Développement, utilisation et comparaison de différents types de marqueurs pour étudier la diversité parmi une collection de blé tendre

Dimension: px
Commencer à balayer dès la page:

Download "Développement, utilisation et comparaison de différents types de marqueurs pour étudier la diversité parmi une collection de blé tendre"

Transcription

1 Les Actes du BRG, 6 (2006) BRG, 2006 Article original Développement, utilisation et comparaison de différents types de marqueurs pour étudier la diversité parmi une collection de blé tendre François BALFOURIER (1)*, Catherine RAVEL (1), Anne-Marie BOCHARD (2), Florence EXBRAYAT-VINSON (1), Gilles BOUTET (1), Pierre SOURDILLE (1), Philippe DUFOUR (2), Gilles CHARMET (1) (1) INRA - UMR Amélioration et Santé des Plantes, 234 avenue du Brézet, Clermont-Ferrand, France (2) Limagrain Agro-Industrie, site ULICE, ZAC les Portes de Riom, BP173, Riom Cedex, France Abstract: Generation, use and comparison of different molecular markers for diversity analyses in bread wheat collection. In order to determine the interest of different types of molecular markers for genetic diversity analyses, molecular polymorphism was studied in a set of 731 bread wheat accessions using 38 genomic microsatellites (SSRg), 44 EST-derived microsatellites (SSRest) and SNPs from 16 genes. The total of 98 markers covers the whole bread wheat genome. SSRg present the highest level of polymorphism (900 alleles) compared to SSRest and SNPs (183 alleles and 69 haplotypes, respectively). Among SSRest markers, those with dinucleotide repeats are significantly more polymorphic than the others with tri and tetra nucleotide repeats. Whatever markers we consider, no significant difference appears in the level of diversity between the different A, B and D genome of bread wheat. The three genetic matrices distances between pairs of accessions, calculated for each type of markers in a sub-sample of 41 accessions with no missing data, are not significantly different. However, SSRg appear to be more efficient than SSRest to estimate these distances. The two types of microsatellites offer the same capacity to restore the topology of a given hierarchical tree. The three hierarchical trees, obtained from the sub-sample of 41 accessions individually analysed by the three types of markers, show a common topological structure. This structure, which clearly separates the European wheat accessions from the Asian ones, may be both explained by historical process of wheat germplasm migration and selective adaptation to environmental conditions. The whole results are discussed according to the nature and the level of neutrality of the different markers in relation to selection. bread wheat/ genetic structure/ microsatellite/ SNP/ phylogenic tree * Correspondance et tirés à part : 129

2 F. Balfourier et al. Résumé : Afin d analyser l intérêt de différents marqueurs moléculaires pour des études de diversité génétique, le polymorphisme a été étudié dans un échantillon de 731 blés tendres à l aide de 38 microsatellites génomiques (SSRg), 44 microsatellites issus d EST (SSRest) et de SNP détectés sur 16 gènes, soit 98 locus également répartis sur le génome. Les SSRg apparaissent comme les plus polymorphes (900 allèles) comparés aux SSRest (183 allèles) et aux SNP (69 haplotypes). Parmi les SSRest, ceux au motif di-nucléotique sont significativement plus polymorphes que les autres. Les matrices de distance génétique, calculées entre paires d accessions pour chaque type de marqueur dans un sous échantillon de 41 accessions, ne sont pas significativement différentes, mais les SSRg s avèrent plus efficaces que les SSRest pour estimer ces distances. Les deux types de microsatellites présentent la même cinétique de reconstruction de la topologie d un arbre donné. Les trois arbres, obtenus à partir du sous échantillon de 41 accessions analysé par les trois types de marqueurs pris individuellement, montrent une structure commune en terme de topologie qui est liée à l origine géographique des accessions. Ces résultats sont discutés en fonction de la nature et du niveau de neutralité des marqueurs vis-à-vis de la sélection. blé tendre/ structuration génétique/ microsatellite/ SNP/ arbre phylogénétique 1. INTRODUCTION L analyse des variations de séquence de l ADN est aujourd hui abondamment exploitée pour la cartographie génétique, l étiquetage de gènes ou encore l analyse de populations (analyse de diversité génétique, étude d évolution, ). De nombreux marqueurs moléculaires tels que les RFLP (Restriction Fragment Length polymorphism), les RAPD (Random Amplified Polymorphic DNA), les AFLP (Amplified Fragment Length polymorphism ) ou encore les SSR (Simple Sequence Repeat) ont été récemment utilisés pour conduire ce dernier type d analyse chez le blé tendre [13], [18], [21]. Parmi ces marqueurs, les microsatellites ou SSR sont réputés être les plus performants pour des analyses de diversité dans de vastes collections de ressources génétiques. Ce sont des séquences de quelques nucléotides (1 à 6) répétées en tandem, abondamment dispersées à travers tout le génome, multi-alléliques, co-dominantes et facilement amplifiables par PCR (Polymorphism Chain Reaction). Parmi ceux-ci, on distingue les SSR génomiques (SSRg), issus de banques enrichies en ADN génomique, des SSR développés à partir d EST (Expressed Sequence Tag) représentant les régions exprimées du génome (SSRest). Il a été démontré qu environ 10 % des contigs d EST de blé contiennent un microsatellite [9]. De par leur origine, les SSRg sont supposés présenter une neutralité plus importante vis-à-vis de la sélection que les SSRest possédant potentiellement une valeur sélective non nulle. Plus récemment, un nouveau type de marqueurs basés sur des changements ponctuels d une base dans une séquence donnée et appelés SNP (Single 130

3 Comparaison de marqueurs chez le blé tendre Nucleotide Polymorphism) a été développé. Ces marqueurs sont général e- ment bi-alléliques et permettent d appréhender des variations de gènes impliqués dans le contrôle de caractères d intérêts. Plusieurs études ont contr i- bué à la mise en évidence de SNP soit par séquençage de gènes sur collection [2], [11], soit par bioanalyse de séquences d EST regroupées en contigs et issues des bases de données [17]. Jusqu à présent, la recherche systémat i- que de SNP chez le blé a été conduite sur une cinquantaine de gènes env i- ron, ce qui a permis de mener quelques travaux de cartographie génétique et des études de génétique d association [3], [12]. Néanmoins, ces marqueurs, qui à l instar des SSRest révèlent un polymorphisme dans des gènes d intérêts, n ont encore jamais été utilisés à grande échelle pour décrire la diversité parmi de larges collections de ressources génétiques et analyser la façon dont ils peuvent structurer cette diversité. Dans l étude présentée ici, nous avons évalué la diversité génétique d un large échantillon de blé tendre déjà décrit pour un jeu de microsatellites g é- nomiques (SSRg), en utilisant un second jeu des microsatellites issus cette fois d EST (SSRest) ainsi qu un panel de SNP développés par ailleurs. Le but est d analyser l intérêt de ces types de marqueurs pour des études de diversité en comparant les différents niveaux de polymorphismes neutres et sélectionnés qu ils révèlent, ainsi que la façon dont ils permettent individuellement de structurer la diversité parmi les collections de ressources génétiques. En effet, pour une conservation optimale (non biaisée) de la diversité dans les collections il peut être préférable de se baser à priori sur la diversité neutre. Cependant, le développement récent de nouveaux marqueurs issus de parties codantes (SSRest, SNP) et destinés au départ plutôt à la recherche de gènes candidats ou d associations, doit nous amener à nous interroger aussi sur leur int é- rêt pour décrire, structurer et donc potentiellement servir de base dans des méthodes d optimisation pour la conservation de la diversité. L objet de cet article est de tenter de répondre à certaines de ces questions. 2. MATÉRIEL ET MÉTHODES 2.1. Choix du matériel d étude Un échantillon de 731 accessions de blé tendre, issues de la collection INRA conservées à Clermont-Ferrand, a été utilisé pour cette étude. Cet échantillon, composé de variétés de pays et de lignées fixées issues de plus de 60 origines géographiques différentes, a été choisi parmi plus de blés de la collection globale de manière à contenir la totalité des allèles microsatellites observés à l aide d un jeu de SSRg [13]. Il a en outre été choisi de façon à représenter un optimum de la diversité en terme d origine géo- 131

