INTRODUCTION À LA BIO-INFORMATIQUE

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimension: px
Commencer à balayer dès la page:

Download "INTRODUCTION À LA BIO-INFORMATIQUE"

Transcription

1 Biologie moléculaire INTRODUCTION À LA BIO-INFORMATIQUE Dans cette section, on désire vous donner une introduction sur l utilisation du site web du National Center for Biotechnology Information (NCBI) pour l analyse de données de séquences. FAIRE CONNAISSANCE AVEC LE SITE WEB DE NCBI Avant que vous utilisiez les diverses ressources du site de NCBI j aimerai que vous découvriez quelques un des outils disponibles que vous utiliserez au cours de l année. 1. Copier-coller cette adresse dans votre fureteur pour accéder au site.

2 Biologie moléculaire Cliquer sur "Resource list (A-Z)". Sur cette page se retrouve la majorité des liens que vous utiliserez durant l'année. 3. La première ressource que nous utiliserons est BLAST (Basic Local Alignment Search Tool). Alternativement, vous pouvez accéder rapidement à Blast à partir de la page d'accueil initiale (voir la page précédente de ce document) à partir du menu "Popular Resources". Explorons BLAST. Cliquer sur le lien BLAST. Vous devriez obtenir la page suivante :

3 Biologie moléculaire «BLAST» est une collection d engins de recherches de similarités conçus pour examiner toutes les bases de données de séquences indépendamment qu elle soit protéine ou ADN. «Nucleotide blast» compare une séquence nucléique d intérêt aux séquences d une base de données d acides nucléiques. «Protein blast» compare une séquence d acides aminés d intérêt aux séquences d une base de données de protéines. «Blastx» compare une séquence nucléique d intérêt traduite dans tous les cadres de lecture aux séquences d une banque de données de protéines. Vous pourriez utiliser cette option pour trouver les produits de traduction d une séquence nucléique inconnue. «Tblastn» compare une séquence d acides aminés d intérêt aux séquences d une base de données d acides nucléiques dont la traduction a été faite dans tous les cadres de lecture. «Tblastx» compare les traductions dans les six cadres de lectures d une séquence nucléique d intérêt aux séquences d une base de données d acides nucléiques traduites. En premier lieu, nous utiliserons ce programme pour obtenir de l information sur différentes séquences avec lesquelles vous allez travailler. Notez, une de ces séquences représente celle de l insertion que vous devez vérifier pour le projet I. 4. Cliquer sur l option "Nucleotide blast" (blastn). Vous devriez obtenir la page suivante:

4 Biologie moléculaire Avant de pouvoir faire l entrée de la séquence d intérêt, on doit s assurer que le format de celle-ci est compatible avec le logiciel. La majorité des logiciels qui traitent des séquences peuvent comprendre un format appelé FASTA. Le format FASTA est un fichier texte dépourvu de chiffres ou toute autre annotation qui est précédée par une ligne descriptive de texte. Voici un exemple : >John s sequence123 (Pesez «enter» après cette ligne) AACGTCGGATTCAGGTACCCAGGAAAACTACATCTC La première ligne de votre fichier doit débuter avec le symbole suivant : «>». Ce symbole informe le logiciel que cette ligne est descriptive seulement et que l information au sujet de la séquence débute sur la prochaine ligne. Vous pouvez écrire quoi que ce soit sur cette ligne pour identifier la séquence. La prochaine ligne représente la séquence. Obtenir le document texte des séquences inconnues disponible sur la page web de BIO3551, en suivant le lien: Séquences>Gènes inconnus. Ce document contient cinq séquences numérotées de 1-5. Convertir chacune des séquences au format FASTA. Vous pouvez faire cela dans «NOTEPAD» 6. Copier et coller la séquence dans la boite de requête de «nucleotide blast». Choisir la banque de données sur laquelle la recherche sera exécutée dans le menu «Choose Search Set». Choisir «other» puisque les séquences ne sont pas d origine humaine ou de souris et «nucleotide collection (nr/nt). (Voir l image ci-dessous) 7. Maintenant, choisir le logiciel qui fera la recherche à partir du menu «Program Selection». Choisir «Somewhat similar sequences (blastn)»

5 Biologie moléculaire Cliquer sur BLAST. Une nouvelle page apparaîtra vous indiquant d attendre pour que la requête soit complétée. Cela pourrait être très rapide ou très long en fonction de la charge sur le serveur du NCBI. 9. Une fois que votre requête aura été complétée, une nouvelle page sera ouverte indiquant les résultats de votre recherche. 10. Avant de procéder avec l analyse des résultats, nous allons changer les options du format. Cliquer sur «formatting options au haut de la page. Un nouveau menu apparaitra tel qu illustré ci-dessous: choisir l option Old view et ensuite cliquer sur Reformat.

6 Biologie moléculaire Les correspondances à votre séquence sont présentées sous trois formats. Un format graphique tel que celui-ci : Plus bas sur la page, un format textuel comme celui-ci :

7 Biologie moléculaire Et encore plus bas, les alignements des séquences : Pour cet exercice, le format qui nous intéresse c'est la liste des différents fichiers obtenus qui représentent des correspondances. Parmi l'information qui peut être retrouvée sont les valeurs suivantes : «Query coverage» : Cette valeur indique quelle étendue de votre séquence (de requête initiale) correspond à la séquence trouvée. Par exemple, si la requête initiale est de 631 nucléotides de long et BLAST peut aligner tous les 631 nucléotides de cette requête contre une des séquences dans la base de donnée, alors cela représenterait une couverture de 100%. Rappelez-vous, «Query coverage» ne prends pas en considération la longueur de la séquence retrouvée, mais seulement le pourcentage de la séquence de requête qui s aligne avec celle retrouvée. La valeur attendue (E) est un paramètre qui décrit le nombre de séquences qu on peut «s attendre» de retrouver par hasard lors de la recherche d'une base de données d'une taille particulière. Essentiellement, la valeur E décrit le bruit de fond aléatoire. Par exemple, une valeur E de 1 attribué à un résultat peut être interprétée comme signifiant que, dans une base de données de la taille actuelle on pourrait attendre à avoir une correspondance avec un score similaire simplement par hasard. La plus faible est la valeur E, ou le plus proche qu elle est de zéro, la plus «significative» est la correspondance. "

