Développement, utilisation et comparaison de différents types de marqueurs pour étudier la diversité parmi une collection de blé tendre

Dimension: px
Commencer à balayer dès la page:

Download "Développement, utilisation et comparaison de différents types de marqueurs pour étudier la diversité parmi une collection de blé tendre"

Transcription

1 Les Actes du BRG, 6 (2006) BRG, 2006 Article original Développement, utilisation et comparaison de différents types de marqueurs pour étudier la diversité parmi une collection de blé tendre François BALFOURIER (1)*, Catherine RAVEL (1), Anne-Marie BOCHARD (2), Florence EXBRAYAT-VINSON (1), Gilles BOUTET (1), Pierre SOURDILLE (1), Philippe DUFOUR (2), Gilles CHARMET (1) (1) INRA - UMR Amélioration et Santé des Plantes, 234 avenue du Brézet, Clermont-Ferrand, France (2) Limagrain Agro-Industrie, site ULICE, ZAC les Portes de Riom, BP173, Riom Cedex, France Abstract: Generation, use and comparison of different molecular markers for diversity analyses in bread wheat collection. In order to determine the interest of different types of molecular markers for genetic diversity analyses, molecular polymorphism was studied in a set of 731 bread wheat accessions using 38 genomic microsatellites (SSRg), 44 EST-derived microsatellites (SSRest) and SNPs from 16 genes. The total of 98 markers covers the whole bread wheat genome. SSRg present the highest level of polymorphism (900 alleles) compared to SSRest and SNPs (183 alleles and 69 haplotypes, respectively). Among SSRest markers, those with dinucleotide repeats are significantly more polymorphic than the others with tri and tetra nucleotide repeats. Whatever markers we consider, no significant difference appears in the level of diversity between the different A, B and D genome of bread wheat. The three genetic matrices distances between pairs of accessions, calculated for each type of markers in a sub-sample of 41 accessions with no missing data, are not significantly different. However, SSRg appear to be more efficient than SSRest to estimate these distances. The two types of microsatellites offer the same capacity to restore the topology of a given hierarchical tree. The three hierarchical trees, obtained from the sub-sample of 41 accessions individually analysed by the three types of markers, show a common topological structure. This structure, which clearly separates the European wheat accessions from the Asian ones, may be both explained by historical process of wheat germplasm migration and selective adaptation to environmental conditions. The whole results are discussed according to the nature and the level of neutrality of the different markers in relation to selection. bread wheat/ genetic structure/ microsatellite/ SNP/ phylogenic tree * Correspondance et tirés à part : 129

2 F. Balfourier et al. Résumé : Afin d analyser l intérêt de différents marqueurs moléculaires pour des études de diversité génétique, le polymorphisme a été étudié dans un échantillon de 731 blés tendres à l aide de 38 microsatellites génomiques (SSRg), 44 microsatellites issus d EST (SSRest) et de SNP détectés sur 16 gènes, soit 98 locus également répartis sur le génome. Les SSRg apparaissent comme les plus polymorphes (900 allèles) comparés aux SSRest (183 allèles) et aux SNP (69 haplotypes). Parmi les SSRest, ceux au motif di-nucléotique sont significativement plus polymorphes que les autres. Les matrices de distance génétique, calculées entre paires d accessions pour chaque type de marqueur dans un sous échantillon de 41 accessions, ne sont pas significativement différentes, mais les SSRg s avèrent plus efficaces que les SSRest pour estimer ces distances. Les deux types de microsatellites présentent la même cinétique de reconstruction de la topologie d un arbre donné. Les trois arbres, obtenus à partir du sous échantillon de 41 accessions analysé par les trois types de marqueurs pris individuellement, montrent une structure commune en terme de topologie qui est liée à l origine géographique des accessions. Ces résultats sont discutés en fonction de la nature et du niveau de neutralité des marqueurs vis-à-vis de la sélection. blé tendre/ structuration génétique/ microsatellite/ SNP/ arbre phylogénétique 1. INTRODUCTION L analyse des variations de séquence de l ADN est aujourd hui abondamment exploitée pour la cartographie génétique, l étiquetage de gènes ou encore l analyse de populations (analyse de diversité génétique, étude d évolution, ). De nombreux marqueurs moléculaires tels que les RFLP (Restriction Fragment Length polymorphism), les RAPD (Random Amplified Polymorphic DNA), les AFLP (Amplified Fragment Length polymorphism ) ou encore les SSR (Simple Sequence Repeat) ont été récemment utilisés pour conduire ce dernier type d analyse chez le blé tendre [13], [18], [21]. Parmi ces marqueurs, les microsatellites ou SSR sont réputés être les plus performants pour des analyses de diversité dans de vastes collections de ressources génétiques. Ce sont des séquences de quelques nucléotides (1 à 6) répétées en tandem, abondamment dispersées à travers tout le génome, multi-alléliques, co-dominantes et facilement amplifiables par PCR (Polymorphism Chain Reaction). Parmi ceux-ci, on distingue les SSR génomiques (SSRg), issus de banques enrichies en ADN génomique, des SSR développés à partir d EST (Expressed Sequence Tag) représentant les régions exprimées du génome (SSRest). Il a été démontré qu environ 10 % des contigs d EST de blé contiennent un microsatellite [9]. De par leur origine, les SSRg sont supposés présenter une neutralité plus importante vis-à-vis de la sélection que les SSRest possédant potentiellement une valeur sélective non nulle. Plus récemment, un nouveau type de marqueurs basés sur des changements ponctuels d une base dans une séquence donnée et appelés SNP (Single 130

3 Comparaison de marqueurs chez le blé tendre Nucleotide Polymorphism) a été développé. Ces marqueurs sont général e- ment bi-alléliques et permettent d appréhender des variations de gènes impliqués dans le contrôle de caractères d intérêts. Plusieurs études ont contr i- bué à la mise en évidence de SNP soit par séquençage de gènes sur collection [2], [11], soit par bioanalyse de séquences d EST regroupées en contigs et issues des bases de données [17]. Jusqu à présent, la recherche systémat i- que de SNP chez le blé a été conduite sur une cinquantaine de gènes env i- ron, ce qui a permis de mener quelques travaux de cartographie génétique et des études de génétique d association [3], [12]. Néanmoins, ces marqueurs, qui à l instar des SSRest révèlent un polymorphisme dans des gènes d intérêts, n ont encore jamais été utilisés à grande échelle pour décrire la diversité parmi de larges collections de ressources génétiques et analyser la façon dont ils peuvent structurer cette diversité. Dans l étude présentée ici, nous avons évalué la diversité génétique d un large échantillon de blé tendre déjà décrit pour un jeu de microsatellites g é- nomiques (SSRg), en utilisant un second jeu des microsatellites issus cette fois d EST (SSRest) ainsi qu un panel de SNP développés par ailleurs. Le but est d analyser l intérêt de ces types de marqueurs pour des études de diversité en comparant les différents niveaux de polymorphismes neutres et sélectionnés qu ils révèlent, ainsi que la façon dont ils permettent individuellement de structurer la diversité parmi les collections de ressources génétiques. En effet, pour une conservation optimale (non biaisée) de la diversité dans les collections il peut être préférable de se baser à priori sur la diversité neutre. Cependant, le développement récent de nouveaux marqueurs issus de parties codantes (SSRest, SNP) et destinés au départ plutôt à la recherche de gènes candidats ou d associations, doit nous amener à nous interroger aussi sur leur int é- rêt pour décrire, structurer et donc potentiellement servir de base dans des méthodes d optimisation pour la conservation de la diversité. L objet de cet article est de tenter de répondre à certaines de ces questions. 2. MATÉRIEL ET MÉTHODES 2.1. Choix du matériel d étude Un échantillon de 731 accessions de blé tendre, issues de la collection INRA conservées à Clermont-Ferrand, a été utilisé pour cette étude. Cet échantillon, composé de variétés de pays et de lignées fixées issues de plus de 60 origines géographiques différentes, a été choisi parmi plus de blés de la collection globale de manière à contenir la totalité des allèles microsatellites observés à l aide d un jeu de SSRg [13]. Il a en outre été choisi de façon à représenter un optimum de la diversité en terme d origine géo- 131

