REGULATION POST- TRANSCRIPTIONNELLES ET CANCER. Yann Audic, CNRS UMR 6061

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimension: px
Commencer à balayer dès la page:

Download "REGULATION POST- TRANSCRIPTIONNELLES ET CANCER. Yann Audic, CNRS UMR 6061"

Transcription

1 REGULATION POST- TRANSCRIPTIONNELLES ET CANCER 1 Yann Audic, CNRS UMR 6061

2 - Régulations Post-transcriptionnelles - Régulation stabilité et traduction d'oncogènes c-fos c-myc - Syndrome de Von-hippel-Lindau 2

3 Du GENE à la PROTEINE Transcription Epissage AAAAAAA...AAA Export AAAAAAA...AAA AAAAAAA...AAA ARNm Degradation ADN pre-arnm AAAAAAA...AAA Translation 3

4 Du GENE à la PROTEINE Transcription Epissage AAAAAAA...AAA Export AAAAAAA...AAA AAAAAAA...AAA ARNm Degradation ADN pre-arnm AAAAAAA...AAA Translation 4

5 Du GENE à la PROTEINE Transcription Epissage AAAAAAA...AAA Export AAAAAAA...AAA AAAAAAA...AAA ARNm Degradation ADN pre-arnm AAAAAAA...AAA Translation 5

6 Voies de dégradation des ARNm Newbury SF,

7 INITIATION DE LA TRADUCTION CAP-DEPENDANTE 7 DeMoor, 2005

8 RNABP C 5'UTR PHASE CODANTE RE 3'UTR AAA...AAA 8

9 TRADUCTION C PHASE CODANTE 5'UTR RNABP RE 3'UTR AAA...AAA DEGRADATION 9

10 TRADUCTION C PHASE CODANTE 5'UTR RNABP RE 3'UTR AAA...AAA DESADENYLATION 10

11 11

12 C-fos C-fos est un gène de réponse précoce codant pour une des sous-unité du facteur de Transcription AP1 Human epidermoid carcinoma cells/egf treated (t0) 1) Transcription activable et réprimable rapidement et avec une forte activité 2) Un ARNm Instable 12

13 L'ARNm c-fos contient 2 éléments de régulation Post-transcriptionnelle 5'UTR 3'UTR C CRD ARE AAA...AAAAAA UUUUAUUGUGUUUUUAAUUUAUUUAUUAAGAUGGAUUCUCAGAUAUUUAUAUUUUUAUUUUAUUUUUUU 1) l'au-rich Element : -Les ARE sont présent dans de nombreux ARNm codant pour des Cytokines, Oncogènes ou Facteurs de croissances. -Ce sont des platesformes de fixation pour des facteurs régulateurs (environ une dizaine différents sont connus). Soit des protéines induisant la désadénylation puis dégradation de l'arnm (AUF1, TTP,...) Soit des protéines stabilisant l'arnm (HuR). Soit des protéines bloquant la traduction. Ceci peut dépendre du type cellulaire ou des conditions physiologiques. 2) L'importance de l'are est démontré par a) sa délétion rend c-fos oncogénique et peut induire la transformation de fibroblastes (Meijlink et al.1985), b)le pendant viral de c-fos (FBJ osteosarcoma virus) ne contient pas d'are et induit des tumeurs osseuses. 13

14 ARE-BP et leurs cibles 14

15 Le déterminant d'instabilité de la phase codante 1) Le blocage global de la traduction (cycloheximide) ou le blocage spécifique de la traduction de c-fos (insertion structure tige-boucle stable dans la 5'UTR) stabilise l'arnm. Cet effet est dépendant de la présence d'un élément dans la phase codante. 2) Cet élément de 87 nt fonctionne même s'il n'est pas en phase. 3) il s'associe à UNR, HnRNPD( AUF1), NSAP1, PAIP1, PABP1. Chang,Genes and Development

16 C-Myc C-myc est surexprimé dans de nombreuses formes de tumeurs soit en lien avec des duplications, des cassures chromosomiques. L'expression de c-myc est contrôlée largement au niveau transcriptionnel par l'existence de 4 promoteurs différents, tandis qu'un contrôle de sa stabilité et de sa traductibilité assure une expression limitée cet oncogène très actif. 16

17 C-myc est un facteur de transcription qui après dimérisation avec ses partenaires peut activer ou réprimer la transcription. 5'UTR 3'UTR C I R E S CRD ARE AAA...AAAAAA 3 SEQUENCES REGULATRICES DIFFERENTES 1) Un site d'initiation interne de la traduction (IRES) 2) Un déterminant de stabilité dans la phase codante 3) Un ARE 17

18 - Le CRD contient des codons rares favorisant le ralentissement de la traduction. 18

19 CRD-BP /hvickz-1 - CRD-BP appartient à une large famille de protéine à domaine KH (HnRNP K homology domain). -Elle a été identifié séparément comme KOC (KH-domain protein overexpressed in cancer). -Quelques ARNm cibles de cette protéine sont identifiés : c-myc, IGF-2, FMR1, Semaphorin 3F. 19

20 CRDBP expression C-myc expression -Une analyse extensive de tissus issus de tumeurs primaires de cancer du sein (118 cas) presentaient dans 60 % des cas une surexpression de CRD-BP. Sur 21 adenocarcinomes de cancer du colon, 17 (81%) présentait une surexpression de CRD-BP. -L'expression ectopique de CRD-BP dans le tissu mammaire de souris transgénique induit des tumeurs mammaires. C-myc n'etait pas affecté mais IGFII était surexprimé. 20

21 Von Hippel-Lindau proteine 1) Le syndrome de VHL est une maladie héréditaire autosomale dominante (OMIM ) et les individus affectés présentent des prédisposition aux cancer de type rénaux, pancreatique ou au cerveau. 2) pvhl est un supresseur de tumeur puisque son absence favorise l'apparition de tumeur. 3)pVHL participe dans un complexe fonctionnant comme une E3- ubiquitin ligase impliquée dans l'addition d'ubiquitin sur des protéines destinées à être dégradée par le protéasome. 4) Une cible principale et très étudiée est le facteur de transcription HIF1-alpha 5) La stabilité et la traduction d'un certain nombre de facteur de croissance (TGF alpha, beta, VEGF) est accrue en absence de pvhl 21