4 F. Balfourier et al. graphique et de périodes décennales d inscription au catalogue (lignées) ou de culture (variétés de pays) entre les années 1840 et L extraction d ADN a été réalisée à partir de plantules issues de semences de plantes autofécondées. Les feuilles de cinq à six plantes par accessions ont été mélangées, puis broyées avant d en extraire l ADN en mélange selon la méthode d extraction au métabisulfite [13] Microsatellites Le jeu de SSRg considéré pour la présente étude correspond à celui utilisé précédemment pour décrire la collection globale de blés [13], [14], [15]. Il s agit d un jeu de 37 SSRg donnant 38 loci polymorphes. Ces microsatellites ont été choisis selon leur répartition sur le génome (locus gwm et cfd sur fig. 1). Ce sont en majorité des microsatellites à motif dinucléotidique parfait. gpw7072 cfe167 gwm135 gwm11 gwm413 gpw7082 gwm337 gwm372 gwm312 gpw7438 gwm257 Gogat cfe68 gpw7325 gwm261 cfe78 gwm120 gwm539 cfe175 gwm480 BPGIPBM gwm664 gwm99 gpw7577 gpw7570 gwm642 cfe52 gpw7213 GaMyb cfe189 Aap Glu gpw7443 Glu gpw7335 1A 1B 1D 2A 2B 2D 3A 3B 3D gwm234 gwm469 cfe8 cfe273 gwm190 cfe214 cfd71 gpw7795 gpw7218 Pin B gwm325 gwm415 gpw7592 gwm610 gwm626 gpw7241 cfd71 Pbf Pbf Pbf gpw7574 gwm186 Gdh cfe300 gwm149 cfe186 cfe95 Gdh cfe301 gpw7666 Gdh gpw7425 gpw7107 gpw7384 gwm251 gwm408 gwm272 gwm427 gwm219 gpw7433 4A 4B 4D 5A 5B 5D 6A 6B 6D gwm46 gpw7288 gpw7185 gwm260 gpw7320 gpw7342 gwm400 gwm044 cfe135 Sal1 Sal1 gwm437 cfe248 gpw7596 Sal1 gpw7386 7A 7B 7D gwm2 gpw7553 gpw7452 gwm341 gwm566 cfe172 gpw7586 Figure 1 : Assignation des différents marqueurs aux différents bras chromosomiques du génome du blé tendre (SSRg, SSRest, gènes). Près de SSRest ont été développés ces dernières années au sein du laboratoire INRA de Clermont-Ferrand (885 gpw [9] ; 301 cfe [22]). Les conditions d exploitation de ceux-ci sont décrites dans la base de données Graingenes (http://wheat.pw.usda.gov). Pour notre étude, nous avons s é- lectionné 44 SSRest selon des critères de position sur le génome (compl é- mentaire au jeu de SSRg), de type de motif (di-, tri- ou tétranucléotides) et 132

5 Comparaison de marqueurs chez le blé tendre de facilité de lecture, de façon à couvrir in fine la totalité du génome avec autant que possible quatre microsatellites par chromosome (2 SSRg + 2 SSRest) (locus gpw et cfe sur fig. 1). Les conditions d amplification PCR et de lecture des allèles ont été celles décrites par Roussel et al. [14]. Les opérations de génotypage des microsatellites ont été réalisées sur la plate-forme de génotypage haut-débit INRA de Clermont-Ferrand SNP Les gènes étudiés concernent : le métabolisme azoté (AAP, Amino Acid Permease ; 2,3 BPGIPGM, 2,3 BiphosphoGlycerate Independant Phosphoglycerate Mutase; GDH, Glutamate-deshydrogenase; Gogat, glutamate synthase), la synthèse de protéines de réserve (Glu-A3 et Glu-D1-1, codant respectivement pour des gluténines de faible et de haut poids moléculaires), deux facteurs régulant l expression de gènes codants pour les protéines de réserve (wpbf et Gamyb), la dureté (PinB) et le nombre de couches d aleurone (Sal1, Super Aleurone Layer). Des SNP ont été détectés au sein de ces gènes par séquençage direct d un sous-échantillon de 42 lignées représentatives de la diversité dans le blé tendre (13 kb séquencées par lignée). Les informations nécessaires à l utilisation de ces SNP seront accessibles dans la base de SNP développée par l Unité de Recherche Génomique et Informatique (INRA, Evry) sur le site genoplante-info.infobiogen.fr. En tenant compte des copies homéologues, les gènes étudiés correspondent à 16 locus (fig. 1). Le génotypage des SNP candidats a été réalisé à l'aide de la technologie MassArray (Sequenom Inc., San Diego, CA). Après une amplification PCR, les produits issus de l'extension d'amorce ont été analysés par spe ctrométrie de masse MALDI-TOF Analyse des données La comparaison entre les trois types de marqueurs a tout d abord été réalisée à l aide d indices de diversité simples que sont le nombre de locus polymorphes, la richesse allélique (ou nombre d allèles) et la valeur PIC (Polymorphism Information Content = indice de diversité de Nei), indices calculés par locus, sur l ensemble des 731 individus. Les moyennes de ces indices ont été comparées à l aide d un test non paramétrique de Mann Whitney. Dans un second temps, l aptitude des différents marqueurs à structurer la diversité a été comparée par calcul de la distance génétique de Sokal et Michener entre paires d accessions pour les trois types de marqueurs (SSRg, SSRest 133

6 F. Balfourier et al. et SNP). Cette distance est définie dans Perrier et al. [10] comme étant égale à 1-P, où P est la proportion d allèles communs aux deux accessions. Les matrices de distances ont d abord été comparées deux à deux par le test de Mantel [8]. Puis elles ont permis de construire des arbres de classification hiérarchique selon la méthode du Neighbor-Joining [16]. Les coefficients de corrélation de Pearson entre ces matrices de distances prises deux à deux, puis entre les matrices de topologie caractérisant la structure de ch a- que arbre, ont également été calculés. Ces coefficients de corrélation ont été comparés deux à deux par la méthode de Lapointe et Legendre [7]. Enfin, les trois arbres obtenus ont été comparés deux à deux selon la méthode du MAST (Maximum Agreement Sub-Tree). Cette méthode repose sur l identification des accessions qui présentent une structuration commune dans chacun des deux arbres. On recherche l échantillon d accessions de taille maximale qui donne la même structure dans les deux arbres comparés ; ces accessions forment alors le MAST. La recherche de cet échantillon fait appel à un algorithme développé par Kubicka et al. [6] et proposé dans le logiciel DARwin [10]. Dans ce cas, le nombre d unités conservées dans le MAST, appelé l ordre «o» est considéré comme une mesure de ressemblance entre les deux arbres. La distribution statistique de ce critère «o» sous l hypothèse d indépendance des arbres n est pas connue mais a été approchée par simulation. Compte tenu de la taille des matrices et des arbres à manipuler, ces calculs ont été réalisés sur un échantillon plus restreint de 41 blés correspondant aux accessions ne présentant aucune donnée manquante, échantillon néanmoins bien représentatif des différentes origines géographiques prése n- tes dans les 731 accessions. 3. RÉSULTATS 3.1. Capacité des différents marqueurs à exprimer du polymorphisme Avec un total de 900 allèles, calculé sur l ensemble des 731 individus, les SSRg apparaissent de loin les marqueurs les plus polymorphes, co mparés aux SSRest (183 allèles) et aux SNP (69 haplotypes) (tabl. I); le nombre d allèles par locus varie ainsi de 7 à 45 pour les SSRg et seulement de 1 à 14 pour les SSRest, tandis que le nombre d haplotypes par locus étudié pour les SNP varie de 2 à 11 dans notre échantillon (un haplotype correspondant ici à la combinaison de différents SNP au même locus). Neuf locus SSRest apparaissent ici non polymorphes. Ramenés aux seuls locus polymorphes, les calculs du nombre moyen d allèles et de la valeur PIC moyenne indiquent 134

7 Comparaison de marqueurs chez le blé tendre clairement que les SSRg sont signif icativement plus polymorphes (p < 0,0001), tandis que SSRest et SNP présentent un même niveau de polymorphisme. Tableau I : Indices de diversité, par type de marqueurs, calculés à partir des 731 individus. Type de marqueurs Nombre d allèles (SSRs) ou d haplotypes (SNPs) Nbre. de locus Nbre. moyen d allele/locus Valeur PIC moyenne/locus total mini-maxi polymorphes polymorphes polymorphes 38 SSRg ,68 0, SSRest ,97 0, gènes ,31 0,353 L analyse de la valeur PIC, moyennée par type de marqueur et par génome du blé tendre (tabl. II) confirme le niveau significativement plus élevé de diversité pour les SSRg et ce quel que soit le génome considéré, tandis que les SSRest et SNP ne semblent pas significativement différents dans notre échantillon. Enfin, que l on considère les marqueurs indépendamment ou en totalité, sans doute compte tenu de nos effectifs en locus, il n apparaît pas ici de différence significative de niveau de diversité entre les génomes A, B ou D. Tableau II : Indices de diversité par type de marqueurs et par génomes. Type de marqueur Nbre. locus poly. Genome A Genome B Genome D Valeur PIC Nbre. Valeur PIC Nbre. moyenne locus moyenne locus Valeur PIC moyenne poly. poly. SSRg 12 0, , ,775 SSRest 13 0, , ,205 SNP 4 0, , ,196 total/genome 29 0, , ,459 L analyse du niveau de polymorphisme des SSRest en fonction de leur motif de base (tabl. III) indique que les SSRest au motif di-nucléotidique sont significativement plus polymorphes (p<0.0012) que les tri- et tétranucléotidiques. Par ailleurs, sept parmi les neuf SSRest non polymorphes ont des motifs tri-nucléotidiques. Ainsi, il semble que le niveau global de polymorphisme d un SSRest décroisse avec la taille de son motif de base. Tableau III : Valeur PIC moyenne en fonction du motif microsatellite des SSRest. Motif microsatellite Di-nucléotidique Tri-nucléotidique Tétra-nucléotidique Nbre. locus total Nbre locus polymorphes Valeur PIC moyenne 0,532 0,224 0,

