Modélisation de la structure 3D des protéines

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimension: px
Commencer à balayer dès la page:

Download "Modélisation de la structure 3D des protéines"

Transcription

1 Modélisation de la structure 3D des protéines We are drowning in data and starving for knowledge -R.D. Roger Unité Mathématique Informatique et Génome Séminaire AGENAE, Seignosse-le-Pénon, mai 2003 p.1/23

2 Du génome au phénotype repeats horizontal gene transfers nucleotide frequencies Protein function in the context of cellular processes: physiology PHENOTYPE GENOME high resolution cartography ESTs Transcriptomics, proteomics two hybrid proteomics: phenotypic features: Behavior morphology Protein function and cellular processes in the context of: tissues organs proteins, rrna, trna RBS, promotors, terminators, etc. post traductional modifications gene inactivation experiments gene expression protein interactions tissue and organ specificic transcriptomics, proteomics: ESTs Protein function inference domain detection intrinsic properties of sequences homology search gene context metabolic pathways signalling cascade cell structure Experimental data Other known genomes non orthologous gene displacements orthologs protein 3D structure modeling: protein engineering drug design, etc. contigs assembly prediction of gene associated signals: gene prediction: exceptional words expression patterns subcellular localisation prediction gene fusions gene neighbors cellular pathways comparison of missing genes phylogenetic profiles annotation process level annotation nucleotide level annotation protein level genetic markers genome comparisons Séminaire AGENAE, Seignosse-le-Pénon, mai 2003 p.2/23

3 Structure 3D et fonction les biologistes s intéressent à la fonction des protéines la fonction d une protéine dépend étroitement de la structure 3D la structure 3D est atteinte lors du repliement de la chaîne polypeptidique la séquence spécifie d une manière unique la structure 3D Séminaire AGENAE, Seignosse-le-Pénon, mai 2003 p.3/23

4 Structure 3D des protéines 1. Présence d un cœur hydrophobe très compact (les cavités représentent moins de 1% du volume) 2. Les angles φ, ψ et ω sont dans des zones de basse énergie (90% des φ, ψ dans 14% du diagramme de Ramachandran) 3. Tous les donneurs ou accepteurs potentiels de liaison hydrogène sont satisfaits 4. Empilement des chaînes latérales varie de spécifique à aléatoire 5. Structure 3D est dominée par les structures secondaires (50-60% des résidus en hélice ou feuillet) Séminaire AGENAE, Seignosse-le-Pénon, mai 2003 p.4/23

5 Modélisation de la structure 3D Plus ou moins difficile selon les cas : les méthodes utilisant une structure 3D connue (homologie) alignement de séquences et modélisation comparative méthodes de reconnaissance de repliements les autres méthodes... les méthodes ab initio les méthodes de novo Séminaire AGENAE, Seignosse-le-Pénon, mai 2003 p.5/23

6 Notion d homologie SP1 Orthologie, paralogie et xenologie DP1 SP2 DP2 A1 AB1 B1 B2 C1 C2 C3 2 gènes sont orthologues si leur ancetre commun est localisé à une jonction (spéciation) 2 gènes sont paralogues si leur ancetre commun est localisé sur une barre horizontale (duplication) C2 paralogue C3 C2 et C3 orthologues B2 mais paralogues B1 AB1 xenologue aux 6 autres Séminaire AGENAE, Seignosse-le-Pénon, mai 2003 p.6/23

7 Notion d homologie Évolution divergente à partir d un ancêtre commun orthologues paralogues Propriétés des protéines homologues très bonne conservation de la structure 3D fonctions «voisines» La structure 3D est toujours mieux conservée que la structure primaire Séminaire AGENAE, Seignosse-le-Pénon, mai 2003 p.7/23

8 Modélisation comparative Mise en évidence d une relation d homologie par comparaison des séquences Transfert de la fonction Utilisation de la structure 3D connue pour bâtir un modèle Méthodes utilisées depuis 25 ans qui sont bien rodées problème principal : qualité de l alignement problème annexe : modélisation des parties non conservées (boucles) Séminaire AGENAE, Seignosse-le-Pénon, mai 2003 p.8/23

9 Reconnaissance de repliements But : améliorer la détection des homologues lointains Rationnel : structure 3D meilleur critère que structure primaire nombre limité de repliements possibles Principe : alignement séquence structure 3D Méthode : Définition d une banque de «cœurs» Détermination de paramètres de scores Méthode pour aligner les séquences sur les structures 3D Estimation de la significativité du score Séminaire AGENAE, Seignosse-le-Pénon, mai 2003 p.9/23

10 Représentation schématique Définition du coeur s ij Alignement Calcul du score de l alignement Σ i<j s ij Estimation de la significativité du score Séminaire AGENAE, Seignosse-le-Pénon, mai 2003 p.10/23

11 Définition d un cœur Séminaire AGENAE, Seignosse-le-Pénon, mai 2003 p.11/23

12 Représentation schématique Séminaire AGENAE, Seignosse-le-Pénon, mai 2003 p.12/23

13 Fonction de score et filtres Utilisation de plusieurs fonctions de scores différentes (filtres) Combinaison des résultats réseaux de neurones machines à vecteurs supports (SVM) Séminaire AGENAE, Seignosse-le-Pénon, mai 2003 p.13/23

14 Alignement de la séquence sur un cœur Paramètres 1D (locaux) : programmation dynamique Paramètres 3D (non locaux) : algorithmes exacts : branch & bound, divide & conquer heuristiques Séminaire AGENAE, Seignosse-le-Pénon, mai 2003 p.14/23

15 Alignement de la séquence sur un cœur L = 12 M = 3 ~ n = 5 Nombre d alignements : (M+ñ 1)! M!(ñ 1)! Séminaire AGENAE, Seignosse-le-Pénon, mai 2003 p.15/23