8 Biologie moléculaire «Ident.» : BLAST calcule le pourcentage d'identité entre la requête et le résultat pour un alignement de nucleotide à nucleotide. Comment expliquez-vous le fait que plus d'une séquence possède une identité de 100%? Notez que certaines des séquences représentent des séquences du génome entier! Par exemple, la première séquence de cette recherche. Pour cet exercice, vous souhaitez obtenir la séquence du gène et non celle du génome. Celles-ci sont parfois suivies de la lettre «G». Notez dans l'exemple ci-dessus que le fichier suivi d'un «G» indique 100% d'identité, mais seulement une couverture de 42%. Qu'est-ce que cela veut dire? 12. Obtenir les informations suivantes pour le premier fichier qui représente une séquence génique (suivi d un «G») plutôt que la séquence d un génome complet. Numéro d accession «Coverage» «Ident.» «E value» Cliquer sur le numéro d accession pour visualiser le fichier. Vous devriez obtenir la page suivante : To convert to FASTA

9 Biologie moléculaire Obtenir les informations suivantes à propos de la séquence à partir de ce fichier : La définition (N o 1) Le numéro d accession (N o 2) L organisme duquel cette séquence a été obtenue (N o 3) Le produit du gène (N o 4) Le numéro d accession («protein id») de cette protéine (N o 5) 14. Dans plusieurs des exercices ultérieurs, vous devrez obtenir et sauvegarder ces séquences sous format FASTA. Afin de changer la présentation à FASTA, choisir FASTA au haut de la page. Vous devriez être redirigé à une page telle que la suivante : 15. Vous pourriez maintenant sélectionner et copier la description qui est précédée par le symbole «>» ainsi que la séquence et la collée dans le programme de votre choix, ou dans «Notepad» si vous désiriez sauvegarder la séquence sous ce format. 16. Répéter les étapes 1-14 de cet exercice pour chacune des séquences disponibles dans le document des gènes inconnues.

La Bioinformatique fonctionnelle Retrouver les Gènes

La Bioinformatique fonctionnelle Retrouver les Gènes Biologie moléculaire-2016 1 La Bioinformatique fonctionnelle Retrouver les Gènes Le séquençage est devenu chose tellement courante, que dans les dernières années nous avons obtenu les séquences complètes

Plus en détail

INTRODUCTION À LA BIO-INFORMATIQUE

INTRODUCTION À LA BIO-INFORMATIQUE Biologie moléculaire-2017 1 INTRODUCTION À LA BIO-INFORMATIQUE Dans cette section, on désire vous donner une introduction sur l utilisation du site web du National Center for Biotechnology Information

Plus en détail

GUIDE D UTILISATION DYNAFORME ABRÉGÉ L outil de création de formulaires auto-validés

GUIDE D UTILISATION DYNAFORME ABRÉGÉ L outil de création de formulaires auto-validés GUIDE D UTILISATION DYNAFORME ABRÉGÉ L outil de création de formulaires auto-validés Document préparé par: FACULTÉ DES SCIENCES DE L ADMINISTRATION Services technologiques Québec, décembre 2005 TABLE DES

Plus en détail

Création de page Web. Microsoft Publisher. 1. Ouvrez Microsoft Publisher. 2. Cliquez sur Sites Web. 3. Choisissez un modèle

Création de page Web. Microsoft Publisher. 1. Ouvrez Microsoft Publisher. 2. Cliquez sur Sites Web. 3. Choisissez un modèle Création de page Web Microsoft Publisher 1. Ouvrez Microsoft Publisher 2. Cliquez sur Sites Web 3. Choisissez un modèle 4. Personnalisez votre jeu de couleurs et les options 5. Cliquez sur «créer», lorsque

Plus en détail

Guide d utilisation (STAT-TAB)

Guide d utilisation (STAT-TAB) Département fédéral de l'intérieur DFI Office fédéral de la statistique OFS Ressources et affaires internationales Guide d utilisation (STAT-TAB) Recherche de données interactives dans le Portail Statistique

Plus en détail

INSTALLATION & PARAMETRAGE DES CLIENTS DE SAUVEGARDE RESTAURATION DES SAUVEGARDES DEPUIS LE CLIENT DE SAUVEGARDE ET L INTERFACE WEB DE SUPERVISION

INSTALLATION & PARAMETRAGE DES CLIENTS DE SAUVEGARDE RESTAURATION DES SAUVEGARDES DEPUIS LE CLIENT DE SAUVEGARDE ET L INTERFACE WEB DE SUPERVISION INSTALLATION & PARAMETRAGE DES CLIENTS DE SAUVEGARDE RESTAURATION DES SAUVEGARDES DEPUIS LE CLIENT DE SAUVEGARDE ET L INTERFACE WEB DE SUPERVISION Date de dernière mise à jour : Février 2009 SOMMAIRE 1

Plus en détail

Introduction à Excel

Introduction à Excel Introduction à Excel Commentaires : Cet exercice a pour but de vous apprendre les fonctions rudimentaires du logiciel excel. C est seulement par la pratique que vous connaîtrez parfaitement le logiciel.

