ESSAIS CLINIQUES EN AFRIQUE: BONNES PRATIQUES

Dimension: px
Commencer à balayer dès la page:

Download "ESSAIS CLINIQUES EN AFRIQUE: BONNES PRATIQUES"

Transcription

1 ESSAIS CLINIQUES EN AFRIQUE: BONNES PRATIQUES Ogobara K. Doumbo, MD, PhD Malaria Research and Training Center Département d Epidémiologie des Affections Parasitaires Faculté de Médecine, de Pharmacie et d Odontostomatologie du Mali Université de Bamako, Mali

2 Les essais cliniques en Afrique doivent répondre aux ICH and FDA requirements ICH are from consensus: US, Europe, Japan, WHO, Canada, Scandinavia Studies realized under ICH/GCP should be accepted in all ICH region for expedite examination of new drug dossiers ICH GCP have been accepted as FDA guidelines. En Afrique l essai clinique implique non seulement le volontaire, mais tout un village+++

3 Malaria = 3 sunami En Afrique par an > 1,000,000 Décès

4 Durant cette présentation, au moins 80 enfants vont mourrir de Plasmodium falciparum malaria en Afrique.

5

6 Enfant africain est en contact avec les antigènes plasmodiaux in utero === Impact sur son Devéloppement immunologique?

7 IMPORTANCE DES DONNÉES NOUVELLES NOUVELLES POSSIBILITÉS DE VACCINS Micro vessel Placenta Adhesion molecules CD36, ICAM-1, E-Selectin, VECAM, PECAM-1/CD31 etc.. Fried & Duffy, 1996, 1998, 2000, 2005 Receptors CSA -Thrombomodulin - Betaglycan Hyaluronic Acid Fc IgG receptor?

8 IMPACT SCOLAIRE DU PALUDISME ET CRÉATIVITÉ DE LA NATION

9 Inexorable, contiguous spread of chloroquine resistance from limited foci suggested rare, complex genetic event required for resistance

10 IMPACT DE LA CHLOROQUINORESISTANCE Décès Malaria Downloaded from: Principles and Practice of Infectious Diseases (on 3 October :45 PM) 2005 Elsevier

11 Dangers de la Résistance à l Artemisinine

12

13 COMPETENCES REQUISES POUR LES EQUIPES AFRICAINES 1] ECRITURE DES PROTOLES D ESSAIS CLINIQUES DE PHASE I, II, III 2] ECRITURE DES SOPs 3] PLANIFICATION ET GESTION DU PROTOCOLE, 4] GESTION DES DONNÉES = RAPPORTS SMC, DSMB, 5] GESTION DES AEs, SAEs.

14 PROTECTION DES VOLONTAIRES PI, SPONSOR, ASSURANCE DE L ETUDE, MONITEUR CLINIQUE LOCAL, MONITEURS INDÉPENDANTS, COMITÉ ÉTHIQUE INDÉPENDANT, PLATEAU TECHNIQUE DE QUALITÉ LOGISTIQUE FONCTIONNELLE, SMC, DSMB GESTION DES DÉCHETS DES ÉTUDES CLNIQUES FLUIDITÉ DE LA COMMUNICATION, FEEDBACK ET TRANSPARENCE

15 Malaria vaccines: History 1920s-1940s Whole parasite vaccines protect canaries, ducks, chickens, turkeys 1960s Irradiated sporozoites protect mice 1970s Irradiated sporozoites protect man (Clyde, et.al. University of Maryland) 1980s Recombinant DNA Heterologous expression systems Viruses, bacteria, yeast transformed with Plasmodia DNA Sub-unit peptide vaccines 1990s DNA, viral vector vaccines 2000s Whole parasite vaccines

16 Sites d Action des vaccins antipaludiques Bloquant la transmission Preérythrocytaire Stades sanguins

17 Cibles Parasitaires des Candidats Vaccins

18 Malaria vaccines: Targets and goals Stage Preerythrocytic Goal Prevent infection in travelers (sterile immunity) Eradicate malaria? Examples Circumsporozoite protein (CSP) Liver stage antigen-1 (LSA-1) TRAP/SPSS LSA-3 Whole, live, attenuated sporozoites Blood stage Sexual stage Prevent disease in African children, pregnant women Improve efficacy of leaky preerythrocytic vaccines Reduce transmission Merozoite surface proteins (MSP-1, 2, 4, 5) Apical membrane antigen-1 (AMA-1) Erythrocyte binding antigens (EBA-175 and others) PfEMP1 Pfs25, others

19 Malaria vaccine attrition ? 80 Number of Projects Total Projects 50 Reached clinical trials 15 Reached field trials 1 Reached phase III

20 The role of vaccines in malaria control/eradication Administer with standard pediatric vaccines Use in combination with other tools: Insecticide-Treated Nets (ITN) Intermittent Preventive Treatment (IPT) Indoor Residual Spraying (IRS) Artemisinin-based Combination Therapy (ACT)

21 RTS,S Mozambique trial A Proof of Concept: a Hope Alonso et al Lancet 366:

22 NIH MIM/TDR/WHO Intramural : MVDB, LMVR CVD Maryland WRAIR Extramural: NIAID/ DMID/ FIC MRTC/DEAP/FMPOS Government of Mali/Uni-Bko/MOH AIEA AUF AMANET Universities: Marseille, Angers, Bordeaux, Lyon, Paris, Oxford, Stokholm, Nijmegen, Tulane, Dakar, Ouagadougou, Abidjan, Conakry, Cotonou, Libreville MALI-TULANE FIC/ITGH CDC Institut Pasteur Pharma: Sanofi- Aventis, GSK, Dafra, Pfizer, Mepha, Bio-Merieux EU grants: BioMalPar network EDCTP USAID

23 IMPORTANCE DE LA SELECTION DES SITES DE TERRAIN 1] VISION A LONG TERME, 2] STABILITÉ POLITIQUE ET COHÉSION SOCIO- CULTURELLE DE LA POPULATION, 3] VALEUR SOCIAL DU SITE POUE LA COMMUNAUTÉ, 4] FACILITÉ PERMISSION COMMUNAUTAIRE, 5] PROCÉDURES ÉTABLIES DE CONCENTEMENT ÉCLAIRÉ 6] ETABLIR UN DIALOGUE ET UNE CONFIANCE MUTUELLE

24 Bandiagara Sotuba Donéguébougou Bancoumana

25 Importance du Partenariat collaboratif

26 IMPORTANCE DE LA FORMATION INITIALE DES EQUIPES CLINIQUES CERTIFICATION EN BONNES PRATIQUES CLINIQUES, CERTIFICATION EN BONNES PRATIQUES DE LABORATOIRE, CERTIFICATION EN ETHIC === STANDARDS ICH

27 QUALITÉ ICH DES SITES ESSAIS CLINIQUES AU MALI

28 Qualité des Capacités de Gestion des SAEs Equipements pour les Urgence, Disponibilité de Kits de prise en charge Disponibilité d Urgentistes Compétents Disponibilité d une possibilité d Evacuation en cas de.

