Thèse présentée pour obtenir le grade de Docteur de l Université Louis Pasteur Strasbourg I

Dimension: px
Commencer à balayer dès la page:

Download "Thèse présentée pour obtenir le grade de Docteur de l Université Louis Pasteur Strasbourg I"

Transcription

1 Thè pn pou obn d d Dou d Unv Lou Pu Sbou Eo Doo d Sn d V d Sn Ap mou u d boo P Axnd SENEGAS PHYSOPATHOLOGE DE L'NFECTON A TOXOPLASMA GOND : MECANSMES CELLULARES ET MOLECULARES CONTRBUANT A L'ARRET PHYSOPATHOLOGE DE LA GESTATONDE DANS L'NFECTON UN MODELE A TOXOPLASMA MURN DEGOND : MECANSMES CELLULARES ET MOLECULARES CONTRBUANT TOXOPLASMOSE ACQUSE A L'ARRET DE LA GESTATON DANS UN MODELE MURN DE TOXOPLASMOSE ACQUSE Sounu pubqumn 26 jun 2007 Mmb du ju Rppou Exn : Rppou Exn : Rppou nn : Du d Thè : Co-du d Thè : M Gd CHAOUAT, DR1 M Yv CARLER, PU-PH Mm Fnço STOLL-KELLER, PU-PH M Emnno CANDOLF, PU-PH M Jn-Pu KLEN, DR1

2 Thè pn pou obn d d Dou d Unv Lou Pu Sbou Eo Doo d Sn d V d Sn Ap mou u d boo P Axnd SENEGAS PHYSOPATHOLOGE DE L'NFECTON A TOXOPLASMA GOND : MECANSMES CELLULARES ET MOLECULARES CONTRBUANT A L'ARRET PHYSOPATHOLOGE DE LA GESTATONDE DANS L'NFECTON UN MODELE A TOXOPLASMA MURN DEGOND : MECANSMES CELLULARES ET MOLECULARES CONTRBUANT TOXOPLASMOSE ACQUSE A L'ARRET DE LA GESTATON DANS UN MODELE MURN DE TOXOPLASMOSE ACQUSE Sounu pubqumn 26 jun 2007 Mmb du ju Rppou Exn : Rppou Exn : Rppou nn : Du d Thè : Co-du d Thè : M Gd CHAOUAT, DR1 M Yv CARLER, PU-PH Mm Fnço STOLL-KELLER, PU-PH M Emnno CANDOLF, PU-PH M Jn-Pu KLEN, DR1

3

4 A m pn mon è

5 Rmmn J m mon du d hè, Monu Pou Emnno Cndo, pou mvo u dn on boo u xpm ou m onnn pou vo ud v. Aompnn hqu p ou n m n un nd b, no hn mon pm d mnh n u pn poonn qu ponn. J n mn à m mon o-du d hè, Monu Jn-Pu Kn, pou vo p d d v. Son n nqu xpmn ouu un d pu qu pu dn boon d mnu. J voud xpm m poond ud à Od Vd, pou on mpon onbuon ondb dn on d v m mn pou on dnmm on nhoum quodn. Jd m mmn à Monu L Pou Yv C, Monu Dou Gd Chou Mdm Pou Fnço So-K, qu m on honnu d ju v. M nè mmn von mn à Monu Lu Mn Mdm Anè Nuv, Pn Hop, pou u oboon n qu u dponb à d d m vux. J n à m nmb du ponn d hh d dno d nu d poo, qu, hun à mnè, p m v u boo n pu Thom, M C, pou u oun n qu u onbuon, m o-o d bbohèqu, no pou u on v (n pu M Shö-Gund) n qu ponb nm pou ou ppon xpmn. Jm m m poh, m m, qu mon ompn dun pod, qu on p m vn qu mon ounu mn dn momn d dou. J n à mon è, qu oujou pn un modè à uv, Ju, qu omm mon p è. Enn, d mmn pu d qu du. A m pn qu mon onu v mou non, v dn p p nuqu d vu mo omm bnon voon. C v opond à boumn dun p d u duon. J u xêmmn d m pou ou.

6 Tb d mè Tb d mè NTRODUCTON TOXOPLASMA GOND ET LA TOXOPLASMOSE Dpon d T. ond Dn d Spoozoï Thzoï nonvon hzoï bdzoï Bdzoï Onon mou Pon d u Pon d monèm Pon d hop Pon d nu dn C booqu d T. ond non d hô dn non d hô nmd Ap nqu phonqu Txonom Dv nqu Mhod d p mquu nopqu Cqu d o p d T. ond Dbuon d 3 p d T. ond Mnon phophooqu mn d oxopmo Pvn dno d oxopmo humn Mnon phophooqu Toxopmo qu Toxopmo d mmunodpm

7 Toxopmo onn Tmn pophx Rpon mmun à T. ond Rpon nn To-Lk Rpu Avon d u ph nn Avon d moph d ponu nuoph Avon d u dndqu - Rô d L Au u mmun Rpon dpv Rpon d p Th1 FN-γ Rpon d p Th2 pvnon d phnomèn mmunophooqu L Lpoxn A 4 (LXA 4 ) Ph honqu - Pn du p GESTATON Gon dvoppmn œ hz ou Sèm poduu C ovn oupmn mpnon Ph p-mpno du dvoppmn mbonn Mnm mou d mpnon d mbon Rpon mn à 'mpnon (dduon) Fomon ô du pn (pnon) Dnon mon d u ophobqu Conô d pnon Rô d u unk Rô du pn Dvoppmn mbonn M b

8 2. Mnm mmunooqu pmn on du m œo-pn Ronnn d nèn dhoompb ophobqu p u unk nhbon d oox u dpndn d nop (ADCC) d on ophob nhbon d v d LTCD HLA-G DO non F/FL Onon Th2 mon d poduon dfn-γ d TNF-α Rô d poon d PGE Rô d L Rô du TNF-α Rô d FN-γ Rô d u okn non mn on Lmon d Aon d n d mè Modon d nvonnmn oknqu o à on Pubon du dvoppmn pn d hn mno-œux OBJECTFS MATEREL ET METHODES 1. Pooo xpmn Sou Gnop d ou Souh d T. ond M n poduon non

9 2. An hooqu d un œo-pn Ppon d oup Dpn Cooon hmun-on Mqu n-t. ond Mqu n-bx Mqu omp d u unk Mqu PAS (poxd d Sh) Mqu DBA-n-FTC Comp d u unk Mqu TUNEL Mu d pm nun œo-pn Exon dadn à p du n d un œo-pn Exon d ADN d ouh RH d T. ond onuon d mm d n PCR onvnonn PCR qunv n mp Do qu pn d FN-γ, du TNF-α, d L-4, d L-6 d -L Obnon d hnon Enzm Lnkd mmunosobn A (ELSA) Wn Bo Exon do poqu Eophoè mmunobo An nomqu RT-PCR qunv n mp (qpcr) Exon Ron d npon v PCR qunv Mhod qu v -

10 RESULTATS 1. Mnm bo ndu p non à T. ond Appon d opon hz ou Sw n Fb h p dn un œo-pn Pn dhmo d domn pn dn un œo-pn n Don d è p dn un œo-pn n Apopo d u pn mpon d vo mohond Dmnuon du nomb d u unk dn un n An d pon d p Th1 mn œo-pn o d non LFN-γ: okn Th1 mju podu o d non Poduon un d ARNm odn FN-γ Poduon pn dl-15 du VEGF Rô d FN-γ dn pou ABORTFS ndu o d non p T. ond Dmnuon du poun d opon hz ou FN-γR -/- n Aumnon d h p mn un hz ou FN-γR -/- n Abn dhmo d domn pn hz ou FN-γR -/- n Abn d don d è p hz ou FN-γR -/- n Dmnuon du nomb d u unk dn un œo-pn hz ou FN-γR -/- n Abn dpopo dn un œo-pn d ou FN-γR -/- n Rbmn d poduon d ARNm pn odn L-15 hz ou FN-γR -/ v -

11 DSCUSSON CONCLUSONS ET PERSPECTVES BBLOGRAPHE v -

12 Abvon Abvon ADN ADCC ARN BET BSA CMH COX-2 CPA DAB DBA-n DC dntp ELSA FTC GM-CSF h HLA HRP DO FN- FN-γR -/- LB LF LPS LT Ad DoxboNuqu Coox Cu Dpndn d Anop Ad RboNuqu Bomu dhdum Bovn Sum Abumn Compx Mou dhoompb Cooxn-2 Cu Pn danèn Dmnobnzdn Doho bo n Cu dndqu Doxnuod phoph Enzm Lnkd mmunosobn A Fuon-o-Tho-Cn Gnuo-Moph Coon-Smun Fo Hu Humn Luo Ann Ho Rdh Poxd ndomn 2,3-doxn non-mm nvd pou pu d non-mm Lmpho B Luo mpnon Fo LpoPoShd Lmpho T LXA 4 Lpoxn A 4 MΦ Moph MLAp Mom Lmphod A o pnn mn NF-κB NK NO P4 PAS PBS PBS-SVF Mnu Nu Fo kpp B Cu Nu K Monoxd dzo Poon Poxd Ad Sh Phoph Bu Sn PBS onnn 10 % SVF PBST PBS-Twn 20 à 0,05 % PCR Pom hn on PBF PMN q..p qpcr Poon ndud Bokn Fo Ponu Mono Nuoph Qun un pou R Tm Qunv PCR Sond - v -

13 STA SVF TGF-β TLR TMB TNF- TUNEL unk VEGF Soub Thzo Ann Sum d Vu Fœ nv Tumo Gowh Fo-b To-Lk Rpo TMhBnzdn Tumo No Fo-ph Tmn doxnuod n-mdd dutp-bon Nk End-Lbn Cu NK un Vu ndohum owh o - v -

14 L d u L d u Fu 1. Fomon d oo mu... 2 Fu 2. Suu du hzoï d T. ond... 3 Fu 3. Pnon d T. ond dn un u hô... 4 Fu 4. Fu o à nonvon d om hzoï-bdzoï... 6 Fu 5. C d T. ond vo d onmnon d homm Fu 6. Rqu d nmon mno-œ v d n d nn n onon d pod d pmo-non d mè Fu 7. Avon d TLR p T. ond Fu 8. Rpon mmun nn nn à T. ond Fu 9. Ph dnon d pon nn à T. ond Fu 10. Conô d pon nmmo dun non à T. ond Fu 11. Pnpux p d pnon on n u œ ophobqu n mn Fu 12. Dvoppmn mbonn p-mpno mpnon hz ou Fu 13. Au ppn à mpnon mbonn vo d non mpqu dn ppoon dhn du bo Fu 14. Dvoppmn pn hz ou Fu 15. Suu du pn d ou (hmo-ho) Fu 16. Dvoppmn mbonn hz ou Fu 17. Suu du pn humn (hmo-monoho) Fu 18. Dn onnn du èm HLA n mè ophob xvo œux Fu 19. Pooo d ppon d oup bnh Fu 20. Con un d ou non n () n p T. ond (b) Fu 21. Poun d ou n () d opon (b) n oup non n n à dn mp d on Fu 22. Mhod dobnon d oup bnh () mqu un d T. ond à J10 dnon (b) Fu 23. Un œo-pn non n () n (b) oo à hmun-on Fu 24. Aè p oo à hmun-on à J10 () mu d u don (b) Fu 25. Un œo-pn n oo à hmun-on omn pmn dobv mnon nu o dn ddu b Fu 26. Mqu TUNEL à J10 d un œo-pn non n () n (b) x -

15 Fu 27. Qunon d xpon pn à J10 d pon Bx, p53 B2 () Mqu d pon Bx dn un œo-pn n (b) Fu 28. Mqu PAS DBA-n d u unk à J10 à p dun œo-pn non n () n (b) Fu 29. Qunon du nomb d u unk mu d ddu b à p dun ooon hmun-on Fu 30. Cnqu d poduon qu un d FN-γ Fu 31. Poduon un à J10 d ARNm odn FN-γ Fu 32. Poduon un d ARNm odn L-15 () VEGF (b) Fu 33. Poun d opon à J10 dn modè d ou v Fu 34. Aè p oo à hmun on à J10 dun ou Sw () dun ou FN-γR -/- (b) mu d don d è n ou FN-γR -/- n non n () Fu 35. Qunon à J10 du nomb d u unk mu dn ddu b hz ou FN-γR -/- n non n Fu 36. Un œo-pn dun ou Sw () FN-γR -/- (b) oo u PAS à J Fu 37. Poduon un à J10 hz ou FN-γR -/- d ARNm odn VEGF () L-15 (b) Fu 38. Hpohè u mnm d opon ndu o dun non p T. ond x -

16 L d bux L d bux Tbu 1. Av d mmbn d vuo popho d T. ond... 5 Tbu 2. Pon d u d T. ond... 7 Tbu 3. Pon d monèm umn : pop onon... 8 Tbu 4. Pon d hop... 9 Tbu 5. Pon GRA Tbu 6. Pnpux èn d T. ond u dn ud du pomophm nqu Tbu 7. Pnp qu booqu d dn p d T. ond Tbu 8. Ep mju du dvoppmn hz ou Tbu 9. Cqu d ELSA Tbu 10. Anop pm ond u Tbu 11. Squn d mo qu d qpcr on b qun Tbu 12. Qunon qu pn d T. ond hz ou v x -

17 noduon

18 noduon TOXOPLASMA GOND ET LA TOXOPLASMOSE L oxopmo un non du à un poozo à dvoppmn nu obo, Toxopm ond (T. ond), don dbuon v n onon d on du ob. L p ompnd un hô dn, n don h domqu, d hô nmd, mmmè oux. L onmnon humn u pnpmn p mnon o d onommon d vnd u ou m u onnn d k, om d n du p. Lnon p T. ond pu ouvn bnn hz homm. L mupon du p m p pon mmun m u- p dn n u (mu vu) dun ou v d hô. Lnon pu ê v hz md mmunodpm (dn ou ) ou o dun nmon npn (oxopmo onn)

19 noduon 1. DESCRPTON DE T. ond 1.1. Dn d Spoozoï Lo d poduon xu qu u dn phum nn d d, poozoï (d xu d T. ond) dn n mè mâ ou m. L zo obnu pè ondon, pp poon, 'nou d'un oqu om un oo mmu, d om ovoïd (d 9 à 14 µm), b d u-hô x dn mu xu v è d nm. L oo n dp von ub un ph d muon, pooon, opondn à un d dvon (un mo uv d dux mo) du zo (dpoïd) boun à omon d'oo mu nux onnn dux poo onnn hun 4 poozoï (hpoïd) (Fu 1) (Coud & Povô, 1973). Fom d n uqu, oo pn d d onmnon pu qummn mpqu dn onmnon d hô nmd hbvo. n n Gmè mâ Gmè m Fondon 2n Spoon Oo mmu Spooon Spoo Spoozoï Oo mu Fu 1. Fomon d oo mu

20 noduon Thzoï L hzoï dv du poozoï. om dun on mqu mun 6 à 7 µm d on u 2 à 3 µm d. poèd un xm nu (ompx p) ompnn onoïd, pop, hop, monèm nu dn un xm pou ond (Fu 2) (Bk & Boohod, 2000). Conoïd Monèm Rhop Apop Nou Mmbn pmqu Compx d mmbn nn Gnu dn Fu 2. Suu du hzoï d T. ond. Adp d Bk & Boohod, L pnon du hzoï dn un u-hô un mnm u pmn dhpp ux pou d u. En, nvon ompn d omon dun vuo popho p nvnon d mmbn pmqu d u-hô. L pnon nvn dux on p ( hop monèm), non du onoïd omon dun jonon mob u pon d on n p mmbn pmqu d u-hô. A nu d vuo, p dv p un pou qu ppî nmn onoïd omon onomn du CM (ompx d mmbn nn) (Fu 3). L omon d uu unqu podu à jonon mob n p mmbn pmqu d hô (K & Sod, 2004)

21 noduon CM Rhop Monèm Mmbn pmqu d u hô Jonon mob Conoïd Vuo popho nn Vuo popho CM Rhop mmu Conoïd Fu 3. Pnon d T. ond dn un u-hô. Pou dpndn d p du p à nvn mmbn pmqu mnn à omon d vuo popho. CM : ompx d mmbn nn. Adp d K & Sod, L mmbn d vuo popho poèd puu onon don 'quon d numn u, mnpuon d vo d non d u-hô ou no mnn d 'n uu d vuo popho (Tbu 1). En ou, bn d pu SNARE (Soub N-hmmd-nv o Ahmn pon Rpo), pobbmn ponb d n à uon v oom à on don, pmn n du uv du p

22 noduon Tbu 1. Av d mmbn d vuo popho d T. ond. Adp d Mn., Av Dpon Rn Suu Rnmn d moubu d hô Rumn du MTOC Exnon d PVM Couvu d vmnn Aoon à MTO Aoon u RE Aon d qu uu d moubu d hô onon d moubu uou d vuo popho. Mdu nonnu Rumn du MTOC p PVM pu ouvn p d xnon d PVM. Mdu nonnu Exnon mmbn mnn d PVM onnn d nombu pon GRA on d moubu du MTOC Ronon d mn nmd d vmnn uou d PVM. B mou nonnu Rumn oon v un nd n d MTO d u hô à PVM. Md p ROP2 Rumn oon v un nd n du RE d u hô à PVM. B mou nonnu Andd., 2001; Cn & D Souz, 1985; Coppn, 2006 Coppn., 2006 Bmud., 1994; C., 2000; Coppn., 2006; Lod., 1999 Cn & D Souz, 1985; Honn & Wdn, 1994 d Souz, 2005; Mno., 2005; Shn & R, 2004; Sn & Jon, 1997; Sn & Jon, 2001 d Souz, 2005; Mno., 2005; Shn & R, 2004; Sn & Jon, 1997 Aquon d numn Numn oub (nuod, d mn, u) Pmb d PVM Lpd Aoon à MTO Aoon u RE Choo (vo LDL) Cop pdqu Mnpuon d vo d non Phophoon d κbα vo d NFκB ROP4 phophoon Pon kn d m ROP2 Au kn/phoph u u Aè bdonn b ux mou < 1300 D du opm d u-hô p d po d PVM. B mou nonnu Dounmn d d poïqu mohond v mohond du p. B mou nonnu Mnm pon pou dounmn d phophopd d o (don RE ou). B mou nonnu Dounmn d vo LDL-hoo un un mnm dpndn d moubu. Rô pobb d GRA7 du pon GRA Dounmn du onnu d op pdqu. B mou nonnu Rô dn modon no d von du NFκB p pon TKK o u PVM n un v κb kn Phophoon d ROP4, mmb d m ROP2, p un kn d hô ou p dn u n Av kn d nombux mmb d m ROP2. L b pon nonnu Mup v kn, phoph d uon o à PVM u p d ud poomqu Shwb., 1994 Cwod., 2006 Gup., 2005; Sn., 1997 Coppn, 2006; Coppn., 2000; Sh., 2005 Chon & Sb, 2002; Coppn., 2006; Nhkw., 2005 Mon & Sn, 2005; Mon & Sn, 2005b C., 2004 E Hjj., 2006 Mn, Lu, Lnn Sn (non pub) MTO : mohond, RE : uum ndopmqu, PVM : mmbn d vuo popho, MTOC : n onu d moubu nonvon hzoï bdzoï L bdzoï pn ou mêm om qu hzoï m pn d qun du p. D nombux u von non d onvon du d hzoï n d bdzoï qu von d ph, ho hmqu n qu n u mmun d on p : u d oxd (pb - 5 -

23 noduon dnhb onon mohond du p) omm NO (monoxd dzo) ou u oknqu omm FN-γ (non-mm), TNF-α (Tumo No Foph) ou L-12 (nukn-12) (Fu 4). L onvon du d bdzoï n hzoï u n bn d mêm u (Fu 4b). Lmpon d okn dn mnm dnonvon dmu d à vu n vvo n upb d ndmn (Lon., 2002).. Convon hzoï v bdzoï Von d ph Cho hmqu Snhè d NO SnhèdFN-γ Snhè d TNF-α Snhè dl-12 Thzoï Bdzoï b. Convon bdzoï v hzoï Abn dl-12 Abn d NO Abn dfn-γ Abn d TNF-α Fu 4. Fu o à nonvon d om hzoï-bdzoï. L pou d onvon vb ponb d bmn d ph honqu d md. Adp d Lon., Bdzoï L bdzoï dvn nmn dn u-hô. L mmbn d vuo popho onnn mod dvn puèmn n ux don nzmqu p ppn. Lnmb d uu onu k. Dun om phqu ou ovoïd, k mun d 20 à 200 µm d dmè on pnmn dn u muu bux. Cqu d ph honqu d non, pn dn onm dun ou v d hô n nîn d on dmnon pnn om d dmnon d onmnon pnp d nvo Onon mou D nombux vux on po u onon mou d T. ond nommn dnon d pon n un pon nnqu. Dux nd m puvn ê dnu dn : pon d u pon - 6 -