Plus en détail

Formulaires : Parametrages

Formulaires : Parametrages Guide utilisateur Formulaires : Parametrages Page 2 sur 24 Processus de validation Rédigé par Validé par Approuvé par BARTHONNET Lucile LE FEVRE Bertrand MOLIERE Corinne 25/03/2015 2015-04-09 2015-04-14

Plus en détail

Bilan Social Saisir ses données par Internet

Bilan Social Saisir ses données par Internet Bilan Social Saisir ses données par Internet Bilan Social 1 Saisir ses données par Internet 1 Description générale 2 Phase 1 : Connexion au système 2 a) Se connecter 2 b) Installation de Citrix si nécessaire

Plus en détail

IMPRESSION D UNE FEUILLE DE CALCUL OU D UN GRAPHIQUE

IMPRESSION D UNE FEUILLE DE CALCUL OU D UN GRAPHIQUE IMPRESSION D UNE FEUILLE DE CALCUL OU D UN GRAPHIQUE Pour imprimer une feuille de calcul, vous devez d abord définir la zone à imprimer (cette étape n est pas nécessaire si vous désirez imprimer tout le

Plus en détail

Guide d utilisation. Configurateur d échafaudage

Guide d utilisation. Configurateur d échafaudage Guide d utilisation «www.mefranvision.fr» Configurateur d échafaudage Edition du 15/06/2015 www.mefranvision.fr Page 1 sur 29 Table des matières 1. Avant propos... 4 2. Introduction... 4 3. Réglages à

Plus en détail

Ce TD se déroule sur 3 heures : vous devez donc consacrer environ 1 heure pour chacune des phases.

Ce TD se déroule sur 3 heures : vous devez donc consacrer environ 1 heure pour chacune des phases. TD Analyse de données pour l évaluation de l exposition Octobre 2014 1 Contexte et objectif du TD Pour réaliser une évaluation de l exposition d une population à un contaminant chimique, plusieurs sources

Plus en détail

Manuel d aide pour les logiciels Cat s Family

Manuel d aide pour les logiciels Cat s Family Manuel d aide pour les logiciels Cat s Family 1) Installation du logiciel... 2 2) Première connexion... 5 4) Page principale... 13 5) L administrateur... 15 a) Ajouter un administrateur... 15 b) Modifier

Plus en détail

Fiche n 10 : Statistiques et rapports avec Excel

Fiche n 10 : Statistiques et rapports avec Excel PlanningPME Planifiez en toute simplicité Fiche n 10 : Statistiques et rapports avec Excel I. Description... 2 II. Les statistiques depuis le menu Outils -> Statistiques... 2 III. Zoom sur la charge de

Plus en détail

Accès et utilisation d Outlook Web Access http://exchange.ulaval.ca

Accès et utilisation d Outlook Web Access http://exchange.ulaval.ca Accès et utilisation d Outlook Web Access http://exchange.ulaval.ca Faculté des sciences de l éducation Centre de services et de ressources technopédagogiques Table des matières 1. Introduction... Page

Plus en détail

L AUTOMATISATION DU FONCTIONNEMENT D UNE BASE DE DONNÉES

L AUTOMATISATION DU FONCTIONNEMENT D UNE BASE DE DONNÉES 1 L AUTOMATISATION DU FONCTIONNEMENT D UNE BASE DE DONNÉES Dans ce chapitre, nous allons automatiser le fonctionnement de la base de données. Jusqu à présent, nous avons créé différents objets, mais maintenant

Plus en détail

Guide d utilisation Service TFP Internet

Guide d utilisation Service TFP Internet 205, rue Saint-Édouard, C.P. 308 Drummondville (Québec) J2B 6W3 Service de la taxe scolaire Téléphone : (819) 478-6718 Télécopieur : (819) 478-6849 Guide d utilisation Service TFP Internet Institutions

Plus en détail

Manuel d utilisation du CMS

Manuel d utilisation du CMS Manuel d utilisation du CMS ---------------------------- Le gestionnaire de contenu Web et son manuel d utilisation sont une production Global-Média inc. Cet ouvrage est assujetti aux lois sur les droits

Plus en détail

Manuel utilisateur du site IReMus

Manuel utilisateur du site IReMus Manuel utilisateur du site IReMus Adresse du site : http://www.iremus.cnrs.fr CONNEXION AU SITE DU LABORATOIRE... 2 DEMANDER UN MOT DE PASSE... 4 CHANGER DE MOT DE PASSE APRÈS CONNEXION... 6 VOS ACCÈS...

Plus en détail

METTEZ VOUS-MÊME À JOUR VOTRE SITE AVEC

METTEZ VOUS-MÊME À JOUR VOTRE SITE AVEC METTEZ VOUS-MÊME À JOUR VOTRE SITE AVEC Comment est géré votre site internet? JOOMLA est un «système de gestion de contenu» qui vous permettra d administrer votre site internet en toute simplicité. Il

Plus en détail

La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST.

La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST. La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST. Gaël Le Mahec - p. 1/12 L algorithme BLAST. Basic Local Alignment Search Tool est un algorithme de recherche

Plus en détail

Informatique de gestion. Description du thème : gestion des réservations dans un hôtel. Mysql, publipostage, requête SQL, privilèges.

Informatique de gestion. Description du thème : gestion des réservations dans un hôtel. Mysql, publipostage, requête SQL, privilèges. Informatique et gestion Description du thème : gestion des réservations dans un hôtel Mots-clés : Niveau : Domaine(s) : Type(s) de ressource : Objectifs : Mysql, publipostage, requête SQL, privilèges Terminale

Plus en détail

Tramway version 3.0. Trucs et astuces

Tramway version 3.0. Trucs et astuces Tramway version 3.0 Trucs et astuces Astuce #1 : Se brancher dans Tramway pour la première fois But : Démontrer les étapes nécessaires au branchement dans Tramway Outil nécessaire : fureteur Internet 1.

Plus en détail

Web-Interactive Mai 2010. Interactive 2.0. Manuel d utilisation

Web-Interactive Mai 2010. Interactive 2.0. Manuel d utilisation Interactive 2.0 Manuel d utilisation 1 Contenu Chapitre 1 : L Arborescence... 3 Créer un menu.... 3 Ordonner les menus... 6 Destruction d un menu.... 6 Chapitre 2 : Les pages... 7 Titre de votre page....