22 pvhl?? STABILITE ARNm TGF, VEGF TRADUCTION ARNm TNFalpha 22

23 pvhl HIF1alpha GENE VEGF ARNm VEGF VEGF Expression constitutive pvhl HIF1alpha Expression Oxygène-dependante GENE VEGF ARNm VEGF VEGF 23

24 pvhl HIF1alpha GENE VEGF ARNm VEGF VEGF Expression constitutive Hypoxie pvhl HIF1alpha GENE VEGF ARNm VEGF VEGF 24

25 Diminution du complexe ARN/Protéine en conditions hypoxique 25

26 pvhl? STABILITE ARNm VEGF TRADUCTION ARNm TNFalpha 26

27 PVHL réprime TNF alpha traduction via la 3'UTR Galban et al.,

28 pvhl 3'UTR dépendante STABILITE ARNm VEGF TRADUCTION ARNm TNFalpha QUELS SONT LES FACTEURS ASSOCIES? 28

29 TNF alpha 3'UTR s'associe à TIA1, un represseur traductionnel VEGF mrna s'associe à HuR et inhibe l'association de HuR à VEGF. 29

30 CONCLUSIONS - Les Régulations Post-transcriptionnelles apportent un niveau supplémentaire de complexité dans les régulations de l'expression des gènes. - Elles sont indispensables à la régulation correcte d'acteurs centraux de la prolifération cellulaire - Les acteurs de ces Régulations, séquences cis et protéines de liaisons aux ARN, pourront peut-être être des cibles thérapeutique pour inhiber l'expression de tel ou tel ARN ou au contraire l'activer. 30

31 31

REGULATION POSTTRANSCRIPTIONNELLES ET CANCER. Yann Audic, CNRS, UMR6061, RENNES

REGULATION POSTTRANSCRIPTIONNELLES ET CANCER. Yann Audic, CNRS, UMR6061, RENNES REGULATION POSTTRANSCRIPTIONNELLES ET CANCER YannAudic,CNRS,UMR6061,RENNES Octobre2009 - Régulations Post-transcriptionnelles -Qualitatives -Quantitatives - Régulation de l'apoptose par -l'équilibre FasR/Fas

Plus en détail

Comment une cellule en G0 peut rentrer en G1

Comment une cellule en G0 peut rentrer en G1 Comment une cellule en G0 peut rentrer en G1 Les cellules-filles, dès la sortie de mitose, peuvent entrer en phase G0, stade de non division ou de «quiescence». La plupart des cellules dans un organisme

Plus en détail

Cancérogenèse : transformation cellulaire (2)

Cancérogenèse : transformation cellulaire (2) 31/03/15 BASTOS REINALDO Julia L2 BMCP Pr OUAFIK 6 pages CR : Borg Manon Cancérogenèse : transformation cellulaire (2) Plan: A. Gènes suppresseurs de tumeur I. Généralités / définition II. Découverte III.

Plus en détail

OPERON LACTOSE CHEZ LES PROCARYOTES IX. RÉGULATION DE L EXPRESSION GÉNÉTIQUE «OPERON LACTOSE CHEZ LES PROCARYOTES»

OPERON LACTOSE CHEZ LES PROCARYOTES IX. RÉGULATION DE L EXPRESSION GÉNÉTIQUE «OPERON LACTOSE CHEZ LES PROCARYOTES» 76 IX. RÉGULATION DE L EXPRESSION GÉNÉTIQUE «OPERON LACTOSE CHEZ LES PROCARYOTES» Avec l étude de l opéron lactose, François Jacob, Jacques Monod et André Lwoff ont été les premiers scientifiques à décrire

Plus en détail

Epigénétique. «pourquoi toutes les cellules d'un organisme ne sont-elles pas identiques» Alors qu elles ont toutes les mêmes gènes.

Epigénétique. «pourquoi toutes les cellules d'un organisme ne sont-elles pas identiques» Alors qu elles ont toutes les mêmes gènes. Epigénétique Introduction «pourquoi toutes les cellules d'un organisme ne sont-elles pas identiques» Alors qu elles ont toutes les mêmes gènes. Deux périodes successives récentes dans l étude des génomes

Plus en détail

La régulation de la prolifération cellulaire (2)

La régulation de la prolifération cellulaire (2) C 25, Pr BERGERAT Pauline BOIREAU Cours du 21.10.2011 15h à 16h Elodie CASTILLE Master Cancérologie La régulation de la prolifération cellulaire (2) F. Rôle de c-myc dans le contrôle de la prolifération

Plus en détail

BMCP Cancérogenèse vs Tumorigenèse. Cancérogenèse vs Tumorigenèse (suite)

BMCP Cancérogenèse vs Tumorigenèse. Cancérogenèse vs Tumorigenèse (suite) 14/04/2015 BOUILLOUX Elsa L2 (CR : Hamza Berguigua) BMCP Pr.OUAFIK 8 pages Cancérogenèse vs Tumorigenèse (suite) Plan A. Angiogenèse tumorale I. Sources des facteurs angiogéniques II. Régulation des facteurs

Plus en détail

La dégradation des ARN eucaryotes : de la régulation de l expression des gènes au contrôle de qualité

La dégradation des ARN eucaryotes : de la régulation de l expression des gènes au contrôle de qualité La dégradation des ARN eucaryotes : de la régulation de l expression des gènes au contrôle de qualité Conférence de Mr. B.Séraphin DOBOSZ Alicia MEIER Marie M2 BBMC bgm Année 2012-2013 INTRODUCTION ARNm

Plus en détail

CHAPITRE II Génétique moléculaire du Cancer

CHAPITRE II Génétique moléculaire du Cancer CHAPITRE II Génétique moléculaire du Cancer DEFINITIONS Le cancer semble être le résultat d une série d accidents génétiques aléatoires soumis à la sélection naturelle. Chaque cancer est Unique mais il

Plus en détail

De la biologie molécualire à la génomique

De la biologie molécualire à la génomique De la biologie molécualire à la génomique Pierre Neuvial École Nationale de la Statistique et de l Administration Économique Méthodes statistiques pour la biologie Plan du cours 1 Introduction à la biologie

Plus en détail

Stratégies anti-angiogéniques dans le cancer du rein

Stratégies anti-angiogéniques dans le cancer du rein Stratégies anti-angiogéniques dans le cancer du rein BENEFICES ET RISQUES Gilles PAGES CNRS UMR 6543 - Nice Néovascularisation des tumeurs / Stade 1 Ang 2 Déstabilisation des interactions cellules endothéliales

Plus en détail

REGULATION DE L EXPRESSION DES GENES.