24 noduon onnu dn on o pqu du p (monèm, hop nu dn) Pon d u Pu d 20 pon d u ou SAG (Su AnGn) on dn à jou (Tbu 2). E ppnnn à 5 upm dnomm SAG1 à SAG5. Tou on n à u du p p un n GP (GoPhophdnoo). E ppn à 'hmn à pnon dn u-hô n qu'à moduon d pon mmun (Lku., 2001). L m SAG1 pu bondn. E ompnd pon SAG1 popmn d, don uu dmnonn ompo d dux ou-un dnqu (homodmè) p oph (H., 2002) d nombu pon homoou SRS (SAG1-Rd-Squn) (Jun., 2004). Tbu 2. Pon d u d T. ond. Dpè Lku., Fm SAG Nomb A Gèn Sd p Thzoï Bdzoï Rn SAG Bu., Hh., Mn., Mn., ?? Mn., 1998 ND Lku., ?? Lku., 2001? 7?? Lku., 2001? 8?? Lku., 2001 SAG Pn., b +? Lku., Lku., d - + Lku., ?? Mon, non pub SAG Cbon-Duw., 1994 SAG Odb-Fu., b?? Mn., 1998 SAG Spno., b + - Spno., Spno., : pn, - : bn,? : non dmn

25 noduon Pon d monèm Un qunzn d pon d monèm on dn à jou (Tbu 3). E on b o du on n du pô p du p v u-hô ppn à 'hmn du p (Cuh, 2002). Tbu 3. Pon d monèm umn : pop onon. Dpè Dow & Sod, Nom Domn, homoo Compx Muon Fonon MC1 2 TSP-k MC4-MC1-MC6 Tnpo d MC4, MC6 S à u-hô MC2 1 nn, 5 TSR TM, C- M2AP (hxmè) N-m, C-m poxoo Tnpo d M2AP S à u-hô MC3 1 n-k MC3-MC8 N-m nu S à u-hô 5 EGF-k Dmon d MC3 MC4 6 pp MC4-MC1-MC6 N-m, C-m poxoo S à u hô MC5 PP? N-m nu? MC6 3 EGF-k MC4-MC1-MC6 N-m nu Eo MC1 MC4 TM, C- C-m po-xoo MC7 5 EGF-k??? MC8 1 n-k MC3-MC8 C-m Eo MC3 10 EGF-k TM, C- po-xoo MC9 3 EGF-k??? TM, C- MC10 -? -? MC11 -? Cv du poppd? MC12 EGF-k, TSR? C-m? TM, C- po-xoo M2AP - MC2 (hxmè) N-m nu po-xoo Tnpo/odn d MC2 Sub1 Sub? N-m nu C-m po-xoo AMA1 Rh n n? N-m nu C-m po-xoo Po (ub?) nvon d u-hô TSP : hombopondn, EGF : pdm owh o, PP : ppd-po om, TM : nmmbn, C-m : p box-mn, N-m : p mno-mn, C- : p C- m opmqu, TSR : hombopondn p 1 p.? : non dmn Pon d hop L pon d hop (ROP) on pndn pnon u pu n à vuo popho (Jon & Roo, 2002; No., 2004). E on n ux p d pnon, d pon du p à non v u-hô (Cuh., 1999). x dux nd m d pon ROP : pmè n onn qu ROP1, pon oub qu dn vuo popho o d pnon du p (Hknon., 2001). L duxèm m (Tbu 4) dn à p d pon ROP2 (Lh & Dubmz, 1991), qu - 8 -

26 noduon nè dn mmbn d vuo popho pndn 'nvon d u-hô, xpon on xm mno-mn dn opm d u-hô (Bk., 1994). C pon nmmbn on mpqu dn mnm pmn 'oon d on u d hô à vuo popho (C., 2004) pobbmn dn modon pnqu d u-hô (Sj., 2007). Tbu 4. Pon d hop. Dpè E Hjj., Nom Pod (kd) Nomb A Ppd n Domn hdophob Pdon dun v kn ) DK GL D ROP ROP ROP ROP ROP ROP ROP17 (ROP2L1) ROP18 (ROP2L2) ROP2L ROP2L4 490? ROP2L ROP2L ROP ) pdon dun v kn: DK : domn kn ; GL : bou n ; D : d pqu. + : pn, - : bn,? : Non dmn Pon d nu dn L nu dn on d vu joun un ô mju dn modon uu d vuo popho (M., 2005). L pon d nu dn on b à nu d vuo pndn pè pnon d u hô. Quoz pon on dn : 10 pon GRA (Adjob., 2004 ; Ahn., 2006), 2 nuod phoph hdo (NTP) (Johnon., 2003) 2 nhbu d po (Tbu 5) (Pznn., 2002). L pon GRA on à vuo popho p d non hdophob ou pon/pon, n quu u ubu d u-hô nvnn n dn umn d numn dn nhbon d vo popoqu d u-hô (Cuh, 2002; M., 2005 ). E ppn mn à pnon, à uv nu - 9 -

27 noduon du p à mupon (Ch., 2001). P u, mbn jou un ô dn vun d ouh (Nhk., 2001). Tbu 5. Pon GRA. Dpè M., Pon (kd) Cqu Loon Sd p Thzoï Bdzoï GRA1 (23) Soub dn DG PV Pu o à PVN GRA2 (28) Hαmphph PVN GRA3 (30) TMD PVM, PVN, PVE GRA4 (40/41) TMD PVN GRA5 (21) Homoo v GRA6 PVM, PVE GRA6 (32) TMD PVN GRA7 (29) TMD PVN, PVM, PVE GRA8 (40) TMD PVM, PVE GRA9 (41) Hαmphph PVN?? GRA10 (36) TMD, mo RGD PVM?? DG : nu dn, PV : vuo popho, PVM : mmbn d vuo popho, PVN : u d vuo popho, PVE : xnon d vuo popho, TMD : domn nmmbn. Mo RGD : ppd A-G-Ap (mo d onnn d nn). +++ : o pn, ++ : monn pn, + : b pn, - : bn,? : Non dmn. 2. CYCLE BOLOGQUE DE T. ond L ompnd un hô dn ( d) hz qu dou omp du p : un poduon xu uv p un poduon xu d hô nmd (oux mmmè don homm) hz qu dou xu non d hô dn S d, nommn h, onmnn p d k onnu dn u po, bdzoï nomn n hzoï qu von mup d çon xu dn u d nn ê. Apè ph d mupon, poduon xu u v omon doo mmu mn dn è du h dn mu xu où ubn un muon. C mnon qu dbu n 3 10 jou pè non du h du 10 à 20 jou opond à un dmnon dnvon 100 mon doo (Tn., 2000). L h nmn d oo mmu d çon mvqu o dun pmo-non

28 noduon S h onmn v d oo mu, poozoï von ou dbod nom n hzoï mup dn u d hô, pu p v m v nn ê où u un poduon xu donnn u à omon doo non d hô nmd L onmnon d hô nmd, pob à p d hun d d du p, pu vo u o dun nmon n-ndvdu (hozon) ou onn (v). L nmon hozon don mod d onmnon pnp vo o, pob o p non doo mu oun, u, vux, ud u ou o dun on d v h ou è, o p non d k onnu dn vnd u ou nummn u. Un u mod d onmnon pu hz homm pob o dun npnon don (k /ou hzoï)ou o dun nuon nun (hzoï). L nmon v, qun à, u pè p npn d hzoï (Fu 5). Oo Hô dn Pdon (k) Hô ond Oo Mu xu Conmnon uqu (oo) Tnuon nun ou npnon don (k /ou hzoï) Anmux domqu Conmnon mn (k) Tnmon onn (hzoï) Fu 5. C d T. ond vo d onmnon d homm. Adp d Ab,

29 noduon Chz hô nmd, p ompo 3 p. L pmè pnon nn. Apè don d mmbn du k ou d oo, bdzoï ou poozoï b nomn n hzoï qu pnèn dn no d mn pop n mon d 24 hu. L duxèm p mupon nun dun qu hzoï dvoppn dn u d hô nommn MΦ (Moph) DC (Cu Dndqu) pmn pobbmn duon du p à nmb d on d hô (œu, poumon, vu). C u ou d p qu pu vo u nmon onn. L dnè p omon d k vouon v hon. Au ou d p ou pon d mmun pqu, p mup pu nmn u nvu muu b d k u omn. 3. ASPECTS GENETQUES ET PHYLOGENETQUES 3.1. Txonom T. ond ppn à mbnhmn d poozo, à od d od u n Toxopm. nx quun u pè d: Toxopm ond. Douv n 1908 p No Mnux (No & Mnux, 1909), T. ond u d pou pmè o n 1923 p Jnku (Jnku, 1923). A p d 1948, m u pon d hnqu d dno booqu pm un mu ppoh pdmooqu (Gn & Ambo-Thom, 1963; No & Rmnon, 1980) Dv nqu Mhod d p mquu nopqu L nom d T. ond un d 65 Mb p n 12 homoom (hp://oxomp.wu.du/ ou hp://oxodb.o/toxodb.hm). Dpu un qunzn dnn, d ud nn dv nqu d T. ond. L p po u n d puu o pomoph. L mhod d p on pp à d hnqu onzmqu omm MLEE (MuLou Enzm Eopho) (Dd., 1992), pu ux hnqu d boo mou qu RFLP (Ron Fmn Lnh Pomophm) (How & Sb, 1995) ou n d mo

30 noduon (Ajznb., 2002). Pu dun nqunn d mquu nqu on d, pu u n èn odn nèn mju d T. ond (Tbu 6). Tbu 6. Pnpux èn d T. ond u dn ud du pomophm nqu. Loon Pon Gèn u Mmbn pmqu SAG, SRS, BAG, BSR 1, 2, 3, 4, 1, 2, 3, b4 Gnu dn GRA, NTP 1, 2, 3, 4, 5, 6, 7, np Rhop ROP op1 Monèm MC m1 à m10 M du k MAG m1 Coqu An, -ubun, -ubun 1, ub1, ub Cqu d o p d T. ond L ud onodn pou oup mjo d ouh n d T. ond n 3 nop : p, (Tbu 7) (Ajznb., 2002; Dd., 1992; How & Sb, 1995). Cpndn, x ququ ouh pqu p pn dè unqu qu n on p ouv dn 3 p pnpux (Su., 2003). Tbu 7. Pnp qu booqu d dn p d T. ond. Tp Tp Tp Rpon hz homm D 0 à 40 % d ouh o D 40 à 100 % d ouh o < 20 % d ouh o Toxopmo qu xpmn Sou : è vun (oxopmo uë ) R : non vun Sou : non vun R : non vun Sou : ouvn Vun nmd n p p Toxopmo onn xpmn Sou : nmon v mpon Cob : nmon mno-o monn Sou : nmon mpon Cob : nmon mno-œ mpon N.D. Mupon pd d hzoï Mupon n Mupon nmd Mupon Pu ou p d onvon n bdzoï d omon d k n vvo Convon n bdzoï omon d k n vvo Fomon d k n vvo N.D. : Non Dmn

31 noduon 3.3. Dbuon d 3 p d T. ond L dbuon d dn p v n onon d on du ob. x n Fn un pdomnn è n du p (85 %) o qu ouh d p n pnn qu 8 % d p 2% (Hono., 2000; How., 1997). Aux E-Un, p pdomn mn (How & Sb, 1995). L uon è dn dn du p v un qun pu v d ouh d p n Epn n Gnd-Bn (Apn., 2003; Fun., 2001) ou d ouh pqu u B (F Ad., 2006). 4. MANFESTATONS PHYSOPATHOLOGQUES ET TRATEMENTS DE LA TOXOPLASMOSE 4.1. Pvn dno d oxopmo humn L pvn d oxopmo v dun p à u (d 7 à 80%). L pvn nu à 30% obvn pnpmn n Amqu du Nod, n Gnd-Bn, n Sndnv dn Sud E d A. L pvn upu à 60% obvn pnpmn n Aqu Amqu Ln. En Fn, pvn dmnu uèmn dpu 40 n : 54 % n 1995 (An., 1996) 44 % n 2003 v d o von on no m xpqu. L dno booqu d oxopmo u p oo (hh dmmunoobun G M) /ou m n vdn du p ou d ADN p. Un pn n d oxopmo u o un oonvon opondn u p dun onv (bn dnop d on T. ond) à un opov (pn dnop d on T. ond) Mnon phophooqu Toxopmo qu L oxopmo qu pè nn pu ouvn bnn ou mpomqu hz uj mmunoompn. L n nqu on vb pouvn mn p un èv ou un hn. D om v puvn ê

32 noduon xponnmn obv o dnon p d ouh pqu. L uj u ponnmn n ququ mn. L m n p d pon mmun pm p à ph honqu d md. L pn d k pn dn u vo o quon dun mmun dnv po Toxopmo d mmunodpm Un nomb on d d oxopmo obv hz uj n d d mmun onnux ou qu (SDA) ou oum à d mn mmunouppu (Mo., 1993). pu d pmo-non m pu qummn d von dun oxopmo honqu du à ondmn d mmun. Lnph oxopmqu mnon pu qun (pè d 80% d ) mo n bn dun mn ppop (Bo., 1995; Lpo & Rmnon, 1992) Toxopmo onn L oxopmo onn onqun dun oxopmo mn qu u ou d o. E pu ê à on dvomn ponn, ou d momon (Fouon., 1999). En Fn, ndn nnu d oonvon hz mm nn m n 6,6 14,8 pou 1000 o o n p n (An. 1996). L d oxopmo onn onnn un à dux nouvux-n pou 1000 nn, o un mon d od d 1000 nnu. L qun d nmon mno-œ popoonn à du pn u ou d o, o qu v d on à â du œu u momn d non mn (Ambo-Thom & Poux, 1993) (Fu 6). En, pndn pm m d o, qu d nmon mno-œ b (n 1,4 11 %). Cpndn, œu onmn on xpo à d on v (Dunn., 1999) nînn pu ouvn un vomn ponn. Pndn duxèm m, qu d nmon èv n 13,8 40% bè pn mon. L on dmun mpon : momon mju (hdoph), qu b (npho-mnno-m, on n-nnn), dqu, ou (hoon) ou nuomuu. Au ou du oèm m, pobb d nmon mno-œ mpon (50 à 83%). Lnn ouvn mpomqu à nn (om nnqu ou d)

33 noduon 100 R v Pod qu Tnmon Gv 40% 1,4% 4,5% 11% 13,8% Nombux mpomqu Conpon èm èm Tm Tm Fu 6. Rqu d nmon mno-œ v d n d nn, n onon d pod d pmo-non d mè. Chz 'nm, oxopmo onn un mp onomqu mju povoqu un vomn dn 1 à 2 % hz ovn pn n Euop (Buxon, 1998) 3 à 4 % n Amqu du ud (F., 1999) dn zon d'v xn Tmn pophx Un mn n ju qu dn oxopmo onn dn om v d oxopmo uvnn hz md mmunodpm ou onuv à un non p un ouh è vun. L hox hpuqu on m p b nomb d mou v u T. ond mnqu dnomon u u ou u on hz mm nn (Doun, 2001). D pu, mn m n œuv hz mmunodpm hz mm nn on nmn o d ph uë d md (Doun & Gn, 1993; Mo., 1993). C mn on b u on d n nboqu qu pmn, mod don v u boom vn ou poqu; pmhmn, nhbu d nhè d d oqu n u dhdoo du p (bonhè d nuopon) ou no udzn nhbn dhdopo nh, nzm n dn nhè d o. Pm dn oon dnboqu, u oon n pmhmn udzn on puv dun nd u T. ond. C u qu 2 mdmn n n

34 noduon d u vo d nhè d o, podun un nqu pmn n d pon n-p. 5. REPONSE MMUNTARE FACE A T. ond L pon mmun u ou d 'non à T. ond ompx ompmn. D pu, T. ond p dn ou on, hqu u n pop on mmun pqu, nommn èm nvux n pn. Gnmn, hz un uj mmunoompn, pmo-non à T. ond ndu un pon mmun po pobbmn à pn d k dn n u (mu, vu). C mmun pobbmn nnu p upu podqu d k. Chz uj mmunodpm (dn, ), mupon dmnon nonô d hzoï puvn nîn d on v pouvn ê Rpon nn To-Lk Rpu L EC (Cu Eph nn) n qu du u mmun omm DC M, xpmn à u u d pu PRR (Pn Ronon Rpo) onnn un pn d mou mobnn oup ou m d PAMP (Phon-Aod Mou Pn). L po d PRR è nu puu d pon qu pu TLR (To-Lk Rpo), pu vn pu C-p n. Bn qu mnm n on p mn d, TLR mbn pn mn nux d onnn d PAMP dn d non p T. ond (Khn, 2007) (Fu 7)

35 noduon T. ond GP Pon TLR2- TLR2- TLR4 TLR11 TLR6 TLR1 Mmbn pmqu MD88 MD88 MD88 MD88 B p50 p65 NF- B MAPK TLR9 Endoom ADN d T. ond Chmokn L-12 TNF-α FN-γ Nou L-10 TGF-β Conô d pon nmmo Conô d pon p Bn d non hô-p Fu 7. Avon d TLR p T. ond. Dpè Ab., GP : ophophdnoo, MAPK : MAP kn. L M PMN on pb d onnî pqumn T. ond p TLR11 don omon d homodmè mb unpou v NF-κB (Nu Fo kpp B) ndu nommn poduon dl-12 d TNF-α n à non d pon mmun dpv v LTCD4 + (Lmpho T CD4 + ), n qu dl-15, n à von d unk (Nu K). P u, d ud mn hz ou monn qu n GP d pon mmbn pon d T. ond on onnu p pu TLR2 TLR4 (Shon-Kn., 1997). Chz d ou dn pou TLR2, un du d poduon d NO p MΦ o à un np à v onon n-mobnn obv. A nv, uun hnmn dn poduon oknqu n mqu (Tnh, 2003). Rko- Nhoum dmon qu TLR4 xpm p u ph jou un ô pou v-à-v d domm phux u p T. ond pm mnn d 'homo nn n ndun 'xpon d puu u qu L-6 TNF-α, qu on o-pou ou mpqu dn pon d u (Rko-Nhoum., 2004). Enn, Mnn. on ppo qu TLR9 ndpnb à m n p

36 noduon d on mmun nn à T. ond (Mnn., 2006). En, TLR9, o dn ndoom uum ndopmqu, mb onnî ADN d T. ond v vo d MAP kn (mon vd pon) pmn nhè dfn-γ. D ou dn pou MD88 (MYod Dnon pm-pon pon 88), pon dp d TLR, pnn un o dmnuon d poduon dl-12 n vvo n vo pè muon p un x poqu oub u d hzoï d T. ond pp STA (Soub Thzo Ann). D pu, pè un non p T. ond, ou on un ux d mo pu mpon qu ou uv à un b dvon d pon mmun d pou d FN-γ. Juqu, uun TLR pqu n pu ê o u phnop obv hz ou dn pou MD Avon d u ph nn Lnon p T. ond n u pu ouvn p vo o, pon mmun dbu omn dn muquu dv pu puèmn dn phum nn qu onu pmè bè d dn d hô (Fu 8). Lnon d EC nîn un nhè d mou ooxqu qu NO ph dnn m mn d hmokn omm MCP-1 (Mono Chmo Pon 1), MP-1α (Moph nmmo Pon-1α), MP-β RANTES (Rud on Avon nd Nom T- Expd) d okn qu L-1, L-6, GM-CSF (Gnuo-Moph Coon-Smun Fo) n PMN (Ponu Mono Nuoph), M DC v dnmmon (Buzon-G., 2001; Mnnh., 2002). Enn, EC mbn pouvo jou ô d CPA (Cu Pn danèn). En, d u u un modè n vvo on mon qu u n p T. ond on un umnon d xpon d mou CD40, CD1d, d mou du CMH (Compx Mou dhoompb) d n qu d pu d FN- (Kp., 2004) Avon d moph d ponu nuoph Chz ou, 'von d MΦ n pn d o-nux qu LPS (LpoPoShd) ou TNF-α, pou dnh 'v ooxqu on T. ond

37 noduon (Sb., 1993). L M PMN mu xn un v n-mobnn p dv mnm u : ) mnm oxd (Huh, 1988) ; b) mnm nonoxd, pnpmn p poduon d NO (Dnk., 2004) 'nduon, p FN-γ, d DO (ndomn 2,3-DOxn) ddn pophn n à on du p (Shu., 1999). P u, M nhn mn d L-10 pmn d onô pon nmmo n n u DC. NO T. ond B Lumè nn CE EC MCP-1, GM-CSF, MP-1α MP-1β, RANTES PMN DC NO, DO, RO* L-10 MΦ NK TNF-α, L-12 FN-γ FN-γ FN-γ MΦ L-15 LTCD4 + Fu 8. Rpon mmun nn nn à T. ond. RO* : dux oxn Avon d u dndqu - Rô d L-12 LL-12 jou un ô n dn non d pon nn o dun non p T. ond pu puèmn dn nduon d nhè dfn-γ, omm mon nb à non d ou dn n L-12 (Gzzn., 1994). Au ou dun non p T. ond, DC pnn ou mju d poduon dl-12 n vvo un ud dn un modè mun mon qu DC pnqu podun okn n bn d nux o-muu, monn n qu DC puvn v èm mmun p onnn d mou p ou

