoires. Application à l analyse des données fonctionnelles multivariées.

Sélection de variables groupées avec les forêts aléatoires. Application à l analyse des données fonctionnelles multivariées. Sélection de variables groupées avec les forêts aléatoires. Application à l analyse des données fonctionnelles multivariées. Baptiste Gregorutti 12, Bertrand Michel 2 & Philippe Saint Pierre 2 1 Safety

Plus en détail

TP de Biochimie Groupe 4 Forestier Michèle 25.05.2010 Fournier Coralie Freyre Christophe Manipulation d ADN

TP de Biochimie Groupe 4 Forestier Michèle 25.05.2010 Fournier Coralie Freyre Christophe Manipulation d ADN MANIPULATION D ADN Clonage du gène «venus» dans des plasmides et expression de celui-ci chez les bactéries E.Coli. Assistants: U. Loizides M. Umebayashi C. Gehin - 1 - 1. Résumé Lors de notre expérience,

Plus en détail

Le licenciement des salariés protégés

Le licenciement des salariés protégés Le licenciement des salariés protégés Les salariés bénéficiant de dispositions légales protectrices sont d abord et avant tout les représentants du personnel: délégués du personnel, membres des comités

Plus en détail

B/. 1 1 fr -I- 2 f", I! Méthode de prise en compte de la consanguinité dans un modèle simple de simulation de performances

B/. 1 1 fr -I- 2 f, I! Méthode de prise en compte de la consanguinité dans un modèle simple de simulation de performances NOTE Méthode de prise en compte de la consanguinité dans un modèle simple de simulation de performances J.-L. FOULLEY C. CHEVALET LN.R.A., Station de Génétique quantitative et appliquée, Centre de Recherches

Plus en détail

Méthodes d apprentissage :

Méthodes d apprentissage : Méthodes d apprentissage : application au tri de complexes protéines-protéines Jérôme Azé Apprentissage: tâches Apprentissage non supervisé (Eisen, ) Apprentissage supervisé (arbres de décision, k-ppv,

Plus en détail

Mariane ALLEAUME-BENHARIRA Sylvie ODDOU-MURATORIO François LEFEVRE. Ecologie des forêts méditerranéennes INRA AVIGNON - FRANCE

Mariane ALLEAUME-BENHARIRA Sylvie ODDOU-MURATORIO François LEFEVRE. Ecologie des forêts méditerranéennes INRA AVIGNON - FRANCE MODELISER L IMPACT DES CHANGEMENTS DEMOGRAPHIQUES ET ENVIRONNEMENTAUX SUR L EVOLUTION DES ARBRES Le module Luberon Version 2010 Mariane ALLEAUME-BENHARIRA Sylvie ODDOU-MURATORIO François LEFEVRE Ecologie

Plus en détail

Approche bayésienne des modèles à équations structurelles

Approche bayésienne des modèles à équations structurelles Manuscrit auteur, publié dans "42èmes Journées de Statistique (2010)" Approche bayésienne des modèles à équations structurelles Séverine Demeyer 1,2 & Nicolas Fischer 1 & Gilbert Saporta 2 1 LNE, Laboratoire

Plus en détail

Highly efficient gene transfer into hepatocyte-like HepaRG cells: new means for drug metabolism and toxicity studies

Highly efficient gene transfer into hepatocyte-like HepaRG cells: new means for drug metabolism and toxicity studies Biotechnology Author manuscript, Journal published in "Biotechnology Journal, (00) " DOI : 0.00/biot.0000 Highly efficient gene transfer into hepatocyte-like HepaRG cells: new means for drug metabolism

Plus en détail

Principales techniques utilisées en génie génétique Ces différentes techniques peuvent également se combiner entre elles. Séquençage de l ADN

Principales techniques utilisées en génie génétique Ces différentes techniques peuvent également se combiner entre elles. Séquençage de l ADN Principales techniques utilisées en génie génétique Ces différentes techniques peuvent également se combiner entre elles Séquençage de l ADN 1- Un brin complémentaire de l ADN à séquencer est fabriqué