29 Dr Issaka Soulama, Molecular Biologist from Burkina Faso in training at the MRTC

30 IMPORTANCE DE LA CAPACITÉ DE FORMATION CONTINUE DES ÉQUIPES Workshop on analysis of Molecular Biology Data And Data Management From 11 African countries

31 Understanding the Biologic complexity of Malaria Parasite Organism Genome (Mb) HIV 0.01 Polio 0.08 Haemophilus influenzae 1.8 Streptococcus pneumoniae 2.2 Saccharomyces cerevisiae 13 Plasmodium falciparum chromosomes, 5000 genes

32 RTS,S sustained efficacy (Alonso et al., Lancet 2005, Aponte et al., Lancet 2007) Highest antibody titers in younger children Anti-CSP antibodies associated with protection in infants

33 Genetic diversity in leading malaria vaccine antigens Polymorphism Immune selection Overall efficacy Allelerestricted efficacy or vaccine selection Circumsporozoite protein (CSP) % NO Merozoite surface protein-1 (MSP-1) None Maybe Apical membrane antigen-1 (AMA-1) None yet?

34 Dynamics of blood stage antigen diversity at a vaccine testing site in Mali 100 children followed 3y MSP-1 19 genotyped by Pyrosequencing 17 haplotypes among 1,363 infections Frequency distribution similar over time, season, age groups Suggests balancing selection 3D7 vaccine strain prevalence: 16% Takala et. al PLoS Medicine 2007

35 Genetic diversity of blood stage vaccine antigen AMA-1 Vaccine strain FVO Frequency 0% Vaccine strain 3D7 Frequency 3% 201 haplotypes among 450 infections at vaccine trial site in Mali -Takala et al., unpublished

36 AMA-1 diversity in Bandiagara Domain I is most polymorphic 34 non-synonymous SNPs in 462bp As many as 6 possible amino acids at each polymorphic codon Bai, PNAS, 2005 Important T- and B-cell epitopes located in TGTCCAGTATTTGGTAAAGGTATAATTATTGAGAATTCAAA[T/A]ACT[A/T]CTTTTTTAA[C/A] variable regions of gene ACCGGTAGCTACGG[G/A]A[A/G]A[T/A]CAA[T/G]ATTTAAAAGATGGAGGT[T/A]T[T/C]G CTTTTCCTCCAACA[G/A]A[A/T]CCTC[T/C/A]TAT[G/A]TCACCAATGACATTA[G/A/T]AT [G/C][A/G/T][A/T]ATGAGA[C/G][A/G/T]T[T/C][T/C][T/G/A]TATAAA[G/A]ATAA T[A/G]AA[T/G]ATGTAAAAAATTTAGATGAATTGACTTTATGTTCAAGACATGCAGGAAATAT[G/ C]A[T/A]TCCAGAT[A/G]ATGAT[A/G/C]AAAATTCAAATTATAAATATCCAGCTG[T/G]TTAT GAT[G/T]AC[A/G]A[A/T][G/A/T]ATAA[A/T]AAGTGTCATATATTATATATTGCAGCTCAAG AAAATAATGGTCCTAGATATTG[T/G]AATAAAGAC[G/C]AAAGTA[A/T]AAGAAACAGCATGTTT TGTTTTAGACCAGCAAAAGATA[T/A]AT[C/T]ATTT[C/G]AAAACTATACATATTTAAGT

37 AMA-1/AS02A vaccine: Anti-AMA-1 antibody responses in malaria-experienced adults and children in Bandiagara, Mali Phase 2 safety and efficacy trial in progress Thera et al., PLoS ONE 2008

38 IMPORTANCE DE LA COMPREHENSION DES MECHANISMES IMMUNITAIRES NOUVEAUX Myeloid DC (MDC) Plasmacytoid DC (PDC) Main producers of IL-12 Recognize bacteria, viruses and fungi through TLR1-6 APC induce T cell responses after encountering pathogens Main producers of type I IFN Mainly recognize viruses (through TLR7 and 9)

39 IMPACT SUR LA SANTÉ DE LA POPULATION 1] AMELIORATION EN GCP, GLP, ETHIQUE DES EQUIPES LOCALES, 2] FORMATION CONTINUE BY DOING 3] DEVELOPPEMENT DES FACILITÉS DE SOINS DANS LES SITES ET ENVIRONNANTS 4]ACCÈS DE LA POPULATION AUX MEILLEURS SOINS 5] VISIBILITÉ DE L IMPACT SUR L ETAT DE SANTÉ DE LA POPULATION.

40

41

42 POINTS FAIBLES EN AFRIQUE 1] INSUFFISANCE DES SYSTEMES DE REGLEMENTATION ET DE CONTROL DE QUALITÉ L OMS ET D AUTRES PARTENAIRES SONT ENTRAIN DE COMBLER CETTE LACUNE, 2] INSUFFISANCE DE LA COORDINATION ENTRE LES PAYS UTILSATION DES ORGANISATIONS SOUS RÉGIONALES COMME L OOAS, L EPINEUX PROBLEME DE LA CHAINE DE FROID, ARCHIVAGE DES DOSSIERS CLINIQUES?

43 INFORMATISATION: CONNECTIVITÉ EN AFRIQUE 1-NIVEAU CENTRAL 2-INTRANET 3-SITES DE TERRAINS ET PARTENAIRES 4-ACCES AU NTIC 5-GESTION ET PARTAGE DE L INFORMATION SUR LES ESSAIS CLINIQUES == TRANSPARENCE

44 CONNECTIVITÉ AU MRTC ET SITES Satellite 512kbps 128 kbps Koro NIH Hub SITE 512 kbps Bandiagara 75 km Mopti 600 km Bamako 670 km Satellite link Niono 300 km Sotuba Bamako Packet Radio Donéguebougou 32 km Banambani 25 km 60 km Bancoumana 350 km Sikasso

45 EQUIPE CLINIQUE

46 EQUIPE INTERNATIONALE D ESSAI CLINIQUE A BANDIAGARA University of Bamako: Ogobara K. Doumbo Mahamadou A. Thera Dapa A. Diallo Alassane Dicko Issaka Sagara Drissa Coulibaly Abdoulaye Koné Ando Guindo Mohammed B. Niambélé Moussa Sogoba Mounirou Baby Karim Traoré Modibo Daou Issa Diarra Yacouba Cissoko Amagana Dolo Hamar Alassane Traoré University of Maryland: Christopher V. Plowe Kirsten E. Lyke Aric Gregson Karen Kotloff Robert Edelman Linda L. Rosendorf MVDB/NIAID: David Diemert Louis H. Miller DMID/NIAID: Abdi Naficy WRAIR: D. Gray Heppner Christian F. Ockenhouse Kurt Schaecher Kent E. Kester Jeff Lyon Evelina Angov USAID: Carter Diggs Lorraine Soisson GSK: Rip Ballou Amanda Leach Alfred Tiono

Ogobara K. Doumbo, MD, PhD Directeur PER-MRTC/DEAP/FMPOS Université de Bamako,Mali

Ogobara K. Doumbo, MD, PhD Directeur PER-MRTC/DEAP/FMPOS Université de Bamako,Mali Universités d Afrique Francophone et la Connaissance au service du Développement: Le Centre de Formation et de Recherche sur le Paludisme, Univ. Bamako, Mali Ogobara K. Doumbo, MD, PhD Directeur PER-MRTC/DEAP/FMPOS

Plus en détail

Recherche sur le vaccin antipaludique en Afrique : espoirs et défis

Recherche sur le vaccin antipaludique en Afrique : espoirs et défis Recherche sur le vaccin antipaludique en Afrique : espoirs et défis Mahamadou A. THERA &Ogobara K. DOUMBO Malaria Research and Training Center (MRTC)/DEAP/FMPOS ICER-NIAID, PER-AUF, WANETAM, WANECAM, UMI-CNRS

Plus en détail

How and What are the Conditions to Develop Best Science and Best Practices in Africa?