4 F. Balfourier et al. graphique et de périodes décennales d inscription au catalogue (lignées) ou de culture (variétés de pays) entre les années 1840 et L extraction d ADN a été réalisée à partir de plantules issues de semences de plantes autofécondées. Les feuilles de cinq à six plantes par accessions ont été mélangées, puis broyées avant d en extraire l ADN en mélange selon la méthode d extraction au métabisulfite [13] Microsatellites Le jeu de SSRg considéré pour la présente étude correspond à celui utilisé précédemment pour décrire la collection globale de blés [13], [14], [15]. Il s agit d un jeu de 37 SSRg donnant 38 loci polymorphes. Ces microsatellites ont été choisis selon leur répartition sur le génome (locus gwm et cfd sur fig. 1). Ce sont en majorité des microsatellites à motif dinucléotidique parfait. gpw7072 cfe167 gwm135 gwm11 gwm413 gpw7082 gwm337 gwm372 gwm312 gpw7438 gwm257 Gogat cfe68 gpw7325 gwm261 cfe78 gwm120 gwm539 cfe175 gwm480 BPGIPBM gwm664 gwm99 gpw7577 gpw7570 gwm642 cfe52 gpw7213 GaMyb cfe189 Aap Glu gpw7443 Glu gpw7335 1A 1B 1D 2A 2B 2D 3A 3B 3D gwm234 gwm469 cfe8 cfe273 gwm190 cfe214 cfd71 gpw7795 gpw7218 Pin B gwm325 gwm415 gpw7592 gwm610 gwm626 gpw7241 cfd71 Pbf Pbf Pbf gpw7574 gwm186 Gdh cfe300 gwm149 cfe186 cfe95 Gdh cfe301 gpw7666 Gdh gpw7425 gpw7107 gpw7384 gwm251 gwm408 gwm272 gwm427 gwm219 gpw7433 4A 4B 4D 5A 5B 5D 6A 6B 6D gwm46 gpw7288 gpw7185 gwm260 gpw7320 gpw7342 gwm400 gwm044 cfe135 Sal1 Sal1 gwm437 cfe248 gpw7596 Sal1 gpw7386 7A 7B 7D gwm2 gpw7553 gpw7452 gwm341 gwm566 cfe172 gpw7586 Figure 1 : Assignation des différents marqueurs aux différents bras chromosomiques du génome du blé tendre (SSRg, SSRest, gènes). Près de SSRest ont été développés ces dernières années au sein du laboratoire INRA de Clermont-Ferrand (885 gpw [9] ; 301 cfe [22]). Les conditions d exploitation de ceux-ci sont décrites dans la base de données Graingenes (http://wheat.pw.usda.gov). Pour notre étude, nous avons s é- lectionné 44 SSRest selon des critères de position sur le génome (compl é- mentaire au jeu de SSRg), de type de motif (di-, tri- ou tétranucléotides) et 132

5 Comparaison de marqueurs chez le blé tendre de facilité de lecture, de façon à couvrir in fine la totalité du génome avec autant que possible quatre microsatellites par chromosome (2 SSRg + 2 SSRest) (locus gpw et cfe sur fig. 1). Les conditions d amplification PCR et de lecture des allèles ont été celles décrites par Roussel et al. [14]. Les opérations de génotypage des microsatellites ont été réalisées sur la plate-forme de génotypage haut-débit INRA de Clermont-Ferrand SNP Les gènes étudiés concernent : le métabolisme azoté (AAP, Amino Acid Permease ; 2,3 BPGIPGM, 2,3 BiphosphoGlycerate Independant Phosphoglycerate Mutase; GDH, Glutamate-deshydrogenase; Gogat, glutamate synthase), la synthèse de protéines de réserve (Glu-A3 et Glu-D1-1, codant respectivement pour des gluténines de faible et de haut poids moléculaires), deux facteurs régulant l expression de gènes codants pour les protéines de réserve (wpbf et Gamyb), la dureté (PinB) et le nombre de couches d aleurone (Sal1, Super Aleurone Layer). Des SNP ont été détectés au sein de ces gènes par séquençage direct d un sous-échantillon de 42 lignées représentatives de la diversité dans le blé tendre (13 kb séquencées par lignée). Les informations nécessaires à l utilisation de ces SNP seront accessibles dans la base de SNP développée par l Unité de Recherche Génomique et Informatique (INRA, Evry) sur le site genoplante-info.infobiogen.fr. En tenant compte des copies homéologues, les gènes étudiés correspondent à 16 locus (fig. 1). Le génotypage des SNP candidats a été réalisé à l'aide de la technologie MassArray (Sequenom Inc., San Diego, CA). Après une amplification PCR, les produits issus de l'extension d'amorce ont été analysés par spe ctrométrie de masse MALDI-TOF Analyse des données La comparaison entre les trois types de marqueurs a tout d abord été réalisée à l aide d indices de diversité simples que sont le nombre de locus polymorphes, la richesse allélique (ou nombre d allèles) et la valeur PIC (Polymorphism Information Content = indice de diversité de Nei), indices calculés par locus, sur l ensemble des 731 individus. Les moyennes de ces indices ont été comparées à l aide d un test non paramétrique de Mann Whitney. Dans un second temps, l aptitude des différents marqueurs à structurer la diversité a été comparée par calcul de la distance génétique de Sokal et Michener entre paires d accessions pour les trois types de marqueurs (SSRg, SSRest 133

6 F. Balfourier et al. et SNP). Cette distance est définie dans Perrier et al. [10] comme étant égale à 1-P, où P est la proportion d allèles communs aux deux accessions. Les matrices de distances ont d abord été comparées deux à deux par le test de Mantel [8]. Puis elles ont permis de construire des arbres de classification hiérarchique selon la méthode du Neighbor-Joining [16]. Les coefficients de corrélation de Pearson entre ces matrices de distances prises deux à deux, puis entre les matrices de topologie caractérisant la structure de ch a- que arbre, ont également été calculés. Ces coefficients de corrélation ont été comparés deux à deux par la méthode de Lapointe et Legendre [7]. Enfin, les trois arbres obtenus ont été comparés deux à deux selon la méthode du MAST (Maximum Agreement Sub-Tree). Cette méthode repose sur l identification des accessions qui présentent une structuration commune dans chacun des deux arbres. On recherche l échantillon d accessions de taille maximale qui donne la même structure dans les deux arbres comparés ; ces accessions forment alors le MAST. La recherche de cet échantillon fait appel à un algorithme développé par Kubicka et al. [6] et proposé dans le logiciel DARwin [10]. Dans ce cas, le nombre d unités conservées dans le MAST, appelé l ordre «o» est considéré comme une mesure de ressemblance entre les deux arbres. La distribution statistique de ce critère «o» sous l hypothèse d indépendance des arbres n est pas connue mais a été approchée par simulation. Compte tenu de la taille des matrices et des arbres à manipuler, ces calculs ont été réalisés sur un échantillon plus restreint de 41 blés correspondant aux accessions ne présentant aucune donnée manquante, échantillon néanmoins bien représentatif des différentes origines géographiques prése n- tes dans les 731 accessions. 3. RÉSULTATS 3.1. Capacité des différents marqueurs à exprimer du polymorphisme Avec un total de 900 allèles, calculé sur l ensemble des 731 individus, les SSRg apparaissent de loin les marqueurs les plus polymorphes, co mparés aux SSRest (183 allèles) et aux SNP (69 haplotypes) (tabl. I); le nombre d allèles par locus varie ainsi de 7 à 45 pour les SSRg et seulement de 1 à 14 pour les SSRest, tandis que le nombre d haplotypes par locus étudié pour les SNP varie de 2 à 11 dans notre échantillon (un haplotype correspondant ici à la combinaison de différents SNP au même locus). Neuf locus SSRest apparaissent ici non polymorphes. Ramenés aux seuls locus polymorphes, les calculs du nombre moyen d allèles et de la valeur PIC moyenne indiquent 134

7 Comparaison de marqueurs chez le blé tendre clairement que les SSRg sont signif icativement plus polymorphes (p < 0,0001), tandis que SSRest et SNP présentent un même niveau de polymorphisme. Tableau I : Indices de diversité, par type de marqueurs, calculés à partir des 731 individus. Type de marqueurs Nombre d allèles (SSRs) ou d haplotypes (SNPs) Nbre. de locus Nbre. moyen d allele/locus Valeur PIC moyenne/locus total mini-maxi polymorphes polymorphes polymorphes 38 SSRg ,68 0, SSRest ,97 0, gènes ,31 0,353 L analyse de la valeur PIC, moyennée par type de marqueur et par génome du blé tendre (tabl. II) confirme le niveau significativement plus élevé de diversité pour les SSRg et ce quel que soit le génome considéré, tandis que les SSRest et SNP ne semblent pas significativement différents dans notre échantillon. Enfin, que l on considère les marqueurs indépendamment ou en totalité, sans doute compte tenu de nos effectifs en locus, il n apparaît pas ici de différence significative de niveau de diversité entre les génomes A, B ou D. Tableau II : Indices de diversité par type de marqueurs et par génomes. Type de marqueur Nbre. locus poly. Genome A Genome B Genome D Valeur PIC Nbre. Valeur PIC Nbre. moyenne locus moyenne locus Valeur PIC moyenne poly. poly. SSRg 12 0, , ,775 SSRest 13 0, , ,205 SNP 4 0, , ,196 total/genome 29 0, , ,459 L analyse du niveau de polymorphisme des SSRest en fonction de leur motif de base (tabl. III) indique que les SSRest au motif di-nucléotidique sont significativement plus polymorphes (p<0.0012) que les tri- et tétranucléotidiques. Par ailleurs, sept parmi les neuf SSRest non polymorphes ont des motifs tri-nucléotidiques. Ainsi, il semble que le niveau global de polymorphisme d un SSRest décroisse avec la taille de son motif de base. Tableau III : Valeur PIC moyenne en fonction du motif microsatellite des SSRest. Motif microsatellite Di-nucléotidique Tri-nucléotidique Tétra-nucléotidique Nbre. locus total Nbre locus polymorphes Valeur PIC moyenne 0,532 0,224 0,

