«Biotechnologies et nouvelles stratégies diagnostiques du retard mental.» Colloque médical du Jeudi 26 Avril 2012

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimension: px
Commencer à balayer dès la page:

Download "«Biotechnologies et nouvelles stratégies diagnostiques du retard mental.» Colloque médical du Jeudi 26 Avril 2012"

Transcription

1 «Biotechnologies et nouvelles stratégies diagnostiques du retard mental.» Colloque médical du Jeudi 26 Avril 2012 COUTTON Charles

2 Etude du Génome Cytogénétique Cytogénétique moléculaire Biologie moléculaire ADN

3 Evolution des techniques Cytogénétique Biologie moléculaire Ere de la génomique

4 Evolution des techniques Séquençage haut-débit Biologie moléculaire Faible Globale Approche Résolution Forte Ciblée Cytogénétique ACPA (CGH-array)

5 Enjeux Variations structurales du génome Variations de séquence du génome 10 8 pb M U T A T I O N S 1 pb Remaniements chromosomiques Micro-remaniements génomiques Comment détecter toutes ces mutations? Cytogénétique Biologie moléculaire

6 Choix des techniques ATGCACTGATGAATGCATGCAAT Séquençage ADN MLPA CGH-array FISH Caryotype

7 Choix des techniques Approche globale Approche ciblée Caryotype ACPA (CGH-array) Séquençage haut débit FISH MLPA

8 Investigation du retard mental: Stratégie Générale Patient avec retard mental +/- dysmorphie +/-malformations Clinique non évocatrice d une pathologie ou syndrome Clinique évocatrice d une pathologie ou syndrome X fragile Screening large Génique Chromosomique Caryotype MLPA? CGH-array? Biologie moléculaire Séquençage haut-débit? Caryotype +/- FISH MLPA?

9 MLPA CGH-array Techniques de quantification relative: mise en évidence de pertes ou de gains de matériel chromosomique. Techniques d hybridation comparative (par rapport à une référence) 2 copies 1 copie 3 copies délétion hétérozygote duplication

10 CNV et polymorphismes Cohorte d individus «apparemment» sains Redon et al CNVs polymorphes connus Représenteraient jusqu'à 15-20% de notre génome Principalement dans des régions pauvres en gènes

11 CNVs et pathologies A l origine (seuls ou associés) RM syndromiques: Prader-Willi / Angelman Di George Smith Magenis Williams Beuren Wolf-Hirschhorn Miller Diecker Autisme Schizophrénie Maladies neuro-dégénératives

12 Denaturation Hybridation MLPA

13 Ligation MLPA

14 Ligation MLPA

15 MLPA Amplification

16 MLPA Séparation - Normalisation - Interprétation Control Patient Une différence relative de la hauteur ou surface d un pic indique une variation du nombre de copie de la séquence cible.

17 MLPA Approche «semi-globale» Etudier plusieurs régions simultanément Les régions sub-télomériques (46) Les syndromes microdélétionnnels les plus fréquents Approche «ciblée» Etudier de façon exhaustive certaines régions d intérêt Meilleure sensibilité et spécificité que la FISH

18 Microdélétion 22q11.2 Clinique: Dysmorphie faciale Cardiopathie congénitale Insuffisance vélaire Hypocalcémie néonatale Aplasie ou hypoplasie du thymus et des parathyroïdes Troubles de l'apprentissage et/ou retard psychomoteur FISH normale

19 MLPA et 22q11 Région 22q11 Témoin Délétion 22q11 Comparaison Patient

20 MLPA et 22q11 Non détectées par FISH La MLPA détecte 100% des anomalies impliquées LA FISH ne détecte «que» 95% des anomalies Stachon et al AJMG

21 Investigation du retard mental: Stratégie Générale Patient avec retard mental +/- dysmorphie +/-malformations Clinique non évocatrice d une pathologie ou syndrome Clinique évocatrice d une pathologie ou syndrome X fragile Screening large Génique Chromosomique Caryotype MLPA? CGH-array? Biologie moléculaire Séquençage haut-débit? Caryotype +/- FISH MLPA?

22 CGH-array Analyses chromosomiques sur puces à ADN (CGH-array) Technique quantitative pan-génomique basée sur l hybridation comparative sur micro-réseau. ADN de référence + ADN du patient Co-hybridation sur puce à ADN Lecture Interprétation

23 CGH-array ADN de référence + ADN du patient

24 CGH-array ADN de référence + ADN du patient Exemple d une délétion (1 copie)

25 CGH-array ADN de référence + ADN du patient

26 CGH-array 2 Dysmorphie importante Retard global développement Hypotonie néonatale Epilepsie Délétion 2q11.3 2,11 Mb

27 CGH-array 7 Retard langage +++ Difficulté d apprentissage Dysmorphie discrète Duplication 7q ,394 Mb

28 CGH-array Détection facilité des anomalies complexes délétion Délétion Inv dup del (8p) Retard développement Retard de langage Agénésie du corps calleux duplication Duplication

29 CGH-array et RM Patients avec RM + dysmorphie: Caryotype seul: 3 à 5% de diagnostic Caryotype + FISH: 8 à 10% de diagnostic CGH-array : 12 à 18% de diagnostic ACPA?

30 CGH-array: limites Ne détecte pas les remaniements équilibrés Les anomalies équilibrées représentent moins de 1% des anomalies détectées chez les patients avec RM + dysmorphie dont 0.5% sont familiales

31 CGH-array: limites Ne détecte pas les remaniements équilibrés et les anomalies de la ploïdie Coût Evaluation médico-économique bénéfice / coût favorable

32 CGH-array: limites Ne détecte pas les remaniements équilibrés et les anomalies de la ploïdie Coût Interprétation complexe

33 Interprétation pas toujours facile! Pathogénes? Polymorphes Manolio et al Expertise médicale indispensable à l interprétation correcte des variations observées

34 Détection de CNV «prédisposant à»

35 Variants polymorphes finalement pathogènes

36 CGH-array: limites Ne détecte pas les remaniements équilibrés et les anomalies de la ploïdie Coût Interprétation complexe Ethique

37 Ethique Perte d un gène suppresseur de tumeur (TP53) Impliqué dans le syndrome de Li-Fraumeni => attitude?

38 CGH-array et RM Mefford et al 2012 ACPA en première intention dans la stratégie de l investigation du RM

39 Investigation du retard mental: Stratégie Générale Patient avec retard mental +/- dysmorphie +/-malformations Clinique non évocatrice d une pathologie ou syndrome Clinique évocatrice d une pathologie ou syndrome X fragile Screening large Génique Chromosomique Caryotype MLPA? CGH-array? Biologie moléculaire Séquençage haut-débit? Caryotype +/- FISH MLPA?