16 Significativité du score Probabilité Population 2 sans relation avec le repliement DDEQWAST... SYTRAT... DEPQIY... cytochrome c Population 1 adoptant le repliement GVTEK... ALPSK... AVSTR... score 1 er quartile 4 e quartile GACST... séquence requête STELM... séquence test 1 AASVF... séquence test 2 Probabilité D VRSGA... séquence test N d score Séminaire AGENAE, Seignosse-le-Pénon, mai 2003 p.16/23

17 Problèmes informatiques Définition d une banque de «cœurs» comparaison des structures 3D des protéines (recherche de cliques) Détermination de paramètres de scores combinaison des résultats des différents filtres (SVM?) Méthode pour aligner les séquences sur les structures 3D optimisation combinatoire (branch & bound, programmation linéaire) Estimation de la significativité du score détermination théorique de la distribution des scores (statistiques) Séminaire AGENAE, Seignosse-le-Pénon, mai 2003 p.17/23

18 Méthode de novo Méthodes ab initio (approches physico-chimiques) modélisation du processus physique réel principal problème : taille de l espace à explorer Méthodes de novo (approches bioinformatiques) approche knowledge-based structure 3D est atteinte sans trop perturber la structure locale Séminaire AGENAE, Seignosse-le-Pénon, mai 2003 p.18/23

19 Méthode de novo Méthode proposée par D. Baker extraire des fragments pertinents des bases de données de structures 3D assembler ces fragments en structures 3D plausibles sélectionner «la meilleure» de ces structures 3D Séminaire AGENAE, Seignosse-le-Pénon, mai 2003 p.19/23

20 CASP 4 Séminaire AGENAE, Seignosse-le-Pénon, mai 2003 p.20/23

21 CASP 4 Séminaire AGENAE, Seignosse-le-Pénon, mai 2003 p.21/23

22 Diagramme de Ramachandran Séminaire AGENAE, Seignosse-le-Pénon, mai 2003 p.22/23

23 Combinaison des scores 3D normalized distance y = 3.2 y = 2x x = D normalized distance Séminaire AGENAE, Seignosse-le-Pénon, mai 2003 p.23/23

Prédiction de la Structure des Protéines. touzet@lifl.fr

Prédiction de la Structure des Protéines. touzet@lifl.fr Prédiction de la Structure des Protéines Hélène TOUZET touzet@lifl.fr Structure Structure Structure Structure primaire secondaire tertiaire quaternaire Exemple : la structure secondaire de la transthyretine

Plus en détail

Ce sont les macromolécules les plus abondantes dans les cellules vivantes.

Ce sont les macromolécules les plus abondantes dans les cellules vivantes. Les protéines Ce sont les macromolécules les plus abondantes dans les cellules vivantes. Au cours du temps l idée de la fonction biologique des protéines a évolué au fur et à mesure que leurs structure

Plus en détail

Introduction à la Bio-Informatique IFT3295/IFT6291/BIN6000. Nadia El-Mabrouk DIRO, Université de Montréal

Introduction à la Bio-Informatique IFT3295/IFT6291/BIN6000. Nadia El-Mabrouk DIRO, Université de Montréal Introduction à la Bio-Informatique IFT3295/IFT6291/BIN6000 Nadia El-Mabrouk DIRO, Université de Montréal Qu est-ce que la Bioinformatique? Qu est-ce que la Bio-informatique? Champs multi-disciplinaire

Plus en détail

Comparaison et alignement de séquences 2

Comparaison et alignement de séquences 2 Comparaison et alignement de séquences 2 LV348 -BI Sophie Pasek sophie.pasek@upmc.fr Comment comparer une séquence contre une banque? Comparaison séquence/banque Pourquoi? : Réunir un échantillon taxonomique

Plus en détail

MABioVis. Bio-informatique et la

MABioVis. Bio-informatique et la MABioVis Modèles et Algorithmes pour la Bio-informatique et la Visualisation Visite ENS Cachan 5 janvier 2011 MABioVis G GUY MELANÇON (PR UFR Maths Info / EPI GRAVITE) (là, maintenant) - MABioVis DAVID

Plus en détail

Comparaison et alignement. de séquences 2 LV348 -BI. sophie.pasek@upmc.fr. Sophie Pasek

Comparaison et alignement. de séquences 2 LV348 -BI. sophie.pasek@upmc.fr. Sophie Pasek Comparaison et alignement de séquences 2 LV348 -BI Sophie Pasek sophie.pasek@upmc.fr Comment comparer une séquence contre une banque? Comparaison séquence/banque Pourquoi? : Réunir un échantillon taxonomique

Plus en détail

ARN non codant et bioinformatique

ARN non codant et bioinformatique ARN non codant et bioinformatique Gènes? Deux types de gènes: gènes codant pour des protèines gènes à ARN Les familles d ARNs ARN ARNs codant ARNs non codants ARNm Ribozymes ARNs traduction Petits ARNs

Plus en détail

Apprentissage statistique Stratégie du Data-Mining

Apprentissage statistique Stratégie du Data-Mining Apprentissage statistique Stratégie du Data-Mining Hélène Milhem Institut de Mathématiques de Toulouse, INSA Toulouse, France IUP SID, 2011-2012 H. Milhem (IMT, INSA Toulouse) Apprentissage statistique

Plus en détail

Développement d un modèle d alignements flexibles pour la reconnaissance de repliements des protéines

Développement d un modèle d alignements flexibles pour la reconnaissance de repliements des protéines Développement d un modèle d alignements flexibles pour la reconnaissance de repliements des protéines Guillaume Collet INRA, unité Mathématique, Informatique et Génome 26 juin 2006 Guillaume Collet (MIG)

Plus en détail

VI. Domaines protéiques

VI. Domaines protéiques Chapitre 1 Structure des protéines I. Rappels Définitions II. La Protein Data Bank (PDB) III. Angles dièdres et diagramme de ramachandran IV. Structures secondaires V. Structures supersecondaires VI. Domaines

Plus en détail

TD5 : Prédiction de la structure tridimensionnelle d une protéine Modélisation moléculaire