8 F. Balfourier et al Efficacité des marqueurs à estimer une distance génétique entre paire d accessions La distance génétique moyenne de Sokal et Michener entre paires d accessions est plus faible lorsqu elle est basée sur les SSRg (0,167) que lorsqu elle est calculée sur les SSRest (0,242) ou les SNP (0,267). Global e- ment, les différents tests de Mantel effectués montrent que les matrices de distances obtenues pour chaque type de marqueurs (SSRg, SSRest et SNP) ne sont pas significativement différentes au seuil de 1 %. Figure 2 : Évolution du coefficient de variation moyen de la distance génétique mesurée entre paires d accessions, en fonction du nombre de marqueurs utilisés. 136

9 Comparaison de marqueurs chez le blé tendre La figure 2 représente l évolution du coefficient de variation (CV) moyen de la distance génétique mesurée entre paires d accessions, en fonction du nombre de microsatellites utilisés, et ce pour les deux types de marqueurs microsatellites. Chaque point a été calculé à partir de 200 matrices de distance 41x41 obtenues par bootstraps sur les marqueurs. À effectif identique en marqueurs, on observe la moindre efficacité des SSRest par rapport aux SSRg ; ainsi, la figure 2 montre que le seuil de 10 % pour le CV sur la distance génétique entre paires d accessions serait atteint en utilisant une cinquantaine de marqueurs SSRg, tandis qu il faudrait plus d une centaine de SSRest pour atteindre ce même seuil. Les coefficients de corrélation de Pearson calculés deux à deux entre les trois matrices de distance, obtenues selon les trois types de marqueurs, sont indiqués dans le tableau IV (partie sous la diagonale). Ces trois coefficients sont significatifs au seuil de 1 %, c'est-à-dire supérieurs à la corrélation attendue avec une matrice de distance permutée au hasard. On observe que la corrélation la plus forte apparaît entre SSRg et SSRest, alors qu elle est la plus faible entre SSRg et SNP. Tableau IV : Coefficients de corrélation entre matrices de topologie (au dessus de la diagonale) et matrices de distance (en dessous de la diagonale) selon les différents types de marqueurs. Matrice SSRg Matrice SSRest Matrice SNP Matrice SSRg 0,520** 0,379** Matrice SSRest 0,417** 0,421** Matrice SNP 0,301** 0,322** 3.3. Efficacité des marqueurs à structurer la diversité Dans un premier temps, nous avons comparé la façon dont les deux types de SSR permettaient d obtenir un arbre de structure donnée, appelé ici arbre de référence. Nous avons considéré comme arbre de référence l arbre global obtenu sur les 41 individus avec la totalité des marqueurs SSR polymorphes (soit 30 et 38 pour les SSRest et les SSRg, respectivement). La figure 3 représente, pour les deux types de microsatellites, la distribution (sous forme de boxplots) de la valeur de l ordre o du MAST obtenue en comparant des arbres réalisés avec un nombre croissant de marqueurs, à l arbre de référence. Afin d avoir une idée de la distribution de o, quinze tirages sans remise ont été effectués pour chaque quantité de microsatellites utilisée. La valeur moyenne de o obtenue pour un tirage de cinq microsatellites apparaît significative au seuil de 5 % pour les deux types de marqueurs, ce qui signifie que l arbre obtenu avec cinq marqueurs présente une ressemblance non liée au hasard avec son arbre de référence. Par ailleurs, nous constatons qu une même proportion de marqueurs conduit, pour chaque type de microsatellites, à une valeur iden- 137

10 F. Balfourier et al. tique de l ordre o ; la cinétique de reconstruction de l arbre de référence est donc identique pour les deux types de SSR. Enfin, nous observons que la valeur de l ordre o n est en moyenne que d environ 28 accessions pour respectivement 37 SSRg et 29 SSRest, comparée aux 41 accessions des arbres de référence. Nous constatons ici combien l apport d un dernier marqueur su p- plémentaire vient encore modifier les structures des arbres, ce qui traduit le fait qu il faudrait sans doute beaucoup plus de marqueurs, dans le cas de notre échantillon de blé, pour stabiliser la structure des arbres. Figure 3 : Distribution (sous forme de boxplots) et pour les deux types de marqueurs, de la valeur de l ordre o du MAST obtenue en comparant des arbres réalisés avec un nombre croissant de marqueurs, à l arbre de référence. 138

11 Comparaison de marqueurs chez le blé tendre Enfin la figure 4 représente les arbres de référence obtenus à partir des trois matrices de distance, selon les différents marqueurs. Les trois types de marqueurs permettent de différencier chacune des accessions les unes des autres. Le label utilisé pour caractériser les 41 accessions correspond ici au pays d origine de l accession (Iso3166), suivi éventuellement d un numéro d identification dans le pays considéré. Les coefficients de corrélation, calculés à partir des matrices de topologie de ces trois arbres, sont présentés dans le tableau IV (au dessus de la diagonale). Ces trois coefficients sont significatifs au seuil de 1 %, ce qui indique que les ressemblances topologiques de ces trois arbres, pris deux-à-deux, ne sont pas dues au hasard. Une fois encore la corrélation la plus forte est trouvée entre SSRg et SSRest, la plus faible étant entre SSRg et SNP. Sur la figure 4, compte tenu des échelles différentes de distances entre n uds, l arbre SSRg apparaît comme le plus compact. À un niveau élevé de coupure de l arbre, il permet de distinguer clairement deux classes : la classe de droite (E) regroupe uniquement des accessions provenant d Europe (FRA, DEU, GBR, BEL, NOR, ) et d Amérique du Nord, à l exception de l accessions AFG-2 provenant d Afghanistan. La classe de gauche (A), regroupe quant à elle une majorité d accessions issues d Asie (AFG, CHN, IND, JPN, NPL,..) d Afrique (DZA, MAR) et d Amérique du Sud (ARG, COL, CHL), en plus de quelques accessions européennes. Nous retrouvons ici la structuration en deux grands pools de materiel : le pool des blés européens (E), comprenant également les blés d Amérique du Nord et le pool des blés asiatiques (A) auxquels sont rattachés les blés issus de la révolution verte utilisés en Afrique et en Amérique du Sud. Cette structure forte en deux grandes classes se r e- trouve presque à l identique aussi bien dans l arbre issu des SSRest que dans celui issu des SNP. Par contre à l intérieur de ces deux classes, à un niveau plus faible de coupure de l arbre, il n est pas possible de mettre en évidence, dans notre échantillon, des structures ou regroupements vraiment stables d un arbre à l autre. 139

12 F. Balfourier et al. A E A E A E Figure 4 : Arbres de référence des 41 accessions de blé tendre, obtenus selon les trois types de marqueurs. 140

13 Comparaison de marqueurs chez le blé tendre 4. DISCUSSION 4.1. Détection du polymorphisme A notre connaissance, c est la première fois qu est rapportée une telle étude de diversité, menée sur un échantillon aussi large de blé tendre à l aide de marqueurs nouvellement développés comme les SSRest et surtout les SNP. La mise en évidence d un plus haut niveau de polymorphisme des SSRg par rapport aux SSRest (tabl. I) va dans le sens de résultats déjà publiés à propos des caractéristiques des marqueurs microsatellites issus d EST [1], [4]. Cette différence pourrait peut-être s expliquer par des taux de mutations différents pour ces deux types de microsatellites ; on sait en effet que les SSRg présentent de forts taux de mutation [19] qui sont probablement plus élevés que ceux des SSRest. Elle est sans doute aussi explicable par la nature même des SSRest qui sont issus de séquences exprimées, donc certainement plus conservées que les zones du génome dont proviennent les SSRg. Cette origine des SSRest expliquerait également qu ils présentent un niveau de polymorphisme équivalent à celui des SNP. Les SSRg au motif dinucléotidique sont connus pour être d une façon générale plus polymorphes, probablement parce que le nombre de répétitions de leur motif de base est plus grand. Il est cependant surprenant d observer ce même résultat chez les SSRest (tabl. III) puisque l ajout ou le retrait d un tel motif perturbe automatiquement le cadre de lecture. Nous n avons pas vérifié la localisation exacte (5 UTR, 3 UTR ou partie codante) de ce jeu précis de SSRest dans les séquences, mais ceci peut être fait à partir de la base Graingenes. Les résultats de Varshney et al. [20] selon lesquels les régions 3 UTR révèlent le plus de polymorphisme n ont pu donc être vérifiés. Cependant, d après les résultats de Nicot et al. [9] travaillant sur un échantillon plus large de marqueurs SSRest dont est issu notre jeu, il y avait la même proportion de marqueurs issus de chacune des trois régions Distances génétiques et matrices de distances Les plus fortes moyennes de distances génétiques observées pour les SSRest et les SNP, par rapport aux SSRg, sont sans doute liées au nombre de marqueurs utilisés. Toutes les comparaisons effectuées entre matrices de distance montrent que les différents marqueurs conduisent globalement à des structures identiques entre accessions (tabl. IV). Les tests, par ailleurs peu puissants, ne pe r- mettent donc pas de rendre compte de la nature différente des marqueurs. La valeur relative des corrélations entres les trois types de matrice rend sans doute mieux compte de ce phénomène. En effet, la corrélation la plus forte est trouvée entre les deux marqueurs de types microsatellites, la plus faible 141