40 Séquençage haut-débit

41 Séquençage haut-débit Phimister et al. 2012

42 Séquençage haut-débit Différentes approches Petits génomes (bactériens, viraux ) 10 4 pb Groupes de gènes (ex par pathologie, neuromusclaires, etc ) Exomes Génome humain pb Uniquement la partie codante des gènes (les exons) soit 1.5% du génome (> exons)

43 Séquençage haut-débit

44 Séquençage haut-débit

45 Séquençage haut-débit Fragmentation ADN Ligation d adaptateur Enrichissement PCR ou capture Amplification (PCR en émulsion) Séquençage Analyse

46 Séquençage haut-débit Détection photonique Détection protonique

47 Séquençage haut-débit Fragmentation ADN Ligation d adaptateur Enrichissement PCR ou capture Amplification (PCR en émulsion) Séquençage Analyse Segments de lecture Alignements Détection de variants

48 Alignement - Détection de variants Génome de référence ATCAGATCGATCTATTAGCTATCGATCTAGATCTAGATCTAGCTA CGATATAGATC TATCGATATAGATC AGCTATCGATATA ATCTAGATATAGATCTAG ATCTATTAGCTATCGATAT Présence d une substitution C>A Polymorphisme? Pathogène?

49 Séquençage haut-débit Fragmentation ADN Ligation d adaptateur Enrichissement PCR ou capture Amplification (PCR en émulsion) Séquençage Analyse Segments de lecture Alignements Détection de variants Interprétation

50 Séquençage haut-débit Interprétation complexe: nécessité d une expertise médicale +++ (biologique, clinique, bioinformatique)

51 Séquençage haut-débit Séquençage Sanger : 13 ans pour un génome (HGP) 2012: Séquençage haut-débit 1 Génome complet en 7 jours Adapté de T. Frebourd ANPGM 2012

52 Nouvelle approche efficace Séquençage haut-débit

53 Séquençage haut-débit Dysmorphie faciale caractéristique Pb cardiaques, rénaux, squelettiques RM modéré Mefford et al 2012

54 Investigation du retard mental: Stratégie Générale Patient avec retard mental +/- dysmorphie +/-malformations Clinique non évocatrice d une pathologie ou syndrome Clinique évocatrice d une pathologie ou syndrome X fragile Screening large Génique Chromosomique Caryotype MLPA? CGH-array? Biologie moléculaire Séquençage haut-débit? Caryotype +/- FISH MLPA?

55 Parle pour toi! C est vrai que c est pratique!

56

57 Caryotype / FISH Carotype Résolution entre 3 et 5 Mb Inconvénients: long ; faible résolution; cout Avantages: mécanismes remaniements FISH Résolution: 150Kb Inconvénients: petite duplication, cout, culture, banque de clones Avantages: mécanismes remaniements

58 Indications D. Sanlaville; Bilan réseau ACPA 2012

59

60 Approches ciblées Richard Holt, Anthony P. Monaco

61 Approches ciblées

62

63

64

65

Analyse Chromosomique sur Puce à ADN Applications en Prénatal

Analyse Chromosomique sur Puce à ADN Applications en Prénatal Analyse Chromosomique sur Puce à ADN Applications en Prénatal Véronique Satre, Charles Coutton, Gaëlle Vieville, Françoise Devillard et Florence Amblard Maladies génétiques Anomalies chromosomiques Cytogénétique

Plus en détail

Nouveaux outils de cytogénétique moléculaire (MLPA et CGH) utilisés en constitutionnel COUTTON Charles

Nouveaux outils de cytogénétique moléculaire (MLPA et CGH) utilisés en constitutionnel COUTTON Charles Nouveaux outils de cytogénétique moléculaire (MLPA et CGH) utilisés en constitutionnel COUTTON Charles EC Génétique Jeudi 12 Janvier 2012 Remaniements génomiques Regroupent les duplications, les délétions,

Plus en détail

Objectif : identifier la mutation responsable de la maladie parmi les millions de polymorphisme.

Objectif : identifier la mutation responsable de la maladie parmi les millions de polymorphisme. Identification de gènes morbides Analyses mutationnelles Maladies monogéniques Objectif : identifier la mutation responsable de la maladie parmi les millions de polymorphisme. Plan : Variations du nombre

Plus en détail

La CGH-array : une nouvelle technique de diagnostic en cytogénétique

La CGH-array : une nouvelle technique de diagnostic en cytogénétique La CGH-array : une nouvelle technique de diagnostic en cytogénétique Olivier Pichon (Ingénieur) Laboratoire de cytogénétique de Nantes, Service de Génétique Médicale Les techniques classiques de cytogénétique

Plus en détail

Étiologie des déficiences intellectuelles : démarche diagnostique

Étiologie des déficiences intellectuelles : démarche diagnostique Service de Neurologie Étiologie des déficiences intellectuelles : démarche diagnostique Gaël NICOLAS Définitions Plusieurs définitions, AAMR 1992 puis actualisations (AAIDD 2010) la plus utilisée aux USA

Plus en détail

Principe des études moléculaires en génétique médicale Méthodes d analyse des microlésions du génome

Principe des études moléculaires en génétique médicale Méthodes d analyse des microlésions du génome Mercredi 23 Octobre LECLERCQ Barbara L2 GM Pr Krahn 10 pages Principe des études moléculaires en génétique médicale Méthodes d analyse des microlésions du génome Plan A. Introduction B. Techniques courantes

Plus en détail

Caryotype humain : Technique - Indications

Caryotype humain : Technique - Indications Caryotype humain : Technique - Indications Collège National des Enseignants et Praticiens de Génétique Médicale Dr Cédric Le Caignec Service de génétique médicale, CHU Nantes, France Date de création du

Plus en détail

DEFICIENCE MENTALE et syndromes génétiques démarche diagnostique

DEFICIENCE MENTALE et syndromes génétiques démarche diagnostique DEFICIENCE MENTALE et syndromes génétiques démarche diagnostique M.O. LIVET AIX-en-PROVENCE LES RETARDS MENTAUX: un enjeu majeur en pratique pédiatrique Fréquence des RM: 2% Les cliniciens doivent assurer:

Plus en détail

Cytogénétique et biologie moléculaire

Cytogénétique et biologie moléculaire Cytogénétique et biologie moléculaire apport au diagnostic, à l évaluation pronostique et au suivi des hémopaties malignes C Bastard, DESC, 21 septembre 2009 Pourquoi est-ce possible? Parce que les anomalies

Plus en détail

Revisiter le diagnostic étiologique dans la déficience intellectuelle

Revisiter le diagnostic étiologique dans la déficience intellectuelle Lyon Neuroscience Research Center Revisiter le diagnostic étiologique dans la déficience intellectuelle Damien Sanlaville Service de Génétique, Pr Edery Plateforme ACPA, NGS CHU de Lyon Pas de conflit

Plus en détail

Professeur Joël LUNARDI

Professeur Joël LUNARDI Biochimie - Biologie moléculaire Chapitre 9 : Applications médicales Professeur Joël LUNARDI MED@TICE PCEM1 - Année 2006/2007 Faculté de Médecine de Grenoble - Tous droits réservés. Chapitre 9. APPLICATIONS

Plus en détail

Génétique postnatale 2013

Génétique postnatale 2013 Génétique postnatale 2013 Le rapport d activité de génétique postnatale constitue un outil important notamment dans le cadre de la réalisation des SROS et de la mise en place du second plan maladies rares.

Plus en détail

Combinaison variable avec potentiel de croissance vraisemblablement génétiquement préétabli

Combinaison variable avec potentiel de croissance vraisemblablement génétiquement préétabli Facteurs Maternels Facteurs fœtaux Facteurs placentaires Facteurs externes Combinaison variable avec potentiel de croissance vraisemblablement génétiquement préétabli Combien et lesquels? Quand? Comment?

Plus en détail

CGH array. Alain AURIAS INSERM U509 Institut Curie-Paris

CGH array. Alain AURIAS INSERM U509 Institut Curie-Paris CGH array Alain AURIAS INSERM U509 Institut Curie-Paris Caryotype normal Environ 300 bandes Résolution: 10Mb Ewing Translocation réciproque avec gène de fusion 11 22 EWS FLI1 Nouvelle protéine chimérique,

Plus en détail

PRINCIPES DE BASES DE L ANALYSE DES CHROMOSOMES HUMAINS

PRINCIPES DE BASES DE L ANALYSE DES CHROMOSOMES HUMAINS PRINCIPES DE BASES DE L ANALYSE DES CHROMOSOMES HUMAINS II. Outils CONTEXTE CLINIQUE Jonction entre chromosomique et moléculaire Dr G. Lefort II. TECHNIQUE 1) Le caryotype conventionnel en bandes Nécessite

Plus en détail

Aujourd hui, il y a plus de consortium, ce qui permet des avancées plus rapides.

Aujourd hui, il y a plus de consortium, ce qui permet des avancées plus rapides. GFMOM 20/01/2012 Cours 2 partie 2 T. Bourgeron II. LA CYTOGENETIQUE Nous allons étudier les anomalies chromosomiques des plus grossières aux plus fines. Ces anomalies peuvent être retrouvées dans la population

Plus en détail

DNA-seqciblé : principales méthodes d'enrichissement

DNA-seqciblé : principales méthodes d'enrichissement DNA-seqciblé : principales méthodes d'enrichissement DU de séquençage haut-débit Module 1 : Séquençage nouvelle génération - Technologies & applications 17 octobre 2013 Amélie PITON piton@igbmc.fr 1 Introduction

Plus en détail

GUYANE. Ces fiches présentent des activités spécifiques qui demandent des infrastructures, un savoir-faire et des autorisations particulières.

GUYANE. Ces fiches présentent des activités spécifiques qui demandent des infrastructures, un savoir-faire et des autorisations particulières. Cette nouvelle édition des fiches régionales relatives à l activité 2013 des centres pluridisciplinaires de diagnostic prénatal (CPDPN), des laboratoires de diagnostic prénatal (DPN) et de l activité 2014

Plus en détail

Cas cliniques. Génétique médicale

Cas cliniques. Génétique médicale Cas cliniques Génétique médicale Pathologie autosomique dominante Pathologie autosomique dominante Arguments filles et garçons atteints transmission verticale toutes les générations sont atteintes Risque

Plus en détail

Diagnostic prénatal des maladies génétiques

Diagnostic prénatal des maladies génétiques Diagnostic prénatal des maladies génétiques Collège National des Enseignants et Praticiens de Génétique Médicale C. Coutton, V. Satre, F. Amblard et F. Devillard Date de création du document 2010-2011

Plus en détail

Le séquençage haut-débit

Le séquençage haut-débit Nouveaux outils en biologie Le séquençage haut-débit DES d hématologie 16 janvier 2015 Paris Alice Marceau-Renaut Laboratoire d hématologie CHRU Lille NGS = Next-Generation Sequencing Whole-genome Whole-exome

Plus en détail

L'ADN peut être copié au travers des générations cellulaires successives de manière fidèle, c'est la réplication de l'adn.

L'ADN peut être copié au travers des générations cellulaires successives de manière fidèle, c'est la réplication de l'adn. 24/09/2014 REBOUL Nicolas L2 CR : Hamza BERGUIGUA Génétique Médicale Dr Martin KRAHN 8 pages Introduction à la Génétique Médicale : Les champs de la Génétique Médicale, La place de la Génétique Médicale

Plus en détail

Du microscope. aux microarrays. le "saut de puce" de la cytogénétique

Du microscope. aux microarrays. le saut de puce de la cytogénétique Du microscope le "saut de puce" aux microarrays de la cytogénétique ARL 13 mars 2008 Dr Danielle Martinet Spéc. FAMH en analyses de génétique médicale Laboratoire de cytogénétique constitutionnelle Service

Plus en détail

PRINCIPALES TECHNIQUES UTILISEES EN GENOMIQUE

PRINCIPALES TECHNIQUES UTILISEES EN GENOMIQUE PRINCIPALES TECHNIQUES UTILISEES EN GENOMIQUE Définitions généralités Quelques chiffres 46 chromosomes 22 paires d autosomes (n=44) 1 paire de gonosomes (n=2) : XX/F et XY/H 300 bandes cytogénétiques =

Plus en détail

X-Fragile: Vie d Adulte Particularités du diagnostic, de la prise en charge et du suivi chez les adultes