How and What are the Conditions to Develop Best Science and Best Practices in Africa? How and What are the Conditions to Develop Best Science and Best Practices in Africa? Ogobara K. Doumbo, MD, PhD Malaria Research and Training Center Département d Epidémiologie des Affections Parasitaires

Plus en détail

Développement Clinique de Candidats Vaccins Antimalariques au Mali

Développement Clinique de Candidats Vaccins Antimalariques au Mali Développement Clinique de Candidats Vaccins Antimalariques au Mali Ogobara K. Doumbo, MD, PhD Malaria Research and Training Center (MRTC)/DEAP/FMPOS International Center of Excellence in clinical Research-USTTB-NIAID/NIH

Plus en détail

CONTRIBUTION DU MALI AUX PROGRAMMES DE DÉVELOPPEMENT DE VACCINS ANTI-PALUDIQUES.

CONTRIBUTION DU MALI AUX PROGRAMMES DE DÉVELOPPEMENT DE VACCINS ANTI-PALUDIQUES. CONTRIBUTION DU MALI AUX PROGRAMMES DE DÉVELOPPEMENT DE VACCINS ANTI-PALUDIQUES. M.A. THERA, A.A. DICKO, I. SAGARA & O.K. DOUMBO Malaria Research and Training Center, FMPOS, Université de Bamako, Mali

Plus en détail

Frederic.ariey@pasteur.fr

Frederic.ariey@pasteur.fr RECHERCHE, MISE EN OEUVRE DES PROGRAMMES DE SANTE ET POLITIQUES PUBLIQUES : ENRICHISSEMENTS RECIPROQUES POUR ACCROITRE L IMPACT SUR LA SANTE DES POPULATIONS JEUDI 2 JUILLET 2015 Contrôler et prévenir les

Plus en détail

Et le vaccin antipaludique?

Et le vaccin antipaludique? Et le vaccin antipaludique? Jean-Louis Pérignon Unité de Parasitologie Biomédicale Pierre Druilhe Institut Pasteur, Paris ReMeD Paris, 3 novembre 2008 Un (des) vaccin(s) contre le paludisme? - Différentes

Plus en détail

56 ème Journée de l Hôpital Claude Bernard Paludisme grave : de la physiopathologie aux nouveautés thérapeutiques

56 ème Journée de l Hôpital Claude Bernard Paludisme grave : de la physiopathologie aux nouveautés thérapeutiques 56 ème Journée de l Hôpital Claude Bernard Paludisme grave : de la physiopathologie aux nouveautés thérapeutiques Sandrine Houzé, Laboratoire de parasitologie - CNR paludisme HUPNVS Hôpital Bichat-Claude

Plus en détail

Forces et Faiblesses de la recherche à Marseille

Forces et Faiblesses de la recherche à Marseille Forces et Faiblesses de la recherche à Marseille Michel Drancourt / Jean-Louis Mège URMITE CNRS UMR 6236, IRD198 1 Bilan, recherche Classification of the first 10 European cities : publications in ID&TM

Plus en détail

Hepatitis and pregnancy

Hepatitis and pregnancy Hepatitis and pregnancy GFMER Yaoundé 26 November 2007 José M Bengoa MD Geneva - Switzerland Maladie hépatique et grossesse: trois relations étiologiques maladie hépatique induite par la grossesse nouvelle

Plus en détail

Paludisme pendant la grossesse : conséquences et prévention

Paludisme pendant la grossesse : conséquences et prévention Paludisme pendant la grossesse : conséquences et prévention Michel COT IRD/UPD, Mère et enfant face aux infections tropicales (UMR 216) CEMI 18 15 mars 2013 Institut Pasteur Paludisme et grossesse Premières

Plus en détail

MASSE CRITIQUE, DEVELOPPEMENT RESPONSABLE EN MATIERE DE SANTE ET COOPERATION INTERNATIONALE.

MASSE CRITIQUE, DEVELOPPEMENT RESPONSABLE EN MATIERE DE SANTE ET COOPERATION INTERNATIONALE. MASSE CRITIQUE, DEVELOPPEMENT RESPONSABLE EN MATIERE DE SANTE ET COOPERATION INTERNATIONALE. Experience Malienne dans le domaine du paludisme et la Medicalisation des Zones Rurales Ogobara K. Doumbo, USTTB,

Plus en détail

Thèse de Pharmacie : Immunogénicité du candidat vaccin antipaludique AMA1-C1/Alhydrogel

Thèse de Pharmacie : Immunogénicité du candidat vaccin antipaludique AMA1-C1/Alhydrogel Ministère de l Education Nationale République du Mali Un Peuple Un But Une Foi **************** UNIVERSITE DE BAMAKO *************** FACULTE DE MEDECINE DE PHARMACIE ET D ODONTO-STOMATOLOGIE Année Universitaire

Plus en détail

Paludisme 2005. Recommandations nationales Laos, Vietnam, Cambodge

Paludisme 2005. Recommandations nationales Laos, Vietnam, Cambodge Paludisme 2005 Recommandations nationales Laos, Vietnam, Cambodge NH.Tuan IFMT Séminaire du paludisme Déc. 2005 1 Laos National Policy for Malaria Diagnosis and Treatment 1. Use Guidelines for diagnosis

Plus en détail

Partenariat public privé : comment maîtriser les conflits d intérêts?

Partenariat public privé : comment maîtriser les conflits d intérêts? Partenariat public privé : comment maîtriser les conflits d intérêts? Vincent Mooser Vice-Doyen Recherche Clinique FBM Chef Département des Laboratoires 5 février 2015 Essais cliniques sponsorisés par

Plus en détail

WHAT IS CURRENT PRACTICE OF FASO? PHARMACOVIGILANCE IN BURKINA. Dr Kiema Bérenger. MOH/Burkina Faso. Chef Service Logistique, Approvisionnement

WHAT IS CURRENT PRACTICE OF FASO? PHARMACOVIGILANCE IN BURKINA. Dr Kiema Bérenger. MOH/Burkina Faso. Chef Service Logistique, Approvisionnement WHAT IS CURRENT PRACTICE OF PHARMACOVIGILANCE IN BURKINA FASO? Dr Kiema Bérenger Chef Service Logistique, Approvisionnement et Maintenance PEV_Burkina Direction de la Prévention par la Vaccination MOH/Burkina

Plus en détail

Epidémie de la Maladie à virus Ebola en Afrique de l Ouest : Leçons apprises et perspectives

Epidémie de la Maladie à virus Ebola en Afrique de l Ouest : Leçons apprises et perspectives Epidémie de la Maladie à virus Ebola en Afrique de l Ouest : Leçons apprises et perspectives Training on the prevention and management of public health events in the aviation sector (Dakar, Senegal, 9-13

Plus en détail

1 Développement d un vaccin pédiatrique. 2 Efficacité et sécurité de la prophylaxie de. 3 Réseau africano-européen de

1 Développement d un vaccin pédiatrique. 2 Efficacité et sécurité de la prophylaxie de. 3 Réseau africano-européen de E D C T P Rapport annuel 2008 Financement de bourses 2003-2008 L EDCTP finance des essais cliniques de phase II et III sur le VIH/SIDA, la tuberculose et le paludisme en Afrique subsaharienne. De plus,

Plus en détail

La réglementation européenne pour les médicaments orphelins. De Europese regelgeving voor weesgeneesmiddelen.