Plus en détail

FEDERATION INTERNATIONALE DE L AUTOMOBILE. Norme 8861-2000

FEDERATION INTERNATIONALE DE L AUTOMOBILE. Norme 8861-2000 FEDERATION INTERNATIONALE DE L AUTOMOBILE Norme 8861-2000 NORME FIA CONCERNANT LA PERFORMANCE DES DISPOSITIFS D'ABSORPTION D'ÉNERGIE À L'INTÉRIEUR DES BARRIÈRES DE PNEUS DE FORMULE UN Ce cahier des charges

Plus en détail

Entandrophragma cylindricum (Sprague) Sprague, au sud-est du Cameroun

Entandrophragma cylindricum (Sprague) Sprague, au sud-est du Cameroun Fabien Garcia * Gilles Moynot * Eric Forni ** Marie-Hélène Chevallier * * CIRAD-Forêt TA 10/C Programme forêts naturelles Campus international de Baillarguet 34398 Montpellier Cedex 5 France ** BP 2572

Plus en détail

Biodiversité, Taxonomie et Barcode moléculaire. Nicolas Puillandre puillandre@mnhn.fr

Biodiversité, Taxonomie et Barcode moléculaire. Nicolas Puillandre puillandre@mnhn.fr Biodiversité, Taxonomie et Barcode moléculaire Nicolas Puillandre puillandre@mnhn.fr Biodiversité : - les écosystèmes - les espèces - les gènes Taxonomie : Description des unités taxonomiques Classification

Plus en détail

Annales du Contrôle National de Qualité des Analyses de Biologie Médicale

Annales du Contrôle National de Qualité des Analyses de Biologie Médicale Annales du Contrôle National de Qualité des Analyses de Biologie Médicale ARN du virus de l hépatite C : ARN-VHC ARN-VHC 03VHC1 Novembre 2003 Edité : mars 2006 Annales ARN-VHC 03VHC1 1 / 8 ARN-VHC 03VHC1

Plus en détail

Product Platform Development: A Functional Approach Considering Customer Preferences

Product Platform Development: A Functional Approach Considering Customer Preferences Product Platform Development: A Functional Approach Considering Customer Preferences THÈSE N O 4536 (2009) PRÉSENTÉE le 4 décembre 2009 À LA FACULTé SCIENCES ET TECHNIQUES DE L'INGÉNIEUR LABORATOIRE DES

Plus en détail

Silene latifolia (Caryophyllaceae) sex chromosome evolution

Silene latifolia (Caryophyllaceae) sex chromosome evolution Diss. ETH N 20391 Silene latifolia (Caryophyllaceae) sex chromosome evolution A dissertation submitted to ETH ZURICH for the degree of DOCTOR OF SCIENCES presented by Nicolas Blavet Master of Science in

Plus en détail

Génotypage et Séquençage. Pierre Mournet

Génotypage et Séquençage. Pierre Mournet Génotypage et Séquençage Pierre Mournet Plan Séquençage/Génotypage Classique (usat, Sanger) Séquençage NGS (Next Generation Sequencing) Séquenceur Préparation Pré-NGS Exemple 1 NGS Exemple 2 NGS Génotypage

Plus en détail

Les microarrays: technologie pour interroger le génome

Les microarrays: technologie pour interroger le génome Les microarrays: technologie pour interroger le génome Patrick DESCOMBES patrick.descombes@frontiers-in-genetics.org Plate forme génomique NCCR Frontiers in Genetics Université de Genève http://genomics.frontiers-in-genetics.org

Plus en détail

Sondage stratifié. Myriam Maumy-Bertrand. Master 2ème Année 12-10-2011. Strasbourg, France

Sondage stratifié. Myriam Maumy-Bertrand. Master 2ème Année 12-10-2011. Strasbourg, France 1 1 IRMA, Université de Strasbourg Strasbourg, France Master 2ème Année 12-10-2011 Ce chapitre s appuie essentiellement sur deux ouvrages : «Les sondages : Principes et méthodes» de Anne-Marie Dussaix