X-Fragile: Vie d Adulte Particularités du diagnostic, de la prise en charge et du suivi chez les adultes X-Fragile: Vie d Adulte Particularités du diagnostic, de la prise en charge et du suivi chez les adultes P. Charles, MD, PhD Département de Génétique Centre de référence Déficiences intellectuelles de

Plus en détail

Diagnostic prénatal non invasif (DPNI)

Diagnostic prénatal non invasif (DPNI) Diagnostic prénatal non invasif (DPNI) Etat des lieux des applications Charles COUTTON PHU, Génétique Chromosomique Colloque Médical du Jeudi 05 Mars 2015 Pourquoi? DPN: nécessite un geste invasif pour

Plus en détail

SERVICE DE GYNECOLOGIE OBSTETRIQUE - CLINIQUE DE FERTILITE. Clinique de Fertilité ULB ERASME HOPITAL ERASME

SERVICE DE GYNECOLOGIE OBSTETRIQUE - CLINIQUE DE FERTILITE. Clinique de Fertilité ULB ERASME HOPITAL ERASME Clinique de Fertilité ULB ERASME Introduction Pour des couples à haut risque de mettre au monde un enfant atteint d une maladie génétique, l approche classique par les examens anténatals conventionnels

Plus en détail

La médecine personnalisée Daniel Locker Professeur honoraire Université Orléans

La médecine personnalisée Daniel Locker Professeur honoraire Université Orléans La médecine personnalisée Daniel Locker Professeur honoraire Université Orléans Introduction En 1992, l introduction d'un anticorps monoclonal, l herceptine, pour le traitement du cancer du sein a donné

Plus en détail

LES ANOMALIES CHROMOSOMIQUES DE STRUCTURES

LES ANOMALIES CHROMOSOMIQUES DE STRUCTURES LES ANOMALIES CHROMOSOMIQUES DE STRUCTURES GENERALITES Anomalies chromosomiques sont de deux types Anomalies de nombres : aneuploïdies, les plus fréquentes (95%) Trisomies : 3 exemplaires d un chromosome

Plus en détail

Différents types de chromosomes en Giemsa

Différents types de chromosomes en Giemsa Différents types de chromosomes en Giemsa Marquage Giemsa simple - Comptage d une mitose: 45, 46 ou 47 - Reconnaissance des groupes et certains chromosomes dans les groupes, mais pas dans leur structure,

Plus en détail

1953 : double hélice d ADN

1953 : double hélice d ADN 1953 : double hélice d ADN 1956 : nombre de chromosomes dans le caryotype humain (46) Années 70 : boîte à outils : couper, coller, cloner, premières techniques de séquençage d ADN technique du Southern

Plus en détail

Marc DELPECH. CORATA La Rochelle le 21 mai 2008

Marc DELPECH. CORATA La Rochelle le 21 mai 2008 Marc DELPECH CORATA La Rochelle le 21 mai 2008 En 24 ans les progrès ont été considérables Premières utilisation des techniques de génétique moléculaire en diagnostic : 1984 Une palette de techniques très

Plus en détail

UE1 Chromosomes Caryotypes anomalies 2009/2010. Les chromosomes, le caryotype et ses anomalies

UE1 Chromosomes Caryotypes anomalies 2009/2010. Les chromosomes, le caryotype et ses anomalies Les chromosomes, le caryotype et ses anomalies 1 I. Intérêt de l établissement du caryotype II. Structure t du chromosome métaphasique 1. Le centromère 2. Les télomères III. Le caryotype 1. Le rangement

Plus en détail

Le monde des bio-puces

Le monde des bio-puces Le monde des bio-puces D1 Le «dogme central» de la biologie moléculaire Transcription Epissage Traduction ADN ARNpm ARNm Protéines Génome Transcriptome Protéome D2 Puces à ADN Techniques de génomique fonctionnelle

Plus en détail

INDICATIONS de la CGH ARRAY en DIAGNOSTIC PRENATAL (ACPA) Réseau Naître et Grandir en LR 5 ème Journée Régionale d Echographie Jean CHIESA

INDICATIONS de la CGH ARRAY en DIAGNOSTIC PRENATAL (ACPA) Réseau Naître et Grandir en LR 5 ème Journée Régionale d Echographie Jean CHIESA INDICATIONS de la CGH ARRAY en DIAGNOSTIC PRENATAL (ACPA) Réseau Naître et Grandir en LR 5 ème Journée Régionale d Echographie Jean CHIESA 09 Octobre 2015 5 Mb Principe de la CGH array Nanotechnologie

Plus en détail

Seules les trisomies 13, 18 et 21 sont concernées dans le test génétique non invasif.

Seules les trisomies 13, 18 et 21 sont concernées dans le test génétique non invasif. 1 Normalement, chaque individu a dans chacune de ces cellules 23 paires de chromosomes numérotées de 1 à 22, la 23ème paire étant la paire des chromosomes sexuels. Une des anomalies chromosomiques les

Plus en détail

Approches génomiques des cancers Exemple des leucémies aiguës. Jean Soulier Laboratoire d Hématologie, Hôpital Saint-Louis

Approches génomiques des cancers Exemple des leucémies aiguës. Jean Soulier Laboratoire d Hématologie, Hôpital Saint-Louis Approches génomiques des cancers Exemple des leucémies aiguës Jean Soulier Laboratoire d Hématologie, Hôpital Saint-Louis Leucémies aiguës : prolifération de progéniteurs immatures Leucémies aiguës lymphoblastiques

Plus en détail

Techniques d'étude en cytogénétique

Techniques d'étude en cytogénétique 22/10 ROUBIN Alexandre L2 CR : Victor CHABBERT Génétique médicale H ZATTARA 16 pages Techniques d'étude en cytogénétique Plan : A. Introduction B. Cytogénétique conventionnelle C. Cytogénétique moléculaire

Plus en détail

Réunion des pédiatres de Franche-Comté Belfort 2011 L.Enoch, C.Guillermet, F.Arbez Gindre, A.M. Bertrand,E.Lecointre

Réunion des pédiatres de Franche-Comté Belfort 2011 L.Enoch, C.Guillermet, F.Arbez Gindre, A.M. Bertrand,E.Lecointre Mort inattendue du nourrisson: à propos d une étiologie rare Réunion des pédiatres de Franche-Comté Belfort 2011 L.Enoch, C.Guillermet, F.Arbez Gindre, A.M. Bertrand,E.Lecointre L., sexe féminin décédée