TD5 : Prédiction de la structure tridimensionnelle d une protéine Modélisation moléculaire TD5 : Prédiction de la structure tridimensionnelle d une protéine Modélisation moléculaire Vous aurez besoin des programmes suivant : d un éditeur de séquence d un visualiseur de structure 3D (PyMOL) Avant-propos

Plus en détail

Calcul intensif en Bioinformatique

Calcul intensif en Bioinformatique Calcul intensif en Bioinformatique Réalisations en génétique et génomique évolutives Pôle Rhône Alpin de BioInformatique (PRABI) Laboratoire de Biologie et Biométrie Evolutives (LBBE) Contexte De plus

Plus en détail

Plan. Comparaison de 2 séquences. Dotplot, alignement optimal Recherche de similarité. Alignement multiple. Phylogénie moléculaire

Plan. Comparaison de 2 séquences. Dotplot, alignement optimal Recherche de similarité. Alignement multiple. Phylogénie moléculaire Plan 1 Banques de données 2 Comparaison de 2 séquences Dotplot, alignement optimal Recherche de similarité 3 Alignement multiple l 4 Phylogénie moléculaire Recherche de similarité 1 séquence (Query) comparée

Plus en détail

Réseaux neuronaux artificiels : exemples d applications géoscientifiques

Réseaux neuronaux artificiels : exemples d applications géoscientifiques Réseaux neuronaux artificiels : exemples d applications géoscientifiques Par Sylvain Trépanier CONSOREM, UQAM CONSOREM Consortium de recherche en exploration minérale Aurizon Cambior Majescor Falconbridge

Plus en détail

TD5 : Prédiction de la structure tridimensionnelle d une protéine Modélisation moléculaire

TD5 : Prédiction de la structure tridimensionnelle d une protéine Modélisation moléculaire TD5 : Prédiction de la structure tridimensionnelle d une protéine Modélisation moléculaire Avant de commencer le TD, installer (ou vérifier qu ils le sont) sur la partition K: du poste de travail, les

Plus en détail

Introduction à la bioinformatique

Introduction à la bioinformatique Faculté des Sciences - Rabat Laboratoire de Microbiologie et Biologie Moléculaire -------------------------------------- Université Mohamed V - Agdal Faculté des Sciences B.P. 1014 - Rabat - MAROC TD Biologie

Plus en détail

Objectif : identifier la mutation responsable de la maladie parmi les millions de polymorphisme.

Objectif : identifier la mutation responsable de la maladie parmi les millions de polymorphisme. Identification de gènes morbides Analyses mutationnelles Maladies monogéniques Objectif : identifier la mutation responsable de la maladie parmi les millions de polymorphisme. Plan : Variations du nombre

Plus en détail

leur solubilité dans des solutions salines leur forme leur fonction biologique leur mobilité électrophorétique ou leur coefficient de sédimentation

leur solubilité dans des solutions salines leur forme leur fonction biologique leur mobilité électrophorétique ou leur coefficient de sédimentation Les protéines peuvent être classées sur la base de: leur solubilité dans des solutions salines leur forme leur fonction biologique leur mobilité électrophorétique ou leur coefficient de sédimentation leur

Plus en détail

Reconnaissance d'objets routiers - Application

Reconnaissance d'objets routiers - Application Reconnaissance d'objets routiers - Application Perception pour la conduite automatisée A07 : Interaction Véhicule Environnement Aurélien Cord Aurelien.Cord@lcpc.fr Reconnaissance de piétons 2 1 Etat de

Plus en détail

TD Bioinformatique : Sequence Alignment. Pourquoi faire une recherche par similarité?

TD Bioinformatique : Sequence Alignment. Pourquoi faire une recherche par similarité? TD Bioinformatique : Sequence lignment Pourquoi faire une recherche par similarité? - Savoir si ma séquence ressemble à d'autres déjà connues. - Trouver toutes les séquences d'une même famille. - Rechercher

Plus en détail

Utilisation des diagrammes de Voronoï et des algorithmes génétiques pour l'étude des complexes protéine-protéine.

Utilisation des diagrammes de Voronoï et des algorithmes génétiques pour l'étude des complexes protéine-protéine. Utilisation des diagrammes de Voronoï et des algorithmes génétiques pour l'étude des complexes protéine-protéine. Anne Poupon Biologie et Bioinformatique des Systèmes de Signalisation INRA - Nouzilly France

Plus en détail

Bénéficier de nos savoir-faire pour mieux vous démarquer sur votre marché

Bénéficier de nos savoir-faire pour mieux vous démarquer sur votre marché 1 2 Bénéficier de nos savoir-faire pour mieux vous démarquer sur votre marché Tectura est un fournisseur mondial de conseil et de services liés à l intégration des solutions Microsoft Dynamics. Nous apportons

Plus en détail

Bioinformatique dans l IUP

Bioinformatique dans l IUP Bioinformatique dans l IUP Intervenants Equipe Bioinfo (Laboratoire d Informatique Fondamentale de Lille) Cours : Jean-Stéphane Varré (jean-stephane.varre@lifl.fr) TD sur machine : Jean-Stéphane Varré,

Plus en détail

Tests statistiques Formation «Analyse de données RNA-seq/ChiP-seq»

Tests statistiques Formation «Analyse de données RNA-seq/ChiP-seq» Tests statistiques Formation «Analyse de données RNA-seq/ChiP-seq» Guy Perrière Pôle Rhône-Alpes de Bioinformatique 14 novembre 2012 Guy Perrière (PRABI) Tests statistiques 14 novembre 2012 1 / 40 Plan

Plus en détail

Conception de Médicament

Conception de Médicament Conception de Médicament Approche classique HTS Chimie combinatoire Rational Drug Design Ligand based (QSAR) Structure based (ligand et ou macromolec.) 3DQSAR Docking Virtual screening Needle in a Haystack

Plus en détail

Chapitre 2 : Cycles de vie logiciel et méthodes de développement G L & A G L 2 0 1 4 / 2 0 1 5

Chapitre 2 : Cycles de vie logiciel et méthodes de développement G L & A G L 2 0 1 4 / 2 0 1 5 Chapitre 2 : Cycles de vie logiciel et méthodes de développement G L & A G L 2 0 1 4 / 2 0 1 5 Plan Chapitre 2 Modèles de cycles de vie Méthodes de développement : Méthode lourde Méthode agile Exemple

Plus en détail

La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST.