REGULATION DE L EXPRESSION DES GENES. REGULATION DE L EXPRESSION DES GENES. Modification épigénétiques : viennent s ajouter à la séquence nucléotidique. La séquence nucléotidique est transmise intacte de la cellule mère à la cellule fille.

Plus en détail

LA TRANSCRIPTION. Introduction. I. Modalité générale de la transcription. II. Transcription chez les Procaryotes

LA TRANSCRIPTION. Introduction. I. Modalité générale de la transcription. II. Transcription chez les Procaryotes LA TRANSCRIPTION Introduction I. Modalité générale de la transcription II. Transcription chez les Procaryotes 1. L'ARN polymérase 2. Etapes de la transcription a. Initiation b. Elongation c. Terminaison

Plus en détail

L'ADN peut être copié au travers des générations cellulaires successives de manière fidèle, c'est la réplication de l'adn.

L'ADN peut être copié au travers des générations cellulaires successives de manière fidèle, c'est la réplication de l'adn. 24/09/2014 REBOUL Nicolas L2 CR : Hamza BERGUIGUA Génétique Médicale Dr Martin KRAHN 8 pages Introduction à la Génétique Médicale : Les champs de la Génétique Médicale, La place de la Génétique Médicale

Plus en détail

Qu est-ce qu HER2 et comment le détecter? Pr Frédérique Penault Llorca Pathologiste Centre Jean Perrin, Clermont-Ferrand

Qu est-ce qu HER2 et comment le détecter? Pr Frédérique Penault Llorca Pathologiste Centre Jean Perrin, Clermont-Ferrand Qu est-ce qu HER2 et comment le détecter? Pr Frédérique Penault Llorca Pathologiste Centre Jean Perrin, Clermont-Ferrand Qu est-ce que HER2? HER2 est un récepteur. Il signifie human epidermal growth factor

Plus en détail

INVESTIGATIONS TECHNIQUES EN PHYSIOPATHOLOGIE CELLULAIRE ET MOLECULAIRE Partie I. La transfection. Responsable : Valérie Chopin.

INVESTIGATIONS TECHNIQUES EN PHYSIOPATHOLOGIE CELLULAIRE ET MOLECULAIRE Partie I. La transfection. Responsable : Valérie Chopin. INVESTIGATIONS TECHNIQUES EN PHYSIOPATHOLOGIE CELLULAIRE ET MOLECULAIRE Partie I La transfection Responsable : Valérie Chopin LBH semestre 6 Faculté des Sciences Laboratoire de Physiologie Cellulaire et

Plus en détail

TYROSINES KINASES ET CANCER

TYROSINES KINASES ET CANCER I/ GÉNÉRALITÉ SUR SIGNALISATION CELLULAIRE TYROSINES KINASES ET CANCER Les cellules fonctionnent en harmonie via des transferts d information, c est la signalisation. Le signal passe directement dans la

Plus en détail

CONTRÔLE DU MÉTABOLISME ET DE LA PROLIFÉRATION PAR LES MICROARN ET LES ACTEURS DU CYCLE CELLULAIRE

CONTRÔLE DU MÉTABOLISME ET DE LA PROLIFÉRATION PAR LES MICROARN ET LES ACTEURS DU CYCLE CELLULAIRE UNIVERSITE MONTPELLIER 1 UFR MEDECINE THÈSE Présentée pour obtenir le grade de DOCTEUR DE L UNIVERSITE MONTPELLIER I Discipline : Biochimie et Biologie Moléculaire École doctorale : Sciences Chimiques

Plus en détail

La synthèse des protéines transcription code génétique traduction

La synthèse des protéines transcription code génétique traduction CEC André-Chavanne BIO 3 OS La synthèse des protéines transcription code génétique traduction I. La «Transcription» : de l ADN à l ARNm. L'adresse suivante permet d accéder à une ANIMATION sur la TRANSCRIPTION.

Plus en détail

L3-BH01 Cours n 10 Modifications post-transcriptionnelles

L3-BH01 Cours n 10 Modifications post-transcriptionnelles L3-BH01 Cours n 10 Modifications post-transcriptionnelles Ce cours est présent sur le web à l adresse suivante : http://www.univ-orleans.fr/sciences/biochimie/l/ressources.htm Plan (cours n 10 & 11) Introduction

Plus en détail

Etude de l implication des miarns. dans le cancer du sein basal-like. et la régulation de BRCA1

Etude de l implication des miarns. dans le cancer du sein basal-like. et la régulation de BRCA1 Etude de l implication des miarns dans le cancer du sein basal-like et la régulation de BRCA1 Insaf FKIH M HAMED fkihinsaf@yahoo.com Laboratoire d'oncologie Moléculaire Centre Jean Perrin Clermont-Ferrand

Plus en détail

Identification de microarns régulateurs de l expression du Glypican-3 dans le carcinome hépatocellulaire

Identification de microarns régulateurs de l expression du Glypican-3 dans le carcinome hépatocellulaire 69 ème Journées Scientifiques de l AFEF Mercredi 28 Septembre 2011 Identification de microarns régulateurs de l expression du Glypican-3 dans le carcinome hépatocellulaire Marion Maurel INSERM U1053 Bordeaux

Plus en détail

ED Biologie moléculaire. E. Turpin J. Lehmann-Che 5-6 novembre 2007

ED Biologie moléculaire. E. Turpin J. Lehmann-Che 5-6 novembre 2007 ED Biologie moléculaire E. Turpin J. Lehmann-Che 5-6 novembre 2007 PCR 1983: Kary Mullis Amplification in vitro par une méthode enzymatique d'un fragmentd'adn en présence de deux oligonucléotides spécifiques