Plus en détail

Apport du séquençage à haut débit d un panel de gènes dans le diagnostic d'une cohorte marseillaise de myopathies distales

Apport du séquençage à haut débit d un panel de gènes dans le diagnostic d'une cohorte marseillaise de myopathies distales Apport du séquençage à haut débit d un panel de gènes dans le diagnostic d'une cohorte marseillaise de myopathies distales Thèse de médecine SEVY Amandine, JNIN décembre 2014 I. Myopathies distales Définition

Plus en détail

UP-CNV 2.0 2.0. Projet financé par le GIRCI Grand-Ouest à hauteur de 98 000 (AO 2011)

UP-CNV 2.0 2.0. Projet financé par le GIRCI Grand-Ouest à hauteur de 98 000 (AO 2011) UP-CNV 2.0 Banque de données en ligne répertoriant les CNVs (Copy Number Variations) identifiés par CGH-array chez les patients atteints de retard mental, anomalie du développement 2.0 Projet financé par

Plus en détail

Anomalies chromosomiques

Anomalies chromosomiques Master bioinformatique, Université de Rouen Sylvain Mareschal [@etu.univ-rouen.fr] Anomalies chromosomiques Thèse de Claire Lemaitre (2008), Université Claude Bernard Lyon 1 Réarrangements chromosomiques

Plus en détail

Organisation du Génome humain Notions essentielles

Organisation du Génome humain Notions essentielles Organisation du Génome humain Notions essentielles Biologie Moléculaire et Médecine; Kaplan et Delpech; Flammarion «How to sequence a genome» (film): www.genome.gov/25019885 Human Genome Project: http://www.genome.gov/hgp/

Plus en détail

Planète Autisme 11/01/2013. Stéphanie Marignier

Planète Autisme 11/01/2013. Stéphanie Marignier Planète Autisme 11/01/2013 Stéphanie Marignier Plan Repérage précoce Pathologies associées Bilan médical Repérage précoce Installation des symptômes autistiques Pour certains enfants, signes déjà présents

Plus en détail

Plateforme de Recherche de Mutations. Vincent MEYER contact: pfm@genoscope.cns.fr

Plateforme de Recherche de Mutations. Vincent MEYER contact: pfm@genoscope.cns.fr Plateforme de Recherche de Mutations contact: pfm@genoscope.cns.fr La plateforme recherche de mutations La plateforme mutation: - Gis Institut des maladies rares et IbiSA. - Les instituts thématiques de

Plus en détail

LA TECHNIQUE DE CGH-ARRAY OU ACPA

LA TECHNIQUE DE CGH-ARRAY OU ACPA LA TECHNIQUE DE CGH-ARRAY OU ACPA Les syndromes avec Anomalies du Développement (AD), associés ou non à une Déficience Intellectuelle (DI), englobent des pathologies extrêmement hétérogènes mais majoritairement

Plus en détail

Médecine 4P Prédictive, Préventive, Personnalisée, Participative Les enjeux

Médecine 4P Prédictive, Préventive, Personnalisée, Participative Les enjeux Médecine 4P Prédictive, Préventive, Personnalisée, Participative Les enjeux Unité Inserm UMR 1087-CNRS UMR 6291 Hervé Le Marec Evolution de la médecine et de la recherche biomédicale développement de traitements

Plus en détail

«AFFECTIVITE, SEXUALITE, HANDICAP» Présentation de

«AFFECTIVITE, SEXUALITE, HANDICAP» Présentation de 10 e colloque francophone de Noirlac 19 et 20 novembre 2008 «AFFECTIVITE, SEXUALITE, HANDICAP» Présentation de Mme M-C. de BLOIS (Maître de Conférence des Universités Praticien Hospitalier Généticienne

Plus en détail

Dépistage / Diagnostic de la trisomie 21 en période prénatale

Dépistage / Diagnostic de la trisomie 21 en période prénatale Lyon Neuroscience Research Center Dépistage / Diagnostic de la trisomie 21 en période prénatale Damien Sanlaville Journée mondiale de la trisomie 21 Lyon, le 22 mars 2014 Un point crucial Bien comprendre

Plus en détail

Les biobanques pour les débutants

Les biobanques pour les débutants Les biobanques pour les débutants C Dubourg B Turlin 14 octobre 2010 CHU de Rennes Définition Collection d échantillons biologiques humains Réunion, à des fins scientifiques, de prélèvements biologiques

Plus en détail

FORMATION POSTGRADUÉE POUR SPÉCIALISTE EN MÉDECINE DE LABORATOIRE FAMH. Impression 1 face!!! Cahier des stages

FORMATION POSTGRADUÉE POUR SPÉCIALISTE EN MÉDECINE DE LABORATOIRE FAMH. Impression 1 face!!! Cahier des stages FORMATION POSTGRADUÉE POUR SPÉCIALISTE EN MÉDECINE DE LABORATOIRE FAMH Impression 1 face!!! Cahier des stages Formation postgraduée monodisciplinaire Génétique médicale Version 2013.G.1 de «Vorname» «Nachname»

Plus en détail

Mise en place du NGS en routine diagnostic - Validation, Organisation, Développements

Mise en place du NGS en routine diagnostic - Validation, Organisation, Développements Mise en place du NGS en routine diagnostic - Validation, Organisation, Développements Atelier sur le Diagnostic Moléculaire de la Mucoviscidose 2014 - Lille Stratégie analytique Préparation library (1,5

Plus en détail

Objectif 6 : Conforter l avance de la France dans la médecine personnalisée

Objectif 6 : Conforter l avance de la France dans la médecine personnalisée Objectif 6 : Conforter l avance de la France dans la médecine personnalisée Si les conditions physiques telles que l âge, les antécédents, mais aussi des facteurs sociaux, psychiques et culturels influencent

Plus en détail

Introduction à la Bio-Informatique IFT3295/IFT6291/BIN6000. Nadia El-Mabrouk DIRO, Université de Montréal

Introduction à la Bio-Informatique IFT3295/IFT6291/BIN6000. Nadia El-Mabrouk DIRO, Université de Montréal Introduction à la Bio-Informatique IFT3295/IFT6291/BIN6000 Nadia El-Mabrouk DIRO, Université de Montréal Qu est-ce que la Bioinformatique? Qu est-ce que la Bio-informatique? Champs multi-disciplinaire