La réglementation européenne pour les médicaments orphelins. De Europese regelgeving voor weesgeneesmiddelen. (AFMPS) La réglementation européenne pour les médicaments orphelins. De Europese regelgeving voor weesgeneesmiddelen. Dr. André LHOIR AFMPS - COMP 22 février 2011 1 141/2000: Rare conditions Orphan drugs

Plus en détail

Le renforcement des capacités, une priorité de la recherche clinique?

Le renforcement des capacités, une priorité de la recherche clinique? Le renforcement des capacités, une priorité de la recherche clinique? Michel COT IRD/UPD, Mère et enfant face aux infections tropicales (UMR 216) Qu est-ce que le renforcement des capacités (ou «capacity

Plus en détail

Contrôle de la Peste porcine Classique à Hispaniola & Surveillance en Jamaique, Belize et Bahamas

Contrôle de la Peste porcine Classique à Hispaniola & Surveillance en Jamaique, Belize et Bahamas Endémie Contrôle Contrôle de la Peste porcine Classique à Hispaniola & en Jamaique, Belize et Bahamas Belize 1996 Réunion de fin de projet, République Dominicaine 1-5 mars 2004 Stratégie Conduire un programme

Plus en détail

Mécanismes moléculaires de la chimio- résistancede Plasmodium falciparumet nouvelles stratégies thérapeutiques

Mécanismes moléculaires de la chimio- résistancede Plasmodium falciparumet nouvelles stratégies thérapeutiques Mécanismes moléculaires de la chimio- résistancede Plasmodium falciparumet nouvelles stratégies thérapeutiques Abdoulaye Djimdé Pharmacien Microbiologiste Université de Bamako, Mali DHFR & DHPS 2 Molecular

Plus en détail

Early diagnosis of failure to treatment in resource limited countries

Early diagnosis of failure to treatment in resource limited countries Moving Forward in the Diagnosis of Infectious Diseases in Resource Limited Countries: A Focus on HIV 3rd Forum Les Pensières, Veyrier-du-Lac, France, September 16-17, 2010 Early diagnosis of failure to

Plus en détail

ANRS-FUNDED RESEARCH IN THE DEVELOPING WORLD

ANRS-FUNDED RESEARCH IN THE DEVELOPING WORLD ANRS-FUNDED RESEARCH IN THE DEVELOPING WORLD Brazil Burkina Faso (Bobo Dioulasso) Cambodia (Phnom Penh) Cameroon (Yaounde) Côte d Ivoire (Abidjan) Senegal (Dakar) Vietnam (Ho Chi Minh City) South Africa,

Plus en détail

Professeur Cheikh Saad-Bouh Boye

Professeur Cheikh Saad-Bouh Boye Professeur Cheikh Saad-Bouh Boye Recteur de l'université de THIES / Senegal depuis Octobre 2010 Doyen de la Faculté de Medecine, Pharmacie et d Odontologie de l UCAD de Dakar de Decembre 2006 a Octobre

Plus en détail

CHIMERE - Mother-to-Child Chikungunya virus infection: an ambispective cohort study

CHIMERE - Mother-to-Child Chikungunya virus infection: an ambispective cohort study CHIMERE - Mother-to-Child Chikungunya virus infection: an ambispective cohort study Responsable(s) : Gérardin Patrick, Centre d'investigation Clinique (CIC 1410) - ex Centre d'investigation Clinique -

Plus en détail

Présentation de la Boîte à Outiles du IOMC pour la Prise de Décisions sur la Gestion de produits Chimiques

Présentation de la Boîte à Outiles du IOMC pour la Prise de Décisions sur la Gestion de produits Chimiques Le projet est Présentation de la Boîte à Outiles du IOMC pour la Prise de Décisions sur la Gestion de produits Chimiques Mars 2015 Programme inter-organisations pour la gestion rationnelle des produits

Plus en détail

Quantifier l impact météorologique & climatique sur la santé dans les pays en voie de développement

Quantifier l impact météorologique & climatique sur la santé dans les pays en voie de développement Quantifying Weather & Climate Impacts on health in developing countries Quantifier l impact météorologique & climatique sur la santé dans les pays en voie de développement Photos: QWeCI photo archives

Plus en détail

Université des Sciences, des Techniques et des Technologies de Bamako. Faculté de Pharmacie (FAPH) Année universitaire 2012 2013.

Université des Sciences, des Techniques et des Technologies de Bamako. Faculté de Pharmacie (FAPH) Année universitaire 2012 2013. Ministère de l Enseignement Supérieur et de la Recherche REPUBLIQUE DU MALI Un Peuple Un But Une Foi Scientifique Université des Sciences, des Techniques et des Technologies de Bamako Faculté de Pharmacie

Plus en détail

Un réseau de recherche pour les entreprises dans le domaine de la santé animale

Un réseau de recherche pour les entreprises dans le domaine de la santé animale Un réseau de recherche pour les entreprises dans le domaine de la santé animale Santé : définitions Santé Health is a state of complete physical, mental and social well being and not merely the absence

Plus en détail

IRPP Session 6- Case Studies and Lessons from Abroad

IRPP Session 6- Case Studies and Lessons from Abroad IRPP Session 6- Case Studies and Lessons from Abroad Integration of services for frail elderly- SIPA and PRISMA projects and after Céline Bureau, M.Sc.Inf. (cbureau.csss-iugs@msss.gouv.qc.ca) CSSS-IUG

Plus en détail

PALUDISME PENDANT LA GROSSESSE EN AFRIQUE

PALUDISME PENDANT LA GROSSESSE EN AFRIQUE PALUDISME PENDANT LA GROSSESSE EN AFRIQUE SUBSAHARIENNE: INFLUENCE DU CALENDRIER D ADMINISTRATION DU TRAITEMENT PRÉVENTIF INTERMITTENT BICH-TRAM HUYNH, MD PHD ACADÉMIE NATIONALE DE PHARMACIE, 4 DÉCEMBRE

Plus en détail

LES GROSSESSES DANS LES ESSAIS BIOMÉDICAUX «2 LADY/MOBIDIP»