Plus en détail

TABLE DES MATIERES PARTIE A BIOLOGIE MOLECULAIRE 3. LESIONS ET REPARATIONS DE L ADN 41 AVANT-PROPOS 1. LES ACIDES NUCLEIQUES 3

TABLE DES MATIERES PARTIE A BIOLOGIE MOLECULAIRE 3. LESIONS ET REPARATIONS DE L ADN 41 AVANT-PROPOS 1. LES ACIDES NUCLEIQUES 3 TABLE DES MATIERES AVANT-PROPOS XI PARTIE A BIOLOGIE MOLECULAIRE 1. LES ACIDES NUCLEIQUES 3 1.1 STRUCTURE DE LA CHAINE POLYNUCLEOTIDIQUE 4 Les bases 4 Les pentoses 5 Nucléosides et nucléotides 5 La chaîne

Plus en détail

Professeur François BERGER

Professeur François BERGER UE2 : Biologie cellulaire Chapitre 2 : Le cycle cellulaire Professeur François BERGER Année universitaire 2011/2012 Université Joseph Fourier de Grenoble - Tous droits réservés. Coordonnée: Activité de

Plus en détail

Contrôle extracellulaire du cycle cellulaire : les facteurs de croissance

Contrôle extracellulaire du cycle cellulaire : les facteurs de croissance 11/02/2014 LETOUCHE Marie-Lou L2 BMCP Pr. A. AUTILLO TOUATI 12 pages Relecteur n 3 BMCP Contrôle extracellulaire du cycle cellulaire : les facteurs de croissance Contrôle extracellulaire du cycle cellulaire

Plus en détail

La cellule cancéreuse et son microenvironnement

La cellule cancéreuse et son microenvironnement UE 5 Cours du 8 Novembre 2012 La cellule cancéreuse et son microenvironnement I/ Cancer : Généralités Du au dérèglement de la division de quelques unes des milliards de cellules qui constituent les êtres

Plus en détail

La différenciation cellulaire

La différenciation cellulaire La différenciation cellulaire Définitions Différenciation cellulaire : Processus par lequel une cellule peu ou pas différenciée acquiert les caractéristiques d un type cellulaire sur le plan morphologique

Plus en détail

Contrôle de l expression génétique chez les eucaryotes

Contrôle de l expression génétique chez les eucaryotes Contrôle de l expression génétique chez les eucaryotes 1 ère partie : la transcription - Chapitre III : Les autres classes de facteurs de transcription Cours de Mr Le Dréan I Autres familles de la superclasse

Plus en détail

Baccalauréat général Sciences de la vie et de la Terre

Baccalauréat général Sciences de la vie et de la Terre Baccalauréat général Sciences de la vie et de la Terre Épreuve obligatoire série S Partie 1 (5 points) Thème 1-: Expression, stabilité, variation du patrimoine génétique. Sujet : On cherche à montrer,

Plus en détail

Structure des génomes bactériens / systèmes de mutagénèse / génomique comparative

Structure des génomes bactériens / systèmes de mutagénèse / génomique comparative Master 1 Bactério 10/01/09 8h30-10h30 RT : Stéphanie Ripert-Bernusset RL: Benjamin de Sainte Marie Structure des génomes bactériens / systèmes de mutagénèse / génomique comparative PLAN DU COURS : I- GENOME

Plus en détail

Régulation de la stabilité des ARNm.

Régulation de la stabilité des ARNm. Régulation de la stabilité des ARNm http://perso.univ-rennes1.fr/serge.hardy/ Un ARNm est stable par défaut dans la cellule eif4e m 7 Gppp PABP AUG UAA AAAAAAAAAAAA Un ARNm est stable par défaut dans la

Plus en détail

Oncogènes et anti-oncogenes C. Hourioux

Oncogènes et anti-oncogenes C. Hourioux Oncogènes et anti-oncogenes C. Hourioux Définitions : Cancer Multiplication anarchique de cellules échappant aux mécanismes normaux de différenciation et de régulation de leur multiplication Capacité à

Plus en détail

III - Régulation du métabolisme A) X B) Transcription

III - Régulation du métabolisme A) X B) Transcription BPV : Physiologie Bactérienne UE: 5 Semaine : n 9 (du 02/11/2015 au 06/11/2015 Date : 03/11/2015 Heure : de 9h-10h Professeur : Pr. Romond Binôme : n 54 Correcteur : 53 Aucune remarque particulière du

Plus en détail

Biologie Moléculaire et Organismes Modèles

Biologie Moléculaire et Organismes Modèles Biologie Moléculaire et Organismes Modèles Sami Khuri Department of Computer Science San José State University khuri@cs.sjsu.edu Usine de Protéines Les protéines sont responsables de la plupart des fonctions

Plus en détail

Le cancer, le grand envahisseur.

Le cancer, le grand envahisseur. Le cancer, le grand envahisseur. Jean-Paul Sculier Service des soins intensifs et urgences oncologiques & Oncologie thoracique Institut Jules Bordet (ULB) www.pneumocancero.com Définition et histoire naturelle

Plus en détail

La Reptine, une protéine surexprimée dans les carcinomes hépatocellulaires, régule la réparation des cassures double brin de l ADN.

La Reptine, une protéine surexprimée dans les carcinomes hépatocellulaires, régule la réparation des cassures double brin de l ADN. 2014 La Reptine, une protéine surexprimée dans les carcinomes hépatocellulaires, régule la réparation des cassures double brin de l ADN. Anne-Aurélie RAYMOND Physiopathologie du Cancer du Foie (GREF INSERM

Plus en détail

Université du Québec à Montréal

Université du Québec à Montréal RECUEIL D EXERCICES DE BICHIMIE 6. Les acides nucléiques 6.2. Réplication, transcription et traduction P P P CH 2 H N H N N NH NH 2 Université du Québec à Montréal 6.2. Réplication, transcription et traduction

Plus en détail

Le cycle cellulaire Régulation normale et pathologique

Le cycle cellulaire Régulation normale et pathologique Année universitaire 2011-2012 MED-2 - Enseignements Thématiques Bases moléculaires et cellulaires des pathologies Le cycle cellulaire Régulation normale et pathologique Planches pour le Campus Virtuel