Plus en détail

Translocations réciproques. Translocations réciproques. Ségrégation méïotique. Ségrégation alterne : équilibrée (2 types de gamètes)

Translocations réciproques. Translocations réciproques. Ségrégation méïotique. Ségrégation alterne : équilibrée (2 types de gamètes) Anomalies de structure Réarrangements du matériel chromosomique Un seul ou plusieurs Anomalies Translocations robertsoniennes et réciproques équilibrées Mécanismes de déséquilibre Héritées ou de novo Equilibrées

Plus en détail

Jean-Louis Bergé-Lefranc

Jean-Louis Bergé-Lefranc Apport du séquençage du génome humain à la toxicologie: Toxicogénomique Jean-Louis Bergé-Lefranc QuickTime et un décompresseur TIFF (LZW) sont requis pour visionner cette image. QuickTime et un décompresseur

Plus en détail

Avancées génétiques dans le bilan du retard mental

Avancées génétiques dans le bilan du retard mental Avancées génétiques dans le bilan du retard mental Pluradys, 4 Juin 2010 Pr Olivier-Faivre Centre de Référence Maladies Rares Anomalies du Développement et Syndromes Malformatifs de l Est Epidémiologie

Plus en détail

Génome humain Polymorphismes Marqueurs génétiques. Dr Chrystelle COLAS Département de Génétique GH Pitié Salpêtrière.

Génome humain Polymorphismes Marqueurs génétiques. Dr Chrystelle COLAS Département de Génétique GH Pitié Salpêtrière. Génome humain Polymorphismes Marqueurs génétiques Dr Chrystelle COLAS Département de Génétique GH Pitié Salpêtrière Génome humain Génome Humain () Homme Cellules Noyaux 46 Chromosomes Protéines Gènes ADN

Plus en détail

OneSeq : détection simultanée de CNV et de SNV en attendant le séquençage génome entier

OneSeq : détection simultanée de CNV et de SNV en attendant le séquençage génome entier OneSeq : SNV CNV détection simultanée de CNV et de SNV en attendant le séquençage génome entier Nicolas Chatron 1,2, Marc Le Lorc h 3, Eudeline Alix 1, Matthieu Egloff 3, Didier Goidin 4, Jean-Philippe

Plus en détail

Méthodes diagnostiques en génétique moléculaire

Méthodes diagnostiques en génétique moléculaire Méthodes diagnostiques en génétique moléculaire P. Latour Praticien Hospitalier Responsable UF 3427 Neurogénétique Moléculaire Laboratoire de Neurochimie Pr Renaud HCL Centre de Biologie Est DES Neurologie

Plus en détail

Etapes générales. Polonator. Protocole. Préparation des échantillons. Dover. Séquençage par hybridation/ligation de nonamères. Mise en service en 2009

Etapes générales. Polonator. Protocole. Préparation des échantillons. Dover. Séquençage par hybridation/ligation de nonamères. Mise en service en 2009 Next Generation DNA Sequencing Pourquoi? Séquençage par la méthode de Sanger est pour l instant le «gold standard» Besoins de séquencer toujours plus, plus vite et moins cher But: Séquencer 1 génome humain

Plus en détail

DIAGNOSTIC PRÉNATAL NON INVASIF : LE SANG MATERNEL

DIAGNOSTIC PRÉNATAL NON INVASIF : LE SANG MATERNEL 6 LE TEST DIAGNOSTIC PRÉNATAL NON INVASIF : LE SANG MATERNEL Source : les cellules trophoblastiques Fetal cell Cell isolation Détection 5-6SA Disparition rapide après accouchement Pas de persistance après

Plus en détail

BILAN D ACTIVITE DES PLATEFORMES HOSPITALIERES DE GENETIQUE MOLECULAIRE DES CANCERS POUR L ANNEE 2010

BILAN D ACTIVITE DES PLATEFORMES HOSPITALIERES DE GENETIQUE MOLECULAIRE DES CANCERS POUR L ANNEE 2010 BILAN D ACTIVITE DES PLATEFORMES HOSPITALIERES DE GENETIQUE MOLECULAIRE DES CANCERS POUR L ANNEE 2010 Merci de faire parvenir ces données avant le 11 mai 2011 aux coordonnées suivantes : Frédérique Nowak

Plus en détail

La Génétique en Pratique

La Génétique en Pratique La Génétique en Pratique Deux volets /Trois échelles Clinique :-les syndromes - le conseil génétique Biologie :-Cellulaire -Moléculaire CELLULAIRE=Cytogénétique Structure du chromosome CELLULAIRE=Caryotype

Plus en détail

Retard mental et génétique Déficience intellectuelle / déficience mentale. F Devillard

Retard mental et génétique Déficience intellectuelle / déficience mentale. F Devillard Retard mental et génétique Déficience intellectuelle / déficience mentale F Devillard Introduction Maladie neurodéveloppementale regroupe un panel de maladies incluant des syndromes connus dont la cause

Plus en détail

L anatomopathologiste : un lien entre les différents intervenants. Françoise Collin

L anatomopathologiste : un lien entre les différents intervenants. Françoise Collin L anatomopathologiste : un lien entre les différents intervenants Françoise Collin Les grands classiques Microbiopsie Biopsie chirurgicale Pièce opératoire Diagnostic AP classification OMS 2002 > 50 types

Plus en détail

Testing moléculaire RER/MSI

Testing moléculaire RER/MSI Atelier Instabilité Microsatellitaire 26 avril 2014, Bordeaux Testing moléculaire RER/MSI Isabelle Soubeyran Unité de Pathologie Moléculaire Institut Bergonié Bordeaux PGMC d Aquitaine Système RER = système

Plus en détail

TP 10 : Diversification des êtres vivants

TP 10 : Diversification des êtres vivants TP 10 : Diversification des êtres vivants I. Une diversification du vivant par une diversification des génomes A) Les hybridations suivies de polyploïdisation Activité 1 Doc 1a p 36 Paspalum quadrifarium

Plus en détail

Trisomie 21 et vieillissement Analyse des conséquences au niveau transcriptionnel et traductionnel de la surexpression des gènes SOD-1 et APP

Trisomie 21 et vieillissement Analyse des conséquences au niveau transcriptionnel et traductionnel de la surexpression des gènes SOD-1 et APP Trisomie 21 et vieillissement Analyse des conséquences au niveau transcriptionnel et traductionnel de la surexpression des gènes SOD-1 et APP INTRODUCTION La trisomie 21 Description clinique Trisomie 21

