Le marquage moléculaire

Dimension: px
Commencer à balayer dès la page:

Download "Le marquage moléculaire"

Transcription

1 Le marquage moléculaire Le marquage moléculaire regroupe un ensemble de techniques révélant des différences de séquences d (acide désoxyribonucléique) entre individus. Les marqueurs moléculaires permettent de détecter ces différences (polymorphisme) dans des régions spécifiques de l. L : le support de l information génétique Transcription Noyau Gène Traduction Expression d un caractère Plante Cellule Chromosome ARN messager Protéine Exemples de marqueurs moléculaires Les microsatellites Les microsatellites sont des séquences constituées de répétitions en tandem de motifs nucléotidiques. Les plus courants sont CA, CAT, GATA ; le nombre de répétitions de ces motifs varie de quelques unités à plusieurs dizaines. L analyse d un marqueur microsatellite permet de révéler ces répétitions. Les SNP (Single Nucleotide Polymorphism) Les marqueurs SNP révèlent des différences d une seule base dans une séquence d connue. Identification pour une même séquence d d un SNP entre deux variétés Séquence d cible Microsatellite X monomorphe Microsatellite Y polymorphe ATCCGCTTAGATCCTA ATCCGCTCAGATCCTA TCTCTCTC CATCAT TCTCTCTC CATCATCAT SNP Liens entre génotype/ phénotype Le génotype est l ensemble du patrimoine génétique d un individu. L expression du génotype conduit au phénotype. Le phénotype est l ensemble des caractères observables chez un individu dans un environnement donné. Génotype Exemple : couleur de la fleur Gène C Gène C Phénotype Les marqueurs moléculaires permettent d augmenter l efficacité et la précision des techniques d amélioration des plantes, en intervenant à certaines étapes du processus de sélection.

2 Extraction de l végétal C est le procédé qui permet d isoler l contenu dans les noyaux cellulaires d un fragment de tissu végétal (feuilles, graines). Il constitue le matériel de base pour toute analyse de marquage moléculaire. L automatisation de ce procédé permet l extraction de l d un nombre important d échantillons par unité de temps. Echantillonnage Broyage Sels de précipitation (NH 4 C 2 H 3 O 2 ) + alcool Lyse cellulaire par incubation au bain-marie (95 C, 1 h) dans un tampon d extraction Précipitation de l Centrifugation Pelote d Centrifugation Récupération du surnageant ( + protéines) Elimination du culot composé de débris végétaux (membrane ) Eclatement des cellules, l se libère dans la solution Lavage Récupération du culot d après séchage Suspension de l Culot d dans un évaporateurconcentrateur dans une solution tampon Elimination du surnageant

3 PCR ou amplification de l L objectif de cette technique est de multiplier un fragment d en un grand nombre de copies afin de rendre possible sa visualisation. Préparation de la réaction de PCR Préparation robotisée du mélange réactionnel : l matrice les nucléotides (A, T, C, G) du MgCl 2 et de l H 2 O les amorces l enzyme Taq polymérase 94 C 50 à 65 C à amplifier Dénaturation Hybridation 1 er cycle 72 C Elongation Robot : Tecan Amplification de l Cette amplification par PCR (Polymerase Chain Reaction) est constituée d une répétition de cycles comportant trois étapes : Dénaturation Séparation des deux brins d. Hybridation Accrochage des amorces sur la séquence cible qui seront le point de départ de la synthèse du nouveau fragment. Elongation Synthèse de la chaîne nucléotidique par une enzyme, la Taq polymérase. Une trentaine de cycles d amplification sont suffisants pour détecter l amplifié. 2 ème cycle Dénaturation Hybridation Elongation Thermocycleur : appareil permettant l obtention des températures nécessaires à chaque cycle d amplification. 30 cycle ème Durée du processus : 1h30 à 2h

4 Visualisation de l amplifié ou révélation La révélation est l étape qui consiste à visualiser les fragments d amplifiés. Deux méthodes sont utilisées au laboratoire. Electrophorèse Cette technique est utilisée pour la séparation des fragments amplifiés selon leur taille sur un gel d agarose ou d acrylamide dans un champ électrique. Système de révélation TaqMan Le système Taqman est basé sur une différence au niveau d un nucléotide dans une séquence d. Trois étapes sont nécessaires : Hybridation sur l cible d une sonde complémentaire portant une molécule fluorescente (le fluorophore). Chaque sonde est spécifique d une séquence d donnée. Elongation, au cours de laquelle l enzyme Taq polymérase libère le fluorophore. Visualisation par excitation et quantification du fluorophore à une longueur d onde qui lui est propre. Dépôt sur gel d agarose Cuves d électrophorèse Migration des fragments d selon leurs tailles sur un gel d électrophorèse soumis à un champ électrique Lors de la migration sur gel, les fragments d les plus grands sont retardés par rapport aux plus petits L addition de bromure d éthidium permet la visualisation des fragments d après électrophorèse. Cette molécule s intercale entre les bases de l et a la propriété d être fluorescente sous lumière ultraviolette : A T G C Fragments d amplifié Migration sur gel d agarose 2 Révélation ultra-violet 2 Photographie Système de révélation SNP Taqman 7900 HT F Amorces Fluorophore Sonde spécifique à la variété 1 Sonde spécifique F2 à la variété 2 Taq polymérase Lumière Lumière Fluorescence CGAATCT ACGTAGCCGCTTAGATCCTATTCG Séquence d' cible ACGTAGCCGCTCAGATCCTATTCG Fluorescence Hybridation CGAGTCT Lumière Elongation F2 Fluorescence GAATCT ACGTAGCCGCTTAGATCCTATTCG Séquence d' cible ACGTAGCCGCTCAGATCCTATTCG CGAGTC Visualisation F2 Lumière Fluorescence Résultat de la migration Echelle de fluorescence pour 0 F2 L information est ensuite stockée sur un serveur, pour être analysée avec des outils statistiques. Echelle de fluorescence pour F2