LES GROSSESSES DANS LES ESSAIS BIOMÉDICAUX «2 LADY/MOBIDIP» LES GROSSESSES DANS LES ESSAIS BIOMÉDICAUX «2 LADY/MOBIDIP» Alexandra Serris Interne en médecine interne INTRODUCTION : LES ESSAIS BIOMÉDICAUX EN AFRIQUE SUB-SAHARIENNE De plus en plus nombreux La majorité

Plus en détail

Transfert des expérimentales et innovantes méthodes d enseignement pour l education de management

Transfert des expérimentales et innovantes méthodes d enseignement pour l education de management l education de management 2010-1-PL1-LEO01-11462 1 Information sur le projet Titre: Code Projet: Année: 2010 Type de Projet: Statut: Accroche marketing: Résumé: Transfert des expérimentales et innovantes

Plus en détail

Decorative Fountain Linked to Legionnaires' Disease Outbreak

Decorative Fountain Linked to Legionnaires' Disease Outbreak 01/10/2012 Decorative Fountain Linked to Legionnaires' Disease Outbreak A 2010 outbreak of Legionnaires' disease in Wisconsin has been linked to a decorative fountain in a hospital lobby, according to

Plus en détail

Indicateurs harmonisés TB/VIH et données rapportées à l OMS par les pays d Afrique francophone

Indicateurs harmonisés TB/VIH et données rapportées à l OMS par les pays d Afrique francophone Atelier TB/VIH Afrique Francophone Lomé, Togo, January 25-27 2012 Indicateurs harmonisés TB/VIH et données rapportées à l OMS par les pays d Afrique francophone Henriette Wembanyama Delphine Sculier Organisation

Plus en détail

Master in biochemistry and molecular and cellular biology (BBMC) Prof. Thierry Arnould.

Master in biochemistry and molecular and cellular biology (BBMC) Prof. Thierry Arnould. Master in biochemistry and molecular and cellular biology (BBMC) Prof. Thierry Arnould thierry.arnould@unamur.be : our strengths -Master1 -Master2 Ø Theoritical education: - A large panel of courses to

Plus en détail

Synthèse sur la résistance aux antipaludiques

Synthèse sur la résistance aux antipaludiques Synthèse sur la résistance aux antipaludiques Dr P. Ringwald Global Malaria Programme 1 Résistance aux médicaments antipaludiques Aptitude d une souche de parasite du paludisme à survivre ou à se reproduire

Plus en détail

Le plus important concernant les voyages

Le plus important concernant les voyages Le plus important concernant les voyages Liens d intérêt : voyages /congrès offerts par l industrie Le voyageur : une vraie sentinelle épidémiologique Parashar D., Cherian S. Antiviral perspectives for

Plus en détail

refine initiative Conference 2011 Radisson Blu Centrum Hotel - WARSAW 04 / 05 October 2011

refine initiative Conference 2011 Radisson Blu Centrum Hotel - WARSAW 04 / 05 October 2011 Conference 2011 Conference under the patronage of the Polish National Contact Point for Research Programmes of the EU Supported by: Let s Construct Europe s Future With Innovative Buildings and Infrastructures

Plus en détail

L OOAS Organisation sous-régionale

L OOAS Organisation sous-régionale Table Ronde REMED Paris, 12 Novembre 2007 L OOAS Organisation sous-régionale d Intégration Prof Diallo Abdoulaye Professional Officer / OOAS Organisation Ouest Africaine de la Sant anté Organiza rganizaçao

Plus en détail

INFORMATIONS GÉNÉRALES SUR LE RWANDA

INFORMATIONS GÉNÉRALES SUR LE RWANDA INFORMATIONS GÉNÉRALES SUR LE RWANDA Population 11.2 millions; taux de croissance 2.6% (recensement 2012) Superficie: 26,338 Km 2 44.9% de la population vit sous le seuil de la pauvreté (EICV 2011) 83%

Plus en détail

Les tests de diagnostic rapide (TDR) pour la grippe : Pourquoi? Comment? Quand?

Les tests de diagnostic rapide (TDR) pour la grippe : Pourquoi? Comment? Quand? Les tests de diagnostic rapide (TDR) pour la grippe : Pourquoi? Comment? Quand? Dr. Ilka Engelmann Laboratoire de Virologie, Pôle Biologie Pathologie Génétique, CHRU de Lille EA3610, Université Lille 2

Plus en détail

Retour sur investissement des vaccins antipaludiques : évaluations préliminaires de l impact sur la santé publique en Afrique

Retour sur investissement des vaccins antipaludiques : évaluations préliminaires de l impact sur la santé publique en Afrique Résumé d orientation : Cadre national pour la prise de décisions concernant les vaccins antipaludiques Retour sur investissement des vaccins antipaludiques : évaluations préliminaires de l impact sur la

Plus en détail

IMMUNOLOGIE. La spécificité des immunoglobulines et des récepteurs T. Informations scientifiques

IMMUNOLOGIE. La spécificité des immunoglobulines et des récepteurs T. Informations scientifiques IMMUNOLOGIE La spécificité des immunoglobulines et des récepteurs T Informations scientifiques L infection par le VIH entraîne des réactions immunitaires de l organisme qui se traduisent par la production

Plus en détail

AUTORISATION PARENTALE SAISON 2012-2013

AUTORISATION PARENTALE SAISON 2012-2013 AUTORISATION PARENTALE SAISON 2012-2013 Je soussigné(e)., père, mère, tuteur légal, de... Autorise les membres responsables de l encadrement à appeler tout médecin responsable, le cas échéant, à faire

Plus en détail

Clinical Trials Regulation

Clinical Trials Regulation Clinical Trials Regulation National Implementation Cécile Delval Director of Evaluation Division French Medicines Agency (ANSM) France Ministry of Health ANSM Competent Authority Ethics Committee (EC)

Plus en détail

Les systèmes CDMS. et les logiciels EDC

Les systèmes CDMS. et les logiciels EDC Les systèmes CDMS et les logiciels EDC Khaled Mostaguir, Ph.D, khaled.mostaguir@hcuge.ch Centre de Recherche Clinique HUG http://crc.hug-ge.ch/ Les systèmes CDMS et les logiciels EDC Les systèmes CDMS

Plus en détail

Singapore Schools Green Mark Scheme on Indoor Air Quality

Singapore Schools Green Mark Scheme on Indoor Air Quality Singapore Schools Green Mark Scheme on Indoor Air Quality Teo Ai Lin, Evelyn (Dr) Associate Professor Department of Building National University of Singapore BCA Green Mark (version 4.0) 2007 Version

Plus en détail

Le portage nasal à Staphylococcus aureus :

Le portage nasal à Staphylococcus aureus : Le portage nasal à Staphylococcus aureus : déterminants bactériens et déterminants d hôte Anne Tristan Centre de Biologie et de Pathologie Est CNR des staphylocoques LYON A. Histoire naturelle de la contamination

Plus en détail

Collaborations internationales

Collaborations internationales Collaborations internationales Principes directeurs Hypothèses de recherche nécessitant l inclusion d un nombre de patients tel que ces questions ne peuvent être explorées au sein de chaque cohorte participante