14 F. Balfourier et al. étant entre SSRg et SNP : ceci peut sans doute s expliquer par le niveau de neutralité des marqueurs vis-à-vis de la sélection. Par ailleurs, la moindre efficacité des SSRest à estimer une distance génétique avec précision (fig. 2) s explique probablement par le plus faible polymorphisme de ces marqueurs, comparés aux SSRg. Vu le faible nombre de marqueurs SNP (16) la même analyse statistique du CV n a pu être conduite pour ces marqueurs mais il est vraisemblable qu ils auraient, du fait du faible nombre d haplotypes, conduits à des résultats similaires aux SSRest Matrices de topologie et reconstruction d arbres L étude de la cinétique de reconstruction des arbres de référence (fig. 3) ne permet pas de mettre en évidence des différences entre les deux types de SSR. Dans les deux cas, les arbres restent très instables jusqu au dern ier marqueur introduit. Ce résultat est assez surprenant ; il doit être lié à la nature de notre échantillon d accessions de blé tendre. En effet, celui-ci est constitué, par construction, d accessions très diversifiées, appartenant toutes à la même espèce et en même temps non récemment apparentées. Il faudrait sans doute beaucoup plus de marqueurs pour conduire à des structures d arbre plus stables. Peu d études ont, jusqu à présent, eu pour objet de comparer des arbres de diversité génétique obtenus par les différents marqueurs utilisés ici. Une étude de pedigrees menée sur sept orges à l aide de SSRest et de SNP [5] montre que les deux types de marqueurs conduisent à des résultats similaires mais non identiques. Il existe diverses méthodes de comparaisons d arbres [10]. Ainsi, par exemple, les méthodes consensus supposent que toutes les accessions d un arbre soient correctement représentées, c'est-à-dire que leurs n uds d embranchement présentent de fortes valeurs de bootstraps. Dans les méthodes consensus, toutes les accessions ont le même poids ; les quelques unes au comportement plus erratique peuvent alors masquer une stru c- ture commune. Dans notre étude, les valeurs (non représentées) des bootstraps sont faibles à cause de la nature même de l échantillon et du nombre de marqueurs utilisés. Cependant les trois arbres de la figure 4 semblent avoir globalement une structure commune, excepté pour quelques accessions. C est pourquoi nous avons utilisé d autres approches de comparaison comme les méthodes purement topologiques qui ne tiennent pas compte de la longueur des branches ou la méthode du MAST qui permet d éliminer les accessions les plus fluctuantes pour mettre en évidence une structure co m- mune. Ici, la structure commune aux trois arbres est celle liée à l origine géographique des accessions, structure larg ement décrite par Roussel [13] et qui sépare grossièrement le pool des blés «européens» de celui des blés «asiatiques». Cette structure, d origine démographique et évolutive, qui 142

VI. L APPORT DES MARQUEURS MOLECULAIRES. A. Définitions

VI. L APPORT DES MARQUEURS MOLECULAIRES. A. Définitions VI. L APPORT DES MARQUEURS MOLECULAIRES Comme nous l avons vu précédemment, l étude des caractères quantitatifs est fondée sur l analyse statistique des performances mesurées des individus. Il en est de

Plus en détail

Deuxième partie. Calcul de fréquences de génotypes multilocus dans des pédigrees complexes XXVII

Deuxième partie. Calcul de fréquences de génotypes multilocus dans des pédigrees complexes XXVII Deuxième partie Calcul de fréquences de génotypes multilocus dans des pédigrees complexes XXVII Présentation Les programmes informatiques MDM et grafgen L analyse de schémas de construction de génotypes

Plus en détail

Les documents présentés dans ce cours sont issus : soit de travaux personnels soit de travaux présentés sur le web Leur utilisation ne doit donner

Les documents présentés dans ce cours sont issus : soit de travaux personnels soit de travaux présentés sur le web Leur utilisation ne doit donner Les documents présentés dans ce cours sont issus : soit de travaux personnels soit de travaux présentés sur le web Leur utilisation ne doit donner lieu à aucune exploitation commerciale D. LOCKER Professeur

Plus en détail

Modélisation coalescente pour la détection précoce d un cancer

Modélisation coalescente pour la détection précoce d un cancer Modélisation coalescente pour la détection précoce d un cancer Mathieu Emily 27 Novembre 2007 Bioinformatics Research Center - Université d Aarhus Danemark Mathieu Emily Coalescence et cancer 1 Introduction

Plus en détail

Utilisation des marqueurs ISSR pour l'étude du polymorphisme génétique d'artemisia herba-alba

Utilisation des marqueurs ISSR pour l'étude du polymorphisme génétique d'artemisia herba-alba Utilisation des marqueurs ISSR pour l'étude du polymorphisme génétique d'artemisia herba-alba Haouari M., Ferchichi A. in Ferchichi A. (comp.), Ferchichi A. (collab.). Réhabilitation des pâturages et des

Plus en détail

Annales du Contrôle National de Qualité des Analyses de Biologie Médicale

Annales du Contrôle National de Qualité des Analyses de Biologie Médicale Annales du Contrôle National de Qualité des Analyses de Biologie Médicale ARN du virus de l hépatite C : ARN-VHC ARN-VHC 03VHC1 Novembre 2003 Edité : mars 2006 Annales ARN-VHC 03VHC1 1 / 8 ARN-VHC 03VHC1

Plus en détail

UNION INTERNATIONALE POUR LA PROTECTION DES OBTENTIONS VÉGÉTALES

UNION INTERNATIONALE POUR LA PROTECTION DES OBTENTIONS VÉGÉTALES ORIGINAL : anglais DATE : 21 octobre 2010 UNION INTERNATIONALE POUR LA PROTECTION DES OBTENTIONS VÉGÉTALES GENÈVE F DIRECTIVES CONCERNANT LES PROFILS D ADN : CHOIX DES MARQUEURS MOLECULAIRES ET CONSTRUCTION

Plus en détail

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq Présenté par Xi LIU ATCGCGCTAGCTGGTGTATCGCATCGCGCTAGCTGGTGTATCGCGCTAGCTGGTGTATCGCGCTAGCCTGGTGTATCGCCATCGCGCTAGCTGGCGCTAGCTGAATCGCGCATATG 17 Septembre 2013 Homéoallèles Génome Normalisation Analyse différentielle

Plus en détail

Analyse de l évolution de la structure des ménages dans l enquête sur le budget des ménages

Analyse de l évolution de la structure des ménages dans l enquête sur le budget des ménages Analyse de l évolution de la structure des ménages dans l enquête sur le budget des ménages S. Winandy, R. Palm OCA GxABT/ULg oca.gembloux@ulg.ac.be décembre 2011 1 Introduction La Direction Générale Statistique

Plus en détail

Projet informatique «Voyageur de commerce» Résolution approchée par algorithme génétique du problème du voyageur de commerce

Projet informatique «Voyageur de commerce» Résolution approchée par algorithme génétique du problème du voyageur de commerce Année 2007-2008 Projet informatique «Voyageur de commerce» Résolution approchée par algorithme génétique du problème du voyageur de commerce B. Monsuez Projet informatique «Voyageur de commerce» Résolution

Plus en détail

Conférence retour d expérience Maths et Industrie. La modélisation de processus au service de l industrie

Conférence retour d expérience Maths et Industrie. La modélisation de processus au service de l industrie Conférence retour d expérience Maths et Industrie La modélisation de processus au service de l industrie 1 Performances d un d logiciel de calcul des coûts Le problème de l industriel l : Le CEA avait

Plus en détail

Gènes Diffusion - EPIC 2010

Gènes Diffusion - EPIC 2010 Gènes Diffusion - EPIC 2010 1. Contexte. 2. Notion de génétique animale. 3. Profil de l équipe plateforme. 4. Type et gestion des données biologiques. 5. Environnement Matériel et Logiciel. 6. Analyses

Plus en détail

TD Bioinformatique : Sequence Alignment. Pourquoi faire une recherche par similarité?