8 F. Balfourier et al Efficacité des marqueurs à estimer une distance génétique entre paire d accessions La distance génétique moyenne de Sokal et Michener entre paires d accessions est plus faible lorsqu elle est basée sur les SSRg (0,167) que lorsqu elle est calculée sur les SSRest (0,242) ou les SNP (0,267). Global e- ment, les différents tests de Mantel effectués montrent que les matrices de distances obtenues pour chaque type de marqueurs (SSRg, SSRest et SNP) ne sont pas significativement différentes au seuil de 1 %. Figure 2 : Évolution du coefficient de variation moyen de la distance génétique mesurée entre paires d accessions, en fonction du nombre de marqueurs utilisés. 136

9 Comparaison de marqueurs chez le blé tendre La figure 2 représente l évolution du coefficient de variation (CV) moyen de la distance génétique mesurée entre paires d accessions, en fonction du nombre de microsatellites utilisés, et ce pour les deux types de marqueurs microsatellites. Chaque point a été calculé à partir de 200 matrices de distance 41x41 obtenues par bootstraps sur les marqueurs. À effectif identique en marqueurs, on observe la moindre efficacité des SSRest par rapport aux SSRg ; ainsi, la figure 2 montre que le seuil de 10 % pour le CV sur la distance génétique entre paires d accessions serait atteint en utilisant une cinquantaine de marqueurs SSRg, tandis qu il faudrait plus d une centaine de SSRest pour atteindre ce même seuil. Les coefficients de corrélation de Pearson calculés deux à deux entre les trois matrices de distance, obtenues selon les trois types de marqueurs, sont indiqués dans le tableau IV (partie sous la diagonale). Ces trois coefficients sont significatifs au seuil de 1 %, c'est-à-dire supérieurs à la corrélation attendue avec une matrice de distance permutée au hasard. On observe que la corrélation la plus forte apparaît entre SSRg et SSRest, alors qu elle est la plus faible entre SSRg et SNP. Tableau IV : Coefficients de corrélation entre matrices de topologie (au dessus de la diagonale) et matrices de distance (en dessous de la diagonale) selon les différents types de marqueurs. Matrice SSRg Matrice SSRest Matrice SNP Matrice SSRg 0,520** 0,379** Matrice SSRest 0,417** 0,421** Matrice SNP 0,301** 0,322** 3.3. Efficacité des marqueurs à structurer la diversité Dans un premier temps, nous avons comparé la façon dont les deux types de SSR permettaient d obtenir un arbre de structure donnée, appelé ici arbre de référence. Nous avons considéré comme arbre de référence l arbre global obtenu sur les 41 individus avec la totalité des marqueurs SSR polymorphes (soit 30 et 38 pour les SSRest et les SSRg, respectivement). La figure 3 représente, pour les deux types de microsatellites, la distribution (sous forme de boxplots) de la valeur de l ordre o du MAST obtenue en comparant des arbres réalisés avec un nombre croissant de marqueurs, à l arbre de référence. Afin d avoir une idée de la distribution de o, quinze tirages sans remise ont été effectués pour chaque quantité de microsatellites utilisée. La valeur moyenne de o obtenue pour un tirage de cinq microsatellites apparaît significative au seuil de 5 % pour les deux types de marqueurs, ce qui signifie que l arbre obtenu avec cinq marqueurs présente une ressemblance non liée au hasard avec son arbre de référence. Par ailleurs, nous constatons qu une même proportion de marqueurs conduit, pour chaque type de microsatellites, à une valeur iden- 137

10 F. Balfourier et al. tique de l ordre o ; la cinétique de reconstruction de l arbre de référence est donc identique pour les deux types de SSR. Enfin, nous observons que la valeur de l ordre o n est en moyenne que d environ 28 accessions pour respectivement 37 SSRg et 29 SSRest, comparée aux 41 accessions des arbres de référence. Nous constatons ici combien l apport d un dernier marqueur su p- plémentaire vient encore modifier les structures des arbres, ce qui traduit le fait qu il faudrait sans doute beaucoup plus de marqueurs, dans le cas de notre échantillon de blé, pour stabiliser la structure des arbres. Figure 3 : Distribution (sous forme de boxplots) et pour les deux types de marqueurs, de la valeur de l ordre o du MAST obtenue en comparant des arbres réalisés avec un nombre croissant de marqueurs, à l arbre de référence. 138

11 Comparaison de marqueurs chez le blé tendre Enfin la figure 4 représente les arbres de référence obtenus à partir des trois matrices de distance, selon les différents marqueurs. Les trois types de marqueurs permettent de différencier chacune des accessions les unes des autres. Le label utilisé pour caractériser les 41 accessions correspond ici au pays d origine de l accession (Iso3166), suivi éventuellement d un numéro d identification dans le pays considéré. Les coefficients de corrélation, calculés à partir des matrices de topologie de ces trois arbres, sont présentés dans le tableau IV (au dessus de la diagonale). Ces trois coefficients sont significatifs au seuil de 1 %, ce qui indique que les ressemblances topologiques de ces trois arbres, pris deux-à-deux, ne sont pas dues au hasard. Une fois encore la corrélation la plus forte est trouvée entre SSRg et SSRest, la plus faible étant entre SSRg et SNP. Sur la figure 4, compte tenu des échelles différentes de distances entre n uds, l arbre SSRg apparaît comme le plus compact. À un niveau élevé de coupure de l arbre, il permet de distinguer clairement deux classes : la classe de droite (E) regroupe uniquement des accessions provenant d Europe (FRA, DEU, GBR, BEL, NOR, ) et d Amérique du Nord, à l exception de l accessions AFG-2 provenant d Afghanistan. La classe de gauche (A), regroupe quant à elle une majorité d accessions issues d Asie (AFG, CHN, IND, JPN, NPL,..) d Afrique (DZA, MAR) et d Amérique du Sud (ARG, COL, CHL), en plus de quelques accessions européennes. Nous retrouvons ici la structuration en deux grands pools de materiel : le pool des blés européens (E), comprenant également les blés d Amérique du Nord et le pool des blés asiatiques (A) auxquels sont rattachés les blés issus de la révolution verte utilisés en Afrique et en Amérique du Sud. Cette structure forte en deux grandes classes se r e- trouve presque à l identique aussi bien dans l arbre issu des SSRest que dans celui issu des SNP. Par contre à l intérieur de ces deux classes, à un niveau plus faible de coupure de l arbre, il n est pas possible de mettre en évidence, dans notre échantillon, des structures ou regroupements vraiment stables d un arbre à l autre. 139

12 F. Balfourier et al. A E A E A E Figure 4 : Arbres de référence des 41 accessions de blé tendre, obtenus selon les trois types de marqueurs. 140