Plus en détail

Le gène, de l'adn aux protéines

Le gène, de l'adn aux protéines 13/10/2011 - Par Claude Sauter Le gène, de l'adn aux protéines La vie d'un gène, de sa duplication à la fabrication d'une protéine pour laquelle il code, est une succession d'étapes cruciales. Ce dossier

Plus en détail

Biologie Cellulaire & Biologie Moléculaire

Biologie Cellulaire & Biologie Moléculaire Biologie Cellulaire & Biologie Moléculaire V Transcription Techniques d études Principes généraux Conclusions Cours n 10 : Jeudi 7 novembre 2013 L3 UE 5.2 2013-2014 255 Technique 8 : Retard sur gel P 200

Plus en détail

Module 1 Biologie cellulaire

Module 1 Biologie cellulaire Module 1 Biologie cellulaire Chapitre 3: Cycle cellulaire et mort des cellules eucaryotes II. Régulation du cycle cellulaire II. Régulation du cycle cellulaire 1. Acteurs 2. Moments d intervention et action

Plus en détail

GM- Support de l'information génétique ; structure et fonction du génome. Support de l'information génétique ; structure et fonction du génome

GM- Support de l'information génétique ; structure et fonction du génome. Support de l'information génétique ; structure et fonction du génome Mercredi 9 octobre ABECASSIS Anna L2 GM Pr Beroud 16 pages Support de l'information génétique ; structure et fonction du génome Plan A. Des gènes aux protéines I. Structure de l'adn II. Structure des gènes

Plus en détail

Angiogénèse. Myriam DECAUSSIN 13 Mai 2008

Angiogénèse. Myriam DECAUSSIN 13 Mai 2008 Angiogénèse Myriam DECAUSSIN 13 Mai 2008 Définition Vasculogénèse : différenciation du mésoderme en cellules endothéliales (embryogénèse) Angiogénèse : formation de nouveaux vaisseaux à partir du lit vasculaire

Plus en détail

Portail de la biologie de la reproduction

Portail de la biologie de la reproduction Portail de la biologie de la reproduction www.bio-courses.jimdo.com Auteurs : Yasmina ANTEUR Licence : Module : Biologie du développement Les mécanismes de différenciation cellulaire I. Introduction -

Plus en détail

Résultats : Partie III

Résultats : Partie III Résultats : Partie III Analyse des rôles respectifs de RhoA et RhoC dans le phénotype des cellules d adénocarcinome prostatique Introduction Parmi les protéines du sous-groupe Rho, RhoC a été décrit comme

Plus en détail

TRANSPORT ET STABILITE DES ARNs

TRANSPORT ET STABILITE DES ARNs TRANSPORT ET STABILITE DES ARNs I- Transport des ARNm Après sa maturation dans le noyau, l ARNm reste associé avec des protéines spécifiques pour former des complexes ribonucléoprotéiques (mrnp). L assemblage

Plus en détail

Régulation de l'expression des gènes. Les gènes exprimés et les gènes réprimés dans une cellule déterminent le phénotype de cette cellule.

Régulation de l'expression des gènes. Les gènes exprimés et les gènes réprimés dans une cellule déterminent le phénotype de cette cellule. 21/10/2014 GRANDMAISON Johan L2 Relectrice : Borg Manon BMCP Pr. Alain Margotat 14 pages Régulation de l'expression des gènes Plan A. Introduction B. Modifications de la chromatine I. Modifications post-traductionnelles

Plus en détail

Principe des études moléculaires en génétique médicale Méthodes d analyse des microlésions du génome

Principe des études moléculaires en génétique médicale Méthodes d analyse des microlésions du génome Mercredi 23 Octobre LECLERCQ Barbara L2 GM Pr Krahn 10 pages Principe des études moléculaires en génétique médicale Méthodes d analyse des microlésions du génome Plan A. Introduction B. Techniques courantes

Plus en détail

Etude du transcriptome et du protéome en Neurooncologie

Etude du transcriptome et du protéome en Neurooncologie Etude du transcriptome et du protéome en Neurooncologie Principes, aspects pratiques, applications cliniques François Ducray Neurologie Mazarin, Unité Inserm U711 Groupe hospitalier Pitié-Salpêtrière Etude

Plus en détail

Jean-Louis Bergé-Lefranc

Jean-Louis Bergé-Lefranc Apport du séquençage du génome humain à la toxicologie: Toxicogénomique Jean-Louis Bergé-Lefranc QuickTime et un décompresseur TIFF (LZW) sont requis pour visionner cette image. QuickTime et un décompresseur

Plus en détail

Expression des gènes Comparatif entre procaryotes et eucaryotes

Expression des gènes Comparatif entre procaryotes et eucaryotes Comparaison procaryotes/ 2TSbc Expression des gènes Comparatif entre procaryotes et eucaryotes La majeure partie des connaissances de biologie moléculaire a d'abord débuté par l'étude des phénomènes chez

Plus en détail

Professeur Joël LUNARDI

Professeur Joël LUNARDI Biochimie - Biologie moléculaire Chapitre 5 : La transcription Professeur Joël LUNARDI MED@TICE PCEM1 - Année 2006/2007 Faculté de Médecine de Grenoble - Tous droits réservés. Chapitre 5. La transcription

Plus en détail

La médecine personnalisée Daniel Locker Professeur honoraire Université Orléans

La médecine personnalisée Daniel Locker Professeur honoraire Université Orléans La médecine personnalisée Daniel Locker Professeur honoraire Université Orléans Introduction En 1992, l introduction d'un anticorps monoclonal, l herceptine, pour le traitement du cancer du sein a donné

Plus en détail

Chapitre 2. La synthèse protéique : la relation entre le génotype et le phénotype.