38 noduon oqu on ux-mêm n p p (R Sou., 1997). D ud n vo on mon qu DC pnqu mu p x STA podun nvmn pu dl-12 qu on pbmn xpo ux LPS. L mnm mou qu ou-ndn pon n on p nèmn onnu. Un d hpohè u qu pu CCR5 (CC-Chmokn Rpo 5) poèd un onon mpon dn nduon d poduon dl-12 pè muon p x STA (Ab., 2000). L pnn booqu d nvnon nhbu dun pu à hmokn dn onnn d DC onm p d obvon hz d nmux dn pou pu, monn un dmnuon d poduon dl-12 (Ab., 2000). Un ud ppoond onnn von du pu CCR5 pn à u u d DC pm d m n vdn ô n d pon C-18 (Cophn-18) p T. ond. En, C-18 un po-omè pb d u pu CCR5 v d n ompb à d on nd ndoèn, CCL4 (CC-Chmokn Lnd 4) nînn n un nhè dl-12 (Fu 9) (Ab., 2003). Thzoï Cu dndqu CCR5 L-12 NK FN-γ TNF C-18 L-12 CD4 + FN-γ Moph CD8 + NO Fu 9. Ph dnon d pon nn à T. ond. Dpè Ab., L b mou d von du èn d L-12 on mn ud. M, u d npon dmn mpqu dn nduon du èn d L-12 dun un non n vvo p T. ond n on p no ompèmn ud. Cpndn d ud on mon qu MAP kn p38 n dn poduon dl-12 p MΦ pè muon p x STA (Mon., 2004). P u, d ou dn pou u RF8 (FN-Ruo Fo 8), un u d npon ndub d FN-γ, n dvoppn p d n à non p T

39 noduon ond. C obvon pou dmn mpqu RF8 dn xpon du èn d L-12. En, du ud on mon qu ou pnn un du d poduon dl-12 d muon d DC mpqu dn poduon dl-12 (Ab., 2003) Au u mmun L u NK v nommn p vo d non d STAT4 (Sn Tndu nd Avo o Tnpon 4) (C., 2000) mu p L-12, L-15 TNF-α (Gzzn., 1993), podun d FN-γ qu umn v n-mobnn d M, d DC d EC. C ô n pu ê m n vdn dn d modè n vvo d ou SCD (Sv Combnd mmunodn) hz qu n à 'non à T. ond à poduon d'fn-γ qu, n 'bn d mpho ononn LTCD4 + LTCD8 +, povn d u NK (Sh., 1993). L EL (Lmpho n-ephux) xn un v ooxqu v-à-v d EC n podun du TGF-β (Tumo Gowh Fo-b) pmn d m phnomèn mmunophooqu à FN-γ. L LTγδ pnn mn un v ooxqu n vo on u n p T. ond ndpndn d pnon d nèn p CMH, èn d FN-γ, d L-2 du TNF-α (Subu., 1995). Un umnon d popuon u ouv hz 'homm u ou d non p T. ond m mn dn d ou n p vo n-pon (Hd., 1995). En on d u pn d oon pou nn, u poun pn un ompon n d pon mmun o nn hz homm (Lp., 1998) bn qu u ô dmu ond hz ou (S., 1995). L nuoph, è pobbmn onoph, n qu mo nvnnn pdmn u d 'non on mpqu dn non po d pon mmun non pqu p 'nmd d poduon d'l-12 d dv u po-nmmo (B., 2001). L pqu mbn u pouvo x un v ooxqu v-à-v d T. ond, ndpndn d nop pqu (Chumpz., 1998). Enn, u non-hmopoïqu (bob, u ndoh, ) on pb d du poon du p p d mnm dpndn du, d NOS (ndub N Oxd Snh), d FN-γ du TNF-α (Yp & Sh, 1999)

40 noduon 5.2. Rpon dpv L m n p d pon n pnon d nèn p MΦ DC, dnè pouvn pu dmn d nèn d T. ond à nu d umè nn p onon d u dnd à v jonon. L mnm d pnon qu pnon d nèn u TCR (T C nn Rpo) d LT n qu non du pu CD40 v on nd CD40L. Lmmun u ompon mju d on dpv d hô o dun non p T. ond. En, pon humo bmn v p phoèn à dvoppmn nu mêm dmu mn- du dno d oxopmo hz homm Rpon d p Th1 FN-γ L LTCD4 + on n u dvoppmn d n à 'non p T. ond. C n omn à un pon u d p Th1 vo p 'FN-γ 'L-12 podu pè von d NK d MΦ (Suzuk., 1988). Chz ou, LTCD4 + on ubdv n dux popuon : Th1 Th2. C dnon b u u po oknqu pè muon qu ppo Momnn n 1986 hz ou (Momnn., 1986). L u d p Th1 podun d L-2 d FN-γ nd qu u d p Th2 podun d L-4, d L-5, d L-6 d L- 10. D ud on mon qu onô d 'non à T. ond u d'un on nqu n LTCD4 + LTCD8 + (Gzzn., 1991). L LTCD8 +, v mjomn p pon d u du p m u p 'L-2 p LTCD4 +, xn un v ooxqu md p poduon dfn-γ. C v m à onnn du CMH d. L LTCD8 + joun n un ô n dn n à 'non pndn ph uë hz 'homm ou, ppn mn u mnn dun n pndn ph honqu (Gzzn., 1992). L m n p dun mmo mmun p LT o d non p T. ond hz 'homm un b. En, pmo-non dun mm pm poon d on œu n d non o dun o. pobb qu pn d mmo mmun po p LT o u p upu uè d k nu. C mmo mmun u vo d non nu mpqun NF-κB. C vo on v p pon d u ou d nu

41 noduon dn du p (Pon., 2000) n qu p b d pu mpho CD28 d pu dndqu B7-1 (pp no CD80) B7-2 (V., 1999). P u, un mmo mmun po p LB ndu nhè dnop n-t. ond du dun ou v d hô Rpon d p Th2 pvnon d phnomèn mmuno-phooqu L d pon nmmo dpndn d FN-γ puvn ê dè pou hô. L phoo nmmo omm h ou md d Cohn, puvn p xmp ndu d pon d p Th1 nonô pouvn u d v on. An d pvn d, un pon mmun d p Th2 n-nmmo m n p L-10 LL-10 poèd un v n-nmmo dn d nombu phoo o à un o poduon dfn-γ, dl-1 ou d TNF-α (Vn d Loo & Vn dn B, 2002) podu nommn p pn mun. C okn u p phoèn pou nhb pon mmun nmmo. D vu qu vu Epn-B od un pon v homoou d L-10 qu pu ndu mêm vo d non qu okn ndoèn nînn un nvon d vo nmobnn dpndn d FN-γ, un nhbon du pou dpnon d nèn p CPA un nhbon d poduon d okn à v ooxqu nh p LT (Sk-Adkn., 2002). Du vu, omm poxvu, poèdn d èn odn d homoou du pu d L-10. L u xpmn d pu on ux nux ndu p pu d FN-γ ndun nommn un oox (H, 1998). Lo dnph honqu oxopmqu, nuon d L-10 ondu à un umnon d non uo dn èm nvux n, ndqun un ô d okn dn onô d nmmon o dun non à T. ond. D ou nvd pou L-10 n on p pb d onô pon po-nmmo uombn à non à T. ond è ô u ou d ph uë. E pnn d non uo vè d no u du o d nn, phnomèn n pou pup u dun poduon nonô dfn-γ d TNF-α (Suzuk., 2000). Lnduon dl-10 p T. ond pou ê un d mnm dhppmn du p à pon mmun don hô (Fu 10)

42 noduon Cpndn, mpon d d L-10 dn vun d T. ond n qu on ô dn pn du p du (W., 2001) Lpoxn A 4 (LXA 4 ) L poxn poèdn d pop n-nmmo dn h, nph u phoo nmmo. Lu on nun nhbon d onon uoèn, d onon d u NK, d mon uo, d poduon d TNF-α ndu p hmokn, d noon d NF-κB d xpon d pu ux hmokn d mou ddhon (Oh., 2004). Pou u d onon, n xn u dux pu pnpux : pu à poxn A 4 (LXA 4 R ou FPRL1) pu nu AHR (A Hdobon Rpo) (Mddox., 1997). Un ud hz d ou dn n L-10 n p T. ond mon quon dun poon on p njon d x STA, 24 hu vn non. C mn o à un dmnuon d poduon dl-12 d CCR5 p DC (R Sou., 1999). Lnjon d STA pm dn nhè d LXA 4 nhbn mon d DC poduon dl-12 n vvo n vo, phnomèn pp DC p (Fu 10b).. b. Thzoï Cu dndqu CCR5 L-10 TNF Thzoï Cu dndqu CCR5 LXA 4 TNF C-18 L-12 CD4 + FN-γMoph C-18 L-12 CD4 + FN-γMoph CD8 + NO CD8 + NO Fu 10. Conô d pon po-nmmo dun non à T. ond.. Conô d ooxqu p poduon dl-10 dun ph uë. b. Conô d pon nmmo p nhè d LPA 4 ux où p p o d ph honqu d non. C-18 : ophn Ph honqu - Pn du p Bn qu mnm n-mobn ndu p FN-γ on, n on p omn. En, d p hppn u onô mmun

43 noduon pn hz hô. x dux mnm pnpux popo pou xpqu von du p à pon mmun dun ph honqu: (1) L p dvndn mon nb à v n-mobnn d hô ou ndun d u mmunouppu qu nun v d u d pon mmun nommn poduon d mdu po-nmmo. L pmè hpohè b u ppon dun nomb on d p hppn à pon mmun p nmd d pu mmbn ou dnzm opmqu pb dnv ou d nu mou d pon mmun (pon du ompmn, upoxd ou NO) (Cndo., 1994). En, poduon dnzm oxdo-du omm poxdoxn p T. ond uè qu mnm poun onbu à pn du p hz hô (Son., 2001). (2) Lnhbon d mon d u ou d u von n u p xpon d u moduu ou n-nmmo don p, qu vo n hppmn d T. ond dvoppmn d ph honqu

44 noduon GESTATON L dun m qu po on () p() dpu mpnon juquà puon (ouhmn, m b) pp on. Lbmn d on u dnon ompx n mbon nvonnmn mn. L uu mbonn pmn dh mbon à uu (mpnon) d om onnxon vu n u npo d numn (pnon). L pn n om on onon mmun, ndon mboqu d mè u po d mbon. C v ompx on nb à d pubon omm mon qun v d mo mbonn po phoo d on hz mm. P xmp, un non v, bnn ou p pu nîn un ê d on (vomn ponn) ou d on du pn un non onn. Lmpnon n pu vo u qu ndomè un pbmn pp p on d ooèn pu d poon. x puu p dmpnon: n où ndomè un pu nom (umnn), xn où ndomè un n dn (ou) n où mpnon u dn pu d ndomè un (Homm). Dux p d mmmè dnun : ux pou qu ov ndpnb juquu m d on (ou), ux pou qu ov n pu n p pn (Homm). L pn pn d von d uu mju n onon d dn pè d mmmè. x 3 p d pn p nomb d ouh u n uon œ mn. L u ophobqu onun oujou ouh œ pu xn qu ouv mnhm vux nun œux. L pn d p phoho (qud pon) dn p un ppoon d (dhon vo mêm uon) d ophob v u d phum un mn. L ophob nnvhn p mnhm un omm dn u p d pnon. L p ndohoho (h, hn) p mon d u ophobqu n dê n on d v u ndoh d vux nun mn. L p hmoho ouv hz onu, pm Homm opond à om pu nvv d pnon. L ophob nn à v vux mn n dv n on d v uon nun

45 noduon pubn dmn ouh ndoh un dn n, mu d è un (Fu 11). Ln dhn mno-œ dè on p d pn. Connn pn d p hmoho, n mè/œu pu ê onu dun u ouh u ophobqu opondn u ou-p hmo-monoho (Homm), d 2 ouh u ophobqu opondn u ou-p hmo-dho (pn), ou d 3 ouh ophobqu opondn u ou-p hmo-ho (ou).. Ephoho b. Endohoho. Hmoho Vu œ Vu œ Vu œ Mnhm Tophob Tophob Tophob Ephum un Vu mn un Endomè Vu mn un Endomè Sn mn dn p nvux Endomè Tophob Vu mn un Fu 11. Pnpux p d pnon on n u œ ophobqu n mn. Adp d Mo & Lok,

46 noduon 1. GESTATON ET DEVELOPPEMENT FŒTAL CHEZ LASOURS L on mun onu dun u dvènmn dn dn mp don dux pnpux on mpnon omon du pn. Un xn vu d u u uj djà p Mjhd n 2005 (Mjhd, 2005) (Tbu 8). Tbu 8. Ep mju du dvoppmn hz ou. Dpè Co., Jou d on Evènmn 3,5 Fomon du bo 4 à 4,5 Avon du bo 4,5 à 6 mpnon 6 à 8 Fomon du vn 9 à 10 Dvoppmn du pn 8 à 18 Dvoppmn d vuon œ 20 à 21 M b 1.1. Sèm poduu Luu d ou, à dn d u d mm, onu d dux on qu ndn d omp d Fop juquà p do d v. Luu onu d o ouh uppo. An, d umè d on v xu, on dnu ndomè onnn d nombu nd un, momè onu d dux ouh muu (un onudn xn un u nn) u (Cook, 1983) C ovn oupmn Lnv n dux ovuon uv pn un ovn omp. Lovuon pd p un pod œonqu (ph ou) uv dun pod poonqu (ph u).l m u on dun ou mâ v un ou m, non mmd dun ovn dun du monn d 4 jou u, povoqun n un œu (Whnhm & Wood, 1983) dun qu ovu on pê pou ondon. Dun on hz ou, op jun onô p mprl (ou pon pnn dux p d poduon p jou) podu poon (Su., 1996). L mprl mn ndu p oupmn onu homon uoophqu pdomnn u ou d 8-9 pm jou d on

47 noduon 1.3. mpnon Ph p-mpno du dvoppmn mbonn Apè ondon dn ovdu, œu dv p mnon ( d dvon moqu n uon pd) juquà om mou. A d, mbon n dn umèd uu nom n bo onnn un v (pp boœ) ompo d dux popuon u dn, m u nn (don dv uumn 'mbon popmn d) ophoodm (puu d ophob) onun un vb phum qu u non v phum un. Avn mpnon, bo hpp d "oqu xn" ( zon pud) dn pou donn nn à du p u, pb ndodm pm (Fu 12) (Wn & D, 2006). J1,5 Ov J2 J2,5 Embon 8 u non omp Zon pud J3,0 M u nn J4,0 Boo Tophoodm Epb Mou 8-16 u omp Endodm pm J1 Bo po Ovdu Oo Bo d Uu Ou ond (zo) J0 Ovuon mpnon Fondon J0,5 Fu 12. Dvoppmn mbonn p-mpno mpnon hz ou. Adp d Wn & D, J : jou Mnm mou d mpnon d mbon Lmpnon opond à xon du bo à po d uu u ou du 4 èm jou d on. Phooqumn, dbu d non n mè œu. To ph uèdn u ou d mpnon: ppoon, dhn (ou pnon) nn nvon. L'mpnon, dun du d 24 hu, donn nn u d "dœu nd". Un poon nn u d'hmn v un hmb d'mpnon (ou hmb un mpno) dn qu 'mbon v dvopp

48 noduon Lmpnon n un poond modon d phum un ompn p non dn ddu dun nd nomb d u unk (NK un) d MΦ, dun nomb pu n d LT. C non d u mmun mpqu un on nmmo n à xpon d mou ddhon dn pn ddu (Wood., 1997). L okn po-nmmo L-1, L-6, TNF-α n qu MMP (mopon) on p u ndom d m un uo dduux. L p d poduon un dl-1 (4 èm jou d on) opond à mpnon. L'mpon d L-11 dn pou mn mn dmon (Robb., 1998; Shk., 1999). L ô n d n èn dn mnm d mpnon dmon p d hnqu dnvon nqu: homobox Hox-10 (m d èn d u d npon), ux d m d EGF (Epdm Gowh Fo), u odn pon LF (Luo mpnon Fo), COX-2 (ooxn-2) (Apn, 2000; Bnon., 1996; Dnhuk., 1995; Sw., 1992) ou no nd hpnqu HB-EGF (Hpn-Bndn EGF k Gowh Fo) (D., 1994). Cpndn, mod don d pon od p èn n' p no mn b. Cn mnm mou mpqu dn von du bo pmn p d ph dppoon à ddhn on n vnh bn d (Fu 13). P xmp, pon LF, podu ou onô d poon (P4) d œoèn (E2), n à ppon d uu n qu dn von du bo (Kmb, 2005; Sw., 1992).D mêm, xpon un d pon HB-EGF, onnu p HSPG (Hpn Su PooGn) pu d m d u d on EGF (EbB don EbB1/4) pn à u du bo, on n à hmn du bo à ndomè un à xpon d COX-2 (P., 2000). L poduon d COX-2 ndu nhè un d pondn, u nvu du dppoon nn pou dmpnon, v vo d non mpqun PLA 2α (Coo PhophoLp A 2α ), (Fzb., 2004; P., 2000). L pondn puvn mn v n èn qu ux odn pou d u d on ou bn ux odn d mou ddhon n à mpnon (omm LPA3 ou LoPhophd-Ad po-3), p non v pu homonux nu PPAR/RXR (Poxom Poon-Avd Rpo/Rnod X Rpo), (Lm., 1999)

49 noduon Appoon Adhn Zon pud MC Avon du bo MC Tophoodm EbB1/4 HB-EGF CB1 EbB Mou ddhon LPA3 PLA2α COX2 PPARδ EG S MYO Fu 13. Au ppn à mpnon mbonn vo d non mpqu dn ppoon dhn du bo. Adp d Wn & D, S : Vux nun, EG : Ephum Gnu, MYO : Momè, MC : M Cu nn Rpon mn à 'mpnon (dduon) Ln d dduon boun à omon d ddu noun œu onu p poon dnon d u om un n qu mon, dnon von dun n nomb d u don mpho (Thnd, 1986). Un o om, ddu jou un ô dn n d numn m nvon p ophob. L dduon mpqu mn p un popo d phum un (Jow., 2003), un umn d n popuon d u mmun un novuon d ddu (Con., 2000; Co., 1994). Chz ou, pou dbu u pô n-mom d hmb un mpno, opondn à ndo où bo mpn. Un ouh dn non vu d u (zon ddu pm) om, uv dun ouh djn p vu (zon ddu ond) qu m n p u 6 èm jou d on. Dux jou pè omon d zon ddu pm n-mom, ddu mom omdu ô oppo. Lmbon oî pdmn dn p

50 noduon n-mom, où u d ddu dpn p popo. L u ophobqu n pm nvhn p mn dn mêm zon. Un p d ddu mom (ddu b) v onbu à omon du pn Fomon ô du pn (pnon) Chz onu pm don Homm, duon d 'ndomè un d vux mn p ophob nîn omon du pn hmoho où ophob bn un on d v n mn Dnon mon d u ophobqu L ouh ophobqu pp ophoodm du bo onu pm p u à dn dn 'mbon (Ron & Co, 2001) (Fu 14). L'n d dn n u mbonn u jou 3,5 du dvoppmn pm d dnu dux n u : 'phum ophoodmqu xn p qu "pomp" ud nn du bo pou om v boœqu, MC (M Cu nn) qu u à un ô d v. C uou d pod d'mpnon, u jou 4,5 du dvoppmn mbonn, qu u omon d dn p d u ophobqu. En, ophoodm ouvn MC onnu à po ndu omon d odm x-mbonn du ôn opn d mbon mpn (Copp, 1979). L u du ophoodm pu on d MC oppn u dvon m onnun à pqu u ADN omn o u n ophobqu. Au nvu d mbon, d u no pu nd omn à p d on xn du ôn opn noun onpu n. L'odm x-mbonn nd pou om 'phum hoonqu, qu nou dun n ouh d u moh. L'noïd qu u du modm u dn p pou d 'mbon n n on v hoon ux nou du jou 8,5 du dvoppmn. C vnmn nomm uon hoonoïd, bn qu'uun uon n' u. Ququ hu pè uon hoonoïd, d p ppn dn hoon qu mqun mpmn où vux nun œo-pn dvoppn dn noïd n d podu d ompon œux du u vu pn. L ophob, v u vux œux nun o, n d mbnhmn vux mpon n un uu n m mb pp bnh. Coïndn v

51 noduon dbu du hnmn mophooqu qu opond u pou d'mbnhmn, ophob hoonqu ommnn à dn n dv ouh u ophobqu du bnh. Chz ou, x dux ouh d noophob qu on n on d v u ndoh d vux nun œux. Tophoodm J3,5 J6 Cu n ophobqu Côn opn MC Boœ Tophoodm Epb Eodm x-mbonn J7,5 J12,5 Mohum Cu n ophobqu Ephum hoonqu S vn p Sponoophob Ddu mn Cu n ophobqu S vn v Anoïd Embon Lbnh Codon omb Amno Fu 14. Dvoppmn pn hz ou. L dvoppmn po d mbon d ou d J3,5 à J12,5 mon on d n x-mbonn ompon du pn. Adp d Ron & Co, MC : M Cu nn. Tnd qu bnh dvopp, ounu p un ouh omp d u non-n u n bnh u n xn pp ponoophob. En 'bn dn d d n u, d ud hooqu d onnu dxpon d mquu nqu on uppo qu