TD Bioinformatique : Sequence Alignment. Pourquoi faire une recherche par similarité? TD Bioinformatique : Sequence lignment Pourquoi faire une recherche par similarité? - Savoir si ma séquence ressemble à d'autres déjà connues. - Trouver toutes les séquences d'une même famille. - Rechercher

Plus en détail

Polymorphismes de l ADN

Polymorphismes de l ADN Introduction Polymorphismes de l ADN Présentation et mise en évidence Recherche de gènes responsables de maladies génétiques : Analyse de pedigrees où la maladie est présente Sur quel chromosome? À quel

Plus en détail

TEST MMR POUR TUMEURS COLIQUES EN PRATIQUE COURANTE? Karen LEROY Hôpital Henri Mondor, Créteil

TEST MMR POUR TUMEURS COLIQUES EN PRATIQUE COURANTE? Karen LEROY Hôpital Henri Mondor, Créteil TEST MMR POUR TUMEURS COLIQUES EN PRATIQUE COURANTE? Karen LEROY Hôpital Henri Mondor, Créteil 47 Définition du phénotype MSI (MicroSatellite Instability) Environ 15% des cancers colo-rectaux présentent

Plus en détail

Quelques définitions

Quelques définitions Quelques définitions Sandrine Lagarrigue et Pascale Le Roy 1 Journée Technique SYSAAF La mise en œuvre des outils de la génomique : enjeux pour le SYSAAF et ses adhérents. 03 juin 2015. Rennes Le génome

Plus en détail

COMMENT DÉFINIR L ORIENTÉ OBJET

COMMENT DÉFINIR L ORIENTÉ OBJET COMMENT DÉFINIR L ORIENTÉ OBJET De manière superficielle, le terme «orienté objet», signifie que l on organise le logiciel comme une collection d objets dissociés comprenant à la fois une structure de

Plus en détail

La méthode des quotas

La méthode des quotas La méthode des quotas Oliviero Marchese, décembre 2006 1 La méthode des quotas Principe de la méthode Point de départ et but recherché Caractère «intuitif» de la méthode A quoi ressemble une feuille de

Plus en détail

III CRITERES POUR CHOISIR UN COUPLE DE FLUOROPHORES

III CRITERES POUR CHOISIR UN COUPLE DE FLUOROPHORES Page : 17/ 77 III CRITERES POUR CHOISIR UN COUPLE DE FLUOROPHORES Le choix d un couple donneur-accepteur dépend de la technique utilisée (FRET, TR- FRET, BRET, etc.) et des molécules disponibles pour ces

Plus en détail

Le «data mining», une démarche pour améliorer le ciblage des contrôles

Le «data mining», une démarche pour améliorer le ciblage des contrôles MINISTERE DE L ECONOMIE ET DES FINANCES Le «data mining», une démarche pour améliorer le ciblage des contrôles La lutte contre la fraude aux finances publiques a été renforcée ces dernières années et a

Plus en détail

Simulation d un système d assurance automobile

Simulation d un système d assurance automobile Simulation d un système d assurance automobile DESSOUT / PLESEL / DACHI Plan 1 Introduction... 2 Méthodes et outils utilisés... 2.1 Chaines de Markov... 2.2 Méthode de Monte Carlo... 2.3 Méthode de rejet...

Plus en détail

ESSEC. Cours «Management bancaire» Séance 3 Le risque de crédit Le scoring

ESSEC. Cours «Management bancaire» Séance 3 Le risque de crédit Le scoring ESSEC Cours «Management bancaire» Séance 3 Le risque de crédit Le scoring Les méthodes d évaluation du risque de crédit pour les PME et les ménages Caractéristiques Comme les montants des crédits et des

Plus en détail

Quelques caractéristiques des microsatellites : définition, densité et structure. P. Jarne CEFE - Montpellier

Quelques caractéristiques des microsatellites : définition, densité et structure. P. Jarne CEFE - Montpellier Quelques caractéristiques des microsatellites : définition, densité et structure P. Jarne CEFE - Montpellier Buts * Définitions * Méthodes d études de la distribution * Qques résultats : distribution dans

Plus en détail

Cours d introduction à la génétique de la souris Notion de Souche

Cours d introduction à la génétique de la souris Notion de Souche Cours d introduction à la génétique de la souris Notion de Souche Introduction: - Réponse d un animal à l expérimentation (diapo 1) Facteurs environnementaux et propres à l animal - Notion d animal standardisé

Plus en détail

Algorithmique et Programmation Projets 2012/2013

Algorithmique et Programmation Projets 2012/2013 3 Dames 3. Objectif Il s agit d écrire un programme jouant aux Dames selon les règles. Le programme doit être le meilleur possible. Vous utiliserez pour cela l algorithme α β de recherche du meilleur coup

Plus en détail

Mariane ALLEAUME-BENHARIRA Sylvie ODDOU-MURATORIO François LEFEVRE. Ecologie des forêts méditerranéennes INRA AVIGNON - FRANCE

Mariane ALLEAUME-BENHARIRA Sylvie ODDOU-MURATORIO François LEFEVRE. Ecologie des forêts méditerranéennes INRA AVIGNON - FRANCE MODELISER L IMPACT DES CHANGEMENTS DEMOGRAPHIQUES ET ENVIRONNEMENTAUX SUR L EVOLUTION DES ARBRES Le module Luberon Version 2010 Mariane ALLEAUME-BENHARIRA Sylvie ODDOU-MURATORIO François LEFEVRE Ecologie

Plus en détail

Quentin Rougemont, Guillaume Evanno, Sophie Launey INRA Rennes UMR ESE

Quentin Rougemont, Guillaume Evanno, Sophie Launey INRA Rennes UMR ESE Quentin Rougemont, Guillaume Evanno, Sophie Launey INRA Rennes UMR ESE Rennes Le 19/02/2013 Evolution de l anadromie chez les lamproies Contexte général Objectifs Méthodologie Etats des connaissances Résultats

Plus en détail

Tests de comparaison de moyennes. Dr Sahar BAYAT MASTER 1 année 2009-2010 UE «Introduction à la biostatistique»

Tests de comparaison de moyennes. Dr Sahar BAYAT MASTER 1 année 2009-2010 UE «Introduction à la biostatistique» Tests de comparaison de moyennes Dr Sahar BAYAT MASTER 1 année 2009-2010 UE «Introduction à la biostatistique» Test de Z ou de l écart réduit Le test de Z : comparer des paramètres en testant leurs différences

Plus en détail

Vers l assignation de parenté par SNP

Vers l assignation de parenté par SNP Vers l assignation de parenté par SNP Journée Génomique Sysaaf 3 juin 2015, Rennes Marc VANDEPUTTE INRA UMR Génétique Animale et Biologie Intégrative Ifremer Laboratoire 3AS L assignation de parenté Pour

Plus en détail

Chapitre VI Échantillonages et simulations

Chapitre VI Échantillonages et simulations Chapitre VI Commentaires : Récursivement, les commentaires ne sont pas à l attention des élèves.. Fluctuation d échantillonnage Définition : En statistiques, un échantillon de taille n est la liste des

Plus en détail

L essentiel sur les tests statistiques

L essentiel sur les tests statistiques L essentiel sur les tests statistiques 21 septembre 2014 2 Chapitre 1 Tests statistiques Nous considérerons deux exemples au long de ce chapitre. Abondance en C, G : On considère une séquence d ADN et

Plus en détail

SY09 Rapport TP4 : Analyse discriminante, régression logistique

SY09 Rapport TP4 : Analyse discriminante, régression logistique UNIVERSITÉ DE TECHNOLOGIE DE COMPIÈGNE SY09 Rapport TP4 : Analyse discriminante, régression logistique CUNI Frédéric 15 juin 2015 Objectifs du TP : Le but de ce TP est l application de l analyse discriminante

Plus en détail

Méthodologie d échantillonnage et Échantillonneur ASDE

Méthodologie d échantillonnage et Échantillonneur ASDE Méthodologie d échantillonnage et Échantillonneur ASDE Par Michel Rochon L énoncé suivant définit de façon générale la méthodologie utilisée par Échantillonneur ASDE pour tirer des échantillons téléphoniques.

Plus en détail

STA108 Enquêtes et sondages. Sondages àplusieurs degrés et par grappes

STA108 Enquêtes et sondages. Sondages àplusieurs degrés et par grappes STA108 Enquêtes et sondages Sondages àplusieurs degrés et par grappes Philippe Périé, novembre 2011 Sondages àplusieurs degrés et par grappes Introduction Sondages à plusieurs degrés Tirage des unités

Plus en détail

Compte rendu de LA37 B, TP numéro 1. Evolution de la température et du degrée d'hydratation

Compte rendu de LA37 B, TP numéro 1. Evolution de la température et du degrée d'hydratation 4 6 8 2 4 8 22 26 3 34 38 42 46 5 54 58 62 66 7 74 78 83 89 96 8 44 Bertin Morgan Compte rendu de LA37 B, TP numéro. Les essais effectués par le laboratoire des ponts et chaussés nous ont fournis la température

Plus en détail

LES MARQUEURS MOLECULAIRES

LES MARQUEURS MOLECULAIRES LES MARQUEURS MOLECULAIRES Il y a différents types de marqueurs : o Les caractères phénotypiques : limités, observations sur l arbre entier et sur différentes années o Les marqueurs biochimiques o Les

Plus en détail

Eléments de stratégie d échantillonnage à l adresse des diagnostiqueurs amiante.