Plus en détail

Guide pour créer un compte Simply Publisher

Guide pour créer un compte Simply Publisher Créez votre compte Créez votre compte > Devenez éditeur Accédez à Simply Publisher. Commencez la procédure pour créer votre compte Créez votre compte Créez votre compte > Données d état civil Remplissez

Plus en détail

MANUEL D INSTALLATION et GUIDE UTILISATEUR LOGICIEL CONCEPT DRAW

MANUEL D INSTALLATION et GUIDE UTILISATEUR LOGICIEL CONCEPT DRAW MANUEL D INSTALLATION et GUIDE UTILISATEUR LOGICIEL CONCEPT DRAW INSTALLATION : A partir de votre poste de travail, cliquez sur le dossier «Concept Draw». Ensuite, double-cliquez sur l icône suivant :

Plus en détail

SUPPORT DE FORMATION WORD : niveau 2

SUPPORT DE FORMATION WORD : niveau 2 SUPPORT DE FORMATION WORD : niveau 2 Espace public multimédia Le Cyber 49, rue Maurice Thorez 92000 Nanterre - Tél. : 01 41 20 08 41 www.nanterre.fr Sommaire Introduction...3 I. Bordures et trame... 4

Plus en détail

SOMMAIRE. Choisir le sens d impression de la page. Pages 3 et 4 Insérer un tableau. Fusionner des cellules. Orientation du texte

SOMMAIRE. Choisir le sens d impression de la page. Pages 3 et 4 Insérer un tableau. Fusionner des cellules. Orientation du texte Voici quelques fiches conseils pour faire un tableau avec WORD. On peut aussi utiliser une autre méthode qui consiste à dessiner le tableau. Nous l aborderons dans d autres fiches. Page 2 SOMMAIRE Choisir

Plus en détail

Manuel moteur de recherche «Trouve ton échange»

Manuel moteur de recherche «Trouve ton échange» Manuel moteur de recherche «Trouve ton échange» Paris, 12/11/15 1 Inscription Si vous avez déjà un compte, veuillez vous connecter sur http://trouvetonechange.ofaj.org/wp/wp-login.php Vous pouvez vous

Plus en détail

Atelier d initiation. Initiation au traitement de texte

Atelier d initiation. Initiation au traitement de texte Atelier d initiation Initiation au traitement de texte 1 Contenu de l atelier Qu est-ce qu un traitement de texte?... 1 Ouverture de Word... 1 Ouverture du traitement de texte... 1 Fermeture du traitement

Plus en détail

1 Documentation FastSite. Documentation FastSite

1 Documentation FastSite. Documentation FastSite 1 Documentation FastSite Documentation FastSite 2 Documentation FastSite Sommaire A propos... 3 Les prestations de la plateforme... 3 Les informations pré-requises... 4 Le fonctionnement... 6 Les langues...

Plus en détail

ÉTAPES À SUIVRE POUR CRÉER UN PROFIL ET POSTULER EN LIGNE

ÉTAPES À SUIVRE POUR CRÉER UN PROFIL ET POSTULER EN LIGNE ÉTAPES À SUIVRE POUR CRÉER UN PROFIL ET POSTULER EN LIGNE Ce document a pour objectif de vous guider dans votre processus d application en ligne. Veuillez prévoir environ 15 minutes pour postuler sur l

Plus en détail

G U I D E E T U D I A N T P S T A G E V 2 SOMMAIRE

G U I D E E T U D I A N T P S T A G E V 2 SOMMAIRE G U I D E E T U D I A N T P S T A G E V 2 Gestion des conventions de stages, des offres de stages et d emplois SOMMAIRE 1. PRÉSENTATION DE L OUTIL... 2 1.1. ACCÈS À L APPLICATION... 2 2. CRÉER UNE CONVENTION

Plus en détail

FREEMIND ET LA GESTION DE PROJET

FREEMIND ET LA GESTION DE PROJET FREEMIND ET LA GESTION DE PROJET Il existe plusieurs catégories de logiciels spécifiquement conçus pour la gestion de projet. Ceux-ci sont généralement composés de fonctions qui viennent appuyer les différents

Plus en détail

Composant pour Microsoft Outlook. Collaborez en utilisant Outlook et MDaemon

Composant pour Microsoft Outlook. Collaborez en utilisant Outlook et MDaemon MDaemon GroupWare Composant pour Microsoft Outlook Collaborez en utilisant Outlook et MDaemon Version 1 Manuel Utilisateur 2003 Alt-N Technologies. Tous droits réservés. MDaemon, WorldClient, et RelayFax

Plus en détail

Comment créer un site Wordpress? Mode d emploi

Comment créer un site Wordpress? Mode d emploi Comment créer un site Wordpress? Mode d emploi Table des matières 1 Introduction... 3 2 Le chemin à suivre... 3 2.1 Choisir un hébergeur... 3 2.2 Obtenir ou acheter un nom de domaine... 4 2.3 Choisir ou

Plus en détail

PRESENTATION ET UTILISATION COURANTE

PRESENTATION ET UTILISATION COURANTE PRESENTATION ET UTILISATION COURANTE 1- PRESENTATION Remplaçant Sertifal depuis le 1 er février 2007, Sertifup 1 est composé de deux modules principaux : - Un site web( www.sertifup.fr ) dont l accès est

Plus en détail

360-ESZ-03 Logiciels appliqués en sciences. Microsoft Word. Document de travail portant sur l utilisation de Word. Par Votre nom

360-ESZ-03 Logiciels appliqués en sciences. Microsoft Word. Document de travail portant sur l utilisation de Word. Par Votre nom 360-ESZ-03 Logiciels appliqués en sciences Microsoft Word Document de travail portant sur l utilisation de Word Par Votre nom Pour Nom de votre professeur Remis le jour/mois/année Introduction Word est

Plus en détail

Téléchargement du Logiciel

Téléchargement du Logiciel Téléchargement du Logiciel Etude conduite dans le cadre du projet CASDAR Santé financé par le Ministère de l Agriculture et de la Pêche Cahier du logiciel 1 1 - Accéder au logiciel Afin de pouvoir accéder

Plus en détail

SERVICES EN LIGNE DES SUBVENTIONS ET GUIDE DE L UTILISATEUR POUR LA GESTION CONTRIBUTIONS (SELSC) DE COMPTE DU SYSTEME SELSC

SERVICES EN LIGNE DES SUBVENTIONS ET GUIDE DE L UTILISATEUR POUR LA GESTION CONTRIBUTIONS (SELSC) DE COMPTE DU SYSTEME SELSC SERVICES EN LIGNE DES SUBVENTIONS ET CONTRIBUTIONS (SELSC) GUIDE DE L UTILISATEUR POUR LA GESTION DE COMPTE DU SYSTEME SELSC FEVRIER 2016 TABLE DES MATIÈRES INTRODUCTION... 1 1. MODIFIER LE PROFIL PROFESSIONNEL...