52 noduon ponoophob dv n nd p d u du ôn opn. L ux nun mn v ponoophob p 'nmd d nd nu nux dn qu u ndoh mn on mp p u ophobqu. L n mn pnè p u dn nombux p p du bnh pmn n ux ophob vux d "bn" dmn n hn n dux èm nun (Fu 15). Vux nun œux Cu n ophobqu Sponoophob Lbnh: ophob du hoon, noophob, vux nun, om Ep nun mn Cu ndoh œ Snu vnux mn Snoophob Tophob mononu Fu 15. Suu du pn d ou (hmo-ho). Ln d n mnoœ du bnh. Adp d Ron & Co, Conô d pnon Rô d u unk L ph n d mpnon ompn dun non dun popuon puè d u NK dn ddu, u unk m u dun nd nomb d MΦ dun nomb pu n d LT (Wood., 1997). L unk, pnn 70 % d uo n d ddu poèdn un phnop pu dn d u NK nun, hz homm p un xpon u du mquu CD56 (pp CD56 bh ) p 'bn du mquu CD16 (CD16 - ). Chz ou, u unk mmu ppn p, nu on p mquu LY49G2 (Ln-d NK po), LGL-1 (L Gon Lun-1) (Mon., 1995) DBA-n (Doho bo-n) (Po., 2003). Lo d ph po d dduon, poèn pdmn dn zon ddu ( mom) no d'pmn du mu un qu nou mon d vux nun mn nn d 'uu. C uu, pn n jou 8 14 d on MLAp (Mom Lmphod A o pnn) ou n mom. Lo d u muon, u unk quèn d nombux nu o puèmn h n pon, n, mun Mu-1 (Co., 1997) u nzm qu d phoph, u, mno-ppd β-uuond (P., 1987; Zhn., 1991), qu u

53 noduon onèn un nd (d 40 µm à pu d 100 µm d dmè). P u, mquu phnopqu vn o d u muon v p d L49G2, d α- nn 1, 3 6 n d o-gm1 (Ko., 1994; P., 1990). L u unk mu ouvn dn mn ddu d ddu b où von pdmn n n nn pou dpî povmn p popo à p du mu d on juquà dpî ompèmn u m d on. Lu pn oïnd don v pod dnvon ophobqu. D onon ndon, nun nhè d xn d oèn pn, n bu à u m non p dmon à hu u. En vnh, on p u unk d nombu okn don CSF-1 (Coon- Smun Fo-1), GM-CSF, 'FN-γ, TNF-α, TGF-β LF, d u nonqu qu PGF (Pn Gowh Fo), VEGF-C (Vu Endohum Gowh Fo-C) An-2 (nopon-2) n qu n, un mun d xpon d mpl2 (Pn Lon 2), dmon (Ahk & Co, 1999; Tund & Mo, 2004). L u unk pnn u du dnhmn d modon d è p. En, hz d ou dn n u NK unk qu ou Tε26, ou dn pou hîn γ d pu d okn (γ) -/- u ou n ombnon v dn ombnon-vn n 2 R2 -/- pp (γ) -/- (R2) -/- ou no ou dn n L-15 (L-15 -/- ), è mnn pn, onnu ou nom d'è p, onvn mêm pop qu d ou non n. D pu, n d mo ou u d ou SCD onun unqumn n d u unk, hz d ou n dn n u NK unk, pm d u pop d è p (Gumond., 1998) Rô du pn L pn poèd d nombu onon d'hn n nvonnmn mn œ. u nuon pon du œu n à on dvoppmn (numn, on, oxèn), n qu mnon d dh d on mbom (u, doxd d bon). L pn jou mn un ô pou d o œ mp un ô ndonn ondmn. D oèn pn on d homon uoophqu qu un mnnnn poduon d poon u ou d on (Go &

54 noduon Tmn, 1995). L poduon d oèn pn pnd d poduon d pon hpoph hpophom pè 11 èm jou d on n povoqu p n d on hz ou (Su., 1996). Lhomon mpl1 (Pn Lon-1), d dn uon mn, podu p u n ophobqu. S onnon (d 50 n/ml à 10 µ/ml) pn un p u 10 èm jou d on dmnu pè 11 èm jou (Go & Tmn, 1995; On., 1989). L onnon d mpl2 oî pdmn juquu 14 èm jou (ompb à du mpl1) (On., 1989) m v juquà n d on. Enn, ophob on pb d podu un v d okn (FN-γ, TNF-α, L-1) qu joun un ô è mpon dn phoo pon mmunooqu d mè (P., 1998). D pu, xpmn un n nomb d pu pou m xu poèdn d v nzmqu pb d dd -. En, ophob podun mopon MMP-2 MMP-9, qu ddn oèn V n d pn mmbn b (k., 2003) von n 'nvon du momè (Axnd., 1996; Co., 1994) Dvoppmn mbonn Au 5-6 èm jou, ophoodm poè pdmn, donnn nn u ôn opn à odm x-mbonn. L u d odm mbonn ndodm pm poèn mn omn vn. Au 6 èm jou, om mmbn d Rh (m u p u p) qu om un bè onnu n v mbonn du vn n mn dn nu ubjn. L u ophobqu n nom n u n, onnun dnvh u mn. Un v ( v mnoqu) u dn m mbonn pu dn m x-mbonn. L 7 èm jou, opond à omon d mno, du modm du vn. Au 8-8,5 èm jou, un poubn du modm, noïd, oî n don du ôn opn. L pm om ppn u 8 èm jou. d mn modmqu du op d mbon qu onbun à omon d mu ququ, d vèb, du dm d pu. Au 8,5 èm jou, mbon ommn à p u u-mêm onudnmn mn juquu d om. A momn ppon d buh du o d hoïd on obv. Au 9 èm jou, à mu qu ouè nu u, p upu d p ppoh uonn pou onu ub nu. L mu du ub nu u nvu du vu d ou n ompè

55 noduon quu d om. Pndn mp, buh d mmb nu upu ppn œu ommn à b. Juquà nn, qu u ux nou du 20 èm jou, dn èm onnun à dvopp : udmn du poumon u 9 èm jou, ê n u 11 èm jou, hmu, (Fu 16). Ou J3 J4 J5-6 J6 J7 J8 J8.5 J9 J9.5 J11 J13 J16 J19-20 Fu 16. Dvoppmn mbonn hz ou. J : jou d on M b Chz ou, m b ou puon dn 'nmb d vnmn mnqu phooqu qu on pou onqun 'xpuon du (ou d) œu d nnx mbonn ho d vo n m u m d on. Avn dbu d m b, œu nvopp dn mmbn u n d uu nu p ouon du o un. Lxpuon du œu qu dux modon phooqu : ) d onon oodonn du momè, ) un momn du o un n d du n à o du nouvu-n. D homon, pondn oon, on dmn mpqu dn uon d onb du momè. Puu okn un ppon, non poon d m b hz mmmè. L okn po-nmmo qu L-1 TNF-α n u nzm pnp, don ooxn, mpqu dn bonhè d pondn. C okn puvn mn v d pondn n un xpon d u pu n-un (Hnn., 1999; Kn., 2003). L pu mpho à poon ux un d PBF (Poon ndud Bokn Fo), un u poondpndn, qu nhbn poduon d TNF-α, hun bumn u dbu d m b u à dmnuon d poon (Chou, 1994; Yon., 2003). Pèmn, ux dl-1 d TNF-α un umnn. mon qu njon d TNF-α pè du m, pu ndu un v po, v m b d nouvux-n vvn (Chou, 1994; Yon., 2003), o qun mu d on povoqu d

56 noduon vomn. D u m on ob nu v L-1, L-6 L-8 hz ou d nombu u pè (Chwz., 1994; Romo., 1991). 2. MECANSMES MMUNOLOGQUES PERMETTANT LA TOLERANCE DUMASS FFŒTO-PLACENTARE L œ u po ud è d h d p n n à o n mm n. L xp o nd o- n è n ducmh p n u ou dud v opp m n œ d v don n î n un j du œ u.c p nd n, un on dvopp n u m n œ (Rhuph, 1997; Wmnn., 1993) pmn d v opp m ndu œ u( pou vuv o Thn & Hnn, 2003; Thn., 2000). C mnm mou ouvn ud dn d modè mun, on è p ob b m n pp b à pè hum n.du n onhum n œ u,b n n d n qu d mn o qu,n p n on d v um n.s u noophob oophob xvux on n on d onnu v d u d o n mn (Fu 17). Coophob xvux Coophob oonn Sn mn Coophob vux Snoophob Mnhm Cu ndoh œ Vux nun œ ux Vo hoonqu : Snoophob, Coophob vux, Vux nun, Som Fu 17. Suu du pn humn (hmo-monoho ).L n d n m no œ d unv o ho on qu.adp dron & Co, L dn p u ophobqu, dpouvu d mou HLA (Humn Luo Ann) d, on p un dbuon unqu d mou HLA d. L oophob xvux, nv po, onmn à pup d u om qu d o n m,n xp m np mo u qu è pomoph HLA-A HLA-B (L Bou & Pö, 2001).À nv, xpmn mou vmn pu pomoph HLA-C, n qu mou HLA d non qu, non pomoph, HLA-G (mn ou om oub HLA-G), HLA-E

57 noduon HLA-F. Qun ux noophob, on dpouvu d ou xpon mmbn d mou HLA d bn qu puu oup n pndn mon poduon HLA-G dn unn d uu pm (Mo., 2003), mêm onov (Bhz., 2005; Bhz., 2005b). Lo d o, dn p d u ophobqu, on don hoqumn b pon d u humoux u d pon mmun d mè.l œ udo n à o p dm n pon povnn d mè, pqumn d on d nèn pn : nop ooxqu xn ompmn, LTCD8+ ooxqu u NK unk. En, œ u, n b n d ou p ho o ou n on, pvn à djou dn mn p m n p d mnm mou pou, pqu no R o nn n d n è n d h o omp b opho b qu p u unk L onon d u NK ond n h p n on d pu mmbn vu v u nd pqu xpm à u d u-b. C onon on onô p d pu nhbu qu pvnnn n ou on nom d on d mou du o. L u unk xpmn un nd v d pu, don n nd on onnu xpm u u ophobqu (HLA-E, HLA-G, HLA-C) v qu nn n on (Lok & Kn, 2000; Rou-F., 1997).C d pu CD94/NKG2A (nhbu) CD94/NKG2C (vu), qu onnn HLA-E (Kn., 2000), d pu LT2 (mmunoobun-lk Tnp 2) KR2DL4 (n d pop v nhb), onnu p om oub ou mmbn d HLA-G (Chn., 2002), pu KR (K- mmunoobun-k Rpo, om v ou nhb) onnn mou HLA-C (Anz-Vn., 2001).D u p u v u ( NKG2D, NKp30, NKp46) on mn xpm à u d u unk, m u nd pqu n on p no onnu (Fu 18)

58 noduon Fœ u Tophob xvo Mè NK un nhbu CD94/NKG2A HLA-E KR2DL2/3 HLA-C (è oup 1) KR2DL1 HLA-C (è oup 2) LT2 HLA-G Avu HLA-E *CD94/NKG2C DAP12 *KR2DL4? HLA-G? HLA-C? *KR2DS DAP12 Dmon ond n v d x p ondp o n ndu Mo d on-nhbu d p -pu dn p opmqu Pon dp onnn un mo on-vu d p -pu Fu 18. Dn onnn du èm HLA n mè ophob x v o œ ux.dap12 un pon dp ndun n vu. Adp d Mo-Kn, P u, u ophobqu on n à u p u unk m mn p d u NK du n pphqu (Av., 1999). L b n d d u ophob qu p u unk pou xp qu p un o poduon, u ou du pm m d on, d om v d mou XAP (X-nkd nhbo o popo) (Szwk-Chvz., 2004) : pun nhbu d p boqu d popoqu md p F d u ophob qu.qu nà b n d d u ophobqu p u NK du n pphqu, pou vo d onqun ononn mpon u n v ud n n o ophob / p n v ux n u nm n

59 noduon 2.2. nhbon d oox u dpndn d nop (ADCC) d on ophob T o m n m p n p uxp m n ux op hob d h pp à m d p nop mn ooxqu d on d mou HLA d. ) L u ophob qu n xp m n p dmo u HLA d.en b n d xp o n, mu ond LB, n qu d LTCD4+ (qu mun LB v on d L-4, L-5 L-10). ) P u, pn humn à p n o p o ox qu m n n n h b n v ondu omp m np d mo u u.c n qu on d MCP( M mb n Co op o n ),qu oppo nà x on du omp m n u mmuno obu n, DAF ( D An Fo), qu vo on nvon (Mon & Hom, 2000; Thn., 2000).C n vo m n p o pou nê duàd d u d xp ond p o n u du omp m n.ch z ou, n v ond p o ncrry (Compmn Rpo Rud Gn Y), qu u ompon C3 C4 d d du ompmn, nîn 100 % d vo m n, n ond und pôdc3 u u ophob qu nv v d n mm onp n qu n u (Xu., 2000). ) Enn, LB on pmn d dun on. P u, hz ou ( ) «podu»d n o pm n n-pn, pon nmn o m d n o pd p G1n x np omp m n(b & Bnon, 1983), ou on do n onqun d pop po «n» (Von, 1974) nh b ond v d LTCD8+ L u ophob qu n xp m np mo u p upomoph HLA-A HLA-B (L Bou, 2001) qu on, omm mou HLA d, onnu pou n onn n d o p hô, don u j.b nqu mou HLA-C on xpm bmn à u d u d ophob, LTCD8+ pqu d HLA-C on mn obv pè npnon. Touo, u onn p mê m h z ou,où mo u H-2 K, D, L, ou RT1 on xp m p pon o ophob.c d n d ( v -à-v d HLA-C hz mm )qu n v n on o dmo u mmuno-uppv (HLA-G, TGF-β,P BF, DO F L), ouv à n m no- œ p m n d on ô v d LT,m m nd u NK.L dm n ond n o p n-tgf-βàd ou nh b mp n on mb onn (S., 1993). L PBF,

60 noduon qu ndu on d okn d p Th2 un pon n- bo vdon b n mb ê un ud vo m n pon n p o (Szk-Bho., 2001). Enn, dvopp dun on un d on no vb d LT pqu d nèn ophobqu, pn u nvu d ddu b. Un ud u h z ou d mon qud LT p qu d n è n œ ux d m nu n nnomb p nd n on, qu u è qu und onon pqu pou ê un d mnm d on (Jn & Vho, 1998) HLA-G L mou HLA-G, à o p oophob xvux n o ophob, ndu n pop o d u LTCD8+ v n xn pqumn u mou CD8, qu pou xpqu b nomb d LTCD8+ u nvu d ddu b (Bou, 2002) DO L xp onp nmφ d DO,qu bo p oph n n pon à FN-γ, ndu und p on p dd u p oph n nh b ond v on d poon d LT. C mnm ud u d ou n xpo u 1mh- p oph n,un nh b uph m o o qud nz m DO,qup n nd nombux vomn (Bbn., 2004). C nzm mn xpm p n o ophob n on v nm n d p n v ux non F/FL L po p o,m n m - dn uon d pon mmun, jou un ô dn dvoppmn pn (Chn., 1999). L FL (ou CD95L) un pon mèqu nmmbn d p, ppnn à m d pu du TNF-α,qu ndu pop o d u xp m nf ( oucd95)(ahknz & Dx, 1998). En, F, mou monomqu qu m qund à on nd, ndu v on d vo d non à v on pu d mo "dh domn" n î n n pop o d u (N & Gon, 1995). Chz d ou dn n FL, nommn xp mp ophob, on o àunn o un v ud n mno- œ,qu n î nun o p on œ (Hun., 1997). C u on n nmo n on ov p d u ud m n ud ou d n pouf / F L qu pn un on nom. Un n v mou HLA-G b, n

61 noduon mou ndu poduon d FL oub p LTCD8+ v, ndun u popo p xon u mou F mmbn (Conn., 2003) O n onth2 m o nd p odu ond FN-γ dtnf-α Chz ou, uè d on mb ê o à un po d on oknqu pn mqu d p Th2 (Wmnn., 1993). En, pon d p Th1 puèmn v d u NK on nh b u ou d on, o qu pon humo on mp, un un pdomnn d on d okn d p Th2 (Chou., 2004). Un ud mon on p n u ou m qud L-4 d L-10 (okn d p Th2) u ou d on hz ou (Ln., 1993).D u ud onob vqu o p on œ mb n àunp o ok n qud pth1, v ond FN-γoud TNF-α(Chnn., 2006; H, 1992) qu nj ond L-10, okn d p Th2, p m dd m nu p opo ond vo m n d nd modè mu nà o uxd o p on œ (Chou., 1995). Nnmon, à no, u oun qu nv d on d ok n Th2 m j u,don L-10, h z ou n p o (Fon., 2002) Rô d poon d PGE2 L ho mon j ou nun ô mpo nd n mmuno u on u ou d on. L poon P4, homon ndpnb à ou on hz mmmè, vo poduon d okn d p Th2 (Kzk & Tuowk, 1996). Pèmn à on v n- n mm o, P4 u p b d nh b on onph o d MΦ u n.a o on n on, p u m nb oqu v on poon d LTCD4+ ndu p L-1 (Chou., 1995b), à pu b onnon, povoqu bon p mpho d dux u mmunouppu, pon TJ6 (Bmn., 1996) PBF (Szk-Bho., 1989). C dn mb n boqun on d TNF-α p u ooxqu (LT, NK). D pu, P4 x un on mmunouppv nqu v pondn E (PGE2) (Chou, 1995), qu pn un v mmunouppv p op n nh b n,d unp, p o ond LTCD4+ u on d okn nmmo (L-2, TNF-α, FN-γ ),,d u p, n dun, omm TGF-β, xp ond p u d L-2 u LT v (Vn., 1993). P u,

62 noduon PGE2 nh b p odu ond L-12p u p n d n è n,d m nu p odu ond L-6 mu o m n d L-10 (Vn d Pouw Kn., 1995) Rô d L-10 L L-10 podu p u p h, u o d ndomè p u ophobqu (Ln., 1993). L poduon pn d okn umn à p du 4èm j ouj u qu à mo d onpu d m nuj u qu u m (Chou., 1999; Ln., 1993). C poduon nhb v ond mpho n qu p odu ond ok n d pth1po n m n ox q u pou œ u. Chou. onmon qu L-10 on buà p o ondu œ ud nunmodè d opon mun (oupmn d ou CBA/J v d ou DBA/2) dn qu nj ond L-10 omb n n d m nu uxd o p on œ (Chou., 1995).L L-10 ndu n xp o nd HLA-G p ophob nhb onon qu d u unk (Mou., 1999) Rô du TNF-α L TNF-α v dux pu, TNF-R TNF-R. Apè u on ux pu, mmb d upm du TNF-αj ou nun ô d n pop o, dnon ou poon u (Aw, 2003). L TNF-α un on on mpo n d n uon du dvoppmn mbonn. C- douv o du on d èn mpqu dn nd omd d p od m.c m d n qu,ob v h z homm ou, p p d hvux d dn, du à un muon d pon EDA (Eodm DpAn) mmb d m d TNF-α.En, n ondeda v on p ud n od m u n ond o m ond h v ux d dn (Th & Mkko, 2002). P u, TNF-α u mp qud nd u phoo mbonn n v n pop o (Tod., 2003).D mpo n nom uu on ouvn pd p un popo xv dn uu d mb o n(mk., 2001). Un d onon pob du TNF-α d mpêh nn d nouvux-n pnn d nom uu (Ck., 2002; Pmp, 2001). L TNF-α mb u m n n uxdmo pou m n mb on pnn d domm op mpon. C p nd n,un xp on n pp op p u v d è (Aw, 2003). Bn qu TNF-α o mp qu dn on du bo dn on mpnon

63 noduon (A., 1997), n qu dn on onon du pn (MonzonBodonb., 2002),un x è dp odu onp uê n à u v d mb on (Svon., 2002). En dbu d on, xè ndu un h d mp n on, p u d v m n,un dd o n œ,un up u d m mb n ouunn n pmu (Mnon., 2002). obv hz ou qu u m n ond poduon d TNF-α ndu p nj ondlps ndu d h ombo on ondu mu un (Gndon., 1990).D u ud onmon qu TNF-α u m n uxd v o m n pon n h z ou (Ck., 1999) Rô d FN-γ Comm TNF-α, FN-γ p odu d n p n (Bown., 2002). A do phooqu, n pou obn un vuon o op m d n mno- œ (Ahk & Co, 1999) m à op o onnon, dvn n pou on.en, dm n on xo è nd FN-γ ndu d opon u ou d on p ovoquund m nu ondupo dd œ u( dd o n ).P u, FN-γ nd u xp ond mo u CMH un v ud LTd u u d ddu mpn onon d - v àv d n è n œ ux.l FNγ mn podu p u unk v (An., 2003) dpon d u d m nu uxd o p ond50% ob nud n modè d vomn CBA/J x DBA/2 (Ck., 1998) Rô d u okn L ok n qu L-1, L-3, TGF-β,L F,CSF-1, GM-CSF( FN-u qun x qu h z um n n )j ou nun ô mpo nd n b m n mnn d on (M., 1997). L TGF-β2,p odu p dnomb u u don LTγ δ d ou n (Ando., 1998), x d pop mmunouppv dn pvnon du j d mb on u b n h z ou qu h z homm(ck., 1996). nhb n poduon d LTCD8+ mn n d m nu n xp ondu p uà L-2, n à u poon à u von (Lwn, 1996). nh b m n v d u NK(vn & L, 1995). Ch z ou, mp n on n du un on n mm o v un poduon u nd L-1 d TNF-α.Lp odu onm x m d L-1 oï n d v p d œ o è n ux jou 4-5.L L-1 mb n pou ndu poduon d LF d COX-2 u d mp n on, m o n n p m b v u dun ph. L bo