La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST. La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST. Gaël Le Mahec - p. 1/12 L algorithme BLAST. Basic Local Alignment Search Tool est un algorithme de recherche

Plus en détail

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq Présenté par Xi LIU ATCGCGCTAGCTGGTGTATCGCATCGCGCTAGCTGGTGTATCGCGCTAGCTGGTGTATCGCGCTAGCCTGGTGTATCGCCATCGCGCTAGCTGGCGCTAGCTGAATCGCGCATATG 17 Septembre 2013 Homéoallèles Génome Normalisation Analyse différentielle

Plus en détail

Ingénierie des protéines

Ingénierie des protéines Ingénierie des protéines Stéphane Delbecq EA 4558 Vaccination antiparasitaire Laboratoire de Biologie Cellulaire et Moléculaire Faculté de Pharmacie - Montpellier Rappel: transcription et traduction Universalité

Plus en détail

Familles de gènes. Nadia El-Mabrouk

Familles de gènes. Nadia El-Mabrouk Familles de gènes Nadia El-Mabrouk Les gènes Parties codantes de l ADN Unités de base de l héridité. Une fois les gènes identifiés, ils doivent être annotés pour leur fonction. Familles de gènes Des gènes

Plus en détail

Algorithmes pour la comparaison de séquences II

Algorithmes pour la comparaison de séquences II Algorithmes pour la comparaison de séquences II Hélène TOUZET touzet@lifl.fr Equipe Bioinfo Master recherche informatique www.lifl.fr/~touzet/masterrecherche.html Pourquoi comparer des séquences? Puisque

Plus en détail

Voyage Au Cœur Du Génome

Voyage Au Cœur Du Génome Voyage Au Cœur Du Génome Jean-Philippe.Vert@ensmp.fr ENSMP - CG - Bioinformatique 17 mars 2005 Une brève histoire 1866 : Lois de l hérédité (Mendel) 1909 : Morgan et les drosophilistes 1944 : L ADN est

Plus en détail

DIPLÔME UNIVERSITAIRE DE GENIE GENETIQUE. Le Diplôme Universitaire de Génie Génétique est obtenu par la validation de 3 modules parmi 4 proposés :

DIPLÔME UNIVERSITAIRE DE GENIE GENETIQUE. Le Diplôme Universitaire de Génie Génétique est obtenu par la validation de 3 modules parmi 4 proposés : DIPLÔME UNIVERSITAIRE DE GENIE GENETIQUE Le Diplôme Universitaire de Génie Génétique est obtenu par la validation de 3 modules parmi 4 proposés : Outre l assiduité, l évaluation individuelle est réalisée

Plus en détail

Curriculum Vitæ Kevin BLEAKLEY

Curriculum Vitæ Kevin BLEAKLEY Curriculum Vitæ Kevin BLEAKLEY DATE DE NAISSANCE 20 mai, 1978 NATIONALITE néo-zélandaise ADRESSE (personelle) 36, rue de la Montagne Sainte-Geneviève, Paris 75005, France ADRESSE (professionnelle) Institut

Plus en détail

Plan. Phylogénie. Plan Définition. Théorie de l évolution. Informatique Génomique - Master 1

Plan. Phylogénie. Plan Définition. Théorie de l évolution. Informatique Génomique - Master 1 Plan Phylogénie Informatique Génomique - Master 1 Guillaume Blin IGM-LabInfo UMR 8049, Bureau 4B066 Université de Marne La Vallée gblin@univ-mlv.fr http://igm.univ-mlv.fr/ gblin Présentation du problème

Plus en détail

Présentation succincte. Jean Cavarelli. Septembre 2014

Présentation succincte. Jean Cavarelli. Septembre 2014 Master Sciences du Vivant Spécialité Biologie structurale, bioinformatique et biotechnologies Parcours Biologie structurale intégrative et bio-informatique Présentation succincte. Jean Cavarelli Septembre

Plus en détail

Introduction. La bioinformatique : Traitement des informations biologiques par des méthodes informatiques et/ou mathématiques.

Introduction. La bioinformatique : Traitement des informations biologiques par des méthodes informatiques et/ou mathématiques. Introduction La bioinformatique : Traitement des informations biologiques par des méthodes informatiques et/ou mathématiques. Interdisciplinaire par nature, la bioinformatique est fondée sur les acquis

Plus en détail

Analyse informatique des données moléculaires

Analyse informatique des données moléculaires 6 - Bioinformatique F. CORPET, C. CHEVALET INRA, Laboratoire de Génétique Cellulaire, BP 27, 31326 Castanet-Tolosan cedex e-mail : chevalet@toulouse.inra.fr Analyse informatique des données moléculaires

Plus en détail

La CGH-array : une nouvelle technique de diagnostic en cytogénétique

La CGH-array : une nouvelle technique de diagnostic en cytogénétique La CGH-array : une nouvelle technique de diagnostic en cytogénétique Olivier Pichon (Ingénieur) Laboratoire de cytogénétique de Nantes, Service de Génétique Médicale Les techniques classiques de cytogénétique

Plus en détail

Hiver 2002 Petko Valtchev

Hiver 2002 Petko Valtchev Hiver 2002 Petko Valtchev 1 # Le processus de production # Concepts de base # Nature du processus et phases # Modèles de processus # Modèle en cascade # Modèle par prototypage # «Rapid Application Development»

Plus en détail

Analyse in silico de génomes, protéomes et transcriptomes. «Génomique comparative» V.2012.1. Protocole TD