Plus en détail

Explications théoriques

Explications théoriques Explications théoriques L'ADN: Définitions L'ADN (Acide Désoxyribo Nucléique) est la molécule qui est utilisée dans la nature comme support matériel de l'information génétique des êtres vivants, un peu

Plus en détail

L essentiel sur les tests statistiques

L essentiel sur les tests statistiques L essentiel sur les tests statistiques 21 septembre 2014 2 Chapitre 1 Tests statistiques Nous considérerons deux exemples au long de ce chapitre. Abondance en C, G : On considère une séquence d ADN et

Plus en détail

Génotypage par Séquençage (GBS) : Création d une carte génétique haute densité de Tournesol Population INEDI (RILs PSC8 x XRQ)

Génotypage par Séquençage (GBS) : Création d une carte génétique haute densité de Tournesol Population INEDI (RILs PSC8 x XRQ) Génotypage par Séquençage (GBS) : Création d une carte génétique haute densité de Tournesol Population INEDI (RILs PSC8 x XRQ) Baptiste Mayjonade (IE-CDD SUNRISE) Génétique et génomique des réponses aux

Plus en détail

Corrigé du TD1. Exercice 1:

Corrigé du TD1. Exercice 1: Corrigé du TD1 Exercice 1: le but était d'aligner des séquences à la main et de compter les substitutions entre acides aminés observées. Le résultat se trouve à cette adresse: http://tagc.univ-mrs.fr/herrmann/bio6/displaymatrix.php

Plus en détail

Intérêt énergétique de l utilisation de matériaux à changement de phase (MCP) dans un chauffe-eau utilisant une source d énergie électrique

Intérêt énergétique de l utilisation de matériaux à changement de phase (MCP) dans un chauffe-eau utilisant une source d énergie électrique Intérêt énergétique de l utilisation de matériaux à changement de phase (MCP) dans un chauffe-eau utilisant une source d énergie électrique Stéphane GIBOUT*, Erwin FRANQUET, Jean CASTAING-LASVIGNOTTES,

Plus en détail

Licence d Informatique Année 2001-2002 Option: Introduction à la biologie moléculaire. LA P.C.R. Polymerase Chain Reaction

Licence d Informatique Année 2001-2002 Option: Introduction à la biologie moléculaire. LA P.C.R. Polymerase Chain Reaction Licence d Informatique Année 2001-2002 Option: Introduction à la biologie moléculaire LA P.C.R. Polymerase Chain Reaction "chercher une aiguille dans une meule de foin"? Chercher à repérer un gène particulier

Plus en détail

Marketing Data Set: Follow-Up to Purchases of a Consumer Panel

Marketing Data Set: Follow-Up to Purchases of a Consumer Panel Marketing Data Set: Follow-Up to Purchases of a Consumer Panel Typologie des consommateurs et Mesure de la loyauté/fidélité Stéphanie Ledauphin-Menard, Sébastien Lê Face aux problèmes de pouvoir d achat

Plus en détail

Association des Doctorants du campus STIC. Séminaires doctorants 11

Association des Doctorants du campus STIC. Séminaires doctorants 11 Association des Doctorants du campus STIC Séminaires doctorants 11 07 mars 2007 Actes édités par l association des doctorants du campus STIC. Les travaux individuels publiés restent l unique propriété

Plus en détail

A- Exploiter des animations pour repérer une mutation et étudier son mécanisme de réparation.