64 noduon d p u d L-1 mpê h mp n on du b o p un d u 'phum d 'ndomè (Smon., 1998). L L-3 mu poon ophob qu o n d un œ o-pn dmnu ux d opon œ d n modè CBA/ JxDBA/ 2(Chou., 1990).L L-11 n à poduon d ou. En, bo d on pu mpêh mp n on(robb., 1998). L GM-CSF pn dè pm d d dduon pu dn u up -mpno poèd un ô ophqu mpon u on d ophob (Pod., 1991). Enn, CSF-1, u d on ophobqu, o m nd n omu n h z mm omm h z n m (H., 2003) m on ô n p n o m nd n. 3. NFECTON MATERNELLE ET GESTATON Un non pndn on pn un uon phophooqu p u è m n omp xd n qu np ho è n, nd ho d on on u o n mm n,p u n î n o un ê d on, o d ondup n d v opp ond m n h z œ u.l n onp d v u,d b ou d p on upb d m p d poduon d puu çon, ) n m n d hô, ) n n n d mè, ) n mu n poduon d okn booèn, v) n pubn dvoppmn pn hn mno- œ ux v) np o v oqu nd n on on n Lmon d Ch z ou, n onp T. ond pu povoqu un mon d, p ê du no m d œ u, oph d ov, on du d v opp m n o u b n d o m ondu o pj un( nd qu nun b n d ovu on )(Sh., 1994). P u, n onp Tpnoom uz (T. uz), poozo ponb d md d Ch, ndu mn un mpon duon d ond hz ou, phnomèn o à un nhbon du dvoppmn mbonn p-mpno (Mjhd., 2002 ; d Bouk., 2006)

65 noduon 3.2. A o nd n d mè Un n onm n p u œ u nd m n nd m nu n d n m n.l è v n m m n ond u h b umn o à d d d on n-u nouàunmo œ.c o d un non p Pmodum pum (P. pum) upb d dvopp d è pu b pu ou mon vè un nm hz mè (Sk., 2001). p u mon qu xpoon n uo à d bèv hphm pndn d ph qu d dnon nuon pu n v poduon mon d u-p u u n u on, n î n n pp ond nom d n dvoppmn du v u œ (Hnou., 2001) Mo d ond nv o nn m n oknqu o à on Lo d un n on u ou d on, m n m dd n mmun do v nê v ndm n n d ç on p qu on ô d n on ou n nh b n d n h m nd ond v n u m nd è pou œ u.un modè d n onmu np Lhmn mjo (L. mjo) pm d mon qu p odu ond ok n Th1, o d un n onm n,p u b qu b ok n qu pn n u bon d ou m nd on.en, n onp L. mjo p ovoquun u m n on n vdunomb d o p on œ o àun u m n ond p odu ond FN-γ d TNF-α und m nu ond L-4 d L-10 pn (Khnn., 1996). A n v, nv onn m nth2ph o o qud un œ o-pn mb vob à mupon d mo-onm nu (nommn onô p un pon Th1). L mupon d ux- d n un œ o-pn pou vo u n m on u œ u on bu à u m n n d n d n on onn. L bn xêmmn d ompx d puu okn qu pou b m n m n nd onp uê p u b o m nou u nvu m qu n d n onm n p u n î n un dd o n œ ouun vomn (Enn, 2002)

66 noduon 3.4. Pubon du dvoppmn pn d hn mno- œ ux L n onp P. pum un xmp pn d poond on d hn mno- œ ux n p n pouv n vo uo d on. En, n onp u n î n mo du œ u( m à3-8 %) ou un ouhmn pmu (Sk., 2001). L mè n pnn d pm pn è v.l ob v ond dh n d h o n d u qu on dn p n v o d m n dup n u x n, u noophob, d pu xn vmn obu ou p (Fd & Du, 1996).C d n xp m nunph no pd dh n p p n d ndd CSA ( Chond oï nsu A),duCD36 d CAM-1 à u u mmbn (Bon., 1999; Mub., 2000). D pu, xpmn à u u d vn nènqu d m d PEMP1 (P. pum Eho Mmbn Pon 1) n, n u, à CSA pn (Sh., 2001). An, n mm onp n qu u d qu ond u n mb o à h po oph œ, on qu n p ob b d mod on d h n n p n dnu m n d ox è n(bbn., 2004). L b on m n p b d ndu un vo m n n p u b n dvoppmn pn hn mno- œ ux.en, ou n p b à Gm po L monoon, pnn d nom hooqu pn (Abm., 2003) don ô dn pou bo no à dmon. L ou n p b à Gm n Bon b pnn qun à d d d on n-u n d o p on œ o à d on vu u nvu du pn, pouvn mn pub hn mno œ ux(bouou., 2001).En n, n ond ov np nd n onp b à Gm n Chmd bou povoqu d vomn o à mupon d mo-onm dn hoon pn, d poduon homon ponb du mnn d on (Buxon., 2002)

67 Obj Obj Obj L oxop mo on n do n n dn nnu n Fn m n un à dux nouvux-n pou 1000 nn po un pobèm d n pubqu. L qun d nmon mno- œ on d ommp opo onn à du pn u ou d o, o qu v d on à â du œ u u mom nd n onm n (Ambo-Thom & Poux, 1993). En, pndn pm m d o, qu d nmon mno- œ b, p nd n, œ u on m n on xpo àd on v (Dunn., 1999) nînn pu ouvn un vomn ponn. Pndn duxèm m, qu d n m on è v, b è p n nmo n, ond m u n mpon. Au ou du oèm m, pobb d nmon mno- œ mpo n n n ouv n mp om quà n n.l n o m on dponb u on mno- œ d n n onp T. ond doun à o d ud o d n on on n h z Homm d v uxm n d n n on xp m n mu n.dn omb ux v uxon ud m n m dup npn d T. ond m u undon n n u m nd pon b u m n m bo n u o d un n onp o. L obj d v d,d nunmodè mu n, m n m du p o u bo o d un n o np T. ond u ou d ph po d on. C modè p m dmon d unp qu n onp T. ond ndu un vo m n h z ou pu d u p d ud m n m u mou m n ju o d pou. L dux hpohè pnp pou on : ) mnm bo ppn u à un poon d T. ond à n m no- œ ndu n d u ondu œ up un on quou ) mnm bo on u à m n p d pon nmmo nommn p b d FN-γ, ok n onnu pouê booèn dn d ondon nonnu (Vd., 1994)

68 M M Mhod Mhod

69 M Mhod 1. PROTOCOLE EXPERMENTAL 1.1. Sou L xpmnon nm on on ommndon du Gud Con d R h hn on pou U on P odu ond An m ux v u o on( n 6740d v 07/ 01/ 2000)dum n è d u u.d ou Sw W b ( n d v.r.j nv,lg n -Sn-, Fn) non onnqu n qu d ou onnqu v129 (don d Mm M. Fudnb, Mx Pnk nu o mmunoo, Fbu, Amn), uv ou nvd pou èn odn pu à FN-γ,dn dn FN-γ R-/-, â d 8 à 12 mn, on v dn d ondon ndd (22 C, 60 % d hum d v, j ou/nu d 12 h) v un è b à u àun m m n on ô ( H n,g nn,f n ).L ou FN-γ R-/- onp d nun mo, n mb dum ( nou u, u) um n pu on u ou ho à ux mn (PSM d p 2) Gnop d ou Pou xpn u ou v129 uv nvd, un nop u u pn n qu u non F1. C nop pè x ond ADN um mb n n m nun d p è mq A mp DNA M nk o on( Q nsa,cou bœu,f n )àp d unp è v m ndqu u on ommndon du ounu. Un p d don p pon K pndn un nu à56 C u v nd n p nd x on.l ADN x ud n200 µld mpond u onae( T -HC 10 mm, EDTA 0,5 mm, ph 9, Qn) onv à -20 Cj u qu à ondpcr ( po m h nr on).l mo u on FN-γ R-/- n (5'-CCCATTTAGATCCTACATACGAAACATACGG-3') FN-γ R-/- n n( 5 -TTTCTGTCATCATGGAAAGGAGGGATACAG-3 ) n om n n( 5' -CTT GGGTGGAGAGGCTATTC-3') nomn nn (5'-AGGTGAGATGACAGGAG ATC-3' ).Lm n onn,d unvo umd50µl, on n1µld ADNà,5µL d PCR Bu 10x (500 mm KC, 100 mm T-HC à ph 9, Qn), 1,5 µm d MC2 ( nv o n,c Pon o,f n ),200µM d unm n qu mo d qu dntp (nvon), 1,25 U (Un) d Ho S Tq Pom (Qn), 2 µm d hqu mo d uu pu q.. p.50µl.un mo nd ADN x d ou v129 uv, n d n h qu.l d mp on on u d nun h mo u

70 M Mhod (Pkn Em 2400). L v on p opho è n d o à2%. L p n d mp on v u p è o o on ubet ( b omu d h d um).l d mn FN-γ R nomn mp on pvmn d pb (p d b) Souh d T. ond L ouh vun ME49 (p ) d T. ond u pou n on.l k d T. ond on obnu à p d vux d ou Sw n 2 mo upvn p vo o v 20 k d ME49. L ou on u h n p nh ond o u n (Foèn, Abbo, Run, Fn) vux on pv dn 1 ml d PBS (Phoph Bu Sn, NC 0,138 M KC 0,0027 M ph 7,4, Sm-Adh, S Qunn Fv, Fn) pu bo (U-ux mx T25, Jnk & Kunk, Sun, Amn). 20 µl on dpo u m k on omp. L hzoï d ouh RH on obnu p p u d 106 hzoï nj p vo n-pon à d ou Sw. L ou on uhn 4 jou pu dp nh ond o u n.l q u dd up p pon on v d v pon v 5 ml d PBS pu u mmbn n pobon d poo 3 µm (Nuopo, Wh m n ) nd m n d b u d ou M n poduon non Un n h on ond œ ud ou m ( 2p ) ob nu p è u on du n48h v un è mp n d od u d un ou mâ. L m mâ on m n on un nu. L ndmn mn, ond omm jou 1 d on (J1), m on p n p vo o v 10 k d ME49 du dn 100 µl d PBS. Un oup onô v n100µld unb o d v unon n pou hqu xpn. L pèvmn on u à dn jou d o n( J 8,J 9,J 10 J 16) p è u h n d n m uxp nh ond o u n.l ou n u on un on n moopqumn. Un pèvmn nun un pèvmn d dux on un on

71 M Mhod 2. ANALYSES HSTOLOGQUESDESUN TESFŒTO-PLACENTARES 2.1. Ppon d oup L un œ o-p n d n à n hooqu, onv dn du pomdhd à 4 %, on mo-dqu ou oup bnou n d oup d nunp n d mb onp np m ud un ( Fu 19). L 2 dmun on o dhd p b n u d h nod on n on o n ( d 70 à 95 ) pu d ouèn. L hnon on nu dn pn d oup n ( 5µm) on à dd unm o om.l oup ond po ud m Su p Fo (Dko, Tpp, Fn), ouv d'u h ququ mnu u un pqu hun à 45 C. E on nu p à 'uv à 37 C pndn 24 h (hu) pu ok à mpu mbn. A B C F momèqu C d n u on Coup Coup F nmomèqu Fu 19. Pooo d ppon d oup bnh. Rpnon hmqu monn p ond d mp n on( A),p ndoup d mb onpnp m ud un ( B) upo on o d n u ondn p n( C). Adp d Co & X, Dpn L oup ub n oud bo dun pdd p n ndpouvo dn mqu. C dpn ompnd un p d douon d pn p nubon d m dn 2 bn u d 10 mn (mnu) dn xèn, pu un pd h d onp o vd h n ond nd b n u d h noà onnon don :2b nd h no b o ud5m n,1b nd h no95 d5m n, 1b nd h no75 d5m n 1b nd h no50 d5m n

72 M Mhod 2.3. Cooon hmun-on L ooon hmun- o n p m un n h o o qu d un œ opn pm qunon d don d è p p mu du d mè o d è u d mè d um è.ap è dpn, m on o o v un o u ond h m ox ndm ( S m -Adh) pndn 2 à 3 mn. Ap è unb nç à u, on o o v un o u ond u h npon u (Sm-Adh) pndn 5 à 10 mn pu n à u.l m onp on d nun b nd d pho phomo bd qu( S m -Adh) à 1 % pndn 10 mn, à umè duj oup nd n2m npu n à u v nd ê p on d nd up nd n2m n pu mon v un ouon d n n Mqu n-t. ond C mqu n d m n vdn pn du p dn un œ o-pn. Apè dpn oup on pmb dn un bn d mpon 0.1 M hu u mo-ond 2 o 5 mn à 360 W. Apè un v dn du PBS, pqu on boqu pndn 30 mn à mpu mbn v un ouon d PBS, onnn 20 % dsvf( S um dv ufœ n v, nv o n) 10 % d um d hèv (Sm). Apè 3 v d 5 mn v du PBS, poxd ndoèn on nhb v un ouon poxd bokn (Dko) 15 mn à mpu mbn. Apè un nç d 5 mn dn du PBS, un p d bo d bon ndoèn m n u p u ondu è m v d n/ b o nb o k nk (Vob, P, Fn) 15 mn à mpu mbn pu m on v 3 o 5 m nd ndupbs.lm qu d p p un n ub ond unnu à4 C v un um poon d pn n-t. ond (Abd So, C Sn-Choph, Fn) du u 1/50èm dn du PBS onnn 1 % d BSA (Bovn Sum Abumn) 10 % d um d hèv. Apè 3 v d 5 mn v du PBS, m on nub 1 h à mpu mbn v onjuu opondn à d G d hèv n-g d pn oup à bon du u 1/250èm(Jkon mmunoh, Monuçon, Fn) dn du PBS onnn 1 % d BSA 10 % d um d hèv. L don p n ub on30m nà mp u mb n v d p v d n oup à HRP( Ho dh poxd, Dko) du u 1/500èm dn du PBS, 1 % d BSA pndn. Apè nç 5 mn dn du PBS, von p un ouon d Dmnobnzdn (DAB, Dko) pndn 2 à 3 mn à mpu mbn uv 3 v d 5 mn dn du

73 M Mhod PBS. Un p d on- o o ond10 ( ond )d nun o u ond h m ox n d H (Sm), m on n à upu mon d nun o u on d n n Mqu n-bx L oup dpn on omm pdmmn d pou mqu n-t.ond : pmbon, bo d pqu nhbon d poxd bon ndoèn. L mqu d pon Bx n nubn oup 1 nu à 4 C v un um poon d pn n-bx (Sm) du u 1/100èm dn du PBS onnn 1 % d BSA 10 % d um d hèv. Apè 3 v d 5 mn v du PBS, m on nub 1 h à mpu mbn v onjuu : G d hèv n-g d pn oup à bon du u 1/250èm(Jkon mmunoh, Monuon, Fn) dn du PBS onnn 1 % d BSA 10 % d um d hèv. L don p d p v d n oup à HRP( D k o)d u u1/ 500èm dn du PBS, 1 % d BSA n nubn m pndn 30 mn à mpu mbn. Apè nç 5 mn d ndupbs, v on p nubon d 2 à 3 mn à mpu mbn d un o u onddab( D ko), u v 3 v d5m n v dupbs.un on -ooon p un o u ond h m ox ndh ( S m ) p nd n10, m o n n à upu mon dn un ouon d n n Mqu omp d u unk Mqu PAS (poxd d Sh) C ooon pm d m n vdn nuon d u unk. En, ox d on d po h d p d podqu bè d oupmn dhd qu on o v p d Sh (Sm). Apè dpn, m onp on d nunb nd dp od qu( S m )à1% pndn 10 mn à mp u mb n pu n 3 o à u oun. Apè un ooon p ds h p nd n30m nà mp u mb n u v d un nç à u ou n,un on- o o onp un o u ond h m o x ndh ( S m ) p nd n10. L m on n 5m nà u mon v un o u ond n n

74 M Mhod Mqu DBA-n-FTC L DBA-n poèd un è hu n v o-onjuu onnn d oupmn N- D-omn n poon mn pqumn v mmbn pmqu mmbn d nu nu d u unk hz ou (Po., 2003). Apè dpn d m qubon 5 mn dn du PBS, pqu on boqu v un ouon d PBS, 1 % d BSA dun 30 mn à mpu mbn. Apè 3 v u d 5 mn dn du PBS, m on nub 1 h 30 mn n hmb humd à 37 C v un ouon d DBA-n (Sm) oup à FTC (Fuon-o-Tho-Cn), du u 1/50èm d nd ud. Apè un dn v d 5 mn v du PBS, m on mon dn un ouon d Mowo (Cbohm, Nonhm, An) pou u u moop à puon Comp d u unk L o mp d u unk u u oup o o upas nu n un momèqu d 1 mm2 p u o u d unm o op.l omp u à un omn d 400x Mqu TUNEL L on d TUNEL (Tmn doxnuod n-mdd dutp-bon Nk End-Lbn) u mn Doxnuod Tn ou TdT, nm qu ux m n m n ux d ADN n n pon à d nux popoqu on n d ox nu o d b o np m nà d n d ê m qu.cm qu uà ddu è mtdt-feltm DNA Fmnon Don K (Cbohm) on ommndon du ounu. C mn on o d p p v d n oup à HRP v p DAB.Un on ooon un pooo d mqu PAS dn un ond mp pmn d o mn u unk

75 M Mhod 3. MESURE DE LA PARASTEM ESANGU NEETFŒTO-PLACENTARE 3.1. Ex o nd ADNàp du n d un œ o-pn L' x on àp d500µld n o oud unun œ o-pn o onv d ndupbs.l x ond è on pd h n on.l n bo (24000 /mn, 1 mn) pu nu 3 mn à L obu ou on v 1 ml d mpon d d obu ou (T-HCL 10 mm ph 7,5, uo 0,32 M, MC2 5 mm, Ton X100 1 %)pu n u 3m nà13000.l x on u200µldu u n n.l un œ o-pn on o, dqu p du mu un pu bo pmn (24000 /mn, 1 mn) dn un mpon d oun p èm QAmp DNA Mn K ( Q n).l ADN x v è m on ommndon du bn u dn 200 µl d mpon d'uon AE p un nuon (6000, 1 mn) onv à -20 C Exon d ADNd ou hrh dt. ond onuon d mm d n L hzoï on v v du PBS nu à 200 pndn 20 mn. L nomb d hzoï dmn p omp u un u d numon d Nubu (Ho Bomd, K, Amn) onnon ju à 105 hzoï/µl. L ADN d107 hzoï pu u èm QAmp DNA mn k (Qn) pu u v 1 0 0µLd mpond u onae.l ADN qu n p m u d b o b n n pophoom à 260 nm pu m p ppo d bobn à 260 nm u280nm.l mmd n o on u àp d u d ADN.Un pmè duon dn du mpon AE mèn onnon à hzoï pou 5 µl pu d duon n on d 10 n 10 dn mêm mpon d çon à obn pon d mm 1750 ; 175 ; 17,5 ; 10 ; 5 ; 1 0,5 hzoï() pou 5 µl (voum d h n onp ub p ) PCR onvnonn L' mp ondu m n p d ADN AF146527u mo : Tox4 5'CTGCAGGGAGGAAGACGAAAGTTG-3' Tox5 5'-TGCAGACACAGTGCATCTGGA TTC-3' (Homn., 2000).Lvo um onn d50µl on n10µld ADNpu, 5 µl d PCR Bu 10x (Qn), 200 µm d dntp (nvon), 1,25 U d Ho S Tq

76 M Mhod Pom (Qn), 2 µm d hqu mo, 1,5 µm d MC2, d u q.. p.5 0 µl.l mp on u d nun h mo u( P k ne m 2400) omp nd un dnuon n v von d pom pndn 15 mn à 95 C uv d 40 d'mpon (dnuon 30 à 95 C, hbdon 30 à 58,8 C, onon 30 à72 C) d un on on m n d5m nà72 C.Lp n d mp on( 528 pb) v u p è o o on ubet p è opho è n d o 2% PCR qunv n mp Lm u d p m u p qu n on d ADN p PCR qunv n mp (LhC, Roh, Mn, Fn) on mhod d p Rh (Rh., 2003). L mn onn (20 µl) ompo d 5 µl d ADN pu à,d 0, 5 µm n d hun d mo n (Tox-9 :5 AGGAGAGATATCAGGACTGTAG-3 ) n n( Tox-11 :5 -GCGTCGTCTCGTCTA GATCG-3 ),d0, 25µM d h und ond d h b d onm qu à uo n (Tox-HP-1 :5 -GAGTCGGAGAGGGAGAAGATGTT-[FL]-3 )ou u ou 640 (Tox-HP2 :5 -[Rd 640]-CCGGCTTGGCTGCTTTTCCTG-Phoph-3 ),d2µld mpon10xdu èm LhC FS M Hbdzon Pob (Roh), d 4 mm d MC2, d 1 U d UDG ( U -DNA G o,ro h ) d u U Pu q.. p.20 µl. C m n onn d po d nun ub p nv pu oum à mp on qunv. L qunon ndu pob p ompon du n obnu pou hnon à v mm d n. L po mmd mp ondpcr qu n v ompo d un p d on d UDG ( m n on d v n u on m n onp n )p nd n1m nà mp u mb n,d un v ond Tq ADN pom d 10 mn à 95 C d 50 d 10 à 95 C ; 20 à 58 C 20 à 72 C. Lm u d uo n à6 40nm à nd h b d ond mo d ond ; mp d mp u on à20 C/.L n qu n vd donn d uon d çon ndd dn n d uon F2/F1 ou F2/ b kf1 v un p m m x mum d d v ond un j u m n hm qu d ndb.un ou bd u on d ç onàv qu un un u m nd ADNdon mpu d uon ndu à 65 C o mp. L pomm d p 20 à 95 C pu 20 à 45 C (mp d mpu à 20 C/) pu mpu po à 95 C p p d 0,2 C/ un mu onnu d uon à 640 nm u