Analyse in silico de génomes, protéomes et transcriptomes. «Génomique comparative» V.2012.1. Protocole TD Magistère Biotechnologies Analyse in silico de génomes, protéomes et transcriptomes «Génomique comparative» V.2012.1 Protocole TD Notes : Scripts et données sur : http://rna.igmors.u-psud.fr/gautheret/cours/analinsilico

Plus en détail

Les Réseaux de Neurones avec

Les Réseaux de Neurones avec Les Réseaux de Neurones avec Au cours des deux dernières décennies, l intérêt pour les réseaux de neurones s est accentué. Cela a commencé par les succès rencontrés par cette puissante technique dans beaucoup

Plus en détail

Distance et classification. Cours 4: Traitement du signal et reconnaissance de forme

Distance et classification. Cours 4: Traitement du signal et reconnaissance de forme Distance et classification Cours 4: Traitement du signal et reconnaissance de forme Plan Introduction Pré-traitement Segmentation d images Morphologie mathématique Extraction de caractéristiques Classification

Plus en détail

Génétique et épigénétique

Génétique et épigénétique Le génome : avancées scientifiques et thérapeutiques et conséquences sociales The genome: scientific and therapeutic developments and social consequences 2002 Éditions scientifiques et médicales Elsevier

Plus en détail

10 points clés pour faire de Lamyline votre collaborateur préféré! GUIDE SIMPLIFIÉ D UTILISATION. www.lamyline.fr. Code d accès.

10 points clés pour faire de Lamyline votre collaborateur préféré! GUIDE SIMPLIFIÉ D UTILISATION. www.lamyline.fr. Code d accès. GUIDE SIMPLIFIÉ D UTILISATION www.lamyline.fr Notez ici vos identifiants et gardez les toujours à portée de main. Code d accès Mot de passe 10 points clés pour faire de Lamyline votre collaborateur préféré!

Plus en détail

Etapes générales. Polonator. Protocole. Préparation des échantillons. Dover. Séquençage par hybridation/ligation de nonamères. Mise en service en 2009

Etapes générales. Polonator. Protocole. Préparation des échantillons. Dover. Séquençage par hybridation/ligation de nonamères. Mise en service en 2009 Next Generation DNA Sequencing Pourquoi? Séquençage par la méthode de Sanger est pour l instant le «gold standard» Besoins de séquencer toujours plus, plus vite et moins cher But: Séquencer 1 génome humain

Plus en détail

MASTER (LMD) - USTH BIOTECHNOLOGIE MÉDICALE- BIOTECHNOLOGIE VÉGÉTALE-PHARMACOLOGIE

MASTER (LMD) - USTH BIOTECHNOLOGIE MÉDICALE- BIOTECHNOLOGIE VÉGÉTALE-PHARMACOLOGIE MASTER (LMD) - USTH BIOTECHNOLOGIE MÉDICALE- BIOTECHNOLOGIE VÉGÉTALE-PHARMACOLOGIE RÉSUMÉ DE LA FORMATION Type de diplôme : Master (LMD) Domaine ministériel : Sciences, Technologies, Santé Objectifs Acquisition

Plus en détail

L Intelligence Artificielle

L Intelligence Artificielle Conférence L Intelligence Artificielle Taalabi M. 30/04/2004 Intelligence Artificielle 1 Historique Définition Paradigmes Systèmes experts Concevoir un système expert Système à Inférence floue Applications

Plus en détail

ENSEIGNEMENT DU GÉNIE INDUSTRIEL EN S7-S8-S9 T. Coudert B. Grabot F. Pérès

ENSEIGNEMENT DU GÉNIE INDUSTRIEL EN S7-S8-S9 T. Coudert B. Grabot F. Pérès ENSEIGNEMENT DU GÉNIE INDUSTRIEL EN S7-S8-S9 T. Coudert B. Grabot F. Pérès 11/01/2016 DÉFINITION DU GÉNIE INDUSTRIEL Le génie industriel s'intéresse : à l'étude des organisations industrielles et à l'amélioration

Plus en détail

1. Explorer, organiser et démontrer des propriétés géométriques en termes de longueurs et d angles. Découvrir et étudier des nombres irrationnels.

1. Explorer, organiser et démontrer des propriétés géométriques en termes de longueurs et d angles. Découvrir et étudier des nombres irrationnels. Compétences : math, 2 ème degré (pages 1 à 3) math, 3 ème degré (pages 4 à 8) 3 grands thèmes du cours à 4h sem (pages 9 à 11) 3 grands thèmes du cours à 2h sem (pages 12 à 14) (Seules les définitions

Plus en détail

Cours Fouille de données avancée

Cours Fouille de données avancée Ministère de l Enseignement Supérieur et de la Recherche Scientifique Université Mohamed Khider - Biskra Faculté des Sciences Exactes et des Sciences de la Nature et de la Vie Département d Informatique

Plus en détail

De la biologie molécualire à la génomique

De la biologie molécualire à la génomique De la biologie molécualire à la génomique Pierre Neuvial École Nationale de la Statistique et de l Administration Économique Méthodes statistiques pour la biologie Plan du cours 1 Introduction à la biologie

Plus en détail

Comparaison d approches statistiques pour la classification de textes d opinion. Michel Plantié, Gérard Dray, Mathieu Roche (LGI2P/EMA LIRMM)

Comparaison d approches statistiques pour la classification de textes d opinion. Michel Plantié, Gérard Dray, Mathieu Roche (LGI2P/EMA LIRMM) Comparaison d approches statistiques pour la classification de textes d opinion Michel Plantié, Gérard Dray, Mathieu Roche (LGI2P/EMA LIRMM) Caractéristiques des traitements Approche identique pour les

Plus en détail

Initiation à la cotation 3D CATIA V5 Module FTA

Initiation à la cotation 3D CATIA V5 Module FTA TN29 Initiation à la cotation 3D CATIA V5 Module FTA Alexandre D après le cours de Arnaud LAPORTE Plan du cours 2 Qu est ce que le FTA? Pourquoi utiliser le FTA? Comment utiliser le FTA? Algorithme de

Plus en détail

Comment utiliser les modèles mathématiques pour concevoir les stress tests?