A- Exploiter des animations pour repérer une mutation et étudier son mécanisme de réparation. THEME 1A : Expression, stabilité et variation du patrimoine génétique Chapitre 2 : Variabilité Génétique et Mutation de l ADN TP-3-: Réparation de l ADN, mutations et polyallélisme Les mutations de l ADN

Plus en détail

Obtention de données génétiques à grande échelle

Obtention de données génétiques à grande échelle Obtention de données génétiques à grande échelle Stéphanie FERREIRA Ph.D. Campus de l Institut Pasteur de Lille 1, rue du Professeur Calmette 59000 LILLE Tel : 03 20 87 71 53 Fax : 03 20 87 72 64 contact@genoscreen.fr

Plus en détail

PERCIMAP. Oreochromis niloticus. Construction d une carte RH à haute densité du génome de Tilapia CNRS UMR 6061

PERCIMAP. Oreochromis niloticus. Construction d une carte RH à haute densité du génome de Tilapia CNRS UMR 6061 PERCIMAP Construction d une carte RH à haute densité du génome de Tilapia Oreochromis niloticus CIRAD UPR20 Aquaculture et gestion des ressources aquatiques, Montpellier H. D Cotta E. Pepey J.F. Baroiller

Plus en détail

DOCTORAT DE L'UNIVERSITÉ DE TOULOUSE

DOCTORAT DE L'UNIVERSITÉ DE TOULOUSE En vue de l'obtention du DOCTORAT DE L'UNIVERSITÉ DE TOULOUSE Délivré par : Institut National Polytechnique de Toulouse (INP Toulouse) Discipline ou spécialité : Génie des Procédés et de l'environnement

Plus en détail

11. Evaluation de la qualité des essais

11. Evaluation de la qualité des essais 11. Evaluation de la qualité des essais L évaluation de la qualité méthodologique d un essai thérapeutique est une tâche difficile [117]. L essai thérapeutique contrôlé randomisé est considéré comme étant

Plus en détail

1998.02 Composition d un portefeuille optimal. Dinh Cung Dang

1998.02 Composition d un portefeuille optimal. Dinh Cung Dang 199802 Composition d un portefeuille optimal Dinh Cung Dang Docteur en gestion de l IAE de Paris Ingénieur Conseil Résumé : Dans ce travail, le risque est défini comme étant la probabilité de réaliser

Plus en détail

Clonage de Vénus et transformation de E.Coli.

Clonage de Vénus et transformation de E.Coli. Clonage de Vénus et transformation de E.Coli. Samueal Joseph, Romain Laverrière, Elias Laudato, Noé Mage Assisstants : Gisele Dewhurst, Charlotte Gehin, Miwa Umebayashi Résumé [1] L expérience consiste

Plus en détail

Points méthodologiques Adapter les méthodes statistiques aux Big Data

Points méthodologiques Adapter les méthodes statistiques aux Big Data Points méthodologiques Adapter les méthodes statistiques aux Big Data I. Répétition de tests et inflation du risque alpha II. Significativité ou taille de l effet? 2012-12-03 Biomédecine quantitative 36

Plus en détail

Méthodes diagnostiques en génétique moléculaire

Méthodes diagnostiques en génétique moléculaire Méthodes diagnostiques en génétique moléculaire P. Latour Praticien Hospitalier Responsable UF 3427 Neurogénétique Moléculaire Laboratoire de Neurochimie Pr Renaud HCL Centre de Biologie Est DES Neurologie

Plus en détail

Single Molecule Real Time (SMRT) Sequencing : PacBio RS II

Single Molecule Real Time (SMRT) Sequencing : PacBio RS II Single Molecule Real Time (SMRT) Sequencing : PacBio RS II Input sample Genome DNA, Amplicons, cdna Input sample amounts according to the protocols (10ng-10µg) High Input sample quality (integrity and

Plus en détail

Louis-André Vallet (CNRS) Laboratoire de Sociologie Quantitative, CREST, UMR 2773 CNRS & INSEE

Louis-André Vallet (CNRS) Laboratoire de Sociologie Quantitative, CREST, UMR 2773 CNRS & INSEE Utiliser le modèle log-linéaire pour mettre au jour la structure du lien entre les deux variables d un tableau de contingence : un exemple d application à la mobilité sociale Louis-André Vallet (CNRS)

Plus en détail

TABLEAU 5 Nombre moyen (et écarts types) de mots produits selon le niveau scolaire et les trois conditions de révision