5 Description de la variabilité génétique Chaque individu d une espèce donnée peut être identifié rigoureusement par une empreinte génétique ou fingerprinting. Pour établir cette empreinte, une analyse du polymorphisme de l est conduite avec un ensemble de marqueurs moléculaires (quelques dizaines à quelques centaines). Le profil de chaque individu est observé pour chacun des marqueurs analysés. C est la combinaison de ces données qui constitue l empreinte génétique. La comparaison des empreintes génétiques au sein de populations ou groupes d individus permettra une caractérisation plus poussée de la variabilité génétique, et fournira une meilleure connaissance des relations de parenté entre individus. Caractérisation et structuration de la variabilité génétique Le fingerprinting permet au sélectionneur d optimiser les décisions stratégiques en ce qui concerne la gestion des ressources génétiques : le choix des lignées parentales pour la création d hybrides ou de populations à sélectionner. Le sélectionneur privilégie les croisements entre deux parents complémentaires et suffisamment éloignés pour la production d hybrides performants. la constitution de collections variétales assurant la conservation de ressources génétiques à long terme. Variétés Marqueur 215 pb Mon pb Marqueur de poids moléculaire (fragments de taille connue) 350 pb 300 pb 250 pb 200 pb 150 pb 100 pb 50 pb Variétés A B C Marqueur 1 Marqueur 2 Marqueur 3 Marqueur 4 Etablissement d une matrice de lecture Variétés A B C Marqueur 1 Marqueur 2 Marqueur 3 Marqueur Représentation graphique (dendrogramme) Calcul des % de similarité entre individus Deux types de représentation graphique de la variabilité génétique Graphique ACP Analyse en Composantes Principales Dendrogramme A B A C C A est plus proche de C que de B B Représentation graphique (ACP)

6 La Sélection Assistée par Marqueurs (S.A.M) C est une stratégie qui améliore l efficacité des processus de sélection (progrès génétique par unité de temps) pour la création de variétés hautement performantes. Par l utilisation des marqueurs moléculaires, qui permettent l étiquetage de régions chromosomiques favorables à l expression de caractères d intérêt, la sélection assistée par marqueurs rend possible la construction des meilleures combinaisons de gènes. Deux étapes principales : Identification des régions d impliquées dans l expression des caractères complexes (rendement, précocité de maturation) : analyse des corrélations marqueurs-caractères. Recombinaison des individus les plus complémentaires pour l accumulation de ces régions favorables. Utilisation de la SAM pour l obtention de nouvelles variétés élites Développement d une population en ségrégation Recombiner les caractéristiques apportées par les 2 parents Parent 1 Parent 2 Exemple d un marqueur informatif : Test statistique au marqueur X Différence des effets sur le rendement Nb BB AA Rendement Supériorité de la forme A au marqueur X Essais aux champs Analyse des corrélations Marqueurscaractères Génotypage- Marqueur X Parent 1 Parent 2 Individus AA BB AB AA BB BB AA AB BB AB Sélection et intercroisement Augmentation de la fréquence des gènes favorables Résultats attendus Rendement en Qx/ha Initiation d un nouveau cycle Gain de rendement : +7% en moyenne Meilleur hybride (parent) Sélection phénotypique Nouvelle population Analyse aux marqueurs informatifs Sélection des individus ayant accumulé le plus de régions chromosomiques Créer la meilleure combinaison : favorables Chromosomes Sélection assistée par marqueurs Expérience DEKALB de Sélection Récurrente Assistée par Marqueurs sur 43 populations de maïs Région favorable Parent 1 Région favorable Parent 2 Profil de l individu idéal

7 Les conversions assistées par marqueurs Certains caractères monogéniques présentent un intérêt majeur pour l amélioration des variétés et leur réussite commerciale sur le marché : résistance à des maladies, qualité d huile, transgènes (ex : Maïs Bt). Une fois identifiés, ces gènes portés par une plante appelée donneuse, peuvent être transmis par croisement à toute autre plante receveuse. Dans un deuxième temps, une succession de rétrocroisements (Back cross) avec le parent receveur est réalisée afin d éliminer les portions d provenant du donneur à l exception du gène d intérêt. L efficacité de ce processus est améliorée par l utilisation de marqueurs moléculaires bien répartis sur le génôme (marqueurs cartographiés). Marqueur moléculaire cartographié Caractère d intérêt Plante donneuse Plante receveuse Chromosome Sélection des individus génétiquement les plus proches de la lignée receveuse et possédant le caractère d intérêt Elimination des descendants n ayant pas le caractère d intérêt Back Cross Back Cross Efficacité comparée de la conversion assistée par marqueurs avec la conversion traditionnelle Par sélection classique, 6 rétrocroisements sont nécessaires pour obtenir un retour vers le parent receveur de 97 % alors qu avec les marqueurs moléculaires 2 rétrocroisements seulement suffisent. La conversion assistée par marqueurs permet un gain de temps de 2 à 3 ans % de récupération du parent récurrent Conversion assistée par marqueurs Conversion traditionnelle Nombre de rétrocroisements

8 Les marqueurs diagnostics Il s agit de marqueurs moléculaires liés à des caractères à déterminisme simple (monogénique), comme la résistance à certaines maladies (mildiou). Une fois la liaison génétique établie entre le gène et le marqueur, il devient très facile de suivre et contrôler la présence de ce gène chez n importe quel individu sans avoir recours à l observation phénotypique du caractère. Détermination du phénotype à l aide d un marqueur diagnostic Variété A Variété B Gène de résistance au mildiou Marqueur diagnostic (résistance) Forme résistante Marqueur diagnostic (sensibilité) Forme sensible PCR Electrophorèse Les marqueurs diagnostics permettent de déterminer le phénotype de la plante dès le stade précoce Plante 1 Plante 2 Plante 3 Plante 4 Plante 5 Plante 6 résistante résistante sensible résistante sensible résistante La disponibilité d un marqueur lié à un gène majeur (marqueur diagnostic) est une aide précieuse pour le sélectionneur. Comme un fragment de feuille suffit à obtenir l nécessaire pour établir l empreinte génétique d une plante, un tri précoce peut être établi dès le début de la croissance des plantes. Ceci permet un gain de temps et d argent, car il n est plus nécessaire d attendre le stade adulte pour observer le phénotype.

9 Détection d OGM dans le contrôle qualité Aujourd hui, la biologie moléculaire permet de contrôler certains paramètres de qualité des semences, de leur conception à leur commercialisation. Monsanto a d ores et déjà mis en place un système de contrôle, dont les capacités sont uniques en Europe, pour éliminer tout risque de présence fortuite d OGM dans les variétés conventionnelles (un OGM est une plante dans laquelle la présence d un nouveau gène, lui confère un nouveau caractère). On recherche la présence de ce gène dans un échantillon représentatif (semence ou tissu végétal) de 3 manières possibles. Echantillon végétal Détection du gène Exemples : gène Bt gène Roundup Ready Détection de la protéine Exemples : toxine anti-insecte enzyme de résistance au Roundup Détection du nouveau caractère Exemples : plante résistante à la pyrale au Roundup Test Extraction Test ELISA Détection immunologique de la protéine Test biologique Exemples : libération d insectes, pulvérisation de pesticide PCR Quantitative Révélation et identification du gène Différentes analyses des résultats Qualitative La détection d OGM est une technique utilisée : actuellement pour mesurer la teneur en OGM dans les semences conventionnelles. à l avenir et dans les pays où les OGM sont commercialisés, garantir la présence et la pureté des nouveaux gènes dans les semences génétiquement modifiées.