Eléments de stratégie d échantillonnage à l adresse des diagnostiqueurs amiante. Eléments de stratégie d échantillonnage à l adresse des diagnostiqueurs amiante. Essai de détermination du nombre de prélèvements à effectuer lors d un diagnostic amiante afin d assurer une représentativité

Plus en détail

Entrée à Sciences Po ADMISSION AU COLLÈGE UNIVERSITAIRE Mardi 26 juin 2012 MATHEMATIQUES durée de l épreuve : 4h

Entrée à Sciences Po ADMISSION AU COLLÈGE UNIVERSITAIRE Mardi 26 juin 2012 MATHEMATIQUES durée de l épreuve : 4h Entrée à Sciences Po ADMISSION AU COLLÈGE UNIVERSITAIRE Mardi 26 juin 2012 MATHEMATIQUES durée de l épreuve : 4h A. P. M. E. P. Le problème se compose de 4 parties. La dernière page sera à rendre avec

Plus en détail

MODIFICATIONS DES PRINCIPES DIRECTEURS CONCERNANT LA RÉDACTION DES DÉFINITIONS RELATIVES AU CLASSEMENT

MODIFICATIONS DES PRINCIPES DIRECTEURS CONCERNANT LA RÉDACTION DES DÉFINITIONS RELATIVES AU CLASSEMENT ANNEXE VI MODIFICATIONS DES PRINCIPES DIRECTEURS CONCERNANT LA RÉDACTION DES DÉFINITIONS RELATIVES AU CLASSEMENT RECOMMANDATIONS GÉNÉRALES Les utilisateurs s attendent à trouver dans les définitions des

Plus en détail

UNIVERSITÉ DE CERGY. LICENCE d ÉCONOMIE et FINANCE LICENCE de GESTION. Seconde année - Semestre 3 PROBABILITÉS. Cours de M. J.

UNIVERSITÉ DE CERGY. LICENCE d ÉCONOMIE et FINANCE LICENCE de GESTION. Seconde année - Semestre 3 PROBABILITÉS. Cours de M. J. Année 2013-2014 UNIVERSIÉ DE CERGY LICENCE d ÉCONOMIE et FINANCE LICENCE de GESION Seconde année - Semestre 3 PROBABILIÉS Cours de M. J. Stéphan ravaux Dirigés de Mme M. Barrié, M. J-M. Chauvet et M. J.

Plus en détail

Heuristique et métaheuristique. 8. Optimisation combinatoire et métaheuristiques. Optimisation combinatoire. Problème du voyageur de commerce

Heuristique et métaheuristique. 8. Optimisation combinatoire et métaheuristiques. Optimisation combinatoire. Problème du voyageur de commerce Heuristique et métaheuristique IFT1575 Modèles de recherche opérationnelle (RO) 8. Optimisation combinatoire et métaheuristiques Un algorithme heuristique permet d identifier au moins une solution réalisable

Plus en détail

Plan. Comparaison de 2 séquences. Dotplot, alignement optimal Recherche de similarité. Alignement multiple. Phylogénie moléculaire

Plan. Comparaison de 2 séquences. Dotplot, alignement optimal Recherche de similarité. Alignement multiple. Phylogénie moléculaire Plan 1 Banques de données 2 Comparaison de 2 séquences Dotplot, alignement optimal Recherche de similarité 3 Alignement multiple l 4 Phylogénie moléculaire Recherche de similarité 1 séquence (Query) comparée

Plus en détail

TD de statistique : tests du Chi 2

TD de statistique : tests du Chi 2 TD de statistique : tests du Chi 2 Jean-Baptiste Lamy 6 octobre 2008 1 Test du Chi 2 C est l équivalent de la comparaison de moyenne, mais pour les variables qualitatives. 1.1 Cas 1 : comparer les répartitions

Plus en détail

Méthode automatisée de dosage colorimétrique du dioxyde de soufre total dans les vins

Méthode automatisée de dosage colorimétrique du dioxyde de soufre total dans les vins Méthode automatisée de dosage colorimétrique du dioxyde de soufre total dans les vins Marc DUBERNET* et Françoise GRASSET* Laboratoire DUBERNET - 9, quai d Alsace - 11100 Narbonne France 1. Objet Méthode

Plus en détail

Chapitre 2 La diversification du vivant

Chapitre 2 La diversification du vivant Chapitre 2 La diversification du vivant 1 Introduction Méiose et fécondation : sources de diversité Mutations germinales : processus fondamental de diversification génétique, générateur de biodiversité

Plus en détail

Chapitre V : Résultats. 5.1 Présentation des résultats obtenus. 5.1.1 Interprétation des corrélations

Chapitre V : Résultats. 5.1 Présentation des résultats obtenus. 5.1.1 Interprétation des corrélations Chapitre V : Résultats Les corrélations présentées par la suite, sont celles qui correspondent aux chiffres choisis (corrélation de 0,13 ou 0,13), et celles que nous avons jugées les plus significatifs

Plus en détail

Exercice 2 du cours Management Bancaire : «Calcul de la VaR d une position de marché»

Exercice 2 du cours Management Bancaire : «Calcul de la VaR d une position de marché» Exercice du cours Management Bancaire : «Calcul de la VaR d une position de marché» La réglementation bancaire impose aux banques de maintenir un niveau de capital minimum pour absorber les pertes dues

Plus en détail

Mini-Projet de Prolog : Solver de Sudoku

Mini-Projet de Prolog : Solver de Sudoku UNIVERSITE François Rabelais TOURS Polytech Tours-Département Informatique 64, Avenue Jean Portalis 37200 TOURS Mini-Projet de Prolog : Solver de Sudoku Encadré par : Présenté par : M. J-L Bouquard Florent

Plus en détail

Générateur de Nombres Aléatoires

Générateur de Nombres Aléatoires Générateur de Nombres Aléatoires Les générateurs de nombres aléatoires sont des dispositifs capables de produire une séquence de nombres dont on ne peut pas tirer facilement des propriétés déterministes.

Plus en détail

Androids as an Experimental Apparatus: Why Is There an Uncanny Valley and Can we Exploit It?

Androids as an Experimental Apparatus: Why Is There an Uncanny Valley and Can we Exploit It? Androids as an Experimental Apparatus: Why Is There an Uncanny Valley and Can we Exploit It? Karl F. MacDorman 1 The Uncanny Valley : Le terme d Uncanny Valley a été défini par Masahiro Mori, chercheur

Plus en détail

L approche Bases de données

L approche Bases de données L approche Bases de données Cours: BD. Avancées Année: 2005/2006 Par: Dr B. Belattar (Univ. Batna Algérie) I- : Mise à niveau 1 Cours: BDD. Année: 2013/2014 Ens. S. MEDILEH (Univ. El-Oued) L approche Base

Plus en détail

Génétique et génomique Pierre Martin

Génétique et génomique Pierre Martin Génétique et génomique Pierre Martin Principe de la sélections Repérage des animaux intéressants X Accouplements Programmés Sélection des meilleurs mâles pour la diffusion Index diffusés Indexation simultanée

Plus en détail

Atradius Buyer Ratings

Atradius Buyer Ratings Atradius Buyer Ratings Le pouvoir de prévoir FAQ A. Questions générales 1. Que signifie le Buyer Rating? Le Buyer Rating d Atradius est un score statistique sur une échelle de 1 à 100 qui a été développé

Plus en détail

NOTE SUR LA MODELISATION DU RISQUE D INFLATION

NOTE SUR LA MODELISATION DU RISQUE D INFLATION NOTE SUR LA MODELISATION DU RISQUE D INFLATION 1/ RESUME DE L ANALYSE Cette étude a pour objectif de modéliser l écart entre deux indices d inflation afin d appréhender le risque à très long terme qui

Plus en détail

Modèles et simulations informatiques des problèmes de coopération entre agents

Modèles et simulations informatiques des problèmes de coopération entre agents Modèles et simulations informatiques des problèmes de coopération entre agents Bruno Beaufils LIFL Axe CIM Équipe SMAC Laboratoire d'informatique Plan 1. Motivations 2. Dilemme itéré du prisonnier 3. Simulations

Plus en détail

Première STMG1 2014-2015 progression. - 1. Séquence : Proportion d une sous population dans une population.

Première STMG1 2014-2015 progression. - 1. Séquence : Proportion d une sous population dans une population. Première STMG1 2014-2015 progression. - 1 Table des matières Fil rouge. 3 Axes du programme. 3 Séquence : Proportion d une sous population dans une population. 3 Information chiffrée : connaître et exploiter

Plus en détail

STAT0162-1 Analyse statistique de données qualitatives et quantitatives en sciences sociales. Transparents Philippe Lambert

STAT0162-1 Analyse statistique de données qualitatives et quantitatives en sciences sociales. Transparents Philippe Lambert STAT0162-1 Analyse statistique de données qualitatives et quantitatives en sciences sociales Transparents Philippe Lambert http : //www.statsoc.ulg.ac.be/quali.html Institut des Sciences Humaines et Sociales

Plus en détail

CONCOURS D ENTREE A L ECOLE DE 2007 CONCOURS EXTERNE. Cinquième épreuve d admissibilité STATISTIQUE. (durée : cinq heures)

CONCOURS D ENTREE A L ECOLE DE 2007 CONCOURS EXTERNE. Cinquième épreuve d admissibilité STATISTIQUE. (durée : cinq heures) CONCOURS D ENTREE A L ECOLE DE 2007 CONCOURS EXTERNE Cinquième épreuve d admissibilité STATISTIQUE (durée : cinq heures) Une composition portant sur la statistique. SUJET Cette épreuve est composée d un

Plus en détail

Le Data Mining au service du Scoring ou notation statistique des emprunteurs!