Plus en détail

La recherche clinique au cœur du progrès thérapeutique

La recherche clinique au cœur du progrès thérapeutique 2 èmes Assises de l Innovation Thérapeutique Paris, 05-11-2014 La recherche clinique au cœur du progrès thérapeutique Pr. Jean-François DHAINAUT Président du Groupement Inter-régional de la Recherche Clinique

Plus en détail

ICC International Court of Arbitration Bulletin. Cour internationale d arbitrage de la CCI

ICC International Court of Arbitration Bulletin. Cour internationale d arbitrage de la CCI ICC International Court of Arbitration Bulletin Cour internationale d arbitrage de la CCI Extract for restricted use Extrait à tirage limité International Court of Arbitration 38, Cours Albert 1er, 75008

Plus en détail

SE/05/C/F/TH-82601. http://www.adam-europe.eu/adam/project/view.htm?prj=3295

SE/05/C/F/TH-82601. http://www.adam-europe.eu/adam/project/view.htm?prj=3295 (EuroguideVAL) SE/05/C/F/TH-82601 1 Information sur le projet Implementing the Common European Principles through Improved Guidance and Titre: Implementing the Common European Principles through Improved

Plus en détail

Logiciels pour l'industrie pharmaceutique

Logiciels pour l'industrie pharmaceutique CIS Valley Logiciels pour l'industrie pharmaceutique La gamme Pharma Valley The PHARMA Valley range L'industrie pharmaceutique est confrontée à un enjeu stratégique majeur : les exigences toujours plus

Plus en détail

Les Biotherapies Généralités Pr François LEMOINE

Les Biotherapies Généralités Pr François LEMOINE Les Biotherapies Généralités Pr François LEMOINE Laboratory I 3 of Immunology-Immunopahtology- Immunotherapy CNRS-UMR7211 / INSERM U959 Hôpital de la Pitié Salpêtrière - CERVI 83, Boulevard de l Hôpital

Plus en détail

SC 27/WG 5 Normes Privacy

SC 27/WG 5 Normes Privacy SC 27/WG 5 Normes Privacy Club 27001 Toulousain 12/12/2014 Lionel VODZISLAWSKY Chief Information Officer l.vodzislawsky@celtipharm.com PRE-CTPM 141212-Club27001 Toulouse normes WG5_LV L organisation de

Plus en détail

Valorisation des résultats de la recherche publique Solutions mises en œuvre en région PACA

Valorisation des résultats de la recherche publique Solutions mises en œuvre en région PACA Valorisation des résultats de la recherche publique Solutions mises en œuvre en région PACA Olivier FRENEAUX PROTISVALOR Méditerranée www.protisvalor.com Valorpaca www.valorpaca.fr Valoriser : Pourquoi?

Plus en détail

Evolution de l introduction des statines chez les diabétiques âgés au Québec entre 2000 et 2008

Evolution de l introduction des statines chez les diabétiques âgés au Québec entre 2000 et 2008 Evolution de l introduction des statines chez les diabétiques âgés au Québec entre 2000 et 2008 ML Laroche 1, E Demers 2, MC Breton 2, JP Gregoire 2, J Moisan 2 1- EA 6310 HAVAE, Université, Limoges, France

Plus en détail

Présentation d EUPATI

Présentation d EUPATI The project is supported by the Innovative Medicines Initiative Joint Undertaking under grant agreement n 115334, resources of which are composed of financial contribution from the European Union's Seventh

Plus en détail

Jean-François Corté Secretary General World Road Association

Jean-François Corté Secretary General World Road Association International Congress «Building Road Safety Capacity» October 2013 - Warsaw Jean-François Corté Secretary General World Road Association 1 At the turn of the XXth century 2 Looking for speed!!! 3 Camille

Plus en détail

Enhancing cybersecurity in LDCs thru multi-stakeholder networking and free software

Enhancing cybersecurity in LDCs thru multi-stakeholder networking and free software WSIS cluster action line C5 22-23 may 2008 Pierre OUEDRAOGO, Institut de la Francophonie Numérique (IFN) pierre.ouedraogo@francophonie.org Enhancing cybersecurity in LDCs thru multi-stakeholder networking

Plus en détail

Les Maladies Tropicales, la Société de Pathologie Exotique. et l Institut Pasteur

Les Maladies Tropicales, la Société de Pathologie Exotique. et l Institut Pasteur Les Maladies Tropicales, la Société de Pathologie Exotique et l Institut Pasteur Un partenariat qui a bien plus de 100 ans Beaucoup des grands noms de la recherche française sur les maladies tropicales

Plus en détail

MASTER (LMD) - USTH BIOTECHNOLOGIE MÉDICALE- BIOTECHNOLOGIE VÉGÉTALE-PHARMACOLOGIE

MASTER (LMD) - USTH BIOTECHNOLOGIE MÉDICALE- BIOTECHNOLOGIE VÉGÉTALE-PHARMACOLOGIE MASTER (LMD) - USTH BIOTECHNOLOGIE MÉDICALE- BIOTECHNOLOGIE VÉGÉTALE-PHARMACOLOGIE RÉSUMÉ DE LA FORMATION Type de diplôme : Master (LMD) Domaine ministériel : Sciences, Technologies, Santé Objectifs Acquisition

Plus en détail

Exemple PLS avec SAS

Exemple PLS avec SAS Exemple PLS avec SAS This example, from Umetrics (1995), demonstrates different ways to examine a PLS model. The data come from the field of drug discovery. New drugs are developed from chemicals that

Plus en détail

Editing and managing Systems engineering processes at Snecma

Editing and managing Systems engineering processes at Snecma Editing and managing Systems engineering processes at Snecma Atego workshop 2014-04-03 Ce document et les informations qu il contient sont la propriété de Ils ne doivent pas être copiés ni communiqués

Plus en détail

Appendix 1 Wording of Noumea Accord and 1999 Organic Law on Restricted Electorates

Appendix 1 Wording of Noumea Accord and 1999 Organic Law on Restricted Electorates Appendix 1 Wording of Noumea Accord and 1999 Organic Law on Restricted Electorates Relating to local (provincial and Congress) elections Article 2.2.1 of the Noumea Accord: le corps électoral aux assemblées

Plus en détail

CONTINUING EDUCATION AND TRAINING IN PHYSIOTHERAPY

CONTINUING EDUCATION AND TRAINING IN PHYSIOTHERAPY CONTINUING EDUCATION AND TRAINING IN PHYSIOTHERAPY 1 day (7 hours) Motor control and ankle joint protection Update on scientific knowledge and practical consequences for physiotherapists Pascal TOSCHI,

Plus en détail

Consensus Scientifique sur le. Paludisme. Etat de la maladie

Consensus Scientifique sur le. Paludisme. Etat de la maladie page 1/7 Consensus Scientifique sur le Paludisme Etat de la maladie Source : OMS (2008) Résumé & Détails: GreenFacts Contexte - Le paludisme est l une des maladies infectieuses les plus fréquentes. Il

Plus en détail

Haute Autorité de santé COMMISSION DE LA TRANSPARENCE

Haute Autorité de santé COMMISSION DE LA TRANSPARENCE Haute Autorité de santé COMMISSION DE LA TRANSPARENCE AVIS 13 avril 2005 Suite à la demande du ministre chargé de la santé et de la sécurité sociale, la Commission réexamine les spécialités suivantes :

Plus en détail

Journal de la Société Ouest-Africaine de Chimie. 17 ème Année, Juin 2012, N 033. J. Soc. Ouest-Afr. Chim. Site Web: http://www.soachim.