TABLEAU 5 Nombre moyen (et écarts types) de mots produits selon le niveau scolaire et les trois conditions de révision Dans ce tableau, si le chercheur ne s intéresse pas aux notes item par item mais simplement à la note globale, alors il conservera seulement les première et dernière colonnes et calculera des statistiques

Plus en détail

Séquençage. Bérénice Batut, berenice.batut@udamail.fr. DUT Génie Biologique Option Bioinformatique Année 2014-2015

Séquençage. Bérénice Batut, berenice.batut@udamail.fr. DUT Génie Biologique Option Bioinformatique Année 2014-2015 Séquençage Bérénice Batut, berenice.batut@udamail.fr DUT Génie Biologique Option Bioinformatique Année 2014-2015 Séquençage Séquençage ADN Détermination de l ordre d enchainement des nucléotides d un fragment

Plus en détail

Structure générale d'une particule virale de type herpès

Structure générale d'une particule virale de type herpès Virus de type herpès et coquillages 1 - Caractéristiques des virus de type herpès infectant les coquillages Des infections à virus de type herpès sont associées à des mortalités massives chez différentes

Plus en détail

GénoToul 2010, Hôtel de Région Midi Pyrénées, Toulouse, 10 décembre 2010

GénoToul 2010, Hôtel de Région Midi Pyrénées, Toulouse, 10 décembre 2010 GénoToul 2010, Hôtel de Région Midi Pyrénées, Toulouse, 10 décembre 2010 Analyse de la diversité moléculaire des régions génomiques de 30 gènes du développement méristématique dans une core collection

Plus en détail

Les principes du sequençage haut-débit

Les principes du sequençage haut-débit Les principes du sequençage haut-débit Mardi 23 avril 2013 Dr H. EL HOUSNI Organisation Génomique Podhala'et'al.'Trends'in'genetics'2012' Costa V et al. J BioMed BioTech 2010 32 ans Costa V et al. J BioMed

Plus en détail

L informatique des entrepôts de données

L informatique des entrepôts de données L informatique des entrepôts de données Daniel Lemire SEMAINE 13 L exploration des données 13.1. Présentation de la semaine L exploration de données (ou data mining) est souvent associée à l intelligence

Plus en détail

CHAPITRE 3 LA SYNTHESE DES PROTEINES

CHAPITRE 3 LA SYNTHESE DES PROTEINES CHAITRE 3 LA SYNTHESE DES ROTEINES On sait qu un gène détient dans sa séquence nucléotidique, l information permettant la synthèse d un polypeptide. Ce dernier caractérisé par sa séquence d acides aminés

Plus en détail

Étude de la biodiversité fongique à l aide de techniques de pyroséquençage

Étude de la biodiversité fongique à l aide de techniques de pyroséquençage Étude de la biodiversité fongique à l aide de techniques de pyroséquençage Biodiversité fongique Biodiversité: diversité spécifique d une communauté écologique, correspondant au nombre d espèces et à leur

Plus en détail

Méthode automatisée de dosage colorimétrique du dioxyde de soufre total dans les vins

Méthode automatisée de dosage colorimétrique du dioxyde de soufre total dans les vins Méthode automatisée de dosage colorimétrique du dioxyde de soufre total dans les vins Marc DUBERNET* et Françoise GRASSET* Laboratoire DUBERNET - 9, quai d Alsace - 11100 Narbonne France 1. Objet Méthode

Plus en détail

Le séquençage Roche 454

Le séquençage Roche 454 Le séquençage Roche 454 www.454.com Stéphane Fénart, Arnaud Mouchon Roscoff, Avril 2012 Systèmes Genome Sequencers Une stratégie unique en séquençage nouvelle génération Pionniers en séquençage de nouvelle

Plus en détail

Introduction aux Méthodes de Monte Carlo

Introduction aux Méthodes de Monte Carlo Méthodes de Monte Carlo pour la Modélisation et le Calcul Intensif Applications à la Physique Numérique et à la Biologie Séminaire CIMENT GRID Introduction aux Méthodes de Monte Carlo Olivier François

Plus en détail

L analyse de variance à un critère de classification (ANOVA)