13 Comparaison de marqueurs chez le blé tendre 4. DISCUSSION 4.1. Détection du polymorphisme A notre connaissance, c est la première fois qu est rapportée une telle étude de diversité, menée sur un échantillon aussi large de blé tendre à l aide de marqueurs nouvellement développés comme les SSRest et surtout les SNP. La mise en évidence d un plus haut niveau de polymorphisme des SSRg par rapport aux SSRest (tabl. I) va dans le sens de résultats déjà publiés à propos des caractéristiques des marqueurs microsatellites issus d EST [1], [4]. Cette différence pourrait peut-être s expliquer par des taux de mutations différents pour ces deux types de microsatellites ; on sait en effet que les SSRg présentent de forts taux de mutation [19] qui sont probablement plus élevés que ceux des SSRest. Elle est sans doute aussi explicable par la nature même des SSRest qui sont issus de séquences exprimées, donc certainement plus conservées que les zones du génome dont proviennent les SSRg. Cette origine des SSRest expliquerait également qu ils présentent un niveau de polymorphisme équivalent à celui des SNP. Les SSRg au motif dinucléotidique sont connus pour être d une façon générale plus polymorphes, probablement parce que le nombre de répétitions de leur motif de base est plus grand. Il est cependant surprenant d observer ce même résultat chez les SSRest (tabl. III) puisque l ajout ou le retrait d un tel motif perturbe automatiquement le cadre de lecture. Nous n avons pas vérifié la localisation exacte (5 UTR, 3 UTR ou partie codante) de ce jeu précis de SSRest dans les séquences, mais ceci peut être fait à partir de la base Graingenes. Les résultats de Varshney et al. [20] selon lesquels les régions 3 UTR révèlent le plus de polymorphisme n ont pu donc être vérifiés. Cependant, d après les résultats de Nicot et al. [9] travaillant sur un échantillon plus large de marqueurs SSRest dont est issu notre jeu, il y avait la même proportion de marqueurs issus de chacune des trois régions Distances génétiques et matrices de distances Les plus fortes moyennes de distances génétiques observées pour les SSRest et les SNP, par rapport aux SSRg, sont sans doute liées au nombre de marqueurs utilisés. Toutes les comparaisons effectuées entre matrices de distance montrent que les différents marqueurs conduisent globalement à des structures identiques entre accessions (tabl. IV). Les tests, par ailleurs peu puissants, ne pe r- mettent donc pas de rendre compte de la nature différente des marqueurs. La valeur relative des corrélations entres les trois types de matrice rend sans doute mieux compte de ce phénomène. En effet, la corrélation la plus forte est trouvée entre les deux marqueurs de types microsatellites, la plus faible 141

14 F. Balfourier et al. étant entre SSRg et SNP : ceci peut sans doute s expliquer par le niveau de neutralité des marqueurs vis-à-vis de la sélection. Par ailleurs, la moindre efficacité des SSRest à estimer une distance génétique avec précision (fig. 2) s explique probablement par le plus faible polymorphisme de ces marqueurs, comparés aux SSRg. Vu le faible nombre de marqueurs SNP (16) la même analyse statistique du CV n a pu être conduite pour ces marqueurs mais il est vraisemblable qu ils auraient, du fait du faible nombre d haplotypes, conduits à des résultats similaires aux SSRest Matrices de topologie et reconstruction d arbres L étude de la cinétique de reconstruction des arbres de référence (fig. 3) ne permet pas de mettre en évidence des différences entre les deux types de SSR. Dans les deux cas, les arbres restent très instables jusqu au dern ier marqueur introduit. Ce résultat est assez surprenant ; il doit être lié à la nature de notre échantillon d accessions de blé tendre. En effet, celui-ci est constitué, par construction, d accessions très diversifiées, appartenant toutes à la même espèce et en même temps non récemment apparentées. Il faudrait sans doute beaucoup plus de marqueurs pour conduire à des structures d arbre plus stables. Peu d études ont, jusqu à présent, eu pour objet de comparer des arbres de diversité génétique obtenus par les différents marqueurs utilisés ici. Une étude de pedigrees menée sur sept orges à l aide de SSRest et de SNP [5] montre que les deux types de marqueurs conduisent à des résultats similaires mais non identiques. Il existe diverses méthodes de comparaisons d arbres [10]. Ainsi, par exemple, les méthodes consensus supposent que toutes les accessions d un arbre soient correctement représentées, c'est-à-dire que leurs n uds d embranchement présentent de fortes valeurs de bootstraps. Dans les méthodes consensus, toutes les accessions ont le même poids ; les quelques unes au comportement plus erratique peuvent alors masquer une stru c- ture commune. Dans notre étude, les valeurs (non représentées) des bootstraps sont faibles à cause de la nature même de l échantillon et du nombre de marqueurs utilisés. Cependant les trois arbres de la figure 4 semblent avoir globalement une structure commune, excepté pour quelques accessions. C est pourquoi nous avons utilisé d autres approches de comparaison comme les méthodes purement topologiques qui ne tiennent pas compte de la longueur des branches ou la méthode du MAST qui permet d éliminer les accessions les plus fluctuantes pour mettre en évidence une structure co m- mune. Ici, la structure commune aux trois arbres est celle liée à l origine géographique des accessions, structure larg ement décrite par Roussel [13] et qui sépare grossièrement le pool des blés «européens» de celui des blés «asiatiques». Cette structure, d origine démographique et évolutive, qui 142

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq Présenté par Xi LIU ATCGCGCTAGCTGGTGTATCGCATCGCGCTAGCTGGTGTATCGCGCTAGCTGGTGTATCGCGCTAGCCTGGTGTATCGCCATCGCGCTAGCTGGCGCTAGCTGAATCGCGCATATG 17 Septembre 2013 Homéoallèles Génome Normalisation Analyse différentielle

Plus en détail

TD Bioinformatique : Sequence Alignment. Pourquoi faire une recherche par similarité?

TD Bioinformatique : Sequence Alignment. Pourquoi faire une recherche par similarité? TD Bioinformatique : Sequence lignment Pourquoi faire une recherche par similarité? - Savoir si ma séquence ressemble à d'autres déjà connues. - Trouver toutes les séquences d'une même famille. - Rechercher

Plus en détail

Nos Métiers. Historique. Notre Vision. Notre Mission

Nos Métiers. Historique. Notre Vision. Notre Mission Historique 1958 : Création de la SMMO : Minoterie de blé tendre à Oujda. Première minoterie cotée en bourse entre 1972 et 1980. 1989 : Création de la société COPATES ; première unité industrielle de production

Plus en détail

Cours d introduction à la génétique de la souris Notion de Souche

Cours d introduction à la génétique de la souris Notion de Souche Cours d introduction à la génétique de la souris Notion de Souche Introduction: - Réponse d un animal à l expérimentation (diapo 1) Facteurs environnementaux et propres à l animal - Notion d animal standardisé

Plus en détail

Barcoding environnemental par séquençage haut débit

Barcoding environnemental par séquençage haut débit Barcoding environnemental par séquençage haut débit Potentiel et limites Jean-François Martin Échantillonnage Spécificités du barcoding environnemental Amplification (PCR) de marqueurs choisis Séquençage

Plus en détail

Domaine de Melgueil, 34130 Mauguio, France (3)

Domaine de Melgueil, 34130 Mauguio, France (3) Les Actes du BRG, 6 (2006) 57-74 BRG, 2006 Article original Analyse et prédiction des patrons de déséquilibre de liaison dans les collections de ressources génétiques de plantes pérennes ou annuelles,

Plus en détail

Les simulations dans l enseignement des sondages Avec le logiciel GENESIS sous SAS et la bibliothèque Sondages sous R

Les simulations dans l enseignement des sondages Avec le logiciel GENESIS sous SAS et la bibliothèque Sondages sous R Les simulations dans l enseignement des sondages Avec le logiciel GENESIS sous SAS et la bibliothèque Sondages sous R Yves Aragon, David Haziza & Anne Ruiz-Gazen GREMAQ, UMR CNRS 5604, Université des Sciences

Plus en détail

Gènes Diffusion - EPIC 2010

Gènes Diffusion - EPIC 2010 Gènes Diffusion - EPIC 2010 1. Contexte. 2. Notion de génétique animale. 3. Profil de l équipe plateforme. 4. Type et gestion des données biologiques. 5. Environnement Matériel et Logiciel. 6. Analyses

Plus en détail

Le séquençage Roche 454

Le séquençage Roche 454 Le séquençage Roche 454 www.454.com Stéphane Fénart, Arnaud Mouchon Roscoff, Avril 2012 Systèmes Genome Sequencers Une stratégie unique en séquençage nouvelle génération Pionniers en séquençage de nouvelle

Plus en détail

Génotypage et Séquençage. Pierre Mournet

Génotypage et Séquençage. Pierre Mournet Génotypage et Séquençage Pierre Mournet Plan Séquençage/Génotypage Classique (usat, Sanger) Séquençage NGS (Next Generation Sequencing) Séquenceur Préparation Pré-NGS Exemple 1 NGS Exemple 2 NGS Génotypage

Plus en détail

Les microarrays: technologie pour interroger le génome

Les microarrays: technologie pour interroger le génome Les microarrays: technologie pour interroger le génome Patrick DESCOMBES patrick.descombes@frontiers-in-genetics.org Plate forme génomique NCCR Frontiers in Genetics Université de Genève http://genomics.frontiers-in-genetics.org

Plus en détail

Approche bayésienne des modèles à équations structurelles

Approche bayésienne des modèles à équations structurelles Manuscrit auteur, publié dans "42èmes Journées de Statistique (2010)" Approche bayésienne des modèles à équations structurelles Séverine Demeyer 1,2 & Nicolas Fischer 1 & Gilbert Saporta 2 1 LNE, Laboratoire