Journal de la Société Ouest-Africaine de Chimie. 17 ème Année, Juin 2012, N 033. J. Soc. Ouest-Afr. Chim. Site Web: http://www.soachim. Journal de la Société Ouest-Africaine de Chimie J. Soc. Ouest-Afr. Chim. Code Chemical Abstracts : JSOCF2 Cote INIST (CNRS France) : ISSN 0796-6687 17 ème Année, Juin 2012, N 033 Site Web: http://www.soachim.org

Plus en détail

Atelier Essais cliniques dans les projets santé Horizon 2020

Atelier Essais cliniques dans les projets santé Horizon 2020 Nacer Boubenna, PhD Chargé de mission Europe au siège de l Inserm Coordinateur du Point de contact national santé Atelier Essais cliniques dans les projets santé Horizon 2020 Paris 6 juin 204 Définitions

Plus en détail

BABEL MED MUSIC 24 > 26 MARS MARCH 2011 CANDIDATURES ARTISTES ARTIST S APPLICATION FORM FORUM DES MUSIQUES DU MONDE / WORLD MUSIC FORUM

BABEL MED MUSIC 24 > 26 MARS MARCH 2011 CANDIDATURES ARTISTES ARTIST S APPLICATION FORM FORUM DES MUSIQUES DU MONDE / WORLD MUSIC FORUM BABEL MED MUSIC FORUM DES MUSIQUES DU MONDE / WORLD MUSIC FORUM 24 > 26 MARS MARCH 2011 CANDIDATURES ARTISTES ARTIST S APPLICATION FORM CANDIDATURES ARTISTES / ARTIST S APPLICATION FORM DATE LIMITE DE

Plus en détail

THE SYMPOSIUM FROM CRCHUM ON HIV AND AGING. 29 avril, 2016/April 29, 2016 PROGRAMME. Organisatrice/Organiser : Dre Cécile Tremblay

THE SYMPOSIUM FROM CRCHUM ON HIV AND AGING. 29 avril, 2016/April 29, 2016 PROGRAMME. Organisatrice/Organiser : Dre Cécile Tremblay LE SYMPOSIUM DU CRCHUM SUR LE VIH ET VIEILLISSEMENT THE SYMPOSIUM FROM CRCHUM ON HIV AND AGING 29 avril, 2016/April 29, 2016 CENTRE DE RECHERCHE DU CHUM 900, rue Saint-Denis, Pavillon R, Auditorium, 5

Plus en détail

THE OUAGADOUGOU RECOMMENDATIONS INTERNET INFRASTRUCTURE FOR AN AFRICAN DIGITAL ECONOMY 5-7 MARCH 2012

THE OUAGADOUGOU RECOMMENDATIONS INTERNET INFRASTRUCTURE FOR AN AFRICAN DIGITAL ECONOMY 5-7 MARCH 2012 THE OUAGADOUGOU RECOMMENDATIONS INTERNET INFRASTRUCTURE FOR AN AFRICAN DIGITAL ECONOMY 5-7 MARCH 2012 We, the participants, assembled in Ouagadougou, Burkina Faso, from 5-7 March 2012, for the meeting

Plus en détail

Est-il (toujours) attractif de réaliser la recherche clinique en Suisse?

Est-il (toujours) attractif de réaliser la recherche clinique en Suisse? EBM Oct 20, 11 Kopfzeile Est-il (toujours) attractif de réaliser la recherche clinique en Suisse? Berne, 29.01.2014 Prof. Pierre Dayer, président du SCTO Constat Il est coutumier d entendre que la recherche

Plus en détail

Apprêtement et présentation de l antigène

Apprêtement et présentation de l antigène pprêtement et présentation de l antigène pprêtement et présentation de l antigène Phagocytose par les PMN Captation des antigènes : cellules phagocytaires, Notions de cellule présentant l antigène (CP).

Plus en détail

236. 2. 7 mai. 9 mai. Final paper. Final paper dû le 12 Mai

236. 2. 7 mai. 9 mai. Final paper. Final paper dû le 12 Mai 236. 2 17ème 5 mai 7 mai 9 mai dû le 12 Mai objectifs pp.76 78 pp.78 7Turn in p. 83. I L Europe pp. 80 81 8ème 3 mars 5 mars 7 mars Révision Examen 2 La famille pp. 134 137 9ème 10 mars 12 mars 14 mars

Plus en détail

Stratégie pour une riposte accélérée à l épidémie de maladie à virus Ébola en Afrique de l Ouest. Juillet-Décembre 2014

Stratégie pour une riposte accélérée à l épidémie de maladie à virus Ébola en Afrique de l Ouest. Juillet-Décembre 2014 Stratégie pour une riposte accélérée à l épidémie de maladie à virus Ébola en Afrique de l Ouest Juillet-Décembre 2014 1 1. Introduction Le 21 mars 2014, le ministère de la Santé de la République de Guinée

Plus en détail

+ La génomique et ses applications Quel usage et quel usager? Jorge Niosi (UQAM) Bryn Williams-Jones (UdeM)

+ La génomique et ses applications Quel usage et quel usager? Jorge Niosi (UQAM) Bryn Williams-Jones (UdeM) + La génomique et ses applications Quel usage et quel usager? Jorge Niosi (UQAM) Bryn Williams-Jones (UdeM) + La «génomique» 2 Le terme est apparu dans les années 1980 pour décrire l étude du génome entier

Plus en détail

OBJECTIFS 2015-2016 DU ROTARY INTERNATIONAL

OBJECTIFS 2015-2016 DU ROTARY INTERNATIONAL 1 OBJECTIFS 2015-2016 DU ROTARY INTERNATIONAL 2 OBJECTIFS 2015-2016 RI / RI s OBJECTIVES 2015-2016 Pour l année 2015-2016, le Président Ravi a choisi des objectifs dont les résultats sont mesurables par

Plus en détail

TOut DES or Not to des... Moi Congrès de Cardiologie Franco-Libanais 2005

TOut DES or Not to des... Moi Congrès de Cardiologie Franco-Libanais 2005 TOut DES or Not to des... Moi Congrès de Cardiologie Franco-Libanais 2005 Tout DES or not tout Des Historique & Illustration Arguments (1), (2) et (3) Statistiques et illustrations Un peu d Histoire...

Plus en détail

Marie DARRASON. Curriculum vitae. 11 rue Tournefort 75005 PARIS marie.darrason@gmail.com 06.77.52.19.17.