Plus en détail

BACCALAURÉAT TECHNOLOGIQUE

BACCALAURÉAT TECHNOLOGIQUE BACCALAURÉAT TECHNOLOGIQUE Série : Sciences et Technologies de Laboratoire Spécialité : Biotechnologies SESSION 2015 Sous-épreuve écrite de Biotechnologies Lundi 22 juin 2015 Coefficient de la sous-épreuve

Plus en détail

GENETIQUE MEDICALE- Étude de ségrégation, ED génétique moléculaire

GENETIQUE MEDICALE- Étude de ségrégation, ED génétique moléculaire 20/11/2013 GUIMERA Jordan L2 Génétique Médicale C. BEROUD 24 pages Relecteur n 3 Etude de ségrégation, ED génétique moléculaire (haplotype, interprétation des données mutationnelles, notion bio-informatique,

Plus en détail

Laboratoire Cerba. Congrès SHIP Marseille 15 Octobre 2010

Laboratoire Cerba. Congrès SHIP Marseille 15 Octobre 2010 Diagnostic prénatal non invasif à partir du sang maternel > J.M. COSTA Laboratoire Cerba Congrès SHIP Marseille 15 Octobre 2010 Diagnostic prénatal in utero en France : quelques chiffres clés Toutes indications

Plus en détail

Université Bordeaux Segalen - PACES 2011-2012 ED UE9s Mars 2012

Université Bordeaux Segalen - PACES 2011-2012 ED UE9s Mars 2012 Sélectionner les propositions exactes Université Bordeaux Segalen - PACES 2011-2012 ED UE9s Mars 2012 QCM 1. La température de fusion (Tm) d une molécule d ADN : A. est mise en évidence par l augmentation

Plus en détail

Diagnostic prénatal, Diagnostic préimplantatoire et maladies génétiques. Dominique Stoppa-Lyonnet Institut Curie et Université Paris Descartes

Diagnostic prénatal, Diagnostic préimplantatoire et maladies génétiques. Dominique Stoppa-Lyonnet Institut Curie et Université Paris Descartes Diagnostic prénatal, Diagnostic préimplantatoire et maladies génétiques Dominique Stoppa-Lyonnet Institut Curie et Université Paris Descartes APCH juin 202 Définition du DPN et de l IMG Organisation en

Plus en détail

Bioinformatique dans l IUP

Bioinformatique dans l IUP Bioinformatique dans l IUP Intervenants Equipe Bioinfo (Laboratoire d Informatique Fondamentale de Lille) Cours : Jean-Stéphane Varré (jean-stephane.varre@lifl.fr) TD sur machine : Jean-Stéphane Varré,

Plus en détail

AcSé Moléculaire: Modalités pratiques pour le criblage moléculaire

AcSé Moléculaire: Modalités pratiques pour le criblage moléculaire AcSé Moléculaire: Modalités pratiques pour le criblage moléculaire I- Récapitulatif des tests moléculaires à effectuer Type de cancer Transloc. ALK Amp. ALK Amp. MET Transloc. ROS Mut. ALK Mut. MET Mut.

Plus en détail

Pathologies et génétique moléculaire

Pathologies et génétique moléculaire Biochimie - Biologie moléculaire Pathologies et génétique moléculaire Julien Fauré Institut de Formation en Soins Infirmiers 1 ère Année Année universitaire 2014-2015 Plan Les outils de la génétique moléculaire

Plus en détail

PRINCIPES DE BASES DE L ANALYSE DES CHROMOSOMES HUMAINS

PRINCIPES DE BASES DE L ANALYSE DES CHROMOSOMES HUMAINS PRINCIPES DE BASES DE L ANALYSE DES CHROMOSOMES HUMAINS Dr Sylvie Taviaux Laboratoire de cytogénétique Hôpital Arnaud de Villeneuve CHU Montpellier S-taviaux@chu-montpellier.fr Septembre 2014 PRINCIPES

Plus en détail

Mise en évidence des agents infectieux par Biologie Moléculaire

Mise en évidence des agents infectieux par Biologie Moléculaire UE de l agent infectieux à l hôte Janvier 2012 Mise en évidence des agents infectieux par Biologie Moléculaire Dr Isabelle GARRIGUE Laboratoire de Virologie Professeur FLEURY isabelle.garrigue@chu-bordeaux.fr

Plus en détail

De la biologie molécualire à la génomique

De la biologie molécualire à la génomique De la biologie molécualire à la génomique Pierre Neuvial École Nationale de la Statistique et de l Administration Économique Méthodes statistiques pour la biologie Plan du cours 1 Introduction à la biologie

Plus en détail

Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013

Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013 Sélectionner les propositions exactes Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013 QCM 1 La plupart des techniques de biologie moléculaire repose sur le principe de complémentarité

Plus en détail

Trisomie 21. Trisomie 21 1

Trisomie 21. Trisomie 21 1 Trisomie 21 Trisomie 21 1 De l ADN au chromosome Élaboration d un caryotype Caryotype & idéogramme Caryotype bandes G et fluorescence Translocation réciproque équilibrée 46, XX, t (4;18 ) (q13; q22 ) 2

Plus en détail

Emmanuelle GIRODON-BOULANDET, Catherine COSTA et Bruno COSTES* Tests génétiques, génétique moléculaire, réseaux de laboratoires

Emmanuelle GIRODON-BOULANDET, Catherine COSTA et Bruno COSTES* Tests génétiques, génétique moléculaire, réseaux de laboratoires Technologie appliquée Emmanuelle GIRODON-BOULANDET, Catherine COSTA et Bruno COSTES* RÉSUMÉ Les tests génétiques, qui consistent à rechercher des mutations dans des gènes de maladies héréditaires, s imposent

Plus en détail

UN MODELE GENETIQUE POUR L ETUDE DE L OBESITE, DE L AUTISME ET DE LA SCHIZOPHRENIE

UN MODELE GENETIQUE POUR L ETUDE DE L OBESITE, DE L AUTISME ET DE LA SCHIZOPHRENIE PRIX LEENAARDS 2010 POUR LA PROMOTION DE LA RECHERCHE SCIENTIFIQUE UN MODELE GENETIQUE POUR L ETUDE DE L OBESITE, DE L AUTISME ET DE LA SCHIZOPHRENIE C est en étudiant les erreurs de «copier / coller»

Plus en détail

ORGANISMES DE DPC Fédération Française de Génétique Humaine FFGH Catégorie(s) professionnelle(s)