VI. L APPORT DES MARQUEURS MOLECULAIRES. A. Définitions

VI. L APPORT DES MARQUEURS MOLECULAIRES. A. Définitions VI. L APPORT DES MARQUEURS MOLECULAIRES Comme nous l avons vu précédemment, l étude des caractères quantitatifs est fondée sur l analyse statistique des performances mesurées des individus. Il en est de

Plus en détail

UNION INTERNATIONALE POUR LA PROTECTION DES OBTENTIONS VÉGÉTALES

UNION INTERNATIONALE POUR LA PROTECTION DES OBTENTIONS VÉGÉTALES ORIGINAL : anglais DATE : 21 octobre 2010 UNION INTERNATIONALE POUR LA PROTECTION DES OBTENTIONS VÉGÉTALES GENÈVE F DIRECTIVES CONCERNANT LES PROFILS D ADN : CHOIX DES MARQUEURS MOLECULAIRES ET CONSTRUCTION

Plus en détail

LE GÉNIE GÉNÉTIQUE ET LA BIOLOGIE MOLÉCULAIRE

LE GÉNIE GÉNÉTIQUE ET LA BIOLOGIE MOLÉCULAIRE LE GÉNIE GÉNÉTIQUE ET LA BIOLOGIE MOLÉCULAIRE Plan Introduction I - Qu est ce Que le génie génétique? II - Quels sont les outils du génie génétique? II.1- Les Enzymes II.1.1- Enzymes de restriction II.1.2-

Plus en détail

Mise en évidence des agents infectieux par Biologie Moléculaire

Mise en évidence des agents infectieux par Biologie Moléculaire UE de l agent infectieux à l hôte Janvier 2012 Mise en évidence des agents infectieux par Biologie Moléculaire Dr Isabelle GARRIGUE Laboratoire de Virologie Professeur FLEURY isabelle.garrigue@chu-bordeaux.fr

Plus en détail

Ministère des Solidarités, de la Santé et de la Famille

Ministère des Solidarités, de la Santé et de la Famille Ministère des Solidarités, de la Santé et de la Famille Direction générale de la Santé Sous-Direction de la gestion des risques des milieux Bureau des eaux DGS/SD7A N Personnes chargées du dossier : Philippe

Plus en détail

10a: La PCR (locus D1S80)

10a: La PCR (locus D1S80) 10a: La PCR (locus D1S80) Pour des raisons techniques, ce protocole n'est plus utilisé. Il a été remplacé par le protocole "PCR locus PV92" ainsi que le nouveau protocole "PCR sensibilité au PTC". Il reste

Plus en détail

UNION INTERNATIONALE POUR LA PROTECTION DES OBTENTIONS VÉGÉTALES

UNION INTERNATIONALE POUR LA PROTECTION DES OBTENTIONS VÉGÉTALES ORIGINAL: anglais DATE: 18 janvier 2007 UNION INTERNATIONALE POUR LA PROTECTION DES OBTENTIONS VÉGÉTALES GENÈVE F PROJET DIRECTIVES CONCERNANT LES PROFILS D ADN : CHOIX DES MARQUEURS MOLÉCULAIRES ET CONSTRUCTION

Plus en détail

UE 2V311 - TD3-2015. Analyses de méioses, ségrégation et cartographie.

UE 2V311 - TD3-2015. Analyses de méioses, ségrégation et cartographie. Buts du TD : UE 2V311 - TD3-2015 Analyses de méioses, ségrégation et cartographie. - connaître la méiose et ses conséquences sur la transmission et la recombinaison de l information génétique à travers

Plus en détail

LES MARQUEURS MOLECULAIRES

LES MARQUEURS MOLECULAIRES LES MARQUEURS MOLECULAIRES Il y a différents types de marqueurs : o Les caractères phénotypiques : limités, observations sur l arbre entier et sur différentes années o Les marqueurs biochimiques o Les

Plus en détail

Approfondissement des connaissances en biologie moléculaire

Approfondissement des connaissances en biologie moléculaire Approfondissement des connaissances en biologie moléculaire nicolas.glaichenhaus@unice.fr Master IADE Année 2013-2014 Plan du cours Rappels de biologie moléculaire et de biologie cellulaire Les molécules

Plus en détail

Structure de l Opéron Tryptophane

Structure de l Opéron Tryptophane Régulation de la transcription (procaryote) Structure de l Opéron Tryptophane Opéron anabolique 5 gènes de structure nécessaires à la synthèse du tryptophane Trp Trp Trp Trp Trp 1 Régulation de la transcription

Plus en détail

Identification et détection des virus. A) Détection symptomatologique

Identification et détection des virus. A) Détection symptomatologique Identification et détection des virus La détection et l'identification des virus font appel à différentes méthodes. Ces méthodes se caractérisent par leur spécificité et leur sensibilité. On peut citer

Plus en détail

Principe des études moléculaires en génétique médicale Méthodes d analyse des microlésions du génome

Principe des études moléculaires en génétique médicale Méthodes d analyse des microlésions du génome Mercredi 23 Octobre LECLERCQ Barbara L2 GM Pr Krahn 10 pages Principe des études moléculaires en génétique médicale Méthodes d analyse des microlésions du génome Plan A. Introduction B. Techniques courantes

Plus en détail

Mise en évidence des agents infectieux par Biologie Moléculaire

Mise en évidence des agents infectieux par Biologie Moléculaire UE de l agent infectieux à l hôte Février 2015 Mise en évidence des agents infectieux par Biologie Moléculaire Dr Isabelle GARRIGUE UMR CNRS MFP Microbiologie Fondamentale et Pathogénicité isabelle.garrigue@chu-bordeaux.fr

Plus en détail

8. Amplification et séquençage des acides nucléiques

8. Amplification et séquençage des acides nucléiques 8. Amplification et séquençage des acides nucléiques ADN chromosomique, plasmides (ADN bactérienne), ARN messager Rupture cellulaire Isolation et purification des acides nucléiques Concentration et amplification

Plus en détail

MLVA Streptococcus pneumoniae

MLVA Streptococcus pneumoniae H.I.A. Robert Picqué Bordeaux Laboratoire de Biologie moléculaire Version Internet 2 MLVA Streptococcus pneumoniae 1. DESCRIPTION DES OPERATIONS 1.1 Culture et extraction des ADN NB : prévoir dans la série

Plus en détail

BACCALAURÉAT TECHNOLOGIQUE

BACCALAURÉAT TECHNOLOGIQUE BACCALAURÉAT TECHNOLOGIQUE Série : Sciences et Technologies de Laboratoire Spécialité : Biotechnologies SESSION 2015 Sous-épreuve écrite de Biotechnologies Lundi 22 juin 2015 Coefficient de la sous-épreuve