Plus en détail

Prise en main ProConcept ERP. Version 11.1 Web

Prise en main ProConcept ERP. Version 11.1 Web Prise en main ProConcept ERP Version 11.1 Web Version du 08.10.2015 Table des matières 1. Lancement de ProConcept Web ERP 11.1... 4 1.1. Définir la page ProConcept ERP comme page de démarrage... 5 1.2.

Plus en détail

Notice de présentation. Edition de photos du Registre Parcellaire Graphique (RPG)

Notice de présentation. Edition de photos du Registre Parcellaire Graphique (RPG) Notice de présentation Edition de photos du Registre Parcellaire Graphique (RPG) Document mis à jour le 02 avril 2013 Table des matières NOTICE DE PRESENTATION... 1 INTRODUCTION... 3 A savoir avant de

Plus en détail

CRÉATION D EXERCICES INTERACTIFS AVEC HOT POTATOES

CRÉATION D EXERCICES INTERACTIFS AVEC HOT POTATOES CRÉATION D EXERCICES INTERACTIFS AVEC HOT POTATOES Dans la section downloads. Choisir la version auto-extractible. INTRODUCTION Version 6 Pour télécharger : http://hotpot.uvic.ca/ Ce logiciel permet de

Plus en détail

1. Conditions préalables. 2. Créer un compte Web. 3. Se connecter

1. Conditions préalables. 2. Créer un compte Web. 3. Se connecter F Introduction COMMENT ACCÉDER AU PORTAIL PARTENAIRES DE SERVICE TOLL COLLECT Sommaire 1. Conditions préalables 2. Créer un compte Web 3. Se connecter 4. Utiliser le portail Partenaires de service 5. Sous-comptes

Plus en détail

Pour ouvrir la fenêtre Structure territoriale: 1. A partir du menu Saisie de données, sélectionner Zones de structure

Pour ouvrir la fenêtre Structure territoriale: 1. A partir du menu Saisie de données, sélectionner Zones de structure Les noms de structure territoriale qui s affichent dans la fenêtre Structure territoriale de la fenêtre Navigation IMSMA sont créés via la fenêtre Structure territoriale. Pour ouvrir la fenêtre Structure

Plus en détail

INSTALLATION CONFIGURATION D OWNCLOUD. La réponse informatique

INSTALLATION CONFIGURATION D OWNCLOUD. La réponse informatique INSTALLATION CONFIGURATION D OWNCLOUD La réponse informatique Le but de cette documentation est de vous montrer comment installer le logiciel OWNCLOUD sur votre ordinateur Windows et MAC I- Installation

Plus en détail

TP : Utilisation & Configuration de Tuleap-campus

TP : Utilisation & Configuration de Tuleap-campus TP : Utilisation & Configuration de Tuleap-campus Tuleap-campus est un outil ALM. Vous venez de voir les grands principes de l'alm au travers du cours théorique. Nous allons voir ensemble à quoi ressemble

Plus en détail

Installation du logiciel «EASY WEB» Version 2.0

Installation du logiciel «EASY WEB» Version 2.0 Installation du logiciel «EASY WEB» Version 2.0 1 Installation Après téléchargement de votre logiciel, il suffit de lancer l exécutable d installation, en l occurrence easyweb_install.exe. Il se peut que

Plus en détail

Comment partager une vidéo sur un site web CHM?

Comment partager une vidéo sur un site web CHM? Comment partager une vidéo sur un site web CHM? Il se peut que vous vouliez partager des vidéos de rencontres, de projets de sensibilisation, ou autre sur votre site web CHM. Attention, les vidéos doivent

Plus en détail

TABLE DES MATIÈRES. Ouvrir une session.p. 2. Mot de passe perdu p. 3. Recherche de produits.. p. 3-4-5. Recherche encre et toner..p.

TABLE DES MATIÈRES. Ouvrir une session.p. 2. Mot de passe perdu p. 3. Recherche de produits.. p. 3-4-5. Recherche encre et toner..p. TABLE DES MATIÈRES Ouvrir une session.p. 2 Mot de passe perdu p. 3 Recherche de produits.. p. 3-4-5 Recherche encre et toner..p. 6 Placer une commande.. p. 7-8 Commande rapide..p. 9-10 Listes d achats.p.

Plus en détail

Comment s enregistrer au site

Comment s enregistrer au site Comment s enregistrer au site Etape 1 : trouver l espace adhérent dans la colonne de droite Pour commencer l enregistrement cliquez sur «s enregistrer au site». Etape 2 : formulaire d inscription Remplir

Plus en détail

NAS 206 Utiliser le NAS avec Windows Active Directory

NAS 206 Utiliser le NAS avec Windows Active Directory NAS 206 Utiliser le NAS avec Windows Active Directory Connecter votre NAS à un domaine Windows Active Directory C O L L E G E A S U S T O R OBJECTIFS DU COURS À la fin de ce cours, vous devriez : 1. Avoir

Plus en détail

GUIDE D UTILISATION. 1. Installation du logiciel. 2. La page d accueil. 3. Créer une évaluation