Plus en détail

Mariane ALLEAUME-BENHARIRA Sylvie ODDOU-MURATORIO François LEFEVRE. Ecologie des forêts méditerranéennes INRA AVIGNON - FRANCE

Mariane ALLEAUME-BENHARIRA Sylvie ODDOU-MURATORIO François LEFEVRE. Ecologie des forêts méditerranéennes INRA AVIGNON - FRANCE MODELISER L IMPACT DES CHANGEMENTS DEMOGRAPHIQUES ET ENVIRONNEMENTAUX SUR L EVOLUTION DES ARBRES Le module Luberon Version 2010 Mariane ALLEAUME-BENHARIRA Sylvie ODDOU-MURATORIO François LEFEVRE Ecologie

Plus en détail

GénoToul 2010, Hôtel de Région Midi Pyrénées, Toulouse, 10 décembre 2010

GénoToul 2010, Hôtel de Région Midi Pyrénées, Toulouse, 10 décembre 2010 GénoToul 2010, Hôtel de Région Midi Pyrénées, Toulouse, 10 décembre 2010 Analyse de la diversité moléculaire des régions génomiques de 30 gènes du développement méristématique dans une core collection

Plus en détail

Séquençage. Bérénice Batut, berenice.batut@udamail.fr. DUT Génie Biologique Option Bioinformatique Année 2014-2015

Séquençage. Bérénice Batut, berenice.batut@udamail.fr. DUT Génie Biologique Option Bioinformatique Année 2014-2015 Séquençage Bérénice Batut, berenice.batut@udamail.fr DUT Génie Biologique Option Bioinformatique Année 2014-2015 Séquençage Séquençage ADN Détermination de l ordre d enchainement des nucléotides d un fragment

Plus en détail

Obtention de données génétiques à grande échelle

Obtention de données génétiques à grande échelle Obtention de données génétiques à grande échelle Stéphanie FERREIRA Ph.D. Campus de l Institut Pasteur de Lille 1, rue du Professeur Calmette 59000 LILLE Tel : 03 20 87 71 53 Fax : 03 20 87 72 64 contact@genoscreen.fr

Plus en détail

FEDERATION INTERNATIONALE DE L AUTOMOBILE. Norme 8861-2000

FEDERATION INTERNATIONALE DE L AUTOMOBILE. Norme 8861-2000 FEDERATION INTERNATIONALE DE L AUTOMOBILE Norme 8861-2000 NORME FIA CONCERNANT LA PERFORMANCE DES DISPOSITIFS D'ABSORPTION D'ÉNERGIE À L'INTÉRIEUR DES BARRIÈRES DE PNEUS DE FORMULE UN Ce cahier des charges

Plus en détail

Christelle REYNES EA 2415 Epidémiologie, Biostatistique et Santé Publique Université Montpellier 1. 8 Juin 2012

Christelle REYNES EA 2415 Epidémiologie, Biostatistique et Santé Publique Université Montpellier 1. 8 Juin 2012 Extraction et analyse des mesures haut-débit pour l identification de biomarqueurs : problèmes méthodologiques liés à la dimension et solutions envisagées EA 2415 Epidémiologie, Biostatistique et Santé

Plus en détail

4. Résultats et discussion

4. Résultats et discussion 17 4. Résultats et discussion La signification statistique des gains et des pertes bruts annualisés pondérés de superficie forestière et du changement net de superficie forestière a été testée pour les

Plus en détail

Chapitre 1. L algorithme génétique

Chapitre 1. L algorithme génétique Chapitre 1 L algorithme génétique L algorithme génétique (AG) est un algorithme de recherche basé sur les mécanismes de la sélection naturelle et de la génétique. Il combine une stratégie de survie des

Plus en détail

MABioVis. Bio-informatique et la

MABioVis. Bio-informatique et la MABioVis Modèles et Algorithmes pour la Bio-informatique et la Visualisation Visite ENS Cachan 5 janvier 2011 MABioVis G GUY MELANÇON (PR UFR Maths Info / EPI GRAVITE) (là, maintenant) - MABioVis DAVID

Plus en détail

Points méthodologiques Adapter les méthodes statistiques aux Big Data

Points méthodologiques Adapter les méthodes statistiques aux Big Data Points méthodologiques Adapter les méthodes statistiques aux Big Data I. Répétition de tests et inflation du risque alpha II. Significativité ou taille de l effet? 2012-12-03 Biomédecine quantitative 36

Plus en détail

CHAPITRE 3 LA SYNTHESE DES PROTEINES

CHAPITRE 3 LA SYNTHESE DES PROTEINES CHAITRE 3 LA SYNTHESE DES ROTEINES On sait qu un gène détient dans sa séquence nucléotidique, l information permettant la synthèse d un polypeptide. Ce dernier caractérisé par sa séquence d acides aminés

Plus en détail

Génétique et génomique Pierre Martin

Génétique et génomique Pierre Martin Génétique et génomique Pierre Martin Principe de la sélections Repérage des animaux intéressants X Accouplements Programmés Sélection des meilleurs mâles pour la diffusion Index diffusés Indexation simultanée

Plus en détail

Recherche de parenté entre les vertébrés

Recherche de parenté entre les vertébrés 1 CHAPITRE A Recherche de parenté entre les vertébrés 2 Chapitre A : Recherche de parentés entre les êtres vivants Tous les êtres vivants présentent des structures cellulaires et un fonctionnement commun

Plus en détail

La perception du profil de crédit de l émetteur affecte la valorisation de l obligation.

La perception du profil de crédit de l émetteur affecte la valorisation de l obligation. Présentation Optimiser la gestion d un portefeuille obligataire Dans un contexte de rendements historiquement bas, RMG propose une stratégie de gestion de portefeuilles obligataires permettant d améliorer

Plus en détail

Manuel Qualité du plateau de génotypage

Manuel Qualité du plateau de génotypage Manuel Qualité du plateau de génotypage Selon la Norme ISO 9001 : Version 2008 Référence : Manuel Qualité Gestionnaire : Responsable qualité Version Date de version Historique des modifications Version

Plus en détail

Annales du Contrôle National de Qualité des Analyses de Biologie Médicale

Annales du Contrôle National de Qualité des Analyses de Biologie Médicale Annales du Contrôle National de Qualité des Analyses de Biologie Médicale ARN du virus de l hépatite C : ARN-VHC ARN-VHC 03VHC1 Novembre 2003 Edité : mars 2006 Annales ARN-VHC 03VHC1 1 / 8 ARN-VHC 03VHC1

Plus en détail

Les principes du sequençage haut-débit

Les principes du sequençage haut-débit Les principes du sequençage haut-débit Mardi 23 avril 2013 Dr H. EL HOUSNI Organisation Génomique Podhala'et'al.'Trends'in'genetics'2012' Costa V et al. J BioMed BioTech 2010 32 ans Costa V et al. J BioMed

Plus en détail

Recherche et analyse de polymorphismes SNP

Recherche et analyse de polymorphismes SNP Recherche et analyse de polymorphismes SNP 1- Tablet : Détection visuelle de SNP avec Tablet Tablet est un outil graphique de visualisation d assemblage et d alignement de séquences issues de NGS (Next

Plus en détail

Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013

Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013 Sélectionner les propositions exactes Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013 QCM 1 La plupart des techniques de biologie moléculaire repose sur le principe de complémentarité

Plus en détail

TRAITEMENT DES DONNEES MANQUANTES AU MOYEN DE L ALGORITHME DE KOHONEN

TRAITEMENT DES DONNEES MANQUANTES AU MOYEN DE L ALGORITHME DE KOHONEN TRAITEMENT DES DONNEES MANQUANTES AU MOYEN DE L ALGORITHME DE KOHONEN Marie Cottrell, Smaïl Ibbou, Patrick Letrémy SAMOS-MATISSE UMR 8595 90, rue de Tolbiac 75634 Paris Cedex 13 Résumé : Nous montrons

Plus en détail

Improving the breakdown of the Central Credit Register data by category of enterprises

Improving the breakdown of the Central Credit Register data by category of enterprises Improving the breakdown of the Central Credit Register data by category of enterprises Workshop on Integrated management of micro-databases Deepening business intelligence within central banks statistical

Plus en détail

La classification automatique de données quantitatives

La classification automatique de données quantitatives La classification automatique de données quantitatives 1 Introduction Parmi les méthodes de statistique exploratoire multidimensionnelle, dont l objectif est d extraire d une masse de données des informations