Plus en détail

POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA

POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA Amplification spécifique Détection spécifique Clonage dans des vecteurs Amplification in vitro PCR Hybridation moléculaire - hôte cellulaire

Plus en détail

Séance génome : Explication PCR et électrophorèse

Séance génome : Explication PCR et électrophorèse Séance génome : Explication PCR et électrophorèse La PCR (Polymérase Chain Reaction) est une technique qui permet de démultiplier en de très nombreuses quantités une séquence de nucléotides parmi l ensemble

Plus en détail

TP BC : ADN recombinant BCPST1, ENCPB

TP BC : ADN recombinant BCPST1, ENCPB TP BC : principe et analyse de résultats des technologies de l ADN recombinant = clonage moléculaire = génie génétique Sources des illustrations : Analyse génétique moderne, Griffith et al., De Boeck,

Plus en détail

Techniques de base de la biologie moléculaire

Techniques de base de la biologie moléculaire Techniques de base de la biologie moléculaire Présenté par : Addoun Hadjer Ait Saadi Taous Plan: Introduction Purification des acides nucléiques 1-extraction à partir de matériels biologiques 2-estimation

Plus en détail

Le monde des bio-puces

Le monde des bio-puces Le monde des bio-puces D1 Le «dogme central» de la biologie moléculaire Transcription Epissage Traduction ADN ARNpm ARNm Protéines Génome Transcriptome Protéome D2 Puces à ADN Techniques de génomique fonctionnelle

Plus en détail

ED Biologie moléculaire. E. Turpin J. Lehmann-Che 5-6 novembre 2007

ED Biologie moléculaire. E. Turpin J. Lehmann-Che 5-6 novembre 2007 ED Biologie moléculaire E. Turpin J. Lehmann-Che 5-6 novembre 2007 PCR 1983: Kary Mullis Amplification in vitro par une méthode enzymatique d'un fragmentd'adn en présence de deux oligonucléotides spécifiques

Plus en détail

Taq'Ozyme Purple Mix MANUEL D UTILISATION

Taq'Ozyme Purple Mix MANUEL D UTILISATION Taq'Ozyme Purple Mix OZYA003-40 - 40 réactions OZYA003-200 - 200 réactions (avec supplément de MgCl 2 ) OZYA003-200XL - 200 réactions (avec supplément de MgCl 2 ) OZYA003-1000 - 1000 réactions (avec supplément

Plus en détail

Oxoid sites around the world

Oxoid sites around the world Oxoid!!"# Oxoid sites around the world ' $ %& Oxoid s area of expertise )&' )' & ' ' & '' ' ( Oxoid Products Dehydrated Media Prepared Media Latex Agglutination Kits BAX System from DuPont Qualicon DuPont

Plus en détail

PCR (POLYMERASE CHAIN REACTION)

PCR (POLYMERASE CHAIN REACTION) PCR (POLYMERASE CHAIN REACTION) Amplification des acides nucléiques PCR RT-PCR Et leurs applications PCR en temps réel La PCR : une révolution technologique en biologie moléculaire APPLICATIONS : - Médecine

Plus en détail

1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16.

1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 1. Indiquer ce qu est un gène. 2. Décrire la structure de la molécule d ADN. 3. Indiquer ce que sont les allèles d un gène. 4. Indiquer ce qu est le génotype. 5. Indiquer ce qu est le phénotype. 6. Citer

Plus en détail

Vers l assignation de parenté par SNP

Vers l assignation de parenté par SNP Vers l assignation de parenté par SNP Journée Génomique Sysaaf 3 juin 2015, Rennes Marc VANDEPUTTE INRA UMR Génétique Animale et Biologie Intégrative Ifremer Laboratoire 3AS L assignation de parenté Pour

Plus en détail

Jean-Louis Bergé-Lefranc

Jean-Louis Bergé-Lefranc Apport du séquençage du génome humain à la toxicologie: Toxicogénomique Jean-Louis Bergé-Lefranc QuickTime et un décompresseur TIFF (LZW) sont requis pour visionner cette image. QuickTime et un décompresseur

Plus en détail

Pathologies et génétique moléculaire

Pathologies et génétique moléculaire Biochimie - Biologie moléculaire Pathologies et génétique moléculaire Julien Fauré Institut de Formation en Soins Infirmiers 1 ère Année Année universitaire 2014-2015 Plan Les outils de la génétique moléculaire

Plus en détail

S 4B0602: Biologie Moléculaire pour les Biotechnologies

S 4B0602: Biologie Moléculaire pour les Biotechnologies S 4B0602: Biologie Moléculaire pour les Biotechnologies 16h TP: Sexage de viande bovine Production d une protéine recombinante, la TAQ ADN Polymérase. 12h CM: Empreintes génétiques Détection d OGM Construction

Plus en détail

Principales techniques utilisées en génie génétique Ces différentes techniques peuvent également se combiner entre elles. Séquençage de l ADN

Principales techniques utilisées en génie génétique Ces différentes techniques peuvent également se combiner entre elles. Séquençage de l ADN Principales techniques utilisées en génie génétique Ces différentes techniques peuvent également se combiner entre elles Séquençage de l ADN 1- Un brin complémentaire de l ADN à séquencer est fabriqué

Plus en détail

Mlle ImaneSmaili SVI4. Encadré par: Responsable du cours de Biologie Moléculaire Pr. B. BELKADI

Mlle ImaneSmaili SVI4. Encadré par: Responsable du cours de Biologie Moléculaire Pr. B. BELKADI Mlle ImaneSmaili SVI4 Encadré par: Responsable du cours de Biologie Moléculaire Pr. B. BELKADI PLAN 1. Introduction 2.Définition 3. Principe 4.Les applications de la PCR Introduction La PCR «Polymerase

Plus en détail

BACCALAURÉAT TECHNOLOGIQUE

BACCALAURÉAT TECHNOLOGIQUE BACCALAURÉAT TECHNOLOGIQUE Série : Sciences et Technologies de Laboratoire Spécialité : Biotechnologies SESSION 2013 Sous-épreuve écrite de Biotechnologies Coefficient de la sous-épreuve : 4 Ce sujet est

Plus en détail

Professeur Joël LUNARDI

Professeur Joël LUNARDI Biochimie - Biologie moléculaire Chapitre 9 : Applications médicales Professeur Joël LUNARDI MED@TICE PCEM1 - Année 2006/2007 Faculté de Médecine de Grenoble - Tous droits réservés. Chapitre 9. APPLICATIONS