77 M Mhod 4. DOSAGE SERQUE ET PLACENTA REDEL FN-γ, DU TNF-α, DEL L-4,DEL L-6 ET DE L-L Obnon d hnon L um on obnu p nuon du n o 5 mn à L un œ o-pn dn à n on up dn 1 ml d PBS onnn 1 % d o k d nh b u dp o ( S m ) b o à24000 / m n( 1m n) p onon (2 pu/, 1 mn, 60W, u ) (Vb C, Bobok Sn, kh, Fn). L unn on up pè 2 nuon uv (13000, 20 mn, 4 C) onv à -20 C Enzm Lnkd mmunosobn A (ELSA) Lq u n ond FN-γ,dTNF-α,d L-4,d L-6 d L-10 u dn um d n un œ o-p n d ou n on ô n à d d èm mmunonzmqu OpEATM mou ELSA (Phmnn, L Pon d Cx, Fn) (Tbu 9). L nbon d pqu d moon (Mxop, Nun) d 96pu à ondp u uunnu à4 C v 100µL/ pu d n o pmono on dn un mpon bon bbon 0,1 M ph 9,5 ou phoph 0,2 M ph 6,5 on okn à do. Apè 3 v v du PBST (PBS-Twn 20 à 0,05 %), d on non pqu on boqu 1 h à 37 C v 200 µl/pu d PBS-SVF (PBS onnn 10 % SVF) pu pqu on v 3 o v du PBST. L hnon on d po ( 100µL) n p à d u on pp op nd v u p b.d nun mêm mp, un mm on n dup p duon n d okn ombnn opondn. Apè 2 h d n ub onà mp u mb n, p qu on v 5 o v dupbst.ld on u p 1hd n ub onà mp u mb n d 100µL/ pu d un o u on on n n onj u ub o n d ud ndupbssvf v d np oxd du u 1/250èm dn ouon d onjuu du. Apè 7 v v du PBST, von v 100 µl/pu d ub, TMhBnzdn (TMB, KnEnT dno, Copnhu, Dnmk), nub 10 mn à mpu mb n à ob u.l on opp p dd ond50 µl/ pu d d u u qu2n.lm u d on à450nm o RMS (Lboo Dnh, Sn Coud, Fn) pm d oub ndd d u onnon d dn okn

78 M Mhod Tbu 9. Cqu d ELSA. Duon Cokn do Tmpon d d hnon Gmm on nbon Sum Un (n p/ml) Duon du onjuu FP FN-γ Cbon 1/100 1/ à /500 TNF-α Phoph 1/10 1/ à /500 L-4 Cbon Pu Pu 500 à 7.8 1/250 L-6 Cbon Pu Pu 1000 à /250 L-10 Phoph Pu Pu 2000 à /250 FP :Fœ o-pn. 5. WESTERN BLOT 5.1. Exon do poqu L on un d ou Sw up dn un ouon d PBS onnn 1 % d o k d nh b u dp o ( S m ) ond qu nd o un œ uxp n dumu u n.qu un œ o-pn on on pooo du p ph4. 1. n d ob n un x p o qu.l on n on p o qud hnon dmn p mhod d Bdod (Bdod, 1976) Eophoè Un d opho è à10% d m d u pou n x poqu dn d ondon dnun (0,1 % d SDS, Sodum Dod Su). 25µL d x p o qu( o po n d nà50µdp o n o ) onm n à 5µLd mpondd o on( L mm βm p o-hno) nub 5 mn à 100 C. L 30 µl on dpo dn pu n qu 8 µld unm qu udm mo u poqu (Pon Pu Sndd, BoRd, Mn Coqu, Fn). L mon u n mpon T b 0,25 M Gn 2 M SDS 0,1 % pndn 45 mn à 200 V (èm Mn-PROTEAN 3, BoRd)

79 M Mhod 5.3. mmunobo Apè ophoè, pon on n u mmbn d nouo (Amhm) pnub dn du mpon d n (Towbn., 1979). L von d pon p nubon qun v un ouon d uon (PBS onnn 5 % m n poud) pndn un nu ou on à 4 C, d nop pm du dn du PBS, 0.1 % d pndn 2 h ou on à mpu mbn, d nop ond oup à poxd du dn du PBST, 0,1 % d pndn 1 h ou on à mpu mbn (Tbu 10). C p on p p d qun d 3 v d 10 mn v du PBST. L von n uodoh p j oudu ub h m o um n n( ECL P uw nb o nd ons m, Amhm Bon) pndn 5 mn pu m n on v un m phoophqu (BoMx Lh Fm, Kodk, Chon us ôn,f n ).Ap è 10 m n d xpo on à mpu mbn, m dvopp pndn 1 mn dn du vu du u 10èm d nd ud ( X d v op LX24,Kod k), n à up nd n20 x pndn 1 mn dn du xu du u 5èm d nd ud ( X x AL24, Kod k).ap è un nç n d5m nd nd u, m hà b. Tbu 10. Anop pm ond u. Pon à v Anop pm (pod n kd) Monoon β-n (42 kd) Duon u d ou n-β-n (G2), (on AC-74), 1/5000 Sm Bx (23 kd) G d pn n-bx, Monoon B2 (26 kd) 1/1000 Sm d n-b-2 ou (G1), (on C-2), 1/1000 Sn-Cuz, Hdb, Amn Monoon p53 (53 kd) d n-p53 ou (G2), (on DO-1), 1/200 Tbu-bo, L P n Yvn, Fn Anop pm An-G d ou An-G d pn Anop ond An- G d Duon u ou oup à HRP p n oup à HRP Bkmn, Ro, Fn An- G d Jkon mmunoh / /25000

80 M Mhod 5.4. An nomqu L n n d b nd ob nu qu n n ppon à d β-n opondn v o Son mn ow (Son Copoon, Mnd, USA). 6. RT-PCR QUANTTATVE EN TEMPS REEL (qpcr) 6.1. Exon L un œ o-pn dn à n onv dn du RNA (Sm) on mo-dqu ou oup bnou n d p du mu un. L ARN d2un œ o-pn bo à /mn (1 mn) x pu n u n è m u o onn Q A mp RNA M n K (Qn) on ommndon du bn, pu u dn 30 µl d mpon AE qun u pophoomè Ron d npon v L ARN d h qu h n on ob nu v n n ADN ( ADN omp m n )p u on d Moon Mun Lukm Vu (M-MuLV) v np du èm F Snd DNA Snh k (Amhm, O, Fn). L ARN ub oud bo dund n u ond u u à65 C p nd n10m n pu v n à 37 C pndn 1 h, on ommndon du ounu, dn unm n onn on n n2µd ARN,1µLdBu k -nd DNA on Mx, 6mM ddtt,5µd mo No -d( T) 18b un on p m d urn - q..p. 33 µl PCR qunv L poduon d ARNm (ARN m) dmn p qunon d ADN opondn p PCR qunv n mp (LhC). Bèvmn, m n onn on n2µld ADNà,0, 5µM n d h un d mo n nn (Tbu 11), 2 µl d mn onn LhC FS DNA M SYBR Gn onnn Tq on mpon o, dntp n qu SYBR Gn (Roh Appd Sn), 6 mm d MC2, u u pu uov q..p. 20 µl. L 20 µl d mn on dpo dn un ub p n v pu oum à mpon qunv. L qunon obnu n ompn n obnu pou

81 M Mhod hnon à v un mm d n. L mm d dn b on b àp d mp ond ADN - b npcr onv n onn.l mp on pu àp du d o 2% p èm u oonn Hh Pu PCR Podu Puon (Roh Appd Sn, Nu u Sn, Fn) u dn 100 µl d mpond u on ou n, v nd ê qu n u p opho omè.c u d ud10 n 10 d çon à obn pon d mm d 1011 à 102 op/µl p ub p d mm. L po mmd mp ondpcrqu n vpou mm do d hnon uvn : 10 mn à 95 C (von d Tq ADN pom) ; 40 d 10 à 95 C ;20 à mp u d h b d on( Tbu 11) 20 à 72 C.Unm u d uo n à640nm à nd h b d ond mo. L n qu n vd donn d uo n d ç on nd dd n n d uo n F2/ F1ouF2/ b kf1 v unp m m x mum d d v ond un jumn hmqu d n d b. Un oub d uon n d v qu u n u m nd ADN d on mp u d u on ndu o mp (Tbu 11). L pomm d p 20 à 95 C pu 20 à 45 C (mp d mpu à 20 C/) pu mpu po à 95 C p p d 0,2 C/ un mu onnu d uon à 640 nm. Tbu 11. Squn d mo qu d qpcr on b qun. T C Amo b Tmp d u Tm p Tmp u d mp on d hb d on d on on uon 5 -TCTGGCACCACACCTTCTA-3 β -n 19 0 pb 5 -AGGCATACAGGGACAGCAC-3 55 C 8 88 C 5 AGCGGCTGACTGAACTCAGATTGTAG GTCACAGTTTTCAGCTGTATAGGG- FN-γ 5 pb 60 C C 3 5 -CAGCACTCTGTCTTCTAACAAGAA L TCTGTGAAGGTTTTCTCCTCC-3 V EGF 81 3 pb 5 -TTACTGCTGTACCTCCACCA ACAGGACGGCTTGAAGATGTA pb 55 C 4 82 C 55 C C

82 M Mhod 7. METHODES STASTSTQUES L u qu on u mon du o NSTAT (Gphpd ow, Sn Do, CA). Un d Fh u n d omp poun d ou n d opon n dn oup d ou. Un d Sudn mpo pou omp ou u donn (don d è p, nomb d u unk, pm, poduon qu pn d okn, d n qun p qpcr, d pon v p Wn Bo). L vu d p nu à 0,05 on ond omm nv

83 Ru Ru

84 Ru 1. MECANSMES ABORTFS NDU TSPARL NFECTON A T. GOND 1.1. Appon d opon hz ou Sw n L mp on dt. ond d n vo m n p o n p uàd mon pndn phnomèn nvnn dn mo n uo n no è pu ud. Pou xpo mnm mpqu dn vomn ponn, nou von ou d bo dd v oppunmodè d n onp o u ou d on h zd ou Sw (SW) non onnqu n p vo o v 10 k d ouh ME49 (p ) d T. ond nd ndu unm n m bo p ob v ond un œ o-p n o b, o p on nd n p p n d h mo dmnuon d d un (Fu 20). b Con un Un œ o-pn nom Hmo Un œ o-pn ob Fu 20. Con un d ou non n () n p T. ond (b). L n on ndu d o p on,p oubo hz ou. L n on u à J8, J9, J10 J16 d on u 24 ou p oup (n non n). L u opondn à un xpn pnv pou h qu mpd n, nomb d xp n nd2pouj 9 J 16,4pouJ 8 6pouJ 10.L n onnmod n nomb d œ u( u nonmon )n poun d on à J8, J9 J10 (Fu 21). En vnh, nou obvon un dmnuon nv à J16 du poun d ou n dn oup n (16,6 % v 54,1 %, p < 0,05)dmê mqu und m nu on n vdunomb d œ u (14.4 ± 0,4 v 10,5 ± 0.8, p < 0,05).En b n d n on, u un o p onn ob v qu qu o mpd n.nouob von o d n ond o p on dè J8 (8,3 %). C poun d opon, opondn u nomb d ou pnn

85 Ru d un œ o-pn ob, umn v mp (20 % à J9, 54,5 % à J10) pou nd 75 % à J16 (Fu 21b). Poun d ou n Non n n * b Jou d'non 100 Poun d opon 90 ** *** Jou d'non Fu 21. Poun d ou n () d opon (b) n oup non n n à dn mp d on. Un dn du poun d ou n obv à J16 d on n oup d ou n non n. L opon on obv à p d J8 hz ou n poun d opon umn n onon du mp d on. * : p < 0,05, ** : p < 0,01. C u nd qu nqu n onp T. ond n p d u m n m d mp n on mb onn m qu ndu d p o u bo pp n ondmn. P u, dmnuon du poun d ou n obv à J16 pobbmn ux opon obv ux mp nu. Dn u d no

86 Ru v, nou von n no n à J10 n on d o umnon d pè d 50 % d opon obv n J9 J F b h p d n un œ o-pn Un n qunv p PCR du nomb d p, à p d 7 ou u4un œ o-pn p ou, pm dd ADN dt. ond à p d J10 à un onnon quvn à 8 p/m d u pn. Un mqu mmunoh o h m qud up àj 10àp d2 ou,4un œ o-pn p ou n n à dd 2 oup p un ( Fu 22), onm b nomb dp.en,noun ob vonnp o onm vdup,n o dn o u nd un œ o-pn pnn d opon (Fu 22b). L hh du p p dux hnqu m n vdn un b h p o ux opon. F momèqu Coup b Coup F nmomèqu 50 µm C d n u o n Fu 22. M hod d ob n on doupb nh( ) mqu un d T. ond à J10 d n on( b). ()Chquoupp p on nduxun œ o-pn u d mêm ou oup dn pn. (b) L p d n b qun dn ddu b d ou n n povoqu uun n u à poon. L èh monn 2 u n P n d h mo dd o m n p n dn un œ o -pn n L n h o o qu àj 10àp d4 ou n p oup( on u d 24 ou h un), u2un œ o-pn p ou pou qu 4 oup p un on o o à h m un-on, mon pn d domn pn

MINISTÈRE DE L ÉCOLOGIE ET DU DÉVELOPPEMENT DURABLE DIRECTION DE L EAU BUREAU DE LA LUTTE CONTRE LES POLLUTIONS DOMESTIQUES ET INDUSTRIELLES

MINISTÈRE DE L ÉCOLOGIE ET DU DÉVELOPPEMENT DURABLE DIRECTION DE L EAU BUREAU DE LA LUTTE CONTRE LES POLLUTIONS DOMESTIQUES ET INDUSTRIELLES MINISTÈRE DE LÉCOLOGIE ET DU DÉVELOPPEMENT DURABLE DIRECTION DE LEAU BUREAU DE LA LUTTE CONTRE LES POLLUTIONS DOMESTIQUES ET INDUSTRIELLES MESURESTEP SAISIE DES MESURES DAUTOSURVEILLANCE DES STATIONS DÉPURATION

Plus en détail

Associés SARL SA SAS SNC SCS/ SCA Nombre Entre 1 et 1OO (art. L 223-1et L ; n os s.) A partir de 1 (art. L ; n 60093)

Associés SARL SA SAS SNC SCS/ SCA Nombre Entre 1 et 1OO (art. L 223-1et L ; n os s.) A partir de 1 (art. L ; n 60093) CHOI SI RUNEFORMEDE SOCI ÉTÉCOMMERCI ALE ADAPTÉEÀSESBESOI NS D o d DROIT DES AFFAIRES L hox d un fom o un x dff, n pmè à pnd n ondon on nombux (oû d on, qu nouu, u d o d dgn,.). Dn v bn, x d nouv don du

Plus en détail

Introduction à la clinique en psychologie (R. Richardson)

Introduction à la clinique en psychologie (R. Richardson) Fon pdo 2013 Inoduon à nqu n phoo (R Rhdon) Qu- qu phoo nqu? - Wm pub pmè dnon n 1907: ud d nddu p obon ou pmnon nnon d pomouo hnmn - phoo nqu dompnd po md à ndpon hndp nono p b d n ho pqu (dnon APA) 1

Plus en détail

N45 35 40 W0 32 20. Pointsforts:lespistescyclabesetlesrandonnées.

N45 35 40 W0 32 20. Pointsforts:lespistescyclabesetlesrandonnées. B u P huff Lo o ou o o U d o u xm g m u C mbo D p dd pou ou Pou p : A dj ux dp qu p h uff p ugo mpo b dp gpog b by oo Pou po: k b u o o bo p b b u LLo odmob hom W by: 4p +1-30m² 2 h mb 1 u d2p u 2 ô à ô

Plus en détail

Conseil économique et social

Conseil économique et social Na t i ons U ni e s E / C N. 1 7 / 20 0 1 / PC / 1 7 Conseil économique et social D i s t r. gé n é r a l e 2 ma r s 20 0 1 F r a n ç a i s O r ig i n a l: a n gl a i s C o m m i s s io n d u d é v el

Plus en détail

Les modèles de gravité

Les modèles de gravité Jn-M Sën Un P-Duphn n@duphn. ; www.duphn./n www.duphn./n 1 L mdè d g Fn R. 2003 Adnd Innn Td Thy nd Edn Pnn Uny P. Andn J. E. n Wnp E. 2004. Td C. Jun Enm Lu 42(3) Spmb 691-752. 2 Ru èb n Tuh g p u (PIB

Plus en détail

L Europe et les jeunes Club rotary Août 2006 Panhaleux Julie

L Europe et les jeunes Club rotary Août 2006 Panhaleux Julie LEuop jun Cub oy Aoû 2006 Pnhux Ju - Budp mu d: P. 3 L mu d Bux-A L p d A P.4 L u mu - hu d p ux nonounb: P.5 pmn op P.6 u Andy P.7 jdn bo d v P.8 npo n ommun P.9 gnd mh n P.10 p Lz P.11 u Và - mnfon qu

Plus en détail

Rompre le contrat de travail d un employé à domicile

Rompre le contrat de travail d un employé à domicile DROITS DES PARTICULIERS - DROIT SOCIAL Romp on d v d un mpoy à dom Ln ponn qu gd on nfn ou qu nn on jdn n p nodn pou mpoyu pu : pu ê ondmn à py d dommg-nê à on nn mpoy n p p upuumn podu. Dn v bn, x du

Plus en détail

SPECTACLE INHABITUEL dans

SPECTACLE INHABITUEL dans L x u on d ub quh o qu onp o g p L du odd p op n u, pou ou u onnou on. ud od f f mm n S L Mnufu d fmm Dn -du : Pg mbg d Sf. L onfn n gn p : à o, ouvè on fou pou vf qu n mpon p d b dn u vêmn ou u huu. M

Plus en détail

INITIATION A L'AERO-MODELISME (Radio-commandé)

INITIATION A L'AERO-MODELISME (Radio-commandé) Fdn Fnç d'a-mdm A p mnè d np, DGAC, SFACT p Mnè d Jun d Sp NTATON A L'AERO-MODELSME (Rd-mmnd) GENERALTES Edn ju 2009 FFAM 108,u Sn Mu 75010 PARS (33) 01.43.55.82.03 - Fx (33) 01.43.55.79.93 - @ hp://www.ffm..f

Plus en détail

FADOQ à vélo $ @ BALADE 40 KM INITIATION VÉLO 101. Centre-du-Québec - dimanche 11 mai. Montréal vendredi 20 juin

FADOQ à vélo $ @ BALADE 40 KM INITIATION VÉLO 101. Centre-du-Québec - dimanche 11 mai. Montréal vendredi 20 juin P o zno ou u! F m n n n p d Én g G M o : 55 x n u + n po n u * T ul gh M oa d y z p n b 3po h è ou u n u j x n u + n po n u Cu d:65 * T up f o m n P f o gh P ow b nd ux u h mo A z on( mou u ) * j ou 12

Plus en détail

DE LUI, ON NE SAIT RIEN.

DE LUI, ON NE SAIT RIEN. L x u on d ub quh o qu onp o g p L du odd p op n u, pou ou u onnou on. ud od f f mm n S PATRIMOINE Qu bâ Sn-Snn? C-du : V 250, non on d Po ( po nod d Touou omn), d jun f hnn nn Sunn, u vêqu, my pou vo

Plus en détail

Action phare : Présentation : Coup de chapeau état des lieux : Objectifs fixés : Témoignages : évaluation : S. Bisso. V. Vincent. déchets.

Action phare : Présentation : Coup de chapeau état des lieux : Objectifs fixés : Témoignages : évaluation : S. Bisso. V. Vincent. déchets. Po j 2012-2013 o o --------------MOIR H--------------- -D - Po o o H No gy M M Nob 14 Tog hu o o g j c p oy u go u budg p jo go hâ > 1 ph b p p p L g p o o ) J u I pg o c u PN u oy d fo o (gâc c I u b

Plus en détail

37 CADRES ADMINISTRATIFS ET COMMERCIAUX D ENTREPRISES

37 CADRES ADMINISTRATIFS ET COMMERCIAUX D ENTREPRISES C d um nd ê n v : v u p uxp u mp d u mu àv n V up uv z uv d PC Sdv / n d nv d ndads( D n nnu d d nn ) P up udd, np u p ud um nd n d p n b : u d A ph:www ph p u b m n mp n D n b d T v u H nd p ; d n C R

Plus en détail

Formulaire d exonération relatif au ramassage de produits recyclés du client STAPLES Canada Inc.