Le Data Mining au service du Scoring ou notation statistique des emprunteurs! France Le Data Mining au service du Scoring ou notation statistique des emprunteurs! Comme le rappelle la CNIL dans sa délibération n 88-083 du 5 Juillet 1988 portant adoption d une recommandation relative

Plus en détail

Les outils bio-moléculaires en sélection

Les outils bio-moléculaires en sélection Les outils bio-moléculaires en sélection Vers l utilisation d outils de génotypage haut débit - FN3PT/ Inra UMR Igepp Vers l utilisation du génotypage haut débit en sélection Sélection assistée par marqueurs

Plus en détail

Population étudiante en médecine vétérinaire : projections

Population étudiante en médecine vétérinaire : projections Population étudiante en médecine vétérinaire : projections Assemblée Générale des étudiants de Louvain 17 juin 2015 1 Avant-propos Depuis quelques semaines, la question de la surpopulation dans les filières

Plus en détail

ANALYSE DE L HYDRATATION DE LA PEAU AVEC LE SPECTROPHOTOMETRE PROCHE INFRAROUGE PORTABLE LABSPEC PRO

ANALYSE DE L HYDRATATION DE LA PEAU AVEC LE SPECTROPHOTOMETRE PROCHE INFRAROUGE PORTABLE LABSPEC PRO ANALYSE DE L HYDRATATION DE LA PEAU AVEC LE SPECTROPHOTOMETRE PROCHE INFRAROUGE PORTABLE LABSPEC PRO Présentation Introduction I. Matériel et Méthode II. Résultats III. Discussion Comparaison avec d autres

Plus en détail

Examen de Génomique et Protéomique Fonctionnelle M2 BBSG (Mastères Recherche et Pro) 2 février 2006 Durée 3h. Partie1. Génomique fonctionnelle

Examen de Génomique et Protéomique Fonctionnelle M2 BBSG (Mastères Recherche et Pro) 2 février 2006 Durée 3h. Partie1. Génomique fonctionnelle Examen de Génomique et Protéomique Fonctionnelle M2 BBSG (Mastères Recherche et Pro) 2 février 2006 Durée 3h L examen comporte deux parties, l une axée sur la génomique fonctionnelle et l autre sur la

Plus en détail

Motivation : pourquoi exploration de données? Nous nous noyons dans les données, mais manquons cruellement de connaissances

Motivation : pourquoi exploration de données? Nous nous noyons dans les données, mais manquons cruellement de connaissances 1 Introduction Définition et motivations Tâches de data mining (fouille de données, exploration de données) Techniques et algorithmes Exemples et applications 1 Motivation : pourquoi exploration de données?

Plus en détail

5. Information et accès aux moyens de paiement

5. Information et accès aux moyens de paiement 5. Information et accès aux moyens de paiement Cette dernière partie mobilise des méthodes d analyse des données, permettant de mieux comprendre comment s articulent d une part l accès aux différents services

Plus en détail

Chapitre 3 : INFERENCE

Chapitre 3 : INFERENCE Chapitre 3 : INFERENCE 3.1 L ÉCHANTILLONNAGE 3.1.1 Introduction 3.1.2 L échantillonnage aléatoire 3.1.3 Estimation ponctuelle 3.1.4 Distributions d échantillonnage 3.1.5 Intervalles de probabilité L échantillonnage

Plus en détail

Notes méthodologiques

Notes méthodologiques Notes méthodologiques Projection de la population active du Québec de 2010 à 2030 en fonction de cinq hypothèses d'allongement de la vie active À la demande de la Commission nationale sur la participation

Plus en détail

La survie nette actuelle à long terme Qualités de sept méthodes d estimation

La survie nette actuelle à long terme Qualités de sept méthodes d estimation La survie nette actuelle à long terme Qualités de sept méthodes d estimation PAR Alireza MOGHADDAM TUTEUR : Guy HÉDELIN Laboratoire d Épidémiologie et de Santé publique, EA 80 Faculté de Médecine de Strasbourg

Plus en détail

DEPARTEMENT D ETUDES EUROPEENNES ECONOMIQUES

DEPARTEMENT D ETUDES EUROPEENNES ECONOMIQUES DEPARTEMENT D ETUDES EUROPEENNES ECONOMIQUES GUIDE DES ETUDIANTS Ce guide est destiné à vous introduire au fonctionnement du Collège et du Département d études économiques européennes, en présentant les

Plus en détail

RÉSUMÉ DE RECHERCHE. Fondé sur un rapport de recherche préparé pour l IB par : Ling Tan et Yan Bibby, Australian Council for Educational Research

RÉSUMÉ DE RECHERCHE. Fondé sur un rapport de recherche préparé pour l IB par : Ling Tan et Yan Bibby, Australian Council for Educational Research RÉSUMÉ DE RECHERCHE Comparaison des résultats d élèves issus ou non d établissements dispensant les programmes de l IB au programme ISA d évaluation des écoles internationales, et au questionnaire sur

Plus en détail

Chapitre 11. Séries de Fourier. Nous supposons connues les formules donnant les coefficients de Fourier d une fonction 2 - périodique :

Chapitre 11. Séries de Fourier. Nous supposons connues les formules donnant les coefficients de Fourier d une fonction 2 - périodique : Chapitre Chapitre. Séries de Fourier Nous supposons connues les formules donnant les coefficients de Fourier d une fonction - périodique : c c a0 f x dx c an f xcosnxdx c c bn f xsinn x dx c L objet de

Plus en détail

Arbres binaires. Hélène Milhem. Institut de Mathématiques de Toulouse, INSA Toulouse, France IUP SID, 2011-2012

Arbres binaires. Hélène Milhem. Institut de Mathématiques de Toulouse, INSA Toulouse, France IUP SID, 2011-2012 Arbres binaires Hélène Milhem Institut de Mathématiques de Toulouse, INSA Toulouse, France IUP SID, 2011-2012 H. Milhem (IMT, INSA Toulouse) Arbres binaires IUP SID 2011-2012 1 / 35 PLAN Introduction Construction

Plus en détail

23. Interprétation clinique des mesures de l effet traitement

23. Interprétation clinique des mesures de l effet traitement 23. Interprétation clinique des mesures de l effet traitement 23.1. Critères de jugement binaires Plusieurs mesures (indices) sont utilisables pour quantifier l effet traitement lors de l utilisation d

Plus en détail

Nous concluons au travers de quatre axes principaux qui ont guidé la. 1) La théorie du regret de Loomes et Sugden comme théorie de la décision

Nous concluons au travers de quatre axes principaux qui ont guidé la. 1) La théorie du regret de Loomes et Sugden comme théorie de la décision Conclusion générale Nous concluons au travers de quatre axes principaux qui ont guidé la rédaction de cette thèse. 1) La théorie du regret de Loomes et Sugden comme théorie de la décision rationnelle compatible

Plus en détail

UNION INTERNATIONALE POUR LA PROTECTION DES OBTENTIONS VÉGÉTALES

UNION INTERNATIONALE POUR LA PROTECTION DES OBTENTIONS VÉGÉTALES ORIGINAL: anglais DATE: 18 janvier 2007 UNION INTERNATIONALE POUR LA PROTECTION DES OBTENTIONS VÉGÉTALES GENÈVE F PROJET DIRECTIVES CONCERNANT LES PROFILS D ADN : CHOIX DES MARQUEURS MOLÉCULAIRES ET CONSTRUCTION

Plus en détail

1. Les comptes de dépôt et d épargne

1. Les comptes de dépôt et d épargne 1. Les comptes de dépôt et d épargne 1.1 Les comptes de dépôt 1.1.1 Le taux de possession d un compte de dépôt Le premier constat est celui d un accès important aux comptes de dépôt, quelle que soit la

Plus en détail

Chapitre 1. L algorithme génétique

Chapitre 1. L algorithme génétique Chapitre 1 L algorithme génétique L algorithme génétique (AG) est un algorithme de recherche basé sur les mécanismes de la sélection naturelle et de la génétique. Il combine une stratégie de survie des

Plus en détail

ANNEXE J POTEAUX TESTÉS SELON UN CHARGEMENT STATIQUE ET TESTÉS SELON UN CHARGEMENT CYCLIQUE ET STATIQUE

ANNEXE J POTEAUX TESTÉS SELON UN CHARGEMENT STATIQUE ET TESTÉS SELON UN CHARGEMENT CYCLIQUE ET STATIQUE 562 ANNEXE J POTEAUX TESTÉS SELON UN CHARGEMENT STATIQUE ET TESTÉS SELON UN CHARGEMENT CYCLIQUE ET STATIQUE 563 TABLE DES MATIÈRES ANNEXE J... 562 POTEAUX TESTÉS SELON UN CHARGEMENT STATIQUE ET TESTÉS

Plus en détail

A- Exploiter des animations pour repérer une mutation et étudier son mécanisme de réparation.