Plus en détail

Quelques définitions

Quelques définitions Quelques définitions Sandrine Lagarrigue et Pascale Le Roy 1 Journée Technique SYSAAF La mise en œuvre des outils de la génomique : enjeux pour le SYSAAF et ses adhérents. 03 juin 2015. Rennes Le génome

Plus en détail

Baccalauréat général Sciences de la vie et de la Terre

Baccalauréat général Sciences de la vie et de la Terre Baccalauréat général Sciences de la vie et de la Terre Épreuve obligatoire série S Partie 1 (5 points) Thème 1-: Expression, stabilité, variation du patrimoine génétique. Sujet : On cherche à montrer,

Plus en détail

Méthodes et techniques de la biologie du développement

Méthodes et techniques de la biologie du développement Méthodes et techniques de la biologie du développement 1. Etude de l expression des gènes : Détecter les transcrits et les protéines au cours de l ontogenèse l outil anticorps 1.1. La RT-PCR La réaction

Plus en détail

Méthodes d études. Chapitre 8 : Professeur Joël LUNARDI. UE1 : Biochimie Biologie moléculaire

Méthodes d études. Chapitre 8 : Professeur Joël LUNARDI. UE1 : Biochimie Biologie moléculaire Chapitre 8 : UE1 : Biochimie Biologie moléculaire Méthodes d études Professeur Joël LUNARDI Année universitaire 2010/2011 Université Joseph Fourier de Grenoble - Tous droits réservés. Chapitre 8. 8. Méthodes

Plus en détail

Voir en annexe, un tableau résumant toutes les techniques de la génétique moléculaire.

Voir en annexe, un tableau résumant toutes les techniques de la génétique moléculaire. Séance 5. Chapitre 4 : LA BIOLOGIE MOLECULAIRE ET SES APPLICATIONS I/ Les outils de la génétique moléculaire. Voir en annexe, un tableau résumant toutes les techniques de la génétique moléculaire. 1. Découverte

Plus en détail

Testing moléculaire RER/MSI

Testing moléculaire RER/MSI Atelier Instabilité Microsatellitaire 26 avril 2014, Bordeaux Testing moléculaire RER/MSI Isabelle Soubeyran Unité de Pathologie Moléculaire Institut Bergonié Bordeaux PGMC d Aquitaine Système RER = système

Plus en détail

Modifications de l expression de gènes : un nouvel outil de détection d agents de stimulation de l Erythropoièse (ESAs) dans la lutte antidopage?

Modifications de l expression de gènes : un nouvel outil de détection d agents de stimulation de l Erythropoièse (ESAs) dans la lutte antidopage? Modifications de l expression de gènes : un nouvel outil de détection d agents de stimulation de l Erythropoièse (ESAs) dans la lutte antidopage? Société Skuld-Tech Nous avons développé une plate-forme

Plus en détail

10b : La PCR (locus PV92)

10b : La PCR (locus PV92) 10b : La PCR (locus PV92) Cette expérience a été mise en place afin de remplacer le protocole intitulé "PCR (locus D1S80)". L amplification est en effet meilleure et les résultats plus simples à interpréter.

Plus en détail

Produits OGM dans les denrées alimentaires : aperçu des contrôles menés en 2012 par les autorités cantonales d'exécution

Produits OGM dans les denrées alimentaires : aperçu des contrôles menés en 2012 par les autorités cantonales d'exécution Département fédéral de l intérieur DFI Office fédéral de la santé publique (OFSP) Unité de direction Protection des consommateurs Berne, juillet 2013 Produits OGM dans les denrées alimentaires : aperçu

Plus en détail

8.3.3 Réactifs. La polymérase catalyse la synthèse de brins complémentaires d ADN.

8.3.3 Réactifs. La polymérase catalyse la synthèse de brins complémentaires d ADN. 8.3.3 Réactifs 1. AD polymérase: La polymérase catalyse la synthèse de brins complémentaires d AD. Des polymérases qui sont résistantes à la chaleur sont utilisées, telles que la Taq polymérase (Thermus

Plus en détail

KIT PRINCIPE DE LA PCR A RECEPTION DU COLIS : COMPOSITION (pour 5 gels de 8 puits soit 40 dépôts d ADN) MATERIEL NECESSAIRE

KIT PRINCIPE DE LA PCR A RECEPTION DU COLIS : COMPOSITION (pour 5 gels de 8 puits soit 40 dépôts d ADN) MATERIEL NECESSAIRE : 0033 (0)169922672 : 0033 (0)169922674 : @ :sordalab@wanadoo.fr KIT PRINCIPE DE LA PCR Ref: PCR A RECEPTION DU COLIS : Vérifier la composition du colis indiquée ci-dessous en page 1 Stocker les articles

Plus en détail

Technologie de l ADN recombinant. Complément de cours sur: «Les Méthodes d Etude de la Cellule»

Technologie de l ADN recombinant. Complément de cours sur: «Les Méthodes d Etude de la Cellule» Technologie de l ADN recombinant Complément de cours sur: «Les Méthodes d Etude de la Cellule» 1 Les techniques de l ADN Recombinant But: isoler des fragments d ADN de génomes complexes et les recombiner

Plus en détail

Utilisation des marqueurs ISSR pour l'étude du polymorphisme génétique d'artemisia herba-alba

Utilisation des marqueurs ISSR pour l'étude du polymorphisme génétique d'artemisia herba-alba Utilisation des marqueurs ISSR pour l'étude du polymorphisme génétique d'artemisia herba-alba Haouari M., Ferchichi A. in Ferchichi A. (comp.), Ferchichi A. (collab.). Réhabilitation des pâturages et des

Plus en détail

TECHNIQUES QUALITATIVES D'AMPLIFICATION ENZYMATIQUE DES ACIDES NUCLEIQUES :

TECHNIQUES QUALITATIVES D'AMPLIFICATION ENZYMATIQUE DES ACIDES NUCLEIQUES : TECHNIQUES QUALITATIVES D'AMPLIFICATION ENZYMATIQUE DES ACIDES NUCLEIQUES : PCR ( POLYMERASE CHAIN REACTION), RT-PCR (REVERSE TRANSCRIPTION-PCR) ET PCR TEMPS REEL DETECTION ET IDENTIFICATION DES ORGANISMES

Plus en détail

BIOPSIE DE TROPHOBLASTE ou PRÉLÈVEMENT DE VILLOSITÉS CHORIALES

BIOPSIE DE TROPHOBLASTE ou PRÉLÈVEMENT DE VILLOSITÉS CHORIALES BIOPSIE DE TROPHOBLASTE ou PRÉLÈVEMENT DE VILLOSITÉS CHORIALES Le diagnostic prénatal par biopsie de trophoblaste ( 1 ) au premier trimestre de la grossesse est devenu une alternative fréquente aux techniques

