Master 2 Recherche Biologie Géosciences Agroressources Environnement Parcours Biodiversité Écologie Évolution Dounia SALEH

Dimension: px
Commencer à balayer dès la page:

Download "Master 2 Recherche Biologie Géosciences Agroressources Environnement Parcours Biodiversité Écologie Évolution 2008. Dounia SALEH"

Transcription

1 UNIVERSITÉ MONTPELLIER II SCIENCES ET TECHNIQUES DU LANGUEDOC CENTRE INTERNATIONAL D ÉTUDES SUPÉRIEURES EN SCIENCES AGRONOMIQUES - MONTPELLIER Master 2 Recherche Biologie Géosciences Agroressources Environnement Parcours Biodiversité Écologie Évolution 2008 Dounia SALEH Structuration génétique des populations de l aleurode Bemisia tabaci : Importance du biotype, de l origine géographique et de la plante-hôte chez un complexe d espèces phytophages. Stage principal effectué dans le laboratoire Centre de Biologie et de Gestion des Populations (CBGP) Sous la direction de Nathalie Gauthier et Jacques Fargues. Soutenu les 12 et 13 juin 2008 devant la commission d'examen. Membres du jury signataires