GUIDE D UTILISATION. 1. Installation du logiciel. 2. La page d accueil. 3. Créer une évaluation GUIDE D UTILISATION 1. Installation du logiciel Afin d installer le logiciel, veuillez vous assurer que vous disposez des droits d administrateur sur votre ordinateur (par exemple, ordinateur personnel

Plus en détail

Découvrir l environnement de Microsoft Office EXCEL 2010

Découvrir l environnement de Microsoft Office EXCEL 2010 1 Fiche ressource 1. Qu est-ce qu un tableur? 2. Terminologie 3. Démarrer Excel 2010 4. L interface d Excel 5. Fermer un document Excel 6. Quitter Excel Découvrir l environnement de Microsoft Office EXCEL

Plus en détail

La protection de vos données

La protection de vos données www.labo77.fr g.alex@labo77.fr Pour son second anniversaire, le billet du labo change de look mais pas d'objectifs. Il souhaite vous rendre l'informatique toujours plus facile et ludique en se mettant

Plus en détail

Utilitaires Ellipses / Analyse des Ventes Activités des Caisses

Utilitaires Ellipses / Analyse des Ventes Activités des Caisses Utilitaires Ellipses / Analyse des Ventes Activités des Caisses I Préambule Cet utilitaire est accessible dans Ellipses via le menu «Utilitaires» / «C Compléments» puis «Analyse des Ventes» Ce programme

Plus en détail

Installation du logiciel Windows Suivant Démarrer Tous les programmes Démarrer Tous les programmes Manager Pub Manager Publicité Linux ici Mac

Installation du logiciel Windows Suivant Démarrer Tous les programmes Démarrer Tous les programmes Manager Pub Manager Publicité Linux ici Mac Avec le Manager Publicité de bluevizia toutes vos activités de publicité seront facilement planifiées et implémentées. Installation du logiciel Windows Double cliquez avec le bouton gauche de la souris

Plus en détail

Mise à jour de la paie client serveur - norme SEPA

Mise à jour de la paie client serveur - norme SEPA La dans la paie client serveur La mise à jours de la dans la paie peut se faire à partir de la version paie 3.22.x. Celle-ci est disponible sur le dernier CD envoyé en octobre 2013. Suite à l'installation

Plus en détail

Fiche n 8 : Création de champs supplémentaires

Fiche n 8 : Création de champs supplémentaires PlanningPME Planifiez en toute simplicité Fiche n 8 : Création de champs supplémentaires I. Description... 2 II. Paramétrage des champs supplémentaires... 2 III. Les différents types de champs... 7 IV.

Plus en détail

Utilisation de l Explorateur Windows et Gestion de l Information

Utilisation de l Explorateur Windows et Gestion de l Information Utilisation de l Explorateur Windows et Gestion de l Information I Les périphériques de stockage. La seule mémoire centrale fournie avec la carte mère possède une capacité limitée qui ne permet de stocker

Plus en détail

Decade 0.40. Manuel de prise en main

Decade 0.40. Manuel de prise en main Decade 0.40 Manuel de prise en main Thomas Paviot 25 novembre 2005 Dernière modification : 2 mars 2006 thomas.paviot@free.fr www.decade-dynamics.org Pendule double - 1 - Decade 0.40 Prise en main Avertissements

Plus en détail

Paramétrer une adresse mail sur le logiciel Outlook Express Messagerie - Outlook Express

Paramétrer une adresse mail sur le logiciel Outlook Express Messagerie - Outlook Express Messagerie - Outlook Découvrons ensemble et pas à pas comment paramétrer une adresse mail sur le logiciel Outlook Messagerie - Outlook Voici l écran qui s affiche sur l accueil du logiciel Outlook Messagerie

Plus en détail

TUTORIEL OPEN OFFICE WRITER

TUTORIEL OPEN OFFICE WRITER TUTORIEL OPEN OFFICE WRITER Janvier 2012 Table des matières 1Présentation du logiciel... 3 2Création d'un document... 3 3Format des pages et pied de page... 4 3.1Format des pages... 4 3.2Pied de page...

Plus en détail

Utilisation du «Web-VPN» HES-SO FR

Utilisation du «Web-VPN» HES-SO FR Utilisation du «Web-VPN» HES-SO FR Version Date Description 0.3 02.09.2009 Memo pour la connexion et l utilisation du «Web-VPN». Tables des matières 1 Introduction... 1 2 Authentification... 2 3 Utilisation...

Plus en détail

Vade-mecum Intranet du site www.reseau-pwdr.be

Vade-mecum Intranet du site www.reseau-pwdr.be Vade-mecum Intranet du site www.reseau-pwdr.be Le RwDR s est doté d un nouveau site web équipé d un Intranet via lequel vous pouvez proposer du contenu, utiliser le forum ou le Cloud. En haut à droite

Plus en détail

Fiche n 2 : Création de tâches

Fiche n 2 : Création de tâches PlanningPME Planifiez en toute simplicité Fiche n 2 : Création de tâches I. Description... 2 II. Comment créer une tâche?... 2 III. Création de tâches multi ressources... 9 IV. Création de tâches périodiques...

Plus en détail

Groupe Eyrolles, 2003, ISBN : 2-212-11317-X

Groupe Eyrolles, 2003, ISBN : 2-212-11317-X Groupe Eyrolles, 2003, ISBN : 2-212-11317-X 3 Création de pages dynamiques courantes Dans le chapitre précédent, nous avons installé et configuré tous les éléments indispensables à la mise en œuvre d une

Plus en détail

Création de site Web à l aide de l outil SimpliSite

Création de site Web à l aide de l outil SimpliSite Centre de documentation sur l éducation des adultes et la condition féminine (CDÉACF) Création de site Web à l aide de l outil SimpliSite Par François Dallaire CDÉACF Décembre 2006 Création de site Web

Plus en détail

Utilisation d Unix au travers de XWin32

Utilisation d Unix au travers de XWin32 Utilisation d Unix au travers de XWin32 Jean-Yves Didier 19 décembre 2006 Résumé : Le programme XWin32 est un serveur X Window 1 qui permet, grâce à l architecture des systèmes d exploitation de type Unix,