Plus en détail

Université Bordeaux Segalen - PACES 2011-2012 ED UE9s Mars 2012

Université Bordeaux Segalen - PACES 2011-2012 ED UE9s Mars 2012 Sélectionner les propositions exactes Université Bordeaux Segalen - PACES 2011-2012 ED UE9s Mars 2012 QCM 1. La température de fusion (Tm) d une molécule d ADN : A. est mise en évidence par l augmentation

Plus en détail

ATELIER EPIGENETIQUE

ATELIER EPIGENETIQUE Juin 2012 ATELIER EPIGENETIQUE Utilisation de la Q-PCR pour analyser des données de ChIP ou de MeDIP Emmanuèle Mouchel-Vielh I. La PCR quantitative: principe et généralités II. Interprétation des résultats

Plus en détail

TD Révision BIO57. Connaissance et Technique du gène

TD Révision BIO57. Connaissance et Technique du gène TD Révision BIO57 Connaissance et Technique du gène Novembre 2007 Cécile BAUDOT cecile.baudot@medecine.univ-mrs.fr INSERM 910 «Génétique Médicale et Génomique Fonctionnelle» Maladies Neuromusculaires Le

Plus en détail

De la biologie molécualire à la génomique

De la biologie molécualire à la génomique De la biologie molécualire à la génomique Pierre Neuvial École Nationale de la Statistique et de l Administration Économique Méthodes statistiques pour la biologie Plan du cours 1 Introduction à la biologie

Plus en détail

Analyse d échantillons alimentaires pour la présence d organismes génétiquement modifiés

Analyse d échantillons alimentaires pour la présence d organismes génétiquement modifiés Analyse d échantillons alimentaires pour la présence d organismes génétiquement modifiés Module 9 Détection qualitative du maïs MON810, du maïs Bt- 176 et du soja Roundup Ready par PCR M. Querci, M. Maretti,

Plus en détail

Préparation et réalisation de réactions de séquence (Quick Start Kit, Beckman Coulter)

Préparation et réalisation de réactions de séquence (Quick Start Kit, Beckman Coulter) MODE OPERATOIRE Code : SSG / 001 UMR 1229 MGS Microbiologie et Géochimie des Sols 17 rue Sully BP86510 21065 Dijon Cedex Rédigé par : D. Bru Préparation et réalisation de réactions de séquence (Quick Start

Plus en détail

LA PCR QUANTITATIVE EN TEMPS REEL OU LA "TAQMAN"

LA PCR QUANTITATIVE EN TEMPS REEL OU LA TAQMAN LA PCR QUANTITATIVE EN TEMPS REEL OU LA "TAQMAN" I- Terminologie Le terme TaqMan est souvent utilisé par abus de langage pour désigner : - la technique de PCR quantitative par détection en temps réel de

Plus en détail

Activité Intitulé de l'activité Volume horaire

Activité Intitulé de l'activité Volume horaire Informations de l'unité d'enseignement Implantation Cursus de Institut Paul Lambin Bachelier en chimie Intitulé Biotechnologie 2 C2120 Cycle 1 Bloc 2 Quadrimestre 2 Pondération 1 Nombre de crédits 5 Nombre

Plus en détail

Biologie moléculaire et Génie génétique

Biologie moléculaire et Génie génétique Module 1 : Biologie moléculaire et Génie génétique Section 1 : STRUCTURES ET FONCTIONS DES ACIDES NUCLEIQUES Plutôt que de rechercher l'exhaustivité, on s'attachera à la clarification et la structuration

Plus en détail

La génomique fonctionnelle

La génomique fonctionnelle Marc Noël, B.Sc. Agr. Chargé de comptes principal Merial Canada Inc. Journée bovine de l Estrie 2006 25 novembre 2006 All animals are equal but some animals are more equal than others. George Orwell -

Plus en détail

Diagnostic prénatal des maladies génétiques

Diagnostic prénatal des maladies génétiques Diagnostic prénatal des maladies génétiques Collège National des Enseignants et Praticiens de Génétique Médicale C. Coutton, V. Satre, F. Amblard et F. Devillard Date de création du document 2010-2011

Plus en détail

Généticien (nne) : 2) Quels sont les types des protéines qui correspondent aux énoncés du tableau suivant?

Généticien (nne) : 2) Quels sont les types des protéines qui correspondent aux énoncés du tableau suivant? Généticien (nne) : Groupe : EXERCICES GÉNÉTIQUE LES PROTÉINES ET L ADN 1) Les gènes portent de l information. De quelle sorte d information s agit-il? Cette information représente la séquence des acides

Plus en détail

Les documents présentés dans ce cours sont issus : soit de travaux personnels soit de travaux présentés sur le web Leur utilisation ne doit donner

Les documents présentés dans ce cours sont issus : soit de travaux personnels soit de travaux présentés sur le web Leur utilisation ne doit donner Les documents présentés dans ce cours sont issus : soit de travaux personnels soit de travaux présentés sur le web Leur utilisation ne doit donner lieu à aucune exploitation commerciale D. LOCKER Professeur

Plus en détail

Cindy Dallaire, agronome-phytopathologiste Direction de la phytoprotection

Cindy Dallaire, agronome-phytopathologiste Direction de la phytoprotection L UTILISATION DE LA PCR (POLYMERASE CHAIN REACTION), UN TEST DE LABORATOIRE PLUS RAPIDE POUR DÉTECTER ERWINIA TRACHEIPHILA, BACTÉRIE RESPONSABLE DU FLÉTRISSEMENT BACTÉRIEN CHEZ LES CUCURBITACÉES Cindy

Plus en détail

Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013

Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013 Sélectionner les propositions exactes Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013 QCM 1 La plupart des techniques de biologie moléculaire repose sur le principe de complémentarité

Plus en détail

La PCR en temps réel

La PCR en temps réel La PCR en temps réel Hôpital La Rabta Tunis 6 juin 2013 Dr Sabine Favre-Bonté Maître de Conférences, Université Claude Bernard Lyon 1 UMR CNRS 5557 Ecologie Microbienne Equipe Multi-résistance environnementale

Plus en détail

KIT REALISATION DE LA PCR A RECEPTION DU COLIS : COMPOSITION (pour 5 gels de 8 puits et 10 réactions de PCR)

KIT REALISATION DE LA PCR A RECEPTION DU COLIS : COMPOSITION (pour 5 gels de 8 puits et 10 réactions de PCR) : 0033 (0)169922672 : 0033 (0)169922674 : @ :sordalab@wanadoo.fr KIT REALISATION DE LA PCR Ref: PCRREA A RECEPTION DU COLIS : Vérifier la composition du colis indiquée ci-dessous en page 1 Stocker les

Plus en détail

Titre de la séance : Universalité de l ADN, support de l information génétique.