A- Exploiter des animations pour repérer une mutation et étudier son mécanisme de réparation. THEME 1A : Expression, stabilité et variation du patrimoine génétique Chapitre 2 : Variabilité Génétique et Mutation de l ADN TP-3-: Réparation de l ADN, mutations et polyallélisme Les mutations de l ADN

Plus en détail

ECHANTILLONNAGES Fiche de repérage

ECHANTILLONNAGES Fiche de repérage M Objectifs pédagogiques généraux : Fiche de repérage Type : Activité d approche de la notion de fluctuation d échantillonnage et d intervalle de confiance à travers quelques simulations. Niveau : Lycée

Plus en détail

Traitement des données avec Microsoft EXCEL 2010

Traitement des données avec Microsoft EXCEL 2010 Traitement des données avec Microsoft EXCEL 2010 Vincent Jalby Septembre 2012 1 Saisie des données Les données collectées sont saisies dans une feuille Excel. Chaque ligne correspond à une observation

Plus en détail

Annales du Contrôle National de Qualité des Analyses de Biologie Médicale

Annales du Contrôle National de Qualité des Analyses de Biologie Médicale Annales du Contrôle National de Qualité des Analyses de Biologie Médicale Carge virale du VHB : ADN-VHB ADN-VHB 11CHB1 Mars 2011 Edition : Septembre 2011 Afssaps -143/147, Bd Anatole France F-93285 Saint

Plus en détail

CHAPITRE 3 LA SYNTHESE DES PROTEINES

CHAPITRE 3 LA SYNTHESE DES PROTEINES CHAITRE 3 LA SYNTHESE DES ROTEINES On sait qu un gène détient dans sa séquence nucléotidique, l information permettant la synthèse d un polypeptide. Ce dernier caractérisé par sa séquence d acides aminés

Plus en détail

ANALYSE DES RISQUES ET MANAGENEMENT DES RISQUES

ANALYSE DES RISQUES ET MANAGENEMENT DES RISQUES ANALYSE DES RISQUES ET MANAGENEMENT DES RISQUES Introduction : Le management des risques est un processus qui permet au Business Manager d équilibrer les coûts économiques et opérationnels et faire du

Plus en détail

Préparation à l agrégation 2012/2013. Mots clés : Graphes. Vecteur propre ; matrices stochastiques ; matrices à coefficients positifs.

Préparation à l agrégation 2012/2013. Mots clés : Graphes. Vecteur propre ; matrices stochastiques ; matrices à coefficients positifs. Mots clés : Graphes. Vecteur propre ; matrices stochastiques ; matrices à coefficients positifs. Le jury n exige pas une compréhension exhaustive du texte. Vous êtes laissé(e) libre d organiser votre discussion

Plus en détail

Fiche Contenu 9-1 : Vue d ensemble sur l évaluation

Fiche Contenu 9-1 : Vue d ensemble sur l évaluation Fiche Contenu 9-1 : Vue d ensemble sur l évaluation Rôle dans le système de gestion de la qualité Qu est ce que l évaluation? Pourquoi réaliser une L évaluation est un élément important des 12 points essentiels.

Plus en détail

UE 2V311 - TD3-2015. Analyses de méioses, ségrégation et cartographie.

UE 2V311 - TD3-2015. Analyses de méioses, ségrégation et cartographie. Buts du TD : UE 2V311 - TD3-2015 Analyses de méioses, ségrégation et cartographie. - connaître la méiose et ses conséquences sur la transmission et la recombinaison de l information génétique à travers

Plus en détail

D après FD X50-176 Management des processus (2005) AC X50-178 Management des processus, Bonnes pratiques et retours d expérience (2002)

D après FD X50-176 Management des processus (2005) AC X50-178 Management des processus, Bonnes pratiques et retours d expérience (2002) L'approche processus D après FD X50-176 Management des processus (2005) AC X50-178 Management des processus, Bonnes pratiques et retours d expérience (2002) Diaporama : Marie-Hélène Gentil (Maître de Conférences,

Plus en détail

Chapitre 3 L assortiment indépendant des gènes. Des génotypes supérieurs de cultures telles que le riz ont révolutionné l agriculture.

Chapitre 3 L assortiment indépendant des gènes. Des génotypes supérieurs de cultures telles que le riz ont révolutionné l agriculture. Chapitre 3 L assortiment indépendant des gènes Des génotypes supérieurs de cultures telles que le riz ont révolutionné l agriculture. La variation de deux caractères Croisements monohybrides: entre 2 individus

Plus en détail

Fouille de Données et Media Sociaux Cours 2 Master DAC Data Science UPMC - LIP6

Fouille de Données et Media Sociaux Cours 2 Master DAC Data Science UPMC - LIP6 Fouille de Données et Media Sociaux Cours 2 Master DAC Data Science UPMC - LIP6 Ludovic Denoyer 21 septembre 2015 Ludovic Denoyer () FDMS 21 septembre 2015 1 / 1 Contexte Observation La plupart des bonnes

Plus en détail

PROTOCOLE DE DESSIN DES OLIGONUCLEOTIDES LONGS POUR PUCES A ADN. Sommaire

PROTOCOLE DE DESSIN DES OLIGONUCLEOTIDES LONGS POUR PUCES A ADN. Sommaire Sommaire 1. PRINCIPE DE FONCTIONNEMENT:... 2 2. PRE-REQUIS AVANT LE DESSIN DES OLIGONUCLEOTIDES:... 3 2.1 Installation du logiciel OligoArray sur PC:... 3 2.2 Installation du logiciel OligoArray sur Mac:...

Plus en détail

MOOC Agroécologie Séquence 1 Septembre 2015. Application pour l enherbement des cultures pérennes. Elena Kazakou

MOOC Agroécologie Séquence 1 Septembre 2015. Application pour l enherbement des cultures pérennes. Elena Kazakou CONCEPT DES TRAITS FONCTIONNELS Application pour l enherbement des cultures pérennes Elena Kazakou Dans cet exemple je vais vous présenter le concept des traits fonctionnels et vous illustrer comment on

Plus en détail

PRINCIPES DIRECTEURS PERMETTANT DE DÉTERMINER L ENDROIT OÙ DOIVENT ÊTRE CLASSÉS LES DOCUMENTS DE BREVET DANS LA CIB

PRINCIPES DIRECTEURS PERMETTANT DE DÉTERMINER L ENDROIT OÙ DOIVENT ÊTRE CLASSÉS LES DOCUMENTS DE BREVET DANS LA CIB PRINCIPES DIRECTEURS PERMETTANT DE DÉTERMINER L ENDROIT OÙ DOIVENT ÊTRE CLASSÉS LES DOCUMENTS DE BREVET DANS LA CIB adoptés par le Comité d experts de l Union de l IPC à sa quarante-deuxième session et

Plus en détail

L ESTIMATION DES ÉCARTS SALARIAUX

L ESTIMATION DES ÉCARTS SALARIAUX Novembre 2005 L ESTIMATION DES ÉCARTS SALARIAUX (articles 60 à 68) La Loi sur l équité salariale vise à corriger les écarts salariaux dus à la discrimination systémique fondée sur le sexe à l égard des

Plus en détail

Analyse financière. + de 20 fiches de cours + de 160 QCM commentés + de 40 exercices corrigés. L essentiel. 2 e ÉDITION LES INDISPENSABLES VUIBERT

Analyse financière. + de 20 fiches de cours + de 160 QCM commentés + de 40 exercices corrigés. L essentiel. 2 e ÉDITION LES INDISPENSABLES VUIBERT LES INDISPENSABLES VUIBERT Analyse financière 2 e ÉDITION Emmanuelle Plot-Vicard Madeleine Deck-Michon L essentiel + de 20 fiches de cours + de 160 QCM commentés + de 40 exercices corrigés Sommaire Mode

Plus en détail

L approche processus c est quoi?

L approche processus c est quoi? L approche processus c est quoi? D après FD X50-176 Management des processus (2005) AC X50-178 Management des processus, Bonnes pratiques et retours d expérience (2002) Introduction Termes et définitions

Plus en détail

Série : STL Spécialité biotechnologies SESSION 2014 BACCALAURÉAT TECHNOLOGIQUE

Série : STL Spécialité biotechnologies SESSION 2014 BACCALAURÉAT TECHNOLOGIQUE BACCALAURÉAT TECHNLGIQUE Série : STL Spécialité biotechnologies SESSIN 2014 CBSV : sous épreuve coefficient 4 Biotechnologies : sous épreuve coefficient 4 Durée totale de l épreuve: 4 heures Les sujets

Plus en détail