Plus en détail

TYPAGE HLA CROSSMATCH ANTICORPS ANTI-HLA

TYPAGE HLA CROSSMATCH ANTICORPS ANTI-HLA 16/11/12 TYPAGE HLA CROSSMATCH ANTICORPS ANTI-HLA Chantal GAUTREAU LABORATOIRE HLA S E R V I C E D I M M U N O L O G I E E T D H I S T O C O M PAT I B I L I T É, A P - H P, HÔPITAL SAINT LOUIS, PARIS,

Plus en détail

DIAGNOSTIC PRÉNATAL NON INVASIF : LE SANG MATERNEL

DIAGNOSTIC PRÉNATAL NON INVASIF : LE SANG MATERNEL 6 LE TEST DIAGNOSTIC PRÉNATAL NON INVASIF : LE SANG MATERNEL Source : les cellules trophoblastiques Fetal cell Cell isolation Détection 5-6SA Disparition rapide après accouchement Pas de persistance après

Plus en détail

Les Evolutions techniques. Marc Delpech Laboratoire de Génétique et Biologie moléculaires de l hôpital Cochin

Les Evolutions techniques. Marc Delpech Laboratoire de Génétique et Biologie moléculaires de l hôpital Cochin Les Evolutions techniques Marc Delpech Laboratoire de Génétique et Biologie moléculaires de l hôpital Cochin 1 Les principales étapes de l évolution technologique 1975 Southern blot 1977 Séquençage Sanger

Plus en détail

L indice de SEN, outil de mesure de l équité des systèmes éducatifs. Une comparaison à l échelle européenne

L indice de SEN, outil de mesure de l équité des systèmes éducatifs. Une comparaison à l échelle européenne L indice de SEN, outil de mesure de l équité des systèmes éducatifs. Une comparaison à l échelle européenne Sophie Morlaix To cite this version: Sophie Morlaix. L indice de SEN, outil de mesure de l équité

Plus en détail

L informatique des entrepôts de données

L informatique des entrepôts de données L informatique des entrepôts de données Daniel Lemire SEMAINE 13 L exploration des données 13.1. Présentation de la semaine L exploration de données (ou data mining) est souvent associée à l intelligence

Plus en détail

Plateforme. DArT (Diversity Array Technology) Pierre Mournet

Plateforme. DArT (Diversity Array Technology) Pierre Mournet Plateforme DArT (Diversity Array Technology) Pierre Mournet Lundi 8 avril 203 Pourquoi des DArT? Développement rapide et peu onéreux de marqueurs : Pas d information de séquence nécessaire. Pas de pré-requis

Plus en détail

RAPPORT DE PROJET DATA MINING

RAPPORT DE PROJET DATA MINING DEA 127 : INFORMATIQUE SYSTEMES INTELLIGENTS RAPPORT DE PROJET DATA MINING «Analyse des endettements par niveau de développement des pays» Réalisé par : BELEM MAHAMADOU Sous la direction de : M. EDWIN

Plus en détail

Introduction au Data-Mining

Introduction au Data-Mining Introduction au Data-Mining Alain Rakotomamonjy - Gilles Gasso. INSA Rouen -Département ASI Laboratoire PSI Introduction au Data-Mining p. 1/25 Data-Mining : Kèkecé? Traduction : Fouille de données. Terme

Plus en détail

Conception assistée par ordinateur de molécules thérapeutiques

Conception assistée par ordinateur de molécules thérapeutiques Conception assistée par ordinateur de molécules thérapeutiques D. Gilis Bioinformatique génomique et structurale Faculté des sciences appliquées Université Libre de Bruxelles Objectif: illustrer en quoi

Plus en détail

Chapitre 7. Récurrences

Chapitre 7. Récurrences Chapitre 7 Récurrences 333 Plan 1. Introduction 2. Applications 3. Classification des récurrences 4. Résolution de récurrences 5. Résumé et comparaisons Lectures conseillées : I MCS, chapitre 20. I Rosen,

Plus en détail

Bioinformatique en génomique évolutive

Bioinformatique en génomique évolutive Bioinformatique en génomique évolutive Elsa Petit Parcours 1997-2000: Ecole d Ingénieurs des Travaux Agricoles, Bordeaux Option pathologie végétale Eté 1999: Iowa State University, Prévision de l anthracnose

Plus en détail

Principe de symétrisation pour la construction d un test adaptatif

Principe de symétrisation pour la construction d un test adaptatif Principe de symétrisation pour la construction d un test adaptatif Cécile Durot 1 & Yves Rozenholc 2 1 UFR SEGMI, Université Paris Ouest Nanterre La Défense, France, cecile.durot@gmail.com 2 Université

Plus en détail

Marc DELPECH. CORATA La Rochelle le 21 mai 2008

Marc DELPECH. CORATA La Rochelle le 21 mai 2008 Marc DELPECH CORATA La Rochelle le 21 mai 2008 En 24 ans les progrès ont été considérables Premières utilisation des techniques de génétique moléculaire en diagnostic : 1984 Une palette de techniques très

Plus en détail

Méthode automatisée de dosage colorimétrique du dioxyde de soufre total dans les vins

Méthode automatisée de dosage colorimétrique du dioxyde de soufre total dans les vins Méthode automatisée de dosage colorimétrique du dioxyde de soufre total dans les vins Marc DUBERNET* et Françoise GRASSET* Laboratoire DUBERNET - 9, quai d Alsace - 11100 Narbonne France 1. Objet Méthode

Plus en détail

Data issues in species monitoring: where are the traps?

Data issues in species monitoring: where are the traps? Data issues in species monitoring: where are the traps? French breeding bird monitoring : Animations locales : - dealing with heterogenous data - working with multi-species multi-sites monitoring schemes

Plus en détail

Utilisation de la métagénomique 16S pour la surveillance de l émergence de zoonoses bactériennes dans les populations animales

Utilisation de la métagénomique 16S pour la surveillance de l émergence de zoonoses bactériennes dans les populations animales Utilisation de la métagénomique 16S pour la surveillance de l émergence de zoonoses bactériennes dans les populations animales Réunion Rongeur 2014 CBGP Maxime Galan Métagénomique 16S: Pourquoi? Identification

Plus en détail

Decherney et al., 1981 ). La décroissance du taux d HCG après traitement cœlioscopique

Decherney et al., 1981 ). La décroissance du taux d HCG après traitement cœlioscopique La décroissance du taux d HCG après traitement cœlioscopique conservateur de la grossesse extra-utérine J. L. POULY, G. MAGE, H. MANHES, Françoise GACHON Ginette GAIL- LARD M. A. BRUHAT Service de Gynécologie-Obstétrique,

Plus en détail

Gestion obligataire passive

Gestion obligataire passive Finance 1 Université d Evry Séance 7 Gestion obligataire passive Philippe Priaulet L efficience des marchés Stratégies passives Qu est-ce qu un bon benchmark? Réplication simple Réplication par échantillonnage

Plus en détail

Modèle de troncature gauche : Comparaison par simulation sur données indépendantes et dépendantes

Modèle de troncature gauche : Comparaison par simulation sur données indépendantes et dépendantes de troncature gauche : Comparaison par simulation sur données indépendantes et dépendantes Zohra Guessoum 1 & Farida Hamrani 2 1 Lab. MSTD, Faculté de mathématique, USTHB, BP n 32, El Alia, Alger, Algérie,zguessoum@usthb.dz

Plus en détail

Introduction à l Analyse des Réseaux Sociaux

Introduction à l Analyse des Réseaux Sociaux Introduction à l Analyse des Réseaux Sociaux Erick Stattner Laboratoire LAMIA Université des Antilles et de la Guyane, France erick.stattner@univ-ag.fr Guadeloupe, Novembre 2012 Erick Stattner Introduction

Plus en détail

POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA

POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA Amplification spécifique Détection spécifique Clonage dans des vecteurs Amplification in vitro PCR Hybridation moléculaire - hôte cellulaire

Plus en détail

Filtrage stochastique non linéaire par la théorie de représentation des martingales

Filtrage stochastique non linéaire par la théorie de représentation des martingales Filtrage stochastique non linéaire par la théorie de représentation des martingales Adriana Climescu-Haulica Laboratoire de Modélisation et Calcul Institut d Informatique et Mathématiques Appliquées de

Plus en détail

Recherche d information textuelle

Recherche d information textuelle Recherche d information textuelle Pré-traitements & indexation B. Piwowarski CNRS / LIP6 Université Paris 6 benjamin@bpiwowar.net http://www.bpiwowar.net Master IP - 2014-15 Cours et travaux pratiques

Plus en détail

Incertitude et variabilité : la nécessité de les intégrer dans les modèles

Incertitude et variabilité : la nécessité de les intégrer dans les modèles Incertitude et variabilité : la nécessité de les intégrer dans les modèles M. L. Delignette-Muller Laboratoire de Biométrie et Biologie Evolutive VetAgro Sup - Université de Lyon - CNRS UMR 5558 24 novembre