Comment utiliser les modèles mathématiques pour concevoir les stress tests? Comment utiliser les modèles mathématiques pour concevoir les stress tests? Idriss Tchapda-Djamen 18 décembre 2015 Sommaire Exécutif 1. Les stress tests ont pris une importance depuis la dernière crise

Plus en détail

Séminaire: Méthodes et outils d'analyse de données textuelles, un nouveau souffle?

Séminaire: Méthodes et outils d'analyse de données textuelles, un nouveau souffle? Séminaire: Méthodes et outils d'analyse de données textuelles, un nouveau souffle? Daniel K. Schneider TECFA FPSE - Université de Genève daniel.schneider@unige.ch Unité de technologie de l'éducation Université

Plus en détail

BIN 1002: INTÉGRATION BIOSCIENCES/INFORMATIQUE

BIN 1002: INTÉGRATION BIOSCIENCES/INFORMATIQUE BIN 1002: INTÉGRATION BIOSCIENCES/INFORMATIQUE Plan de Cours Automne 2015 Professeurs: Sylvie Hamel, Département d Informatique et de Recherche Opérationnelle Guillaume Lettre, Institut de Cardiologie

Plus en détail

Sujet 6 : Modèles de la planification tactique: planification de production

Sujet 6 : Modèles de la planification tactique: planification de production Sujet 6 : Modèles de la planification tactique: planification de production MSE3312: Planification de production et gestion des opérations Andrew J. Miller Dernière mise au jour: November 18, 2009 Dans

Plus en détail

Manipulation des données textuelles utilisation des outils WEKA/JAVA pour le projet AFD

Manipulation des données textuelles utilisation des outils WEKA/JAVA pour le projet AFD Manipulation des données textuelles utilisation des outils WEKA/JAVA pour le projet AFD Vincent Guigue UPMC - LIP6 Vincent Guigue Preprocessing & JAVA 1/24 Traitements pour la classification de textes

Plus en détail

Fondements de l annotation par homologie

Fondements de l annotation par homologie Fondements de l annotation par homologie 1 Comment les gènes apparaissent? Duplications Duplication du génome entier ou polyploïdisation (plusieurs cas chez les eucaryotes, par exemple chez les téleostéens,

Plus en détail

FOUILLE DE TEXTES Méthodes et enjeux

FOUILLE DE TEXTES Méthodes et enjeux FOUILLE DE TEXTES Méthodes et enjeux 23 mars 2007 Adeline Nazarenko Laboratoire d Informatique de Paris-Nord UMR7030 Université Paris 13 & CNRS adeline.nazarenko@lipn.univ-paris13.fr Plan Applications

Plus en détail

Module BDR Master d Informatique (SAR) Cours 5- bases de données parallèles Anne Doucet Anne.Doucet@lip6.fr

Module BDR Master d Informatique (SAR) Cours 5- bases de données parallèles Anne Doucet Anne.Doucet@lip6.fr Module BDR Master d Informatique (SAR) Cours 5- bases de données parallèles Anne Doucet Anne.Doucet@lip6.fr 1 Plan Introduction Architectures Placement des données Parallélisme dans les requêtes Optimisation

Plus en détail

RN s et prédiction de la structure secondaire des protéines. Rapport du projet d apprentissage automatique

RN s et prédiction de la structure secondaire des protéines. Rapport du projet d apprentissage automatique COUTURIER Olivier LETOMBE Florian RN s et prédiction de la structure secondaire des protéines Rapport du projet d apprentissage automatique Année universitaire 200/2002 SOMMAIRE I Introduction Page 2 II

Plus en détail

VI. L APPORT DES MARQUEURS MOLECULAIRES. A. Définitions

VI. L APPORT DES MARQUEURS MOLECULAIRES. A. Définitions VI. L APPORT DES MARQUEURS MOLECULAIRES Comme nous l avons vu précédemment, l étude des caractères quantitatifs est fondée sur l analyse statistique des performances mesurées des individus. Il en est de

Plus en détail

Algorithmes de recherche locale

Algorithmes de recherche locale Algorithmes de recherche locale Recherche Opérationnelle et Optimisation Master 1 Sébastien Verel verel@lisic.univ-littoral.fr http://www-lisic.univ-littoral.fr/~verel Université du Littoral Côte d Opale

Plus en détail

Structures des ARN.

Structures des ARN. Structures des RN Hélène TOZET touzet@lifl.fr Structure secondaire de l RN ppariements : Watson-rick :, Wobble :,,... Pseudo-nœuds Triplets de bases Exemple : RN de transfert (lanine E. coli) Structure

Plus en détail

Stéphane GOBRON HES SO HE Arc

Stéphane GOBRON HES SO HE Arc Stéphane GOBRON HES SO HE Arc 2015 Algorithmes Numériques 7 chapitres Codage des nombres Résolution d équations Systèmes linéaires Dérivation Intégration Equation différentielles Mots clés du cours : introduction

Plus en détail

Lancer FASTA et BLAST en ligne de commande

Lancer FASTA et BLAST en ligne de commande Lancer FASTA et BLAST en ligne de commande V.2006.1 http://www.esil.univ-mrs.fr/~dgaut/cours Daniel Gautheret ESIL, Université de la Méditerranée Fasta Article original: Lipman and Pearson (1985) Science

Plus en détail

Professeur Joël LUNARDI

Professeur Joël LUNARDI Biochimie - Biologie moléculaire Chapitre 9 : Applications médicales Professeur Joël LUNARDI MED@TICE PCEM1 - Année 2006/2007 Faculté de Médecine de Grenoble - Tous droits réservés. Chapitre 9. APPLICATIONS

Plus en détail

Introduction à l annotation des protéines

Introduction à l annotation des protéines Introduction à l annotation des protéines - Université de Lille 1-2 eme Semestre Pistes sur les fonctions des protéines Comparaison aux banques de séquences Recherche dans les banques de motifs ou domaines