ORGANISMES DE DPC Fédération Française de Génétique Humaine FFGH Catégorie(s) professionnelle(s) ORGANISMES DE DPC Fédération Française de Génétique Humaine FFGH 5096 Fiche programme Réf. Prog. 50961600002 Titre du programme CNV d interprétation difficile Référence organisme 5096 Lien sur votre site

Plus en détail

Organisation des soins

Organisation des soins p.1 Schéma régional Organisation des soins Organisation Médico-Sociale - hospitalier Prévention Examen des caractéristiques génétiques d une personne ou identification d une personne par empreintes génétiques

Plus en détail

leucémie lymphoïde chronique

leucémie lymphoïde chronique la leucémie lymphoïde chronique S.Taoussi, M.T. Abad Service hématologie, EHS ELCC Blida Ce travail a été réalisé au laboratoire hématologie du CAC Blida avec le soutien du CMNG et du laboratoire de recherche

Plus en détail

Syndrome d Asperger: Bilan diagnostique au. CRA de Picardie

Syndrome d Asperger: Bilan diagnostique au. CRA de Picardie Syndrome d Asperger: Bilan diagnostique au CRA de Picardie Pr C Mille, Dr M Bon Saint Come, (Pédopsychiatres), Dr A Simonot (neuropédiatre) H Bué, C Moulin (Psychologues), V Bury (Psychomotricienne), A-L

Plus en détail

CHAPITRE A BASES GENETIQUES

CHAPITRE A BASES GENETIQUES CHAPITRE A BASES GENETIQUES TOUT CE QUE VOUS AVEZ TOUJOURS VOULU SAVOIR SUR LA GÉNÉTIQUE..SANS JAMAIS AVOIR OSÉ LE DEMANDER Nos séquences d ADN se perdent dans la nuit des temps ce qui compte le plus :

Plus en détail

La Génétique pour les Nuls

La Génétique pour les Nuls La Génétique pour les Nuls Marie Pierre AUDREZET Laboratoire de Génétique Moléculaire INSERM U1078 - CHRU BREST La Génétique pour les nuls Mutations Référence : Base de données HGMD Différents types de

Plus en détail

CYTOGENETIQUE MOLECULAIRE

CYTOGENETIQUE MOLECULAIRE CYTOGENETIQUE MOLECULAIRE I)Introduction Le caryotype est l'examen génétique le plus prescrit, car il permet une analyse globale du génome. Il permet de détecter 15% des anomalies. Mais il possède un faible

Plus en détail

Biopuces en pathologie Cardio-vasculaire

Biopuces en pathologie Cardio-vasculaire Biopuces en pathologie Cardio-vasculaire Pr M.Doco-Fenzy Service de Génétique 2009 - UE10 1 Définition des outils 2 Applications Waka Lin 2004 Support membrane de nylon Lame de verre, revêtement chimique

Plus en détail

TROUBLE DU SOMMEIL CHEZ L ENFANT PRÉSENTANT UNE ANOMALIE DE DÉVELOPPEMENT

TROUBLE DU SOMMEIL CHEZ L ENFANT PRÉSENTANT UNE ANOMALIE DE DÉVELOPPEMENT TROUBLE DU SOMMEIL CHEZ L ENFANT PRÉSENTANT UNE ANOMALIE DE DÉVELOPPEMENT Hélène De Leersnyder Pédiatre Consultation «sommeil» Hôpital Necker. Paris Journées Internationales Jérôme Lejeune Familles et

Plus en détail

Filière DéfiScience. Maladies Rares du Développement Cérébral et Déficience Intellectuelle NOTRE PLAN D ACTIONS EN SYNTHÈSE

Filière DéfiScience. Maladies Rares du Développement Cérébral et Déficience Intellectuelle NOTRE PLAN D ACTIONS EN SYNTHÈSE Filière DéfiScience Maladies Rares du Développement Cérébral et Déficience Intellectuelle NOTRE PLAN D ACTIONS EN SYNTHÈSE La filière DéfiScience a fait le choix, dès sa constitution, en septembre 2014,

Plus en détail

Outils moléculaires de surveillance de laboratoire

Outils moléculaires de surveillance de laboratoire Outils moléculaires de surveillance de laboratoire Hugues Charest Laboratoire de santé publique du Québec Faculté de médecine, Université de Montréal Conflits d intérêts Je déclare n avoir aucun conflit

Plus en détail

Détermination de gènes candidats par séquençage d exome dans une famille présentant des calcifications idiopathiques des noyaux gris centraux

Détermination de gènes candidats par séquençage d exome dans une famille présentant des calcifications idiopathiques des noyaux gris centraux Service de Neurologie U614 Génétique médicale et fonctionnelle des cancers et des maladies neuropsychiatriques Pr Frébourg Dr Campion Pr Hannequin Détermination de gènes candidats par séquençage d exome

Plus en détail

La fiche individuelle d examen somatique de l adulte avec autisme

La fiche individuelle d examen somatique de l adulte avec autisme Des consultations spécialistes dédiées, avec réduction des temps d attente, anticipation des problématiques avec mise à disposition de temps supplémentaires. Le regroupement des interventions invasives

Plus en détail

Oxoid sites around the world

Oxoid sites around the world Oxoid!!"# Oxoid sites around the world ' $ %& Oxoid s area of expertise )&' )' & ' ' & '' ' ( Oxoid Products Dehydrated Media Prepared Media Latex Agglutination Kits BAX System from DuPont Qualicon DuPont

Plus en détail

Place de la Génétique en Médecine Générale

Place de la Génétique en Médecine Générale Place de la Génétique en Médecine Générale Principes et indications des examens en génétique médicale ECU-UCL 12.01.2008 Dr I.Maystadt Génétique : quelques petits rappels Cytogénétique tique 46 chromosomes

Plus en détail

Date de naissance (J-M-A) moléculaire et séquençage Adresse. Ville Prov 330 Avenue Université Code postal Moncton, N.B. E1C 2Z3

Date de naissance (J-M-A) moléculaire et séquençage Adresse. Ville Prov 330 Avenue Université Code postal Moncton, N.B. E1C 2Z3 DEMANDE D ANALYSE PAR SEQUENCAGE EXOME Information du patient ID Hôpital # Nom de famille Prénom Sexe: H F Laboratoire de diagnostic Date de naissance (J-M-A) moléculaire et séquençage Adresse Ville Prov

Plus en détail