Chapitre 2. La synthèse protéique : la relation entre le génotype et le phénotype. Chapitre 2. La synthèse protéique : la relation entre le génotype et le phénotype. Les maladies génétiques comme la drépanocytose ou l'albinisme sont liées à des modifications du génotype des individus

Plus en détail

THESE DE DOCTORAT Les mécanismes épigénétiques impliqués dans la différenciation des cellules souches

THESE DE DOCTORAT Les mécanismes épigénétiques impliqués dans la différenciation des cellules souches L Academie Roumaine L Institute de Biologie et Pathologie Cellulaire Nicolae Simionescu THESE DE DOCTORAT Les mécanismes épigénétiques impliqués dans la différenciation des cellules souches Directeur de

Plus en détail

Eléments primordiaux de biologie moléculaire

Eléments primordiaux de biologie moléculaire Eléments primordiaux de biologie moléculaire Pourquoi s intéresser au matériel génétique? Base de l information génétique Tissu Cellule Noyau Organisme entier Lieu où est localisé l ADN Mol d ADN qui est

Plus en détail

Fibroblast Growth Factors Induce Additional Limb Development from the flank of Chick Embryos Martin J. Cohn, Juan Carlos Izpisua-Belmonte and al.

Fibroblast Growth Factors Induce Additional Limb Development from the flank of Chick Embryos Martin J. Cohn, Juan Carlos Izpisua-Belmonte and al. Fibroblast Growth Factors Induce Additional Limb Development from the flank of Chick Embryos Martin J. Cohn, Juan Carlos Izpisua-Belmonte and al. Retour en 1995 Le signal émis par l'aer peut être substitué

Plus en détail

Chapitre 3 - Mécanismes de surveillance contrôlant les transitions G1/S, G2/M et Métaphase/Anaphase

Chapitre 3 - Mécanismes de surveillance contrôlant les transitions G1/S, G2/M et Métaphase/Anaphase site ressources sciences de la vie ENS-DESCO Chapitre 3 - Mécanismes de surveillance contrôlant les transitions G1/S, G2/M et Métaphase/Anaphase L'existence de mécanismes de surveillance En plus des Cdk,

Plus en détail

Imagerie de l expression génique

Imagerie de l expression génique Franck Couillaud MODULE NATIONAL D'ENSEIGNEMENT DE TECHNOLOGIES AVANCEES Imagerie de l expression génique Université de Bordeaux Résonnance Magnétique des Systèmes Biologiques CNRS UMR 5536 et des thérapies

Plus en détail

Paris 12 ECUE SANTE 2 : SOURCES ACTUELLES ET FUTURES DES PRINCIPES ACTIFS FICHE DE COURS N 3 : LES MEDICAMENTS ISSUS DES BIOTECHNOLOGIES

Paris 12 ECUE SANTE 2 : SOURCES ACTUELLES ET FUTURES DES PRINCIPES ACTIFS FICHE DE COURS N 3 : LES MEDICAMENTS ISSUS DES BIOTECHNOLOGIES Paris 12 ECUE SANTE 2 : SOURCES ACTUELLES ET FUTURES DES PRINCIPES ACTIFS FICHE DE COURS N 3 : LES MEDICAMENTS ISSUS DES BIOTECHNOLOGIES (Thématique traitée dans la séance 1) Légende : : Notion tombée

Plus en détail

Un tour de cycle des cellules de mammifères

Un tour de cycle des cellules de mammifères Un tour de cycle des cellules de mammifères Combinatoire des complexes Cycline-Cdk Association de cyclines + Cdk Gestion du cycle cellulaire Fenêtres temporelles, contrôle: - synthèse/dégradation des cyclines

Plus en détail

réponse cellulaire: Prolifération, Différenciation, survie,apoptose

réponse cellulaire: Prolifération, Différenciation, survie,apoptose Signalisation : Concept Stimuli extérieurs: Facteurs de croissance, Hormones Cytokines Interaction cellule/cellule Récepteur cellule ropagation du signal Somme des évènements moléculaires Intracellulaires

Plus en détail

Cycle cellulaire Partie 2

Cycle cellulaire Partie 2 17/02/2015 THIERRY Guilhem L2 CR : BORG Manon BMCP Pr. A. AUTILLO TOUATI 16 pages Cycle cellulaire Partie 2 Plan : A. Les protéines codées par des gènes dits "suppresseurs de tumeurs" I. La protéine p53

Plus en détail

Classification des rétro-éléments

Classification des rétro-éléments Classification des rétro-éléments Transposable elements ~ 45% RNA intermediate Transposons ~ 3% Retroelements ~ 42% non LTR ~ 34% LTR ~ 8% SINE : ~ 11% LINE ~ 17 % Pseudogenes < 1% Class I ERV (~3%) :

Plus en détail

Données scientifiques et hypothèses

Données scientifiques et hypothèses Académie nationale de pharmacie séance thématique du 27 janvier 2010 Effets des flavonoïdes alimentaires sur la santé Conclusions : Données scientifiques et hypothèses Mécanismes potentiels des effets

Plus en détail

Modèles animaux de cancérogenèse

Modèles animaux de cancérogenèse INVESTIGATIONS TECHNIQUES EN PHYSIOPATHOLOGIE CELLULAIRE ET MOLECULAIRE isabelle.dhennin@u-picardie.fr Modèles animaux de cancérogenèse I- Généralités sur le cancer 1- Données épidémiologiques Hommes Femmes

Plus en détail

Etude ancillaire au protocole clinique OS2006 : Analyse des paramètres osseux chez les patients atteints d ostéosarcome traités par le zometa.

Etude ancillaire au protocole clinique OS2006 : Analyse des paramètres osseux chez les patients atteints d ostéosarcome traités par le zometa. Etude ancillaire au protocole clinique OS2006 : Analyse des paramètres osseux chez les patients atteints d ostéosarcome traités par le zometa. Projet déposé par REDINI Françoise (Directeur de Recherche

Plus en détail

Bioinformatique fonctionnelle des protéines et analyse structurale de réseaux d'interactions

Bioinformatique fonctionnelle des protéines et analyse structurale de réseaux d'interactions Bioinformatique fonctionnelle des protéines et analyse structurale de réseaux d'interactions intégration Populations Organismes Tissus, organes Relations inter-espèces, Équilibres écologiques Développement,

Plus en détail

Rôle d IL6 dans le développement d un CAC (colitis associated cancer)

Rôle d IL6 dans le développement d un CAC (colitis associated cancer) Rôle d IL6 dans le développement d un CAC (colitis associated cancer) Article; IL-6 and Stat3 Are Required for Survival of Intestinal Epithelial Cells and Development of Colitis-Associated Cancer Le cancer

Plus en détail

CHAPITRE III : LE NOYAU INTERPHASIQUE ET LE CYCLE CELLULAIRE

CHAPITRE III : LE NOYAU INTERPHASIQUE ET LE CYCLE CELLULAIRE CHAPITRE III : LE NOYAU INTERPHASIQUE ET LE CYCLE CELLULAIRE III.1 LE NOYAU INTERPHASIQUE III.1. 1 STRUCTURE L organite le plus proéminent de la cellule est le noyau. Il est le centre vital de la cellule.