Plus en détail

FOURTH SESSION : "MRP & CRP"

FOURTH SESSION : MRP & CRP FOURTH SESSION : "MRP & CRP" Objectifs : Etre capable d analyser un plan directeur de fabrication (MPS). Pour cela il faut pouvoir : - exploser le plan en termes des différents composants, - Comprendre

Plus en détail

RNAseq et NGS. Adriana Alberti Karine Labadie

RNAseq et NGS. Adriana Alberti Karine Labadie RNAseq et NGS Séquençage et Diversité LES ORGANISMES EUCARYOTES animaux plantes champignons protistes BACTERIES ARCHEES VIRUS METAGENOMES LES SOURCES ADN GENOMIQUE ARN / cdna AMPLICONS BACs ET FOSMIDES

Plus en détail

EXEMPLE : FAILLITE D ENTREPRISES

EXEMPLE : FAILLITE D ENTREPRISES EXEMPLE : FAILLITE D ENTREPRISES Cet exemple a pour objectif d étudier la faillite d entreprises. Les données proviennent de l ouvrage de R.A.Johnson et D.W Wichern : «Applied Multivariate Statistical

Plus en détail

$SSOLFDWLRQGXNULJHDJHSRXUOD FDOLEUDWLRQPRWHXU

$SSOLFDWLRQGXNULJHDJHSRXUOD FDOLEUDWLRQPRWHXU $SSOLFDWLRQGXNULJHDJHSRXUOD FDOLEUDWLRQPRWHXU Fabien FIGUERES fabien.figueres@mpsa.com 0RWVFOpV : Krigeage, plans d expériences space-filling, points de validations, calibration moteur. 5pVXPp Dans le

Plus en détail

Lamia Oukid, Ounas Asfari, Fadila Bentayeb, Nadjia Benblidia, Omar Boussaid. 14 Juin 2013

Lamia Oukid, Ounas Asfari, Fadila Bentayeb, Nadjia Benblidia, Omar Boussaid. 14 Juin 2013 Cube de textes et opérateur d'agrégation basé sur un modèle vectoriel adapté Text Cube Model and aggregation operator based on an adapted vector space model Lamia Oukid, Ounas Asfari, Fadila Bentayeb,

Plus en détail

Données biologiques haut-débit :

Données biologiques haut-débit : Données biologiques haut-débit : problèmes méthodologiques liés à la dimension et utilisation des algorithmes génétiques Christelle REYNES EA 2415 Epidémiologie, Biostatistique et Santé Publique Université

Plus en détail

Etude d un cas industriel : Optimisation de la modélisation de paramètre de production

Etude d un cas industriel : Optimisation de la modélisation de paramètre de production Revue des Sciences et de la Technologie RST- Volume 4 N 1 /janvier 2013 Etude d un cas industriel : Optimisation de la modélisation de paramètre de production A.F. Bernate Lara 1, F. Entzmann 2, F. Yalaoui

Plus en détail

Travailler avec les télécommunications

Travailler avec les télécommunications Travailler avec les télécommunications Minimiser l attrition dans le secteur des télécommunications Table des matières : 1 Analyse de l attrition à l aide du data mining 2 Analyse de l attrition de la

Plus en détail

Marketing Data Set: Follow-Up to Purchases of a Consumer Panel

Marketing Data Set: Follow-Up to Purchases of a Consumer Panel Marketing Data Set: Follow-Up to Purchases of a Consumer Panel Typologie des consommateurs et Mesure de la loyauté/fidélité Stéphanie Ledauphin-Menard, Sébastien Lê Face aux problèmes de pouvoir d achat

Plus en détail

Cet article s attache tout d abord

Cet article s attache tout d abord Méthodes internationales pour comparer l éducation et l équité Comparaison entre pays des coûts de l éducation : des sources de financement aux dépenses Luc Brière Marguerite Rudolf Bureau du compte de

Plus en détail

Approche hybride de reconstruction de facettes planes 3D

Approche hybride de reconstruction de facettes planes 3D Cari 2004 7/10/04 14:50 Page 67 Approche hybride de reconstruction de facettes planes 3D Ezzeddine ZAGROUBA F. S.T, Dept. Informatique. Lab. d Informatique, Parallélisme et Productique. Campus Universitaire.

Plus en détail

Anomalies chromosomiques

Anomalies chromosomiques Master bioinformatique, Université de Rouen Janvier 2013 Sylvain Mareschal [@etu.univ-rouen.fr] Anomalies chromosomiques Speicher & Carter (2005) Nat Rev Genet. Oct;6(10):782-92. The new cytogenetics:

Plus en détail

Gene Predictis parce que je suis unique

Gene Predictis parce que je suis unique Gene Predictis parce que je suis unique Route de Chantemerle 64 - CP 160 - CH-1763 Granges-Paccot Téléphone: +41 26 466 15 45 Fax: +41 26 466 15 46 info@genepredictis.com www.genepredictis.com Gene Predictis

Plus en détail

Séquençage haut débit (Next Generation Sequencing) 12/03/2012 Pascal Le Bourgeois, M1BBT, EM8BTGM 1

Séquençage haut débit (Next Generation Sequencing) 12/03/2012 Pascal Le Bourgeois, M1BBT, EM8BTGM 1 Séquençage haut débit (Next Generation Sequencing) 1 Pyroséquençage (454) Margulies M. et al. (2005). Genome sequencing in microfabricated high-density picolitre reactors. Nature 437:376-80 Pas de banques

Plus en détail

UNE EXPERIENCE, EN COURS PREPARATOIRE, POUR FAIRE ORGANISER DE L INFORMATION EN TABLEAU

UNE EXPERIENCE, EN COURS PREPARATOIRE, POUR FAIRE ORGANISER DE L INFORMATION EN TABLEAU Odile VERBAERE UNE EXPERIENCE, EN COURS PREPARATOIRE, POUR FAIRE ORGANISER DE L INFORMATION EN TABLEAU Résumé : Cet article présente une réflexion sur une activité de construction de tableau, y compris

Plus en détail

BACCALAURÉAT GÉNÉRAL SCIENCES DE LA VIE ET DE LA TERRE

BACCALAURÉAT GÉNÉRAL SCIENCES DE LA VIE ET DE LA TERRE BACCALAURÉAT GÉNÉRAL SESSION 2013 SCIENCES DE LA VIE ET DE LA TERRE Série S Durée de l'épreuve : 3h30 Coefficient : 6 ENSEIGNEMENT OBLIGATOIRE L'usage de la calculatrice n'est pas autorisé. Dès que le

Plus en détail

Principales caractéristiques de Mixmod

Principales caractéristiques de Mixmod Modèle de mélanges Principales caractéristiques de Mixmod Gérard Govaert et Gilles Celeux 24 octobre 2006 1 Plan Le modèledemélange Utilisations du modèle de mélange Les algorithmes de Mixmod Modèle de

Plus en détail

Direction des Études et Synthèses Économiques Département des Comptes Nationaux Division des Comptes Trimestriels

Direction des Études et Synthèses Économiques Département des Comptes Nationaux Division des Comptes Trimestriels Etab=MK3, Timbre=G430, TimbreDansAdresse=Vrai, Version=W2000/Charte7, VersionTravail=W2000/Charte7 Direction des Études et Synthèses Économiques Département des Comptes Nationaux Division des Comptes Trimestriels

Plus en détail

NOUVELLES REGLEMENTATIONS

NOUVELLES REGLEMENTATIONS Vision et Conduite Permis B Permis Professionnels NOUVELLES REGLEMENTATIONS X. ZANLONGHI T. BIZEAU - C. GRIMAUD Centre Basse Vision de la Clinique Sourdille Laboratoire d Explorations Fonctionnelles de

Plus en détail

Étude des résultats des investisseurs particuliers sur le trading de CFD et de Forex en France

Étude des résultats des investisseurs particuliers sur le trading de CFD et de Forex en France Étude des résultats des investisseurs particuliers sur le trading de CFD et de Forex en France Le 13 octobre 2014 Autorité des marchés financiers 17, place de la Bourse 75082 Paris cedex 02 Tél. : 01 53

Plus en détail

TESTS D HYPOTHÈSE FONDÉS SUR LE χ². http://fr.wikipedia.org/wiki/eugénisme

TESTS D HYPOTHÈSE FONDÉS SUR LE χ². http://fr.wikipedia.org/wiki/eugénisme TESTS D HYPOTHÈSE FONDÉS SUR LE χ² http://fr.wikipedia.org/wiki/eugénisme Logo du Second International Congress of Eugenics 1921. «Comme un arbre, l eugénisme tire ses constituants de nombreuses sources

Plus en détail

La génomique. Etude des génomes et de l ensemble de leurs gènes. Nécessite des outils bioinformatiques. Plusieurs étapes :

La génomique. Etude des génomes et de l ensemble de leurs gènes. Nécessite des outils bioinformatiques. Plusieurs étapes : La génomique Etude des génomes et de l ensemble de leurs gènes La structure Le fonctionnement L évolution Le polymorphisme, Plusieurs étapes : Nécessite des outils bioinformatiques 1 Chronologie sur le

Plus en détail

THÈSE. présentée à TÉLÉCOM PARISTECH. pour obtenir le grade de. DOCTEUR de TÉLÉCOM PARISTECH. Mention Informatique et Réseaux. par.