Titre de la séance : Universalité de l ADN, support de l information génétique. Partie du programme : la Terre dans l Univers, la vie et l évolution du vivant : une planète habitée Niveau : seconde EXTRAIT DU PROGRAMME La transgénèse montre que l information génétique est contenue

Plus en détail

Structure des génomes bactériens / systèmes de mutagénèse / génomique comparative

Structure des génomes bactériens / systèmes de mutagénèse / génomique comparative Master 1 Bactério 10/01/09 8h30-10h30 RT : Stéphanie Ripert-Bernusset RL: Benjamin de Sainte Marie Structure des génomes bactériens / systèmes de mutagénèse / génomique comparative PLAN DU COURS : I- GENOME

Plus en détail

GENETIQUE MEDICALE- Étude de ségrégation, ED génétique moléculaire

GENETIQUE MEDICALE- Étude de ségrégation, ED génétique moléculaire 20/11/2013 GUIMERA Jordan L2 Génétique Médicale C. BEROUD 24 pages Relecteur n 3 Etude de ségrégation, ED génétique moléculaire (haplotype, interprétation des données mutationnelles, notion bio-informatique,

Plus en détail

Chapitre 2 : MEIOSE ET FECONDATION : STABILITE ET BRASSAGE GENETIQUE DE L ESPECE

Chapitre 2 : MEIOSE ET FECONDATION : STABILITE ET BRASSAGE GENETIQUE DE L ESPECE Chapitre 2 : MEIOSE ET FECONDATION : STABILITE ET BRASSAGE GENETIQUE DE L ESPECE Introduction : Tous les individus d une même espèce sont caractérisés par un ensemble de gènes qui sont transmis de génération

Plus en détail

HyDRIMZ. Développement de Techniques et Analyse Moléculaire de la Biodiversité

HyDRIMZ. Développement de Techniques et Analyse Moléculaire de la Biodiversité Développement de Techniques et Analyse Moléculaire de la Biodiversité HyDRIMZ DENITEXPRESS a Influence de faibles concentrations en nanoparticules de CuO sur l expression des gènes de la dénitrification

Plus en détail

Biologie Moléculaire 6 GT SG FWB Leçon n 5

Biologie Moléculaire 6 GT SG FWB Leçon n 5 Biologie Moléculaire 6 GT SG FWB Leçon n 5 Tests de paternité (fin labo électrophorèse) Un test de paternité consiste à analyser l'adn de deux personnes dans le but d'établir un lien de parenté génétique.

Plus en détail

CQP Conduite de procédé de fabrication en biotechnologies

CQP Conduite de procédé de fabrication en biotechnologies CQP Conduite de procédé de fabrication en biotechnologies Page 1 Référentiel de compétences 2 2 Passerelles avec les autres CQP 6 3 Indications sur le référentiel de formation 7 4 - Mise en relation des

Plus en détail

Epigénétique. «pourquoi toutes les cellules d'un organisme ne sont-elles pas identiques» Alors qu elles ont toutes les mêmes gènes.

Epigénétique. «pourquoi toutes les cellules d'un organisme ne sont-elles pas identiques» Alors qu elles ont toutes les mêmes gènes. Epigénétique Introduction «pourquoi toutes les cellules d'un organisme ne sont-elles pas identiques» Alors qu elles ont toutes les mêmes gènes. Deux périodes successives récentes dans l étude des génomes

Plus en détail

L'ADN peut être copié au travers des générations cellulaires successives de manière fidèle, c'est la réplication de l'adn.

L'ADN peut être copié au travers des générations cellulaires successives de manière fidèle, c'est la réplication de l'adn. 24/09/2014 REBOUL Nicolas L2 CR : Hamza BERGUIGUA Génétique Médicale Dr Martin KRAHN 8 pages Introduction à la Génétique Médicale : Les champs de la Génétique Médicale, La place de la Génétique Médicale

Plus en détail

Les biobanques pour les débutants

Les biobanques pour les débutants Les biobanques pour les débutants C Dubourg B Turlin 14 octobre 2010 CHU de Rennes Définition Collection d échantillons biologiques humains Réunion, à des fins scientifiques, de prélèvements biologiques

Plus en détail

BIOLOGIE Durée : 4 heures

BIOLOGIE Durée : 4 heures Concours B ENSA B - 17B BIOLOGIE Durée : 4 heures L usage de la calculatrice, d abaques et de tables est interdit pour cette épreuve. Si, au cours de l épreuve, un candidat repère ce qui lui semble être

Plus en détail

Labo ANALYSE GÉNÉTIQUE DE LA CAPACITÉ DE GOÛTER L AMER.

Labo ANALYSE GÉNÉTIQUE DE LA CAPACITÉ DE GOÛTER L AMER. Labo ANALYSE GÉNÉTIQUE DE LA CAPACITÉ DE GOÛTER L AMER. 1. OBJECTIFS 1.1 Effectuer une analyse d ADN dans le but d établir une relation entre les génotypes et les phénotypes d un caractère héréditaire

Plus en détail

L ADN dans les enquêtes criminelles

L ADN dans les enquêtes criminelles Valise Pédagogique: À la découverte de l ADN Une collaboration entre l Université de Fribourg et le Musée d histoire naturelle de Fribourg L ADN dans les enquêtes criminelles Protocole pour les élèves

Plus en détail

Taq Ozyme (Nouvelle Formulation) ADN polymérase thermostable

Taq Ozyme (Nouvelle Formulation) ADN polymérase thermostable Taq Ozyme (Nouvelle Formulation) OZYA001-1000 - 1000 unités OZYA001-5000 - 5000 unités OZYA001-1000D - 1000 unités + dntp Premix - 4x10 mm Stockage et stabilité : Taq Ozyme : 2 ans à -20 C dntp Premix

Plus en détail

Génie génétique. Définition : Outils nécessaires : Techniques utilisées : Application du génie génétique : - Production de protéines

Génie génétique. Définition : Outils nécessaires : Techniques utilisées : Application du génie génétique : - Production de protéines Génie génétique Définition : Ensemble de méthodes d investigation et d expérimentation sur les gènes. Outils nécessaires : ADN recombinant, enzyme de restriction, vecteur, banque ADNc, sonde nucléique...

Plus en détail

On en vient maintenant au test lui-même.