Plus en détail

Le monde des bio-puces

Le monde des bio-puces Le monde des bio-puces D1 Le «dogme central» de la biologie moléculaire Transcription Epissage Traduction ADN ARNpm ARNm Protéines Génome Transcriptome Protéome D2 Puces à ADN Techniques de génomique fonctionnelle

Plus en détail

Annotation de protéines

Annotation de protéines JS Varré Université Lille 1 jean-stephane.varre@lifl.fr http://www.lifl.fr/~varre jean-stephane.varre@lifl.fr 1 / Pourquoi faire de l annotation automatique de protéines? Il est difficile de trouver expérimentalement

Plus en détail

Data mining et statistiques. Hugues Bersini IRIDIA / ULB

Data mining et statistiques. Hugues Bersini IRIDIA / ULB Data mining et statistiques Hugues Bersini IRIDIA / ULB Philippe Smets (1938-2005), créateur d IRIDIA Théorie des croyances vs Probabilités IA, IRIDIA et Data Mining Les réseaux de neurones IA à la Google

Plus en détail

Option 1 and Option 5 are correct. 1 point for each correct option. 0 points if more options are selected than required.

Option 1 and Option 5 are correct. 1 point for each correct option. 0 points if more options are selected than required. Quels sont les deux éléments généralement trouvés sur un diagramme de réseau logique? (Choisissez deux réponses.) Les identifiants d interfaces Les types de connecteurs Les versions du système d exploitation

Plus en détail

L annotation in silico des séquences génomiques Claudine Médigue, Stéphanie Bocs, Laurent Labarre, Catherine Mathé, David Vallenet

L annotation in silico des séquences génomiques Claudine Médigue, Stéphanie Bocs, Laurent Labarre, Catherine Mathé, David Vallenet MEDECINE/SCIENCES 2002 ; 18 : 237-250 > Depuis 1995, nous avons accès à l information génétique complète d un nombre croissant d organismes vivants très divers. Cette explosion d informations impose des

Plus en détail

Pierre BOURDET sept. 96 - fev. 2005. Tolérancement géométrique

Pierre BOURDET sept. 96 - fev. 2005. Tolérancement géométrique Tolérancement géométrique Modèle nominal - Réel - Écarts Géométrie nominale Représentation du réel Écarts Écarts Nuage de points Éléments de substitution Tolérancement : spécifier les limites de variation

Plus en détail

Modélisation et vérification

Modélisation et vérification Modélisation et vérification Yohan Boichut (inspiré du cours de John Mullins, Ecole polytechnique de Montréal) Cours Master IRAD Semestre 3 Yohan Boichut Modélisation et vérification Cours Master IRAD

Plus en détail

Initiation à la Bioinformatique

Initiation à la Bioinformatique Université d Alexandrie Initiation à la Bioinformatique Basic Local Alignment Search Tool BLAST Université d Alexandrie AUF Auteur(s): Mohamed GAD 2009/2010 Auteur(s) : Mohamed GAD Professeur à l institut

Plus en détail

Différences entre Homme et singes?

Différences entre Homme et singes? Différences entre Homme et singes? Différences entre Homme et singes? Apparition de l œil? Apparition du vol? Apparition des hémoglobines? Molécule d hémoglobine HEME Chaîne polypeptidique de type 2 Chaîne

Plus en détail

Génie Logiciel. Art et Science de la construction de logiciel Conception. D. Revuz Université de Marne la Vallée

Génie Logiciel. Art et Science de la construction de logiciel Conception. D. Revuz Université de Marne la Vallée Génie Logiciel Art et Science de la construction de logiciel Conception D. Revuz Université de Marne la Vallée Organisation Conception Techniques, langages, Design Patterns Méthodes I Diagrammes UML outils

Plus en détail

Heuristiques pour l alignement et la recherche dans les banques de données biologiques

Heuristiques pour l alignement et la recherche dans les banques de données biologiques Heuristiques pour l alignement et la recherche dans les banques de données biologiques Plan I. Introduction II. Matrices de substitutions: PAM, BLOSUM III. Algorithmes de Filtrage Basés sur la recherche

Plus en détail

Les instabilités protéiques des vins blancs : les mécanismes physico-chimiques Marie Dufrechou 13 octobre 2011

Les instabilités protéiques des vins blancs : les mécanismes physico-chimiques Marie Dufrechou 13 octobre 2011 Les instabilités protéiques des vins blancs : les mécanismes physicochimiques Marie Dufrechou 13 octobre 2011 Directrice de thèse : Aude Vernhet Codirectrice de thèse : Céline PoncetLegrand 1 Le vin :

Plus en détail

Projet de chaire CFM- ENS sur Modèles et Sciences des Données

Projet de chaire CFM- ENS sur Modèles et Sciences des Données Projet de chaire CFMENS sur Modèles et Sciences des Données Chaire portée par Florent Krzakala et Stéphane Mallat 1. DES MODELES ET DES DONNEES Un des enjeux de la science moderne est de modéliser des

Plus en détail

Détection statistique d anomalies en présence de paramètres de nuisance

Détection statistique d anomalies en présence de paramètres de nuisance Détection statistique d anomalies en présence de paramètres de nuisance Lionel Fillatre ENST Bretagne, département Signal & Communication Lionel Fillatre (département SC) Détection d anomalies 1 / 29 Structure

Plus en détail

Dr. Christophe Geourjon

Dr. Christophe Geourjon Prédiction de la structure 3D Dr. Christophe Geourjon Pôle de BioInformatique Lyonnais PBIL - Site de Lyon-Gerland IBCP - CNRS UMR 5086 Bioinformatique et RMN structurales 7, passage du Vercors 69367 Lyon

Plus en détail

Programme Rhône-Alpes d aide aux PME

Programme Rhône-Alpes d aide aux PME Programme Rhône-Alpes d aide aux PME Amélioration du Processus Participatif d Innovation de Conception 13 mois d accompagnement conseil personnalisé à chaque entreprise des formations inter-entreprises

Plus en détail

MODELISATION DE DONNÉES QUALITATIVES PREMIÈRE PARTIE

MODELISATION DE DONNÉES QUALITATIVES PREMIÈRE PARTIE MODELISATION DE DONNÉES QUALITATIVES PREMIÈRE PARTIE Pierre-Louis Gonzalez 1 I INTRODUCTION 1 variable qualitative. Tri à plat. Représentations graphiques. Modélisation : loi binomiale loi multinomiale

Plus en détail

ProteomeBinders. Vers une infrastructure européenne de ressources pour les agents de liaison dirigés contre le protéome humain.