THÈSE. présentée à TÉLÉCOM PARISTECH. pour obtenir le grade de. DOCTEUR de TÉLÉCOM PARISTECH. Mention Informatique et Réseaux. par. École Doctorale d Informatique, Télécommunications et Électronique de Paris THÈSE présentée à TÉLÉCOM PARISTECH pour obtenir le grade de DOCTEUR de TÉLÉCOM PARISTECH Mention Informatique et Réseaux par

Plus en détail

Atelier 5/11/2013. Structure de la chromatine et marques épigénétiques

Atelier 5/11/2013. Structure de la chromatine et marques épigénétiques Atelier 5/11/2013 Structure de la chromatine et marques épigénétiques La chromatine ADN ADN + Histones = Nucleosome ADN + Protéines + ARNs = Chromatine Niveau extrême de condensation = Chromosome métaphasique

Plus en détail

Titre: Domaine scientifique : Mots clés : Directeurs de thèse : Institution des directeurs de thèse : Adresse email des directeurs de thèse :

Titre: Domaine scientifique : Mots clés : Directeurs de thèse : Institution des directeurs de thèse : Adresse email des directeurs de thèse : Titre: Détermination de l ensemble des ARNs non codants chez Ostreococcus, un modèle d algue unicellulaire marine infectée par des virus à ADN double brin Domaine scientifique : Génomique Mots clés : ARN

Plus en détail

Objectif du groupe GT1.1 Fusion de Données

Objectif du groupe GT1.1 Fusion de Données Objectif du groupe GT1.1 Fusion de Données Le groupe travaille dans trois directions Le vocabulaire (piloté par ADVITAM et l aide de SITE) L état de l art (piloté par SYROKKO) Deux applications illustratives

Plus en détail

Médecine 4P Prédictive, Préventive, Personnalisée, Participative Les enjeux

Médecine 4P Prédictive, Préventive, Personnalisée, Participative Les enjeux Médecine 4P Prédictive, Préventive, Personnalisée, Participative Les enjeux Unité Inserm UMR 1087-CNRS UMR 6291 Hervé Le Marec Evolution de la médecine et de la recherche biomédicale développement de traitements

Plus en détail

Item 169 : Évaluation thérapeutique et niveau de preuve

Item 169 : Évaluation thérapeutique et niveau de preuve Item 169 : Évaluation thérapeutique et niveau de preuve COFER, Collège Français des Enseignants en Rhumatologie Date de création du document 2010-2011 Table des matières ENC :...3 SPECIFIQUE :...3 I Différentes

Plus en détail

MAT 2377 Solutions to the Mi-term

MAT 2377 Solutions to the Mi-term MAT 2377 Solutions to the Mi-term Tuesday June 16 15 Time: 70 minutes Student Number: Name: Professor M. Alvo This is an open book exam. Standard calculators are permitted. Answer all questions. Place

Plus en détail

TRS: Sélection des sous-graphes représentants par l intermédiaire des attributs topologiques et K-medoïdes

TRS: Sélection des sous-graphes représentants par l intermédiaire des attributs topologiques et K-medoïdes TRS: Sélection des sous-graphes représentants par l intermédiaire des attributs topologiques et K-medoïdes Mohamed Moussaoui,Wajdi Dhifli,Sami Zghal,Engelbert Mephu Nguifo FSJEG, Université de Jendouba,

Plus en détail

Empreintes conceptuelles et spatiales pour la caractérisation des réseaux sociaux

Empreintes conceptuelles et spatiales pour la caractérisation des réseaux sociaux Empreintes conceptuelles et spatiales pour la caractérisation des réseaux sociaux Bénédicte Le Grand*, Marie-Aude Aufaure** and Michel Soto* *Laboratoire d Informatique de Paris 6 UPMC {Benedicte.Le-Grand,

Plus en détail

exemple de végétaux exposés au benzène atmosphérique Sylvain Dumez sylvain.dumez@univ-lille2.fr

exemple de végétaux exposés au benzène atmosphérique Sylvain Dumez sylvain.dumez@univ-lille2.fr Approches écotoxicogénomiques et application à la biosurveillance exemple de végétaux exposés au benzène atmosphérique Sylvain Dumez sylvain.dumez@univ-lille2.fr Laboratoire des Sciences végétales et fongiques,

Plus en détail

Tests de comparaison de moyennes. Dr Sahar BAYAT MASTER 1 année 2009-2010 UE «Introduction à la biostatistique»

Tests de comparaison de moyennes. Dr Sahar BAYAT MASTER 1 année 2009-2010 UE «Introduction à la biostatistique» Tests de comparaison de moyennes Dr Sahar BAYAT MASTER 1 année 2009-2010 UE «Introduction à la biostatistique» Test de Z ou de l écart réduit Le test de Z : comparer des paramètres en testant leurs différences

Plus en détail

Chapitre 3 : Principe des tests statistiques d hypothèse. José LABARERE

Chapitre 3 : Principe des tests statistiques d hypothèse. José LABARERE UE4 : Biostatistiques Chapitre 3 : Principe des tests statistiques d hypothèse José LABARERE Année universitaire 2010/2011 Université Joseph Fourier de Grenoble - Tous droits réservés. Plan I. Introduction

Plus en détail

LIVRE BLANC Décembre 2014

LIVRE BLANC Décembre 2014 PARSING MATCHING EQUALITY SEARCH LIVRE BLANC Décembre 2014 Introduction L analyse des tendances du marché de l emploi correspond à l évidence à une nécessité, surtout en période de tension comme depuis

Plus en détail

Revision of hen1317-5: Technical improvements

Revision of hen1317-5: Technical improvements Revision of hen1317-5: Technical improvements Luca Felappi Franz M. Müller Project Leader Road Safety Consultant AC&CS-CRM Group GDTech S.A., Liège Science Park, rue des Chasseurs-Ardennais, 7, B-4031

Plus en détail

Le séquençage haut-débit

Le séquençage haut-débit Nouveaux outils en biologie Le séquençage haut-débit DES d hématologie 16 janvier 2015 Paris Alice Marceau-Renaut Laboratoire d hématologie CHRU Lille NGS = Next-Generation Sequencing Whole-genome Whole-exome

Plus en détail

Méthodes non paramétriques par permutations

Méthodes non paramétriques par permutations Méthodes non paramétriques par permutations Denis Puthier 11 juin 2008 Laboratoire INSERM TAGC/ERM206, Parc Scientifique de Luminy case 928,13288 MARSEILLE cedex 09, FRANCE. http://biologie.univ-mrs.fr/view-data.php?id=245

Plus en détail

Energy Security First!

Energy Security First! ITINERA INSTITUTE SERIE ELECTIONS Energy Security First! 18 03 2014 MENSEN WELVAART BESCHERMING Mise en contexte Johan Albrecht La sortie du nucléaire est désormais toute proche. En 2015, les deux plus

Plus en détail

REFERENTIEL DE CERTIFICATION APPLICABLE AUX SEMENCES :

REFERENTIEL DE CERTIFICATION APPLICABLE AUX SEMENCES : REFERENTIEL DE CERTIFICATION APPLICABLE AUX SEMENCES : «Processus de maîtrise des risques d'émission des poussières issues de semences traitées avec des produits phytopharmaceutiques : Opérations industrielles»

Plus en détail

ACIDES BASES. Chap.5 SPIESS

ACIDES BASES. Chap.5 SPIESS ACIDES BASES «Je ne crois pas que l on me conteste que l acide n ait des pointes Il ne faut que le goûter pour tomber dans ce sentiment car il fait des picotements sur la langue.» Notion d activité et

Plus en détail

Outils de gestion des ressources biologiques

Outils de gestion des ressources biologiques Le Cahier des Techniques de l INRA 2015 (84) N 1 Outils de gestion des ressources biologiques Frédéric Sanchez 1 *, Tou Cheu Xiong 1 Résumé. Les recherches en biologie génèrent un grand nombre d échantillons

Plus en détail