On en vient maintenant au test lui-même. On en vient maintenant au test lui-même. 6 Avant d envisager la technologie elle-même, quelques mots sur le diagnostic prénatal non invasif qui est réalisé historiquement à partir du sang maternel. On

Plus en détail

Lettres: A, T, G, C. Mots: à 3 lettres (codons) Phrase: gène (information pour synthétiser une protéine). Ponctuation

Lettres: A, T, G, C. Mots: à 3 lettres (codons) Phrase: gène (information pour synthétiser une protéine). Ponctuation 2- Les molécules d ADN constituent le génome 2-1 La séquence d ADN représente l information génétique Lettres: A, T, G, C Mots: à 3 lettres (codons) Phrase: gène (information pour synthétiser une protéine).

Plus en détail

Méthodes diagnostiques en génétique moléculaire

Méthodes diagnostiques en génétique moléculaire Méthodes diagnostiques en génétique moléculaire P. Latour Praticien Hospitalier Responsable UF 3427 Neurogénétique Moléculaire Laboratoire de Neurochimie Pr Renaud HCL Centre de Biologie Est DES Neurologie

Plus en détail

Séquence 3. Comment les informations génétiques se transmettent-elles de cellules en cellules? Nos cellules, filles de la cellule-œuf

Séquence 3. Comment les informations génétiques se transmettent-elles de cellules en cellules? Nos cellules, filles de la cellule-œuf Sommaire Nous sommes en train d étudier le support des informations génétiques 1 au sein de nos cellules. Rapidement après sa formation, la cellule-œuf commence à se multiplier (vu en classe de 4 e ).

Plus en détail

CATALOGUE DE NOS PRESTATIONS

CATALOGUE DE NOS PRESTATIONS CATALOGUE DE NOS PRESTATIONS PRESENTATION DE LA PLATE-FORME... 3 Page 1 sur 17 DEFINITION DE LA PRESTATION... 3 PRESTATIONS PROPOSEES... 3 PREPARATION ADN A PARTIR DE MATERIEL VEGETAL... 3 GENOTYPAGE SNP

Plus en détail

Système d information : Maximiser le retour sur investissement

Système d information : Maximiser le retour sur investissement Améliorer le contrôle interne Système d information : Maximiser le retour sur investissement LAURA FREDERICK, CONSULTANTE EN TI ET GESTION DU CHANGEMENT, ECHANGE, LLC, (MARS 2002) WWW.GLOBALECHANGE.COM

Plus en détail

III. LA CYTOMETRIE DE FLUX III.1. DEFINITION

III. LA CYTOMETRIE DE FLUX III.1. DEFINITION III. LA CYTOMETRIE DE FLUX III.1. DEFINITION La cytométrie en flux décrit une technique d analyse de routine des cellules ou particules biologiques en suspension qui traversent une cellule de mesure les

Plus en détail

Thème 4 Chapitre 1 Activité 2

Thème 4 Chapitre 1 Activité 2 Thème 4 Chapitre 1 Activité 2 EXTRACTION ET ANALYSE DE L HEXOKINASE DE SACCHAROMYCES CEREVISIAE Éléments de réponse ANALYSE DES RÉSULTATS 1.1. Cela permet de faciliter la lyse alcaline de la membrane de

Plus en détail

Biologie Moléculaire & Génie Génétique. 6GT SG&SB FWB A.R. d Esneux Maître de Stage: Sylvie Bossrez Stagiaire: Pierre LECOCQ

Biologie Moléculaire & Génie Génétique. 6GT SG&SB FWB A.R. d Esneux Maître de Stage: Sylvie Bossrez Stagiaire: Pierre LECOCQ Biologie Moléculaire & Génie Génétique 6GT SG&SB FWB A.R. d sneux Maître de Stage: Sylvie Bossrez Stagiaire: Pierre LCOCQ 1 Introduction & Plan du cours N Les leçons proposées dans ce document s adressent

Plus en détail

Approche pratique de la transgénèse :

Approche pratique de la transgénèse : Approche pratique de la transgénèse : Recherche et analyse fine d une modification génétique dans le génome murin octobre 2006 1) 2) 3) 7) 8) 9) 10) 11) 12) 13) 14) Plan / Introduction Extraction et Préparation

Plus en détail

Cahier de texte de la classe 1 ère 4 - SVT

Cahier de texte de la classe 1 ère 4 - SVT Cahier de texte de la classe 1 ère 4 - SVT DATE SEQUENCE lundi 12 : revoir la fiche méthodologique «utiliser le microscope optique» (disponible sur le site du lycée) Lundi 12 1 er contact avec les élèves.

Plus en détail

Dynamique d évolution de la flore microbienne dans les fromages

Dynamique d évolution de la flore microbienne dans les fromages Dynamique d évolution de la flore microbienne dans les fromages Colloque Flores microbiennes d intérêt dans les Procédés Alimentaires et la Santé Christine Achilleos Dijon - 07 / 10 / 2014 Le fromage,

Plus en détail

Pipetez, chargez et observez!

Pipetez, chargez et observez! Ce document propose une activité préparatoire et une activité de prolongement à l activité Pipetez, chargez et observez! proposée aux élèves du 3 e, 4 e et 5 e secondaire en complément de la visite de

Plus en détail

Infrastructures de biologie moléculaire à l ADRAO

Infrastructures de biologie moléculaire à l ADRAO Infrastructures de biologie moléculaire à l ADRAO L A BIOLOGIE moléculaire est généralement considérée comme une science avancée que beaucoup de gens ne s attendent pas à trouver dans une institution basée

Plus en détail

Leçon 1 : Les caractères d un individu Date : Chaque être humain possède de nombreux caractères.

Leçon 1 : Les caractères d un individu Date : Chaque être humain possède de nombreux caractères. Leçon 1 : Les caractères d un individu Date : Chaque être humain possède de nombreux caractères. Certains caractères sont communs à tous les individus de notre espèce et permettent de nous distinguer des

Plus en détail

Comment gérer au mieux ma charge de travail en biologie moléculaire?

Comment gérer au mieux ma charge de travail en biologie moléculaire? Comment gérer au mieux ma charge de travail en biologie moléculaire? Une souplesse d emploi inégalée dans les tests de biologie moléculaire, répondant aux exigences de votre laboratoire Le système VERSANT

Plus en détail

Les méthodes d observation

Les méthodes d observation Les méthodes de biologie cellulaire et moléculaire Les méthodes d observation Cocher la (ou les) proposition(s) vraie(s) 1. Concernant les constituants du microscope photonique : A. La lentille la plus

Plus en détail

Principe du séquençage de l ADN selon la technique de Sanger et Coulson (prix Nobel de Chimie 1980)

Principe du séquençage de l ADN selon la technique de Sanger et Coulson (prix Nobel de Chimie 1980) rincipe du séquençage de l DN selon la technique de Sanger et oulson (prix Nobel de himie 1980) d après ndré OUREU modifié ENF École Nationale de Formation gronomique 3 5 Brin à séquencer, présenté dans

Plus en détail