Plus en détail

Sage Reports Guide d installation et d utilisation 26.01.2015

Sage Reports Guide d installation et d utilisation 26.01.2015 Sage Reports Guide d installation et d utilisation 26.01.2015 Tables des matières Sage Reports - Guide d installation et d utilisation Tables des matières 2 1.0 Avant-propos 3 2.0 Prérequis, installation

Plus en détail

Tutoriel sur la création et la gestion des demandes de rendez-vous en ligne sur le site internet du CHU de Bordeaux

Tutoriel sur la création et la gestion des demandes de rendez-vous en ligne sur le site internet du CHU de Bordeaux Tutoriel sur la création et la gestion des demandes de rendez-vous en ligne sur le site internet du CHU de Bordeaux L outil de gestion des demandes de rendez-vous en ligne va vous permettre de définir

Plus en détail

Initiation à l informatique et son matériel Médiathèque de Bussy Saint-Georges SURVEILLEZ VOS MISES A JOUR

Initiation à l informatique et son matériel Médiathèque de Bussy Saint-Georges SURVEILLEZ VOS MISES A JOUR SURVEILLEZ VOS MISES A JOUR SOMMAIRE : I METTRE À JOUR WINDOWS.PAGES 3-8 1.1 - Mettre automatiquement à jour votre système Page 3 1.2 - Mises à jour manuelles...pages 4-5 1.3 - Le Service Pack...Pages

Plus en détail

Insérer des images dans un texte.

Insérer des images dans un texte. Insérer des images dans un texte. 1 Insérer des images dans un texte. Le traitement de texte Word vous permet d insérer des images, des graphiques dans votre document. Toutefois plus vous placez d images

Plus en détail

GUIDE D INSTALLATION DXO OPTICS PRO 6

GUIDE D INSTALLATION DXO OPTICS PRO 6 GUIDE D INSTALLATION DXO OPTICS PRO 6 Merci de votre intérêt pour DxO Optics Pro! Vous trouverez ci-dessous des informations concernant l achat, l installation, l activation et la mise à jour du logiciel.

Plus en détail

SUPPORT WINDEV NUMERO 1

SUPPORT WINDEV NUMERO 1 SUPPORT WINDEV NUMERO 1 29/01/2015 Présentation et premier développement guidé L'objectif de ce premier support est de vous faire programmer de façon simple tout en vous accompagnant pour que vous preniez

Plus en détail

Règles et procédures de modifications de projet et de révision des décisions de financement

Règles et procédures de modifications de projet et de révision des décisions de financement Règles et procédures de modifications de projet et de révision des décisions de financement Guide Utilisateur pour compléter le Formulaire de Modification Investir dans notre futur commun Guide Utilisateur

Plus en détail

Initiation à Powerpoint

Initiation à Powerpoint Initiation à Powerpoint Powerpoint est un logiciel de PréAO, c est à dire de Présentation Assistée par Ordinateur. Il vous permet de créer et de mettre en page des présentations susceptibles d être projetées

Plus en détail

Démarrer avec la facturation Version Business

Démarrer avec la facturation Version Business Démarrer avec la facturation Version Business 1 Bienvenue dans le module de facturation - Version Business Ce document est conçu afin de vous aider à travailler de manière efficace avec le module de facturation

Plus en détail

Tutoriel version pour le système pupitre de l'académie de Lille. version du logiciel: 05 Janvier 2011(v1)

Tutoriel version pour le système pupitre de l'académie de Lille. version du logiciel: 05 Janvier 2011(v1) Tutoriel version pour le système pupitre de l'académie de Lille version du logiciel: 05 Janvier 2011(v1) Préambule: Logiciel initié dans le cadre du Groupe de production pupitre SVT de l'académie de Lille.

Plus en détail

Section 1 - S inscrire aux «Services à l employé de la CSKRDL»?

Section 1 - S inscrire aux «Services à l employé de la CSKRDL»? Inscription au relevé de salaire Web Il est désormais possible de consulter vos relevés de salaire via Internet. En vous abonnant au relevé de salaire Web, vous ne recevrez plus de copie papier de votre

Plus en détail

Le traitement de texte

Le traitement de texte Le traitement de texte Tous les logiciels de traitement de texte disponibles sur vos machines se ressemblent plus ou moins, puisque proposant les même fonctions dans un même but. J'ai choisi de vous faire

Plus en détail

2.4 - Installer le module de gestion moveon - Version MS Access

2.4 - Installer le module de gestion moveon - Version MS Access 2.4 - Installer le module de gestion moveon - Version MS Access Le module de gestion moveon est constitué de deux éléments : le client moveon et la base de données moveon. Le client moveon contient l ensemble

Plus en détail

Plate-forme de formation Moodle Manuel de l'enseignant

Plate-forme de formation Moodle Manuel de l'enseignant Premiers pas SIME Plate-forme de formation Moodle Manuel de l'enseignant Présentation 3 Vous souhaitez créer un cours sur Moodle. 4 Première inscription sur la plate-forme Moodle 4 Modifier votre profil.

Plus en détail

Utilisation de Sarbacane 3 Sarbacane Software

Utilisation de Sarbacane 3 Sarbacane Software Tutorial par Anthony Da Cruz Utilisation de Sarbacane 3 Sarbacane Software Ambiance Soleil 17 Rue Royale 74000, Annecy Sommaire 1. Présentation générale 2. Guide étape par étape 3. Astuces de l éditeur

Plus en détail

Espace Client. Manuel d'utilisation

Espace Client. Manuel d'utilisation Espace Client Manuel d'utilisation Sommaire Connexion et navigation générale 3 1ère Connexion 4 Oubli de mot de passe 7 Connexion 9 Menus de navigation 10 Entête & pied de page 11 Personnalisation du mot

Plus en détail

1. Présentation du projet... Page 2. 2. Navigateur... Page 3. 3. Comment utiliser son navigateur. Page 4. 4. Page d accueil...