Plus en détail

Digestion par les enzymes SalI et EcoRV. Digestion par les enzymes XhoI et SmaI

Digestion par les enzymes SalI et EcoRV. Digestion par les enzymes XhoI et SmaI 2 Digestion par les enzymes SalI et EcoRV Digestion par les enzymes XhoI et SmaI Klenow: sous-unité de l ADN Polymérase I d E. coli possédant une activité ADN polymérase 5-3 et une activité exonucléasique

Plus en détail

MODIFICATIONS EPIGENETIQUES ET PATHOLOGIE HUMAINE

MODIFICATIONS EPIGENETIQUES ET PATHOLOGIE HUMAINE MODIFICATIONS EPIGENETIQUES ET PATHOLOGIE HUMAINE Thierry Forné Institut de Génétique Moléculaire CNRS Montpellier Cours du 25 novembre 2004 Master 1ère année Bases moléculaires des maladies génétiques

Plus en détail

L épissage alternatif : un gène, combien de protéines?

L épissage alternatif : un gène, combien de protéines? L épissage alternatif : un gène, combien de protéines? Avant la publication de la séquence complète de l ADN du génome humain, au début des années 2000, on estimait le nombre de gènes à environ 300.000.

Plus en détail

Professeur Joël LUNARDI

Professeur Joël LUNARDI Biochimie - Biologie moléculaire Chapitre 9 : Applications médicales Professeur Joël LUNARDI MED@TICE PCEM1 - Année 2006/2007 Faculté de Médecine de Grenoble - Tous droits réservés. Chapitre 9. APPLICATIONS

Plus en détail

Université D Oran, Faculté de Médecine, Service D Histologie-Embryologie Dr Belarbi-Amar. Le virus. Les virus(acaryotes)

Université D Oran, Faculté de Médecine, Service D Histologie-Embryologie Dr Belarbi-Amar. Le virus. Les virus(acaryotes) Les virus(acaryotes) Le virus I-Généralités : Le virus (cellule acaryote) est une entité biologique incapable de se reproduire de façon autonome, nécessitant une cellule hôte, dont il utilise les constituants

Plus en détail

Chapitre 10 L isolement et la manipulation de gènes. Injection d ADN étranger dans une cellule animale

Chapitre 10 L isolement et la manipulation de gènes. Injection d ADN étranger dans une cellule animale Chapitre 10 L isolement et la manipulation de gènes Injection d ADN étranger dans une cellule animale Comment amplifier un gène d intérêt? Amplification in vivo à l aide du clonage d ADN L ensemble formé

Plus en détail

Introduction à la Bio-Informatique IFT3295/IFT6291/BIN6000. Nadia El-Mabrouk DIRO, Université de Montréal

Introduction à la Bio-Informatique IFT3295/IFT6291/BIN6000. Nadia El-Mabrouk DIRO, Université de Montréal Introduction à la Bio-Informatique IFT3295/IFT6291/BIN6000 Nadia El-Mabrouk DIRO, Université de Montréal Qu est-ce que la Bioinformatique? Qu est-ce que la Bio-informatique? Champs multi-disciplinaire

Plus en détail

Cahier de texte de la classe 1 ère 4 - SVT

Cahier de texte de la classe 1 ère 4 - SVT Cahier de texte de la classe 1 ère 4 - SVT DATE SEQUENCE lundi 12 : revoir la fiche méthodologique «utiliser le microscope optique» (disponible sur le site du lycée) Lundi 12 1 er contact avec les élèves.

Plus en détail

GLOSSAIRE. Aperto libro

GLOSSAIRE. Aperto libro GLOSSAIRE Aperto libro 1089 1090 GLOSSAIRE Acide désoxyribonucléique ou ADN (angl. DNA) : dimère constitué de deux brins hélicoïdaux composés de nucléotides dont les bases azotées sont la thymine, l adénine,

Plus en détail

DIABETE ET APOPTOSE UN PHENOMENE COURANT INDUIT PAR DE NOMBREUSES MOLECULES

DIABETE ET APOPTOSE UN PHENOMENE COURANT INDUIT PAR DE NOMBREUSES MOLECULES DIABETE ET APOPTOSE L APOPTOSE, UN SUICIDE CELLULAIRE AUX EFFETS SALUTAIRES L'apoptose est une autodestruction cellulaire d'origine endogène. Ce mécanisme prend une grande importance dans l'explication

Plus en détail

L'apport de l'étude des génomes : les innovations génétiques.

L'apport de l'étude des génomes : les innovations génétiques. Introduction : L'apport de l'étude des génomes : les innovations génétiques. Au sein du vivant, les espèces se différencient les unes des autres par l existence de gènes différents. Au sein d une espèce,

Plus en détail

CYCLE CELLULAIRE et CANCER. L. Xerri, Institut Paoli-Calmettes, M2 Oncologie «Module Génomique Tumorale», Novembre 2011

CYCLE CELLULAIRE et CANCER. L. Xerri, Institut Paoli-Calmettes, M2 Oncologie «Module Génomique Tumorale», Novembre 2011 CYCLE CELLULAIRE et CANCER L. Xerri, Institut Paoli-Calmettes, M2 Oncologie «Module Génomique Tumorale», Introduction Le cycle cellulaire est l'ensemble des modifications qu'une cellule subit entre sa

Plus en détail

LES MARQUEURS MOLECULAIRES

LES MARQUEURS MOLECULAIRES LES MARQUEURS MOLECULAIRES Il y a différents types de marqueurs : o Les caractères phénotypiques : limités, observations sur l arbre entier et sur différentes années o Les marqueurs biochimiques o Les

Plus en détail

L'ordre et la nature des acides aminés (ou séquence) d un polypeptide dépend de la séquence des nucléotides de l ADN du gène qui le code.