L analyse de variance à un critère de classification (ANOVA) Bio 041 L analyse de variance à un critère de classification (ANOVA) Pierre Legendre & Daniel Borcard, Université de Montréal Référence: Scherrer (007), section 14.1.1.1 et 14.1. 1 - Introduction Objectif:

Plus en détail

WORKING GROUP ON BIOCHEMICAL AND MOLECULAR TECHNIQUES AND DNA PROFILING IN PARTICULAR. Eleventh Session Madrid, September 16 to 18, 2008

WORKING GROUP ON BIOCHEMICAL AND MOLECULAR TECHNIQUES AND DNA PROFILING IN PARTICULAR. Eleventh Session Madrid, September 16 to 18, 2008 BMT//2 Add ORIGINAL: English DATE: September 3, 28 INTERNATIONAL UNION FOR THE PROTECTION OF NEW VARIETIES OF PLANTS GENEVA E WORKING GROUP ON BIOCHEMICAL AND MOLECULAR TECHNIQUES AND DNA PROFILING IN

Plus en détail

Famille multigénique des gènes des pigments rétiniens : origine scénario possible -

Famille multigénique des gènes des pigments rétiniens : origine scénario possible - Famille multigénique : duplication, transposition et mutation M M M M M M M Gène Gène 1 issu du gène Gène 2 issu du gène M= mutation ponctuelle = création d une copie accidentelle d un gène sur le même

Plus en détail

ANALYSE FACTORIELLE MULTIPLE PROCRUSTEENNE

ANALYSE FACTORIELLE MULTIPLE PROCRUSTEENNE ANALYSE FACTORIELLE MULTIPLE PROCRUSTEENNE Elisabeth Morand & Jérôme Pagès Agrocampus Rennes Laboratoire de mathématiques appliquées CS 425 3542 Rennes cedex Résumé Pour comparer deux nuages de points

Plus en détail

MABioVis. Bio-informatique et la

MABioVis. Bio-informatique et la MABioVis Modèles et Algorithmes pour la Bio-informatique et la Visualisation Visite ENS Cachan 5 janvier 2011 MABioVis G GUY MELANÇON (PR UFR Maths Info / EPI GRAVITE) (là, maintenant) - MABioVis DAVID

Plus en détail

Publication IEC 61000-4-3 (Edition 3.0 2008) I-SH 01

Publication IEC 61000-4-3 (Edition 3.0 2008) I-SH 01 Publication IEC 61000-4-3 (Edition 3.0 2008) I-SH 01 Electromagnetic compatibility (EMC) Part 4-3: Testing and measurement techniques Radiated, radio-frequency, electromagnetic field immunity test INTERPRETATION

Plus en détail

Comparaison et alignement de séquences 2

Comparaison et alignement de séquences 2 Comparaison et alignement de séquences 2 LV348 -BI Sophie Pasek sophie.pasek@upmc.fr Comment comparer une séquence contre une banque? Comparaison séquence/banque Pourquoi? : Réunir un échantillon taxonomique

Plus en détail

Génétique et génomique Pierre Martin

Génétique et génomique Pierre Martin Génétique et génomique Pierre Martin Principe de la sélections Repérage des animaux intéressants X Accouplements Programmés Sélection des meilleurs mâles pour la diffusion Index diffusés Indexation simultanée

Plus en détail

Génie génétique. Définition : Outils nécessaires : Techniques utilisées : Application du génie génétique : - Production de protéines

Génie génétique. Définition : Outils nécessaires : Techniques utilisées : Application du génie génétique : - Production de protéines Génie génétique Définition : Ensemble de méthodes d investigation et d expérimentation sur les gènes. Outils nécessaires : ADN recombinant, enzyme de restriction, vecteur, banque ADNc, sonde nucléique...