Marie DARRASON. Curriculum vitae. 11 rue Tournefort 75005 PARIS marie.darrason@gmail.com 06.77.52.19.17. Marie DARRASON Curriculum vitae Etat civil et coordonnées Née le 24/03/1987 (28 ans) 11 rue Tournefort 75005 PARIS marie.darrason@gmail.com 06.77.52.19.17. Titre de la thèse «Y a- t- il une théorie génétique

Plus en détail

BULLETIN D INFORMATION DU CERMES

BULLETIN D INFORMATION DU CERMES BULLETIN D INFORMATION DU CERMES Centre de Recherche Médicale et Sanitaire N 02 Janvier 2015 SOMMAIRE Editorial P 1 Recherche P 2 Projet FARSIT Santé Publique P 3 CERMES dans la lutte contre la Maladie

Plus en détail

Masters en santé publique en Afrique de l Ouest

Masters en santé publique en Afrique de l Ouest Masters en santé publique en Afrique de l Ouest Expériences du Mali et du Burkina Faso J. Testa, MS Traoré, S Konaté, S Doumbia, A Dicko, H Sangho, A Ag Iknane, S Diop, N. Méda Le Master en santé publique

Plus en détail

THE BOARD OF HEATLH REFERRED THE FOLLOWING REPORT RECOMMENDATIONS TO CITY COUNCIL:

THE BOARD OF HEATLH REFERRED THE FOLLOWING REPORT RECOMMENDATIONS TO CITY COUNCIL: 1 2. APPOINTMENT OF ASSOCIATE MEDICAL OFFICERS OF HEALTH IN CAMERA - PERSONAL MATTERS ABOUT IDENTIFIABLE THE BOARD OF HEATLH REFERRED THE FOLLOWING REPORT RECOMMENDATIONS TO CITY COUNCIL: 1. That Council

Plus en détail

APHLIS (African Postharvest Losses Information System) Système d information Africain des pertes post récolte www.aphlis.net

APHLIS (African Postharvest Losses Information System) Système d information Africain des pertes post récolte www.aphlis.net APHLIS (African Postharvest Losses Information System) Système d information Africain des pertes post récolte www.aphlis.net APHLIS - a unique service APHLIS generates estimates of quantitative postharvest

Plus en détail

Vaccins Papillomavirus

Vaccins Papillomavirus Vaccins Papillomavirus Dr Julian CORNAGLIA Centre Départemental et International de Vaccinations Histoire naturelle de l infection àhpv(1) Histoire naturelle de l infection à HPV(2) Réponse immune naturelle

Plus en détail

Archived Content. Contenu archivé

Archived Content. Contenu archivé ARCHIVED - Archiving Content ARCHIVÉE - Contenu archivé Archived Content Contenu archivé Information identified as archived is provided for reference, research or recordkeeping purposes. It is not subject

Plus en détail

Appels à candidatures Veuillez trouver ci-dessous un aperçu de tous les appels qui sont actuellement ouverts aux candidatures.

Appels à candidatures Veuillez trouver ci-dessous un aperçu de tous les appels qui sont actuellement ouverts aux candidatures. Vol 3, No 2 EDCTP newsletter Avril 2 Note du Directeur Exécutif Informations concernant les appels d offres et les bourses Appels à candidatures Activités du Programme Commun Microbicides contre le VIH

Plus en détail

Cartographie et SIG en Santé Publique. Cartographie et SIG en Santé Publique July 4, 2011

Cartographie et SIG en Santé Publique. Cartographie et SIG en Santé Publique July 4, 2011 Cartographie et SIG en Santé Publique 1 Mandat de l'oms "La possession du meilleur état de santé qu'il est capable d'atteindre constitue l'un des droits fondamentaux de tout être humain" Constitution de

Plus en détail

I-12 Insurance Act 2001-56 RÈGLEMENT DU NOUVEAU-BRUNSWICK 2001-56 NEW BRUNSWICK REGULATION 2001-56. établi en vertu de la.

I-12 Insurance Act 2001-56 RÈGLEMENT DU NOUVEAU-BRUNSWICK 2001-56 NEW BRUNSWICK REGULATION 2001-56. établi en vertu de la. I-12 Insurance Act 2001-56 NEW BRUNSWICK REGULATION 2001-56 under the INSURANCE ACT (O.C. 2001-344) Filed July 27, 2001 1 Section 6 of New Brunswick Regulation 85-151 under the Insurance Act is amended

Plus en détail

JOURNAL D AUTOSURVEILLANCE DU DIABÈTE

JOURNAL D AUTOSURVEILLANCE DU DIABÈTE BLOOD SUGAR LOGBOOK JOURNAL D AUTOSURVEILLANCE DU DIABÈTE My personal information NAME ADDRESS CITY PROV POSTAL CODE TELEPHONE ( ) I have diabetes. In case of emergency, please notify: NAME RELATIONSHIP

Plus en détail

Preparing healthcare workforce?

Preparing healthcare workforce? Swiss Public Health Conference (Re-)Organizing Health Systems Lausanne 30 août 2012 Preparing healthcare workforce? Prof. Diane Morin, Inf, PhD Plan de présentation Merci au Comité organisateur pour l

Plus en détail

AIDE ODONTOLOGIQUE INTERNATIONALE

AIDE ODONTOLOGIQUE INTERNATIONALE AIDE ODONTOLOGIQUE INTERNATIONALE LES RESSOURCES HUMAINES DANS LE SECTEUR DE LA SANTE Hubert Balique 15-1616 Janvier 2009 1 1. LA CRISE DES RESSOURCES HUMAINES 2 RESSOURCES HUMAINES: GRANDE FAIBLESSE ACTUELLE

Plus en détail

Ending HIV/AIDS. M-J Milloy, PhD

Ending HIV/AIDS. M-J Milloy, PhD The Concordia University Community Lecture Series on HIV/AIDS presents: Ending HIV/AIDS M-J Milloy, PhD Research Scientist BC Center for Excellence in HIV/AIDS Thursday, March 10 th, 2016 7pm McGill University

Plus en détail

UNIVERSITE DE MONTPELLIER Référence GALAXIE : 48

UNIVERSITE DE MONTPELLIER Référence GALAXIE : 48 UNIVERSITE DE MONTPELLIER Référence GALAXIE : 48 Numéro dans le SI local : 0215 Référence GESUP : Corps : Maître de conférences Article : 26-I-1 Chaire : Non Section 1 : 87-Sc. biologiques, fondamentales

Plus en détail

Le guide CLIP: un outil d implantation de la pratique factuelle

Le guide CLIP: un outil d implantation de la pratique factuelle Le guide CLIP: un outil d implantation de la pratique factuelle Bertrand Arsenault, Ph.D. École de réadaptation, Université de Montréal et CRIR site Institut de réadaptation de Montréal La pratique factuelle

Plus en détail

GISAfrica First phase closure meeting East African Pole. SIGAfrique Réunion de clôture de la première phase Pôle Afrique de l est

GISAfrica First phase closure meeting East African Pole. SIGAfrique Réunion de clôture de la première phase Pôle Afrique de l est GISAfrica First phase closure meeting East African Pole SIGAfrique Réunion de clôture de la première phase Pôle Afrique de l est Ethiopia MAURITANIE MALI Kenya SENEGAL GUINEE Ouagadougou BURKINA FASO NIGER

Plus en détail