L'ordre et la nature des acides aminés (ou séquence) d un polypeptide dépend de la séquence des nucléotides de l ADN du gène qui le code. L'ordre et la nature des acides aminés (ou séquence) d un polypeptide dépend de la séquence des nucléotides de l ADN du gène qui le code. Une mutation, peut entraîner une modification de la séquence des

Plus en détail

Les vecteurs rétroviraux du transfert de gènes. Critères de choix: Les outils du transfert de gènes. L intérêt du transfert de gènes

Les vecteurs rétroviraux du transfert de gènes. Critères de choix: Les outils du transfert de gènes. L intérêt du transfert de gènes Les vecteurs rétroviraux du transfert de gènes L intérêt du transfert de gènes Recherche fondamentale Compréhension de la fonction d un gène : gain ou perte de fonction dérégulation du gène piégeage de

Plus en détail

CHAPITRE 3 LA SYNTHESE DES PROTEINES

CHAPITRE 3 LA SYNTHESE DES PROTEINES CHAITRE 3 LA SYNTHESE DES ROTEINES On sait qu un gène détient dans sa séquence nucléotidique, l information permettant la synthèse d un polypeptide. Ce dernier caractérisé par sa séquence d acides aminés

Plus en détail

Alexandre Florimond, Philippe Chouteau, Nicole Defer, Aurore Gaudin, Jacqueline Polyte, Hervé Lerat et Jean-Michel Pawlotsky

Alexandre Florimond, Philippe Chouteau, Nicole Defer, Aurore Gaudin, Jacqueline Polyte, Hervé Lerat et Jean-Michel Pawlotsky Dérégulation du cycle cellulaire et activation de la réponse aux dommages de l'adn par les protéines du VHC, déclencheurs potentiels de l'hépatocarcinogenèse Alexandre Florimond, Philippe Chouteau, Nicole

Plus en détail

Structure de l Opéron Tryptophane

Structure de l Opéron Tryptophane Régulation de la transcription (procaryote) Structure de l Opéron Tryptophane Opéron anabolique 5 gènes de structure nécessaires à la synthèse du tryptophane Trp Trp Trp Trp Trp 1 Régulation de la transcription

Plus en détail

Modèle cellulaire du DNID: la cellule B

Modèle cellulaire du DNID: la cellule B Modèle cellulaire du DNID: la cellule B L étude des conséquences du diabète NID à l échelle cellulaire se concentre bien entendu sur les atteintes subies par les cellules B pancréatiques à l origine de

Plus en détail

Contrôle de l expression génétique chez les eucaryotes

Contrôle de l expression génétique chez les eucaryotes Contrôle de l expression génétique chez les eucaryotes 3 ème partie : synthèse, maturation & dégradation des protéines - Chapitre II : Régulation de la traduction Cours de Mr Le Dréan I Introduction transcriptome

Plus en détail

TD Révision BIO57. Connaissance et Technique du gène

TD Révision BIO57. Connaissance et Technique du gène TD Révision BIO57 Connaissance et Technique du gène Novembre 2007 Cécile BAUDOT cecile.baudot@medecine.univ-mrs.fr INSERM 910 «Génétique Médicale et Génomique Fonctionnelle» Maladies Neuromusculaires Le

Plus en détail

Fabrication des produits de thérapie génique : garantir la sécurité et la qualité des produits

Fabrication des produits de thérapie génique : garantir la sécurité et la qualité des produits Fabrication des produits de thérapie génique : garantir la sécurité et la qualité des produits DIAPOSITIVE 1 Cette présentation a trait à la fabrication des produits de thérapie génique, en termes de sécurité

Plus en détail

Biologie moléculaire et Génie génétique

Biologie moléculaire et Génie génétique Module 1 : Biologie moléculaire et Génie génétique Section 1 : STRUCTURES ET FONCTIONS DES ACIDES NUCLEIQUES Plutôt que de rechercher l'exhaustivité, on s'attachera à la clarification et la structuration

Plus en détail

Supplément : Exercice de biologie du développement

Supplément : Exercice de biologie du développement Supplément : Exercice de biologie du développement En cette fin de semestre, un tuteur de biologie fou de tristesse décide de se lancer dans l'étude d'une protéine impliquée dans le développement du Xénope

Plus en détail

Pipetez, chargez et observez!

Pipetez, chargez et observez! Ce document propose une activité préparatoire et une activité de prolongement à l activité Pipetez, chargez et observez! proposée aux élèves du 3 e, 4 e et 5 e secondaire en complément de la visite de

Plus en détail

LES MÉCANISMES MOLÉCULAIRES DE LA CARCINOGENÈSE

LES MÉCANISMES MOLÉCULAIRES DE LA CARCINOGENÈSE LES MÉCANISMES MOLÉCULAIRES DE LA CARCINOGENÈSE TOUT D ABORD UN PETIT HISTORIQUE 1910: Peyton ROUS découvre le virus qui porte son nom 1976: les oncogènes de certains virus ont une contrepartie cellulaire

Plus en détail

CORRECTION DES EXERCICES DE GENETIQUE SYNTHESE PROTEIQUE : P 136-137

CORRECTION DES EXERCICES DE GENETIQUE SYNTHESE PROTEIQUE : P 136-137 CORRECTION DES EXERCICES DE GENETIQUE SYNTHESE PROTEIQUE : P 136-137 Exercice 1 p 171 : définir en une phrase les mots suivants Polypeptide : chaine de plusieurs acides aminés. Séquence protéinique : séquence

Plus en détail

3.3. La dégénérescence cortico basale (DCB).19

3.3. La dégénérescence cortico basale (DCB).19 Table des matières I. Introduction 8 1.Aspects cliniques de la maladie d Alzheimer 9 1.1. Diagnostic clinique..9 1.2. Aspects épidémiologiques 9 1.3. Aspects génétiques..9 2. Lésions neuropathologiques

Plus en détail

LES BASES GENETIQUES DE LA SEP

LES BASES GENETIQUES DE LA SEP LES BASES GENETIQUES DE LA SEP Deux hypothèses sont possibles. Ou bien la SEP est liée à une anomalie génétique unique directement responsable de la maladie (dans ce cas il existe un gène de la SEP) ou

Plus en détail