Plus en détail

Christelle REYNES EA 2415 Epidémiologie, Biostatistique et Santé Publique Université Montpellier 1. 8 Juin 2012

Christelle REYNES EA 2415 Epidémiologie, Biostatistique et Santé Publique Université Montpellier 1. 8 Juin 2012 Extraction et analyse des mesures haut-débit pour l identification de biomarqueurs : problèmes méthodologiques liés à la dimension et solutions envisagées EA 2415 Epidémiologie, Biostatistique et Santé

Plus en détail

La perception du profil de crédit de l émetteur affecte la valorisation de l obligation.

La perception du profil de crédit de l émetteur affecte la valorisation de l obligation. Présentation Optimiser la gestion d un portefeuille obligataire Dans un contexte de rendements historiquement bas, RMG propose une stratégie de gestion de portefeuilles obligataires permettant d améliorer

Plus en détail

Les défis de la Bioinformatique:

Les défis de la Bioinformatique: Les défis de la Bioinformatique: Une introduction à la Journée du 19 octobre Marie-Paule LEFRANC Journées du CINES 19-21 octobre 2004 organisées par Laetitia Regnier Importance des facteurs génétiques

Plus en détail

4. Résultats et discussion

4. Résultats et discussion 17 4. Résultats et discussion La signification statistique des gains et des pertes bruts annualisés pondérés de superficie forestière et du changement net de superficie forestière a été testée pour les

Plus en détail

Méthodes d apprentissage statistique («Machine Learning»)

Méthodes d apprentissage statistique («Machine Learning») Méthodes d apprentissage statistique («Machine Learning») Journées d Etudes IARD Niort, 21 Mars 2014 Fabrice TAILLIEU Sébastien DELUCINGE Rémi BELLINA 2014 Milliman. All rights reserved Sommaire Introduction

Plus en détail

Enquête EPCI 2014 : l appropriation des TIC par les intercommunalités bretonnes

Enquête EPCI 2014 : l appropriation des TIC par les intercommunalités bretonnes Enquête EPCI 2014 : l appropriation des TIC par les intercommunalités bretonnes Nicolas Deporte & Margot Beauchamps Observatoire du GIS M@rsouin Prenant en compte le rôle croissant de l échelon intercommunal

Plus en détail

Analyse de survie appliquée à la modélisation de la transmission des maladies infectieuses : mesurer l impact des interventions

Analyse de survie appliquée à la modélisation de la transmission des maladies infectieuses : mesurer l impact des interventions Analyse de survie appliquée à la modélisation de la transmission des maladies infectieuses : mesurer l impact des interventions Génia Babykina 1 & Simon Cauchemez 2 1 Université de Lille, Faculté Ingénierie

Plus en détail

Recherche des causes génétiques de génodermatoses chez le chien. Catherine André. Heuzé. Catherine André CNRS Rennes Mars 2007.

Recherche des causes génétiques de génodermatoses chez le chien. Catherine André. Heuzé. Catherine André CNRS Rennes Mars 2007. Recherche des causes génétiques de génodermatoses chez le chien Catherine André CNRS André Eric Guaguere Lille Emmanuel Bensignor Rennes Mathieu Heuzé Thè Heuzé Thèse vé vétérinaire Guillaume Queney, Queney,

Plus en détail

Les co-structures génétiques d un parasite (Schistosoma mansoni) et de ses hôtes (mammifères et. dulçaquicole de Guadeloupe

Les co-structures génétiques d un parasite (Schistosoma mansoni) et de ses hôtes (mammifères et. dulçaquicole de Guadeloupe Les co-structures génétiques d un parasite (Schistosoma mansoni) et de ses hôtes (mammifères et mollusques) dans la mangrove dulçaquicole de Guadeloupe Échelles spatiale, fonctionnelle et coévolutive.

Plus en détail

Méthodes de distances Formation CNRS «Phylogénie moléculaire»

Méthodes de distances Formation CNRS «Phylogénie moléculaire» Méthodes de distances Formation CNRS «Phylogénie moléculaire» Guy Perrière Laboratoire de Biométrie et Biologie Évolutive UMR CNRS n 5558 Université Claude Bernard Lyon 1 2 mars 213 Guy Perrière (BBE)

Plus en détail