1. Présentation du projet... Page 2. 2. Navigateur... Page 3. 3. Comment utiliser son navigateur. Page 4. 4. Page d accueil... Table des matie res 1. Présentation du projet... Page 2 2. Navigateur... Page 3 2.1. Qu est-ce qu un navigateur? 2.2. Ouvrir son navigateur? 2.2.1. Dans Windows 7, 8, 8.1 et 10 3. Comment utiliser son

Plus en détail

FACILITER L'ACCÈS AUX RESSOURCES NUMÉRIQUES DEPUIS SES ESPACES DE PUBLICATION

FACILITER L'ACCÈS AUX RESSOURCES NUMÉRIQUES DEPUIS SES ESPACES DE PUBLICATION L U D O V I A 2 0 1 2 FACILITER L'ACCÈS AUX RESSOURCES NUMÉRIQUES DEPUIS SES ESPACES DE PUBLICATION Karen Chabriac - CRDP de l académie de Toulouse USAGE D UN MOTEUR DE RECHERCHE PERSONNALISÉ Google CSE

Plus en détail

Ordinateur, programme et langage

Ordinateur, programme et langage 1 Ordinateur, programme et langage Ce chapitre expose tout d abord les notions de programme et de traitement de l information. Nous examinerons ensuite le rôle de l ordinateur et ses différents constituants.

Plus en détail

Procédure d installation du client Outlook

Procédure d installation du client Outlook Procédure d installation du client Outlook GDI ASQ-Procédure d'installation du client Outlook.doc 1 de 22 1. Cette procédure prendra environ 45 minutes de votre temps. Pour assistance lors de l installation,

Plus en détail

Tutoriel : AccÄs Å un Service Web (GoogleSearch API) avec Visual Basic.Net 2003. Table des matiäres

Tutoriel : AccÄs Å un Service Web (GoogleSearch API) avec Visual Basic.Net 2003. Table des matiäres Tutoriel : AccÄs Å un Service Web (GoogleSearch API) avec Visual Basic.Net 2003 Table des matiäres INTRODUCTION 2 QU EST-CE QU UN SERVICE WEB??? 2 LES PRELIMINAIRES 2 LE DESIGN DE LA FICHE DE RECHERCHE

Plus en détail

Guide de démarrage rapide

Guide de démarrage rapide Guide de démarrage rapide L aspect de Microsoft Access 2013 étant différent par rapport aux versions précédentes, nous avons créé ce guide pour vous aider à être opérationnel au plus vite. Modifier la

Plus en détail

SECTION 3. Aperçu de la boîte à outils logiciels. B IBLIOTHÈQUE N UMÉRIQUE DES C ARAÏBES (dloc) Dans cette section

SECTION 3. Aperçu de la boîte à outils logiciels. B IBLIOTHÈQUE N UMÉRIQUE DES C ARAÏBES (dloc) Dans cette section SECTION 3 Aperçu de la boîte à outils logiciels Dans cette section Introduction Structure du répertoire Application du suivi Modèle de métadonnée Application pour le contrôle de la qualité Go dloc! Client

Plus en détail

Félicitations! Vous disposez désormais de votre armoire numérique en ligne.

Félicitations! Vous disposez désormais de votre armoire numérique en ligne. Félicitations! Vous disposez désormais de votre armoire numérique en ligne. Cette armoire va vous permettre : De mieux classer vos documents De mieux les retrouver De mieux les partager Ce petit guide

Plus en détail

Présentation de la feuille de calcul

Présentation de la feuille de calcul Le Classeur LibreOffice 3.6.4 LibreOffice est une suite bureautique, c est-à-dire un ensemble de logiciels pour créer et modifier des documents bureautiques, tels que des articles, des lettres, des tableaux

Plus en détail

Guide d utilisation en ligne des outils de Thomas International

Guide d utilisation en ligne des outils de Thomas International Guide d utilisation en ligne des outils de Thomas International Bienvenue sur notre site. Vous trouverez ci-dessous un guide pratique qui vous aidera dans l utilisation de notre site. En un clic, vous

Plus en détail

CabloCAD 2009. Démarrer avec CabloCAD. Tracer les chemins de câbles en fil CABLOFIL

CabloCAD 2009. Démarrer avec CabloCAD. Tracer les chemins de câbles en fil CABLOFIL CabloCAD 2009 CabloCAD 2009 est un logiciel permettant de tracer les chemins de câbles en fil CABLOFIL. Ce programme est un plugin des logiciels fréquemment utilisés pour de la CAO : AutoCAD, AutoCAD LT*,

Plus en détail

Test de recouvrement Version : 01-04-2014

Test de recouvrement Version : 01-04-2014 Table des matières 1. Introduction...1 1.1. Pré-requis...1 1.2. Trouver le formulaire sur le site de l ABES...1 2. Comment compléter le formulaire Test de recouvrement...3 3. Consulter, supprimer et imprimer

Plus en détail

Leçon N 2E Utilisation d un traitement de texte (2 ème partie)

Leçon N 2E Utilisation d un traitement de texte (2 ème partie) Leçon N 2E Utilisation d un traitement de texte (2 ème partie) Nous allons travailler sur la MISE EN FORME d un document. 1 Mise en forme des caractères Les logiciels Word et Writer regroupent les commandes

Plus en détail

Bienvenue dans le cours sur l ajout d une page web sur un site web développé avec le PTK

Bienvenue dans le cours sur l ajout d une page web sur un site web développé avec le PTK Centre d échange d informations sur la Convention sur la Diversité Biologique Bienvenue dans le cours sur l ajout d une page web sur un site web développé avec le PTK 1 Objectifs de ce manuel : Etre capable

Plus en détail

1- Présentation Excel :

1- Présentation Excel : - 1-1- Présentation Excel : A l ouverture d Excel, un classeur nommé «Classeur 1» s ouvre, il se compos de plusieurs feuilles (3 initiales et plus si besoin en passant par la barre de menu puis insertion).

Plus en détail