ProteomeBinders. Vers une infrastructure européenne de ressources pour les agents de liaison dirigés contre le protéome humain. ProteomeBinders Vers une infrastructure européenne de ressources pour les agents de liaison dirigés contre le protéome humain GT MaBioVis 27 mars 2008 Introduction ProteomeBinders Projet européen FP6 Participation

Plus en détail

StatHebdo 2007. Résultats détaillés de l enquête sur le lectorat. Marché Laurentides Population 18+ 366 656

StatHebdo 2007. Résultats détaillés de l enquête sur le lectorat. Marché Laurentides Population 18+ 366 656 StatHebdo 2007 Résultats détaillés de l enquête sur le lectorat Marché Laurentides Population 18+ 366 656 Taux de lecture et fidélité du lectorat Adultes 18 ans + Consultation de l'hebdomadaire : Fidélité

Plus en détail

Phylogénomique : introduction

Phylogénomique : introduction Phylogénomique : introduction Les limites des phylogénies basées sur un seul gène Résolution limitée (erreur stochastique) La phylogénie du gène peut être différente de la phylogénie des espèces à cause

Plus en détail

Copyright MECAmaster 2009 Ce document est la propriété de MECAmaster SARL et ne peut être diffusé sans son autorisation 1/17

Copyright MECAmaster 2009 Ce document est la propriété de MECAmaster SARL et ne peut être diffusé sans son autorisation 1/17 MECAmaster Assembly V7 for CATIA V5 Analyses de Tolérances 3D intégrées à la maquette numérique MECAmaster SARL, 64 chemin des mouilles 69134 ECULLY Cedex Tel : +33 4 78 64 35 61 Fax : +33 4 78 64 97 21,

Plus en détail

Lamyline en 10 points clés! GUIDE DE FORMATION LAMYLINE. www.lamyline.fr

Lamyline en 10 points clés! GUIDE DE FORMATION LAMYLINE. www.lamyline.fr GUIDE DE FORMATION LAMYLINE www.lamyline.fr Notez ici vos identifiants et gardez les toujours à portée de main.! Code d accès Mot de passe Si vous accédez à Lamyline par une URL privée, créez votre espace

Plus en détail

AutoGRAPH Un serveur pour automatiser et visualiser la comparaison de génomes: Application à l identification de nouveaux gènes chez le chien.

AutoGRAPH Un serveur pour automatiser et visualiser la comparaison de génomes: Application à l identification de nouveaux gènes chez le chien. AutoGRAPH Un serveur pour automatiser et visualiser la comparaison de génomes: Application à l identification de nouveaux gènes chez le chien. Thomas DERRIEN CNRS-UMR6061 Génétique et Développement Université

Plus en détail

Bioinformatique fonctionnelle des protéines et analyse structurale de réseaux d'interactions

Bioinformatique fonctionnelle des protéines et analyse structurale de réseaux d'interactions Bioinformatique fonctionnelle des protéines et analyse structurale de réseaux d'interactions intégration Populations Organismes Tissus, organes Relations inter-espèces, Équilibres écologiques Développement,

Plus en détail

ARN et bioinformatique: PDF processed with CutePDF evaluation edition www.cutepdf.com

ARN et bioinformatique: PDF processed with CutePDF evaluation edition www.cutepdf.com ARN et bioinformatique: Partie 1 PDF processed with CutePDF evaluation edition www.cutepdf.com Sommaire Principes biologiques : Transcription/traduction, types d ARN, formes primaires/secondaires. Zuker

Plus en détail

Apport des NGS dans l'amélioration des algues

Apport des NGS dans l'amélioration des algues Des approches originales basées sur le séquençage nouvelle génération Apport des NGS dans l'amélioration des algues Gregory Carrier Laboratoire PBA Physiologie et Biotechnologie des Algues Direction: Gaël

Plus en détail

Optimisation en nombres entiers

Optimisation en nombres entiers Optimisation en nombres entiers p. 1/83 Optimisation en nombres entiers Michel Bierlaire michel.bierlaire@epfl.ch EPFL - Laboratoire Transport et Mobilité - ENAC Optimisation en nombres entiers p. 2/83

Plus en détail

MASTER INFORMATIQUE Parcours INFORMATIQUE DECISIONNELLE

MASTER INFORMATIQUE Parcours INFORMATIQUE DECISIONNELLE MASTER INFORMATIQUE Parcours INFORMATIQUE DECISIONNELLE Responsable du parcours: Prof Hoai An LE THI Département d Informatique, UFR MIM Tel. 03 87 31 54 41, email lethi@univ-metz.fr Informatique décisionnelle

Plus en détail

Edouard Duchesnay Benoit Da Mota

Edouard Duchesnay Benoit Da Mota Le calcul haute performance pour l'analyse de données de neuroimagerie-génétique en grandes dimensions Edouard Duchesnay Benoit Da Mota Donnons de la suite à vos idées Problème et enjeux Compréhension

Plus en détail

Le Global Process Control pour la surveillance de process à partir de l analyse multivariée de courbes collectées

Le Global Process Control pour la surveillance de process à partir de l analyse multivariée de courbes collectées France En partenariat avec Standards Certification Education & Training Publishing Conferences & Exhibits Le Global Process Control pour la surveillance de process à partir de l analyse multivariée de

Plus en détail