Formulaire d exonération relatif au ramassage de produits recyclés du client STAPLES Canada Inc. Formulaire d exonération relatif au ramassage de produits recyclés du client STAPLES Canada Inc. Ordinateurs, UCT et Imprimantes et périphériques ordinateurs portatifs Ordinateurs Télécopieurs UCT Téléphones

Plus en détail

Une porte romaine sous la place du Capitole

Une porte romaine sous la place du Capitole L x u on d ub quh o qu onp o g p L du odd p op n u, pou ou u onnou on. ud od f f mm n S PATRIMOINE Un po omn ou p du Cpo ANTIQUITÉ C po nod d Touou omn. Sunomm Po u Moyn-Âg, du o d on d p u XVIII è. S

Plus en détail

)"*$+&,-'$'.,$"/$'+&!##$*0#+&!!#/'$,-'11"'#$ 2! '/'$ )(!)'/'$"*/#/0 )3 )01''#$,0"*'$#$ )!"*$+&'$'.+& ) '/$,,#$$0 28

)*$+&,-'$'.,$/$'+&!##$*0#+&!!#/'$,-'11'#$ 2! '/'$ )(!)'/'$*/#/0 )3 )01''#$,0*'$#$ )!*$+&'$'.+& ) '/$,,#$$0 28 #$ ##$ % #&&##'$ ( )*$+&,-'$'.,$/$'+& % ##$*0#+& #/'$,-'11'#$ 2 '/'$ )( )'/'$*/#/0 )3 45 66 70$0'& ',/0'$7,##'$ 1##1'/'$'*/+& ) 68 63 63 2 )01''#$,0*'$#$ 2 )*$+&'$'.+& 2 ) '/$,,#$$0 28 6 8 6 0*#,##7 8

Plus en détail

Le Crédit Clermontois

Le Crédit Clermontois ( 2 ( è ô V ) O N U è U NUON D VN ÉD œ ( x y 94 x 922 ) y DU U Y -D -D O Q V N 927 U D D 928 üx F V ($ è / U 7 2 N 00 0 x 2 N è 0 N & ÉUÉ ND OON É D É VO N N FN ONNUN YOUOV Ê ÉVOQUÉ NÉ UOUD U UX D N -

Plus en détail

TunInfo. 1 2 r. v Fé

TunInfo. 1 2 r. v Fé TuIf 2 1 0 2 v Fé Idu Ed Smm 1 P u d I A Aumu P2 H g 4P u A P b W & TuAP5 P6 B F - m m u? q u p à f d é é u u d u 1 J u bu Tu A u à u m à g E u P. m 1 9 0 1. p u d ' f g Pu u. www. Qu Chè TuA, Ch TuAu

Plus en détail

version 0.6 août 2013 Pablo Pernot 2013 Creative Commons Attribution ShareAlike 3.0 Unported License http://creativecommons.org/licenses/by sa/3.

version 0.6 août 2013 Pablo Pernot 2013 Creative Commons Attribution ShareAlike 3.0 Unported License http://creativecommons.org/licenses/by sa/3. é g ' à I v 0.6 û 2013 Pb P 2013 Cv Cmm Abu ShAk 3.0 Upd L hp://vmm.g//by /3.0/ Ag Puqu? Pb P 2013 Cv Cmm Abu ShAk 3.0 Upd L hp://vmm.g//by /3.0/ 64% d fé dévppé PAS ué u m... h p dh gup 2001 Pb P 2013

Plus en détail

Un théâtre romain au bord de la Garonne

Un théâtre romain au bord de la Garonne L x u on d ub quh o qu onp o g p L du odd p op n u, pou ou u onnou on. ud od f f mm n S PATRIMOINE Un hâ omn u bod d Gonn L UN DES PLUS BEAUX MONUMENTS DE LA TOLOSA ANTIQUE En qudu foum, Tououn du pm è

Plus en détail

Exercice p 219, n 3 : Quatre droites sont tracées et les deux droites rouges sont parallèles. Enoncer le théorème de Thalès.

Exercice p 219, n 3 : Quatre droites sont tracées et les deux droites rouges sont parallèles. Enoncer le théorème de Thalès. Exercice p 219, n 3 : Quatre droites sont tracées et les deux droites rouges sont parallèles Enoncer le théorème de Thalès Les droites ( BA ) et ( ZI ) sont sécantes en R, et les droites ( AI ) et ( BZ

Plus en détail

histoire Le «Grand siège» de Toulouse

histoire Le «Grand siège» de Toulouse L x u on d ub quh o qu onp o g p L du odd p op n u, pou ou u onnou on. ud od f f mm n S Touou ououn ho 27-28 L «Gnd èg» d Touou Dx mo d un èg pqu v b, u, nondon, fnmn, f à d Tououn pou un fo un, mo d Smon

Plus en détail

CHAPITRE III VECTEURS

CHAPITRE III VECTEURS CHAPITRE III VECTEURS EXERCICES 1) Recopiez le point A et le vecteur u sur le quadrillage de votre feuille : 4 e Chapitre III Vecteurs a) Construisez le point B tel que AB = u. b) Construisez le point

Plus en détail

ECOLE NATIONALE VETERINAIRE DE LYON. Année Thèse n 58 UTILISATION DU CHIEN LORS DE LA CHASSE AU GIBIER D EAU THESE

ECOLE NATIONALE VETERINAIRE DE LYON. Année Thèse n 58 UTILISATION DU CHIEN LORS DE LA CHASSE AU GIBIER D EAU THESE ECOLE NATIONALE VETERINAIRE DE LYON Ann 2005 - Th n 58 UTILISATION DU CHIEN LORS DE LA CHASSE AU GIBIER DEAU THESE Pn à UNIVERSITE CLAUDE-BERNARD - LYON I (Mdn - Phm) ounu pubqumn 15 jun 2005 pou obn d

Plus en détail

1. Caractéristiques Caractéristiques techniques et dimensionnelles Caractéristiques générales Illustrations...

1. Caractéristiques Caractéristiques techniques et dimensionnelles Caractéristiques générales Illustrations... Gmm S R GREENGAS PLUS (C) CHAUDIÈRE GAZ À BRÛLEUR ATMOSPHÉRIQUE TABLE DES MATIERES Cq Cq q dm Cq I Cdm 7 Rdm q 8 Cx q à p ' 8 Rdm d md d 9 Rdm à S R 0 Fm d d M R d 'q d Mdd' Rdm ydq 7 Iydqd d 7 G 7 Cq

Plus en détail

ILT. Interfacultair Instituut voor Levende Talen. T@@lvaardig. Fautes fréquentes. Ann Bertels en taalgroep Frans. Katholieke Universiteit Leuven

ILT. Interfacultair Instituut voor Levende Talen. T@@lvaardig. Fautes fréquentes. Ann Bertels en taalgroep Frans. Katholieke Universiteit Leuven IL Ic I oo L A B op Khok U L 30/01/02 C op mo xpo po o pobèm, m o è mpo. 1. G c pc o m xmp ph op homm m pph p po pobèm pomm yèm b x combo coc w o mho p yhè co / 2. Ic - ç jc b b >< coc - cocè p p om om

Plus en détail

hygiène et soins PRODUITS VÉTÉRINAIRES AB7 iv Laboratoire Vétérinaire

hygiène et soins PRODUITS VÉTÉRINAIRES AB7 iv Laboratoire Vétérinaire PDUS VÉÉNAS hygèn sons Phoos : Foo.om AB7 ndusrs Véérnrs BP. 9-31450 DYM - FAN é. (33) 5 2 71 78 88 www.pou.r - on@pou.r boror Véérnr AB7 v Fbron Frnçs PDUS ANPAASAS NSDS Médmns v Auorson d Ms sur Mrhé

Plus en détail

de l antiquité à nos jours

de l antiquité à nos jours L s x s s us ons s onp o g sp L du odd p op n u, pou ou u s onnous on. ud od f f mm n S Touous ouousns hso L hd Sn-Enn L qu Sn-Enn d nqu à nos jous Au mps ds Romns ( u v sè) L qu s su pès d un ds os gnds

Plus en détail

Saint-Etienne Metropole - Le cycle des dechets

Saint-Etienne Metropole - Le cycle des dechets SEM Px D?h C-1209-3767:M pg 1 6/05/10 11:59 Pg 1 p, 220 000 h g p hg 133 000 u gè, g pp pu p g S-E Mp v p qup pu h 380 000 h vv u 43 u u u gg M S R Jz Dg S M S Jph pl F S Ch Jz Vfuy TARTARAS G Chg Rv G

Plus en détail

THENetworker UN ÉTÉ SEA, SEX AND APPS! Interview d une sexperte : Maïa Mazaurette. Débat : La nudité faitelle. démocratie?

THENetworker UN ÉTÉ SEA, SEX AND APPS! Interview d une sexperte : Maïa Mazaurette. Débat : La nudité faitelle. démocratie? THENwk #12 - J 2013 Ejx méq Nmé pé x UN ÉTÉ SEA, SEX AND APPS! 14 Ivw d xp : Mï M 11 Déb : L dé v dém? L AGENCE E-REPUTATION www.pqd.m Th Nwk mg bm édé p éé Rp Sqd. P v b gm, d-v hp://www.h-wk. «T pd pé

Plus en détail

Prise en charge vésicale Chez la femme tétraplégique

Prise en charge vésicale Chez la femme tétraplégique UNIVERSITE DE HAUTE ALSACE n oboon v AIRR ( Aoon Non d Infm n ééduon Rédpon) ALISTER ( Aoon pou Infomon Snfqu Thnqu n Rééduon) DIPLOME DUNIVERSITE SOINS INFIRMIERS EN REEDUCATION ET READAPTATION P n hg

Plus en détail

Rapport de la JOURNÉE INTERNATIONALE DE LA. Bilan d activités

Rapport de la JOURNÉE INTERNATIONALE DE LA. Bilan d activités REPUBLIQUE ALGERIENNE DEMOCRATIQUE ET POPULAIRE Mè d lamégm du T, d LEvm du Tum Rpp d l JOURNÉE INTERNATIONALE DE LA BIODIVERSITÉ Bl dvé 22 m 2008 «BIODIVERSITE ET AGRICULTURE» 1 D l d d l éléb d l Jué

Plus en détail

Exercices sur les vecteurs

Exercices sur les vecteurs Exercice Exercices sur les vecteurs ABCD est un parallélogramme et ses diagonales se coupent en O () Compléter par un vecteur égal : a) AB = b) BC = c) DO = d) OA = e) CD = () Dire si les affirmations

Plus en détail

Tête à tête s. t 15 pe s. u a. 2 étapes

Tête à tête s. t 15 pe s. u a. 2 étapes R Tê à ê Tê à ê h 15 p p mm C d'n ff pp déb à vé phphq, n pmn x éèv d'v n éfén nè fm d'h fn d déb d hèm q pg, v, j, véé, 'mé, pvé... L v é q péèd pm à hn d n pné vn d'nnd d md. L déb q v pm x éèv d nfn

Plus en détail

WWW.SAMI-EQUIPEMENTS.CH

WWW.SAMI-EQUIPEMENTS.CH A o dmnd, nou nou fon un b p d ou on dn gnmn d o oux xn ou d o nou ou fuu n Nou pouon ou popo : 1. No non dnn d uyux : Inon mhn d g Tou ouff d hg Amo d hg Souff d qug Bn d g n bon Pomp d onô Mhn à ou Égè

Plus en détail

NOTICE SUR L HISTOIRE ET L ÉVOLUTION DE L ASSOCIATION ALPHABETS

NOTICE SUR L HISTOIRE ET L ÉVOLUTION DE L ASSOCIATION ALPHABETS NOTICE SUR L HISTOIRE ET L ÉVOLUTION DE L ASSOCIATION ALPHABETS S : C éé é, ù u. S j 2 C évé ju 3 S u 4 Ex éu u éu 5 S vé éuè 6. é. u é L x é éé 7 M u ju uxu é 8 M v éu ju u é 9 L é ù vu 10 L vé éuv 11

Plus en détail

N 4 DIALOGUES AUTOUR DE LA DOULEUR NOVEMBRE 2014

N 4 DIALOGUES AUTOUR DE LA DOULEUR NOVEMBRE 2014 ï NVB 20 DG N D D N J N F 0 2 B V N \ V ç -F J»? z f «z : \8 6 \ B V 7 D - \ \ 0 y Df j - F 0 F H J j N ç D D 2À À ÀD x D -? # - \ 2 k Þ% f kw D ç K y V W F D P P êk ç B NÀ N GÀ D D F Q D.f ë ü $ D N \

Plus en détail

Velpeau. Tours. Saint-Pierre-des-Corps. Cathédrale. La Fuye Velpeau. Grammont. Sanitas-Rotonde. Beaujardin D 751. Tours-2

Velpeau. Tours. Saint-Pierre-des-Corps. Cathédrale. La Fuye Velpeau. Grammont. Sanitas-Rotonde. Beaujardin D 751. Tours-2 Vp o Fc v é x 21 751 Q L Lo hé No ov Hop To 21 To To S-P--op v og Pompo To-2 L Fy Vp mmo P Spo S-oo S Q éé Lbé hco j opygh 201 évopp posc/oysp. hp://www.mpomc.og oé cogphq 201 OpSp.og cob (cc-by-). hp://www.opmp.og

Plus en détail

carrelage ardoise calcaire tomette grès cérame ciment

carrelage ardoise calcaire tomette grès cérame ciment [ ou ]T hn qu Gu d omp fd m n d o C p qu b on o d on uond unbâm n p u n o d n d unm on nd du ho du m nd o pou n u ouj ou unmom nd n po b on nomb u D u à ou u np np pdpo n d po bonn qu onpouf bon ho u dp

Plus en détail

! "# "$% %&# % *+&*'+&*# ' "'#" & -!"& + '1+ '45 %!! 3 " & + '1+ '4 3 ' "'# ''!1+ '# 3 !-"%&# ''!1+ ' +3

! # $% %&# % *+&*'+&*# ' '# & -!& + '1+ '45 %!! 3  & + '1+ '4 3 ' '# ''!1+ '# 3 !-%&# ''!1+ ' +3 ! "# "$% %&# %! "#"$%&&'"!&%("!)&*' " *&%"*#!*+#)& ", *+&*'+&*# ' "'#" & ''!&()*'+,--. +/!' +-*$0%1%23%!! 3 -!"& + '1+ '45 %!! 3 " & + '1+ '4 3 ' "'# ''!1+ '# 3 --"!. *#0%1+ '6!#3 "'"/**#'"#$ 71+ 63 -&&

Plus en détail

Votre succès notre spécialité!

Votre succès notre spécialité! V ccè pécé! C Cchg Fm Igé Rcm V ccè pécé! L p mbx mché. E MPS I C g démq p ff pé pf d chq c : p é. N Fc: EMPSI Cg éé céé 2010 P Bddd Bchb q pé p d 8 d md d p. I dévpp N cmp xgc d é d. N c pfm mé d q gg

Plus en détail

Noël : un cadeau pour votre e-réputation?

Noël : un cadeau pour votre e-réputation? Nmé5 N 2011 Th Nwk Nmé 5 - Nmb 2011 Th Nwk by Në : d p -ép? 1 Th Nwk Nmé 5 - Nmb 2011 Th Nwk Nmé 5 - Nmb 2011 Éd Në p -mm, péd m qé? P Abé Gg L péd d Fê égq p bp d d é d ê dédé à Mxm, é mkg d, g d d mp,

Plus en détail

Tarif FedEx Ground. En vigueur : 6 janvier 2014

Tarif FedEx Ground. En vigueur : 6 janvier 2014 Tarif FedEx Ground En vigueur : 6 janvier 2014 Introduction FedEx Ground MD offre des services de livraison fiables, économiques et à jour déterminé pour les envois qui n ont pas besoin de la rapidité

Plus en détail

Tarif FedEx Ground. En vigueur : 15 septembre 2008

Tarif FedEx Ground. En vigueur : 15 septembre 2008 Tarif FedEx Ground En vigueur : 15 septembre 2008 Table des matières FedEx Ground MD Tarifs à l intérieur du Canada 2 Tableau des zones FedEx Ground 3 Tarifs FedEx Ground 34 FedEx Ground MD Multiweight

Plus en détail

Tarif FedEx Ground. En vigueur : 19 janvier 2009

Tarif FedEx Ground. En vigueur : 19 janvier 2009 Tarif FedEx Ground En vigueur : 19 janvier 2009 Table des matières FedEx Ground MD Tarifs à l intérieur du Canada 2 Tableau des zones FedEx Ground 3 Tarifs FedEx Ground 34 FedEx Ground MD Multiweight 38

Plus en détail

1831 Les frères Virebent

1831 Les frères Virebent L x u on d ub quh o qu onp o g p L du odd p op n u, pou ou u onnou on. ud od f f mm n S Touou ououn ho Un dyn d h ououn 83 L fè Vbn vouonnn bqu F du onpu d p Won d p du Cpo, nq fè Vbn dpon n 83 bv d «pnhoom»,

Plus en détail

Gros Electro-ménager (GEM)

Gros Electro-ménager (GEM) G -még (GM) Cég C épp Bèm u TSS u F Cfp G M F > 40 Kg Cv à v Réfgéu Cgéu F à u Cmu Pmp à hu < 40 Kg Cv à v Réfgéu Cgéu F à u Cmu Pmp à hu 1.10 1.11 1.20 1.21 1500 700 G M H F Lv-g Sèh-g u à g Lv-v Cuè

Plus en détail

Politique documentaire et réseaux municipaux de bibliothèques

Politique documentaire et réseaux municipaux de bibliothèques Thz Em Poqu doumn ux munpux d bboqu L pu d ond nqu Éud ompv P/Lyon Mmo d mî Ann o 2004-2005 Du : Ann Kup IUP M d d uu, opon «M du Lv», Unv P X-Nn Opon Bboqu Rmmn J n à m Mdm Ann Kup, pou on mmn dponb,

Plus en détail

Les marchés de l avenir

Les marchés de l avenir 8 èm Jé Cmm xé Am 2009 G N p L mé v Av F mm py p Cè péé 24 25 vm 2009 C Cè Bêm Om p Bv D xp S F H Bêm 02 03 1600-1800 P S K CCB 8 èm Jé Cmm xé Am 2009 M 24 vm 2009 S p à vx é P m à é v émq mè pmè évppm

Plus en détail

Guerre de LES ÉVADES DE FRANCE par l'espagne

Guerre de LES ÉVADES DE FRANCE par l'espagne Lo mo d mo «mñ» pp po q f x po q q d ypoq bo. E Epgo, mñ dv gf «dm», m p xo d «g d bo», gf «jo qjod». C-o poo mo (à do) ompg d m pè bo, dv mom à Do Qo, à Mdd po dx jo, bo d 8 mo dm dmpom. Hb pop p Cox-Rog

Plus en détail

Dispositifs Habitat en faveur des ménages

Dispositifs Habitat en faveur des ménages Dpf Hb fv mg (Sbv) D Hb T. : 0262 23 56 00 Dpf Hb Fh N 1 : A Dpm à Am Hb Fh N 2 : A Dpm à Rg S Op (S v) Fh N 3 : A M : Chèq E Fh N 4 : F S p Lgm (F.S.L.) Fh N 5 : A Dpm à A à Pp L P Lf S Fh 1 A Dpm à Am

Plus en détail

Tarif FedEx Ground. En vigueur : 4 janvier 2010

Tarif FedEx Ground. En vigueur : 4 janvier 2010 Tarif FedEx Ground En vigueur : 4 janvier 2010 Table des matières FedEx Ground MD Tarifs à l intérieur du Canada 2 Tableau des zones FedEx Ground 3 Tarifs FedEx Ground 34 FedEx Ground MD Multiweight 38

Plus en détail

Jean-Pierre Dubé Richard Vaillancourt. Acres Printing and Promotion

Jean-Pierre Dubé Richard Vaillancourt. Acres Printing and Promotion Fnnmn C poj nn p Pomm d pn pou doppmn o d Rou humn Doppmn o Cnd. L opnon npon un dn pn pubon on d 'uu n pnn p nmn du ounmn du Cnd. Cobou obo Rhh don : Iuon phm : Ron d x : Coon dpu: M n p : Impon : No

Plus en détail

TABLEAU DE SURVEILLANCE

TABLEAU DE SURVEILLANCE Département de la formation et de la sécurité Service de l enseignement Lycée - Collège des Creusets, Sion Departement für Bildung und Sicherheit Dienststelle für Unterrichtswesen Kollegium Creusets, Sitten

Plus en détail

Sept. 2011. The Networker Numéro 4 - Septembre 2011

Sept. 2011. The Networker Numéro 4 - Septembre 2011 Nmé4 Sp 20 Th Nwk Nmé 4 - Spmb 20 Th Nwk by Th Nwk Nmé 4 - Spmb 20 Th Nwk Nmé 4 - Spmb 20 Éd P Gy C P bdg mm é P Gë M P éèm é, pm dq g m pmp b, démé ô pmd q I j jd h p pq, mm p pbé d m d m q é pm M mb

Plus en détail

3 ème BREVET THEOREME DE THALES

3 ème BREVET THEOREME DE THALES Exercice 1 1 Construire un triangle ABC tel que AB = 6 cm AC = 7,2 cm et BC = 10 cm Placer les points R, T et E tels que : R [AB] et AR = 4,5 cm T [AC] et (RT) // (BC) E [AB) et E [AB] et BE = 2 cm 1 2

Plus en détail

Définition : «interconnection» et «networks». nterconneconnexion des années 60 des années 70 ARPANET des années 80 les années 90 Aujourd'hui

Définition : «interconnection» et «networks». nterconneconnexion des années 60 des années 70 ARPANET des années 80 les années 90 Aujourd'hui I N T R O D U C T I O N D I n t e r n e t e s t l e p l u s g r a n d r é s e a u a u m o n d e a v e c d e s c e n t a i n e s d e m i l l i o n s da o r d i n a t e u r é s e a u x c o n n e c t é sa

Plus en détail

Biogaz Europe Nantes 25 et 26 octobre 2011

Biogaz Europe Nantes 25 et 26 octobre 2011 Bogz Eop Nn 25 26 oob 2011 Un non d méhnon po n o à d bobo-déh Hoq : n xpén d v of péb No omm x g nb à pévon d nvonnmn no no nggon dn dévoppmn db d o n, po : Répond x bon d mè ognq go. Co, nfom vo déh

Plus en détail

été t a u e l q SAUVEGARDE DE SYSTEME SAUVEGARDE DE SYSTEME IDENTITE Numéro d'intervention TYPE DISQUE DUR Etat de la sauvegarde *

été t a u e l q SAUVEGARDE DE SYSTEME SAUVEGARDE DE SYSTEME IDENTITE Numéro d'intervention TYPE DISQUE DUR Etat de la sauvegarde * SAUVEGARDE DE SYSTEME SAUVEGARDE DE SYSTEME N 'nvnn n n n (aaaa//jj/n 'nvnn) N :... an n v Pn :... nv w A :... a Da L 3.. q gn W a n) ' T :... A 'v q a CP :... q (n a fp p ppaag TYPE f Dv :. IDENTITE Maq

Plus en détail

CHAPITRE 3 : TABLEAUX DE CORRESPONDANCE POSTES / COMPTES

CHAPITRE 3 : TABLEAUX DE CORRESPONDANCE POSTES / COMPTES Journal Officiel de l OHADA N 10 4 ème Année 221 AA CHAPITRE 3 : POSTES / COMPTES SECTION 1 : Système normal BILAN-ACTIF ACTIF N os DE COMPTES À INCORPORER DANS LES POSTES Réf. POSTES Brut Amortissements/

Plus en détail

«La figure du vampire féminisée. Enjeux»

«La figure du vampire féminisée. Enjeux» «u u n Enux» Sn Rn Pu : Rn Sn 200 «u u n Enux» Pu «n ux» n 9 En n (Cnu xx / xx / xxxx u n : Rn Sn 200 «u u n Enux» Pu «n ux» n 9 46-5 Pu un u Pu nn u u un : uuq@ S nr án fiu u n En u x n

Plus en détail

k i MA i = 0. OM = n OM = 1 (a OA + b f( u + v ) = f( u ) + f( v ) i=1 i=1

k i MA i = 0. OM = n OM = 1 (a OA + b f( u + v ) = f( u ) + f( v ) i=1 i=1 (, ) (, ) (D, ) D () (D) = D (, ) (, ) (, ) k v (, ) k v (, ) () = k (, ) ( i ) i 1 n (k i ) i k i M n k i M i = 0. i=1 O M 1 n OM = n i=1 k k ioi i a b M OM = 1 (a O + b a+b O) (, a) (, b) (, c) (, a)

Plus en détail

Définition : Un logiciel de traitement de texte permet en particulier Merci de visitez le site web : www.9alami.com

Définition : Un logiciel de traitement de texte permet en particulier Merci de visitez le site web : www.9alami.com I N T R O D U C T I O N W O R D e s t u n l o g i c i e l d e t r a i t e m e n t d e t e x t e t r è s p e r f o r m a n t q u i n o u s p e r m e t d de o ccurméee nr ta u n C e d o c u m e n t p e u

Plus en détail

INTRODUCTION GENERALE

INTRODUCTION GENERALE FCC BEES 1 PHYSIOLOGIE Fk BOUCHETAL PELLEGRI - 1 - A- QUELQUES IDEES DE BASE : INTRODUCTION GENERALE 1- Q q po? A Pq m d d J d L d Eo (Do Rob 2- Q q pom? R = p d dd à mom dod o do 3- Q q m? m à oo dobj

Plus en détail

Tarif FedEx Express MD. En vigueur : 2 janvier 2017

Tarif FedEx Express MD. En vigueur : 2 janvier 2017 Tarif FedEx Express MD En vigueur : 2 janvier 2017 Introduction Le portefeuille des services d expédition FedEx Express MD a été conçu pour répondre à vos besoins uniques en matière d expédition. Que vos

Plus en détail

JOURNAL DE JURISPRUDENCE ET DES DEBATS JUDICIAIRES. MVMlEAtJXi RUE HARLAT -DU -PAUUS, 2, Z

JOURNAL DE JURISPRUDENCE ET DES DEBATS JUDICIAIRES. MVMlEAtJXi RUE HARLAT -DU -PAUUS, 2, Z L 2 VINGT-DEUXIEME FEVRIER 847 ANNEE 626 EDITION DE PARI JOURNAL DE JURIPRUDENCE ET DE DEBAT JUDICIAIRE MVMEAJX RUE HARLAT -DU -PAUU 2 Z Toj Mo 8 Fn Mo 36 Fn mé- FKUJILILI [M [KI @!MOI (L» dov nh) T» ï

Plus en détail

INITIATION A L'AEROMODELISME

INITIATION A L'AEROMODELISME Fdn Fnç d'a-mdm A p mnè d np, DGAC, SFACT p Mnè d Jun d Sp NTATON A L'AEROMODELSME DECOUVERTE DE L'HELCOPTERE LE VOL CRCULARE COMMANDE NOTONS DE SECURTE PRESENTATON DE LA FFAM Edn ju 2009 FFAM 108,u Sn

Plus en détail

SOMMAIRE. Vie locale. 11 Lettre à Dieu Joies et peines. 12 Quels documents Jeunes : aumônerie des. conserver? étudiants, fête de la

SOMMAIRE. Vie locale. 11 Lettre à Dieu Joies et peines. 12 Quels documents Jeunes : aumônerie des. conserver? étudiants, fête de la EDTORA SEPTEMBRE-OCTOBRE 2005-P Y N 8( C O 388-M 428) E m m m m ; m mmà mm à m Q? -? Cmm -à-? D m m m m : m ; m m Q à ù mm? - A E m m V à à à z à à m - S m m m N m R m «F» à G A - m N à m P - E â 1990

Plus en détail

technologique que fonctionnel. d une fenêtre de La première désig

technologique que fonctionnel. d une fenêtre de La première désig L ho fê o cocé vc u ouvu l o ll ouuv u fl u. Aujou hu, l ou obu u ouvll fo ov focoll ou u o ulo ou écué. Af éo ux bo cl, l ch vo élg. L éloo fê o FAKRO b u l cl, f u hbo lu lu cofobl écué. L ho fê o cocé

Plus en détail

L Aude, une idée qui rassemble

L Aude, une idée qui rassemble d n m p é D m b i é h n c S L S N c Ep mb i q n idé, d L A d.f L 219 i d Invni Ni Adoi Un pimoin n doi xcpionn q i f pév L Ad dipo d n pimoin n o à fi xcpionn. C ich écoogiq povin d divié d miix n pén

Plus en détail

Plan de lecture. Pour lire la Bible en 1 an

Plan de lecture. Pour lire la Bible en 1 an Plan de lecture Pour lire la Bible en 1 an Le plan de lecture ci-après permet de lire toute la Bible en 1 an avec une lecture matin et soir, par exemple, ou en 2 ans avec lecture de l Ancien Testament

Plus en détail

Jan. 2012. The Networker Numéro 6 - Janvier 2012. Les bonnes résolutions 2012 pour votre image en ligne!

Jan. 2012. The Networker Numéro 6 - Janvier 2012. Les bonnes résolutions 2012 pour votre image en ligne! Nmé6 J. 2012 Th Nwk Nmé 6 - Jv 2012 Th Nwk by L b é 2012 p v mg g! 1 Th Nwk Nmé 6 - Jv 2012 Éd P Abé Gg Ê-v é Yh dèm? Pbbm p. E b -y m bvm q v dè é. J pé p q hb q v v y d à p d v PC p d v mph d v b. N

Plus en détail

Chapitre 14 Propriétés de Thalès

Chapitre 14 Propriétés de Thalès Chapitre 14 Propriétés de Thalès Pour les exercices 1 et 2, écrire les égalités données par le théorème de Thalès sans rédiger la justification. 1 a. Les droites (NP) et (QM) sont parallèles. b. Les droites

Plus en détail

COPYRIGHT GRAHLF COPYRIGHT GRAHLF COPYRIGHT GRAHLF

COPYRIGHT GRAHLF COPYRIGHT GRAHLF COPYRIGHT GRAHLF LESCROI XDELACOMMUNED ECHANDELYS Du XIX u XXI è. P Dvd LEJEUNE A mmo d M Od CARTIER. «D on qu on muv nom, qu u p ud E hnd y, Cox d To-Cox.» Hn POURRAT Tou do v Sp u u ud pub onon u o x, m j o d n,vo o,

Plus en détail

ÉCOUTER CONSEILLER AGIR SUR LE DÉVELOPPEMENT DURABLE

ÉCOUTER CONSEILLER AGIR SUR LE DÉVELOPPEMENT DURABLE ÉCOUTER CONSEILLER R G E É É R R C E R R E T N INVE METTR E EN SC ÈNE AGIR SUR LE DÉVELOPPEMENT DURABLE Cvy L'p f d fm d vg d péfé (, fm d m, v ). E q'p f d è mp q f d é. S 'p ' p à 'é d p p v q' v vm

Plus en détail

CHAPITRE III VECTEURS

CHAPITRE III VECTEURS CHAPITRE III VECTEURS COURS 1) Exemple : force exercée par un aimant. p 2 2) Définitions et notations. p 3 3) Egalité de deux vecteurs... p 5 4) Multiplication d un vecteur par un nombre réel... p 6 5)

Plus en détail

Tarif FedEx Express. En vigueur : 2 janvier 2012

Tarif FedEx Express. En vigueur : 2 janvier 2012 Tarif FedEx Express En vigueur : 2 janvier 2012 Introduction Le portefeuille des services d expédition FedEx Express MD a été conçu pour répondre à vos besoins uniques en matière d expédition. Que vos

Plus en détail

On ne demande pas de la reproduire.. CO = 3 cm. CA = 5 cm. CB = 8 cm. Les droites (OF) et (AB) sont parallèles. Calculer CF en justifiant.

On ne demande pas de la reproduire.. CO = 3 cm. CA = 5 cm. CB = 8 cm. Les droites (OF) et (AB) sont parallèles. Calculer CF en justifiant. THALES DIRECT Exercice 1 : (Nancy_sept 97) On donne la figure ci-contre. On ne demande pas de la reproduire.. CO 3 cm. CA cm. CB 8 cm. Les droites (OF) et (AB) sont parallèles. Calculer CF en justifiant.

Plus en détail

Exposez la coque pour trouver Cargaison, Rumeurs, Armes ou Équipage. Pas. Matériel pa ir. S t. M a r y s. d assaut

Exposez la coque pour trouver Cargaison, Rumeurs, Armes ou Équipage. Pas. Matériel pa ir. S t. M a r y s. d assaut ( ) v I L v, M, Év v ê j b v è., bx v è à v v. I b j v x q, q b v x j. L x. z-v b! q. M x F yz b. h M I h Q hq h G M Ov L T hy Y, J Ky, Mh B, G Ohw, J Mh, Jh Kx, K Hy, h W, T Gj, Ky W T W Dy, Why, D y,

Plus en détail

Downloaded from www.vandenborre.be

Downloaded from www.vandenborre.be Downloadd from www.vandnborr.b C u i s i n i è r C S M 6 9 3 0 0 G Downloadd from www.vandnborr.b A v a n t d c o m m n c r, b i n v o u l o i r l i r c m a n u l d ' u t i l i s a t i o n! C h è r c l

Plus en détail

terry fox Un seul rêve. Un monde d espoir.

terry fox Un seul rêve. Un monde d espoir. Fd y fx êv. md d p. y Fx v d fm d y dmd d p d p H b d p mp d v d ég d y ég d y Fx jyfx.g 888 836986 Y H pécéd m mp, m c î d bkb m pp mgz cmp c j d mpé q v c d w Yk. à c mm q j décdé d v v déf q pé à m

Plus en détail

26 REPORTAGE l m p il li u l oi à lu déi pou di u v é, ou î l mè Fçoi, l f m lui O joi pu pè ppl fi ii cho il pouoi féu S vi c choli holi, c è ill «Mm éi d ê o fç c é ll ui im» x c ix cho l, ccompgé d

Plus en détail

Références : des informations techniques pour agir. Violences à l école. Prévenir, agir contre

Références : des informations techniques pour agir. Violences à l école. Prévenir, agir contre Références : des informations techniques pour agir Violences à l école Prévenir, agir contre Juin 2008 $ % $ '( ) ) % *'++, - #. / +0 1 *23 4. )( % ) * -!""5. % ( + + 6 ( % 7 % 7 ) + *8 #-. ) + *8!""5.

Plus en détail

TRAVAUX DE CONSTRUCTION DE : 1. MARCHE DU LAC MUNKAMBA DANS LE TERITOIRE DE DIMBELENGE (Lot 01) PROVINCE DU KASAI OCCIDENTAL - RD CONGO

TRAVAUX DE CONSTRUCTION DE : 1. MARCHE DU LAC MUNKAMBA DANS LE TERITOIRE DE DIMBELENGE (Lot 01) PROVINCE DU KASAI OCCIDENTAL - RD CONGO TRAVAUX DE CONSTRUCTION DE :!"#!$%&'( 1. MARCHE DU LAC MUNKAMBA DANS LE TERITOIRE DE DIMBELENGE (Lot 01 2. MARCHE DE DEMBA DANS LE TERRITOIRE DE DEMBA (Lot 02 PROVINCE DU KASAI OCCIDENTAL - RD CONGO %'

Plus en détail

Les Laboratoires Pharmaceutiques

Les Laboratoires Pharmaceutiques Les Laboratoires Pharmaceutiques Les plus grands laboratoires et les cadres de l'industrie pharmaceutique. Les laboratoires recensés sont les laboratoires pharmaceutiques, parapharmaceutiques et leurs

Plus en détail

N L a R e v u e F r a n c o p h o n e d u M a n a g e m e n t d e P r o j e t 4 è m e t r i m e s t r e

N L a R e v u e F r a n c o p h o n e d u M a n a g e m e n t d e P r o j e t 4 è m e t r i m e s t r e La Cible Sommaire F o c u s F o n d a t e u r : J e a n L e B I S S O N N A I S D i r e c t e u r d e l a p u b l i c a t i o n : M a r t i n e M I N Y R é d a c t e u r e n c h e f : S e r g e C H A N

Plus en détail

" #!$! %" & ' % () %* +) & & (+ &'''(!!!) $ % ), & +(!) ## +) /+ *!) $+, -. )0 ' & &*%!1 0 22 % 3 2# ( / &/ 0.1 22&34 0.5

 #!$! % & ' % () %* +) & & (+ &'''(!!!) $ % ), & +(!) ## +) /+ *!) $+, -. )0 ' & &*%!1 0 22 % 3 2# ( / &/ 0.1 22&34 0.5 !"!#$ % " #!$! %" ' % () %* +) (+ '''(!!!) $ % ), +(!) ## %-.( (-.* +) /+ *!) $+, -. )0 ' *%!1 0 22 % 3 2# ( / / 0.1 2234 0.5 3// 0.- 2/) / 06 7/ 0! $ 4 **% 5 5 ) 6 ) 3 0 76 8 9 - - : : 7 -" ;', 5, < =

Plus en détail

BANQUE NATIONALE. N otre banque nationale. 7/i. Zi 4. /Æ à. W m M i i 10. W f w f f l. mm. ' ê â f/m jt» i W J / f f t. y / Y ZJ/Â / f/êv/i r» l J.

BANQUE NATIONALE. N otre banque nationale. 7/i. Zi 4. /Æ à. W m M i i 10. W f w f f l. mm. ' ê â f/m jt» i W J / f f t. y / Y ZJ/ / f/êv/i r» l J. _ ê â j j # W jt W j î Æ jj Æ W } " êv Y  z Wâ W w ( w # ë â F ë W Y T w S L 9 W 2 " E ï k x ü D E W W Æ v Wj E  z  z v F À OTQE W  # g L Y F h 6 L 2L NQE NTONLE N oe bnque none W W â W jâ ÿ Æ É w

Plus en détail

Bilan Du 1/01/11 au 31/12/11. Union Syndicale Solidaires FP 144 Boulevard de la Villette PARIS

Bilan Du 1/01/11 au 31/12/11. Union Syndicale Solidaires FP 144 Boulevard de la Villette PARIS Bilan Du 1/01/11 au 31/12/11 Union Syndicale Solidaires FP 144 Boulevard de la Villette 75019 PARIS Bilan actif du 1/01/11 au 31/12/11 le 27/02/12 à 14:50 P o s t e C d B r u t C d A m o r t. Net N P r

Plus en détail

s i o un univers tradécouvrir r c découvrirc de la physique de la physique s p l r ie sp Les métiers imétiers e de la physique er é à découvrir r ie

s i o un univers tradécouvrir r c découvrirc de la physique de la physique s p l r ie sp Les métiers imétiers e de la physique er é à découvrir r ie g p ng n g ng n ng g n uu xp n uu u ng nvnnn n n nn un x n d xp uu u n ng ng un L d phy n p n d phy d phy g un unv duv à duv n p nd dv duv x n d xp duvn f n n un nvnnn f b f nnn n g ng ng g n nnn n un

Plus en détail

Leçon. Cette leçon aborde le sujet des stéréotypes dans notre société. 2. Documentaire MATÉRIEL FACULTATIF

Leçon. Cette leçon aborde le sujet des stéréotypes dans notre société. 2. Documentaire MATÉRIEL FACULTATIF 1 l g C g ç L m G A M (I ) SO P U S U Ç CO É P S àl C lç bd l uj d d c. c à u cu cv, l lèv v d cm à qul l d lu ug d qull ç d mbu l u d lu ublc. L cl l lumè u l m qu cch dè c qu cmmcl u d dvg u u mdèl l

Plus en détail

DESCRIPTION DE LA CHAUDIERE...

DESCRIPTION DE LA CHAUDIERE... Gmm ROC NOX VERSON CHEMNEE CHAUDERE FOULACER AVEC PRODUCT ON NTEGREED EAU CHAUDESANTARE TABLE DES MATERES DESCRPTON DE LA CHAUDERE 2 CARACTERSTQUES TECHNQUES 4 2 22 2 Dmmpm Rp b x Pbû RACCORDEMENTS HYDRAULQUES

Plus en détail

La Cible Sommaire F oc us F o n d a t e u r : J e a n L e B I S S O N N A I S

La Cible Sommaire F oc us F o n d a t e u r : J e a n L e B I S S O N N A I S La Cible Sommaire F oc us F o n d a t e u r : J e a n L e B I S S O N N A I S D i r e c t e u r d e l a p u b l i c a t i o n : M a r t i n e M I N Y R é d a c t e u r e n c h e f : S e r g e C H A N T

Plus en détail

Gouvernance : l exemple d une grande banque française. Eric ALLAIN - Consultant IBM Global Services Application Services

Gouvernance : l exemple d une grande banque française. Eric ALLAIN - Consultant IBM Global Services Application Services Guv : l xpl u g qu ç E ALLAN - ul BM Gll v Appl v L l L Bqu l u plu g qu ç U v 1200 p ( p)! p Eu (MO ll, vlpp, upp)! F upp v : Mh, U, upp u vlpp, Qul,! Puv lg l l p Eu! G xp l vlpp v hqu / w v U Pu qu

Plus en détail

Ę ę Ó ę - -_::jr-':- r' l'r I i ::--=:: f '3 l!.f:l$e l r-l $ &.::. H =$ n, r.. ii i:ę.1.= i.-l 't a. :,r.. :. '. r..-i. 1' :; '.r. ;..::. rta:r t:' l: :a '!ii$i: 1,.;ł]ii. ' ;s,.i.,q..'.. ::i '','.,,..,...'..

Plus en détail

Le guide pratique pour

Le guide pratique pour L o l lg L gu pqu pou l ml, mé/pé» U vc gu -p.f Iouco C gu vou ccompg pou u -p.f vo o l ml, mé/pé. Il p chqu ép él pou u éu vo mo. Somm Accè à l éclo E. 1 : Mo pofl E. 2 : Chox u yp o E. : Rgm u l ué 7

Plus en détail

Chimie Générale-CH101 Tableau de classification périodique de Mendeleïev

Chimie Générale-CH101 Tableau de classification périodique de Mendeleïev Tableau de classification périodique de Mendeleïev 1 2 Tableau de classification périodique de Mendeleïev s p H Li Na Be Mg Non métal (ou métalloïde) Métal He B C N O F Ne Al Si P S Cl Ar K Rb Cs Ca Sr

Plus en détail

LE GAME DESIGN DE JEUX VIDÉO :

LE GAME DESIGN DE JEUX VIDÉO : UNIVERSITÉ PAUL VERLAINE METZ Éo doo «Ppv :, md, p, o» C d hh mdo (ÉA 3476) LE GAME DESIGN DE JEUX VIDÉO : APPROCHE COMMUNICATIONNELLE ET INTERCULTURELLE Thè po doo d omo d ommo p o pbqm 27 oob 2006 p

Plus en détail

MANUEL SUR L INFORMATION ET LA DOCUMENTATION EN MATIÈRE DE PROPRIÉTÉ INDUSTRIELLE. Réf. : Normes ST.17 page : 3.17.1 NORME ST.17

MANUEL SUR L INFORMATION ET LA DOCUMENTATION EN MATIÈRE DE PROPRIÉTÉ INDUSTRIELLE. Réf. : Normes ST.17 page : 3.17.1 NORME ST.17 Réf. : Normes ST.17 page : 3.17.1 NORME ST.17 RECOMMANDATION EN VUE DE CODER LES RUBRIQUES PUBLIÉES DANS LES BULLETINS OFFICIELS INTRODUCTION 1. La présente recommandation est destinée à renforcer le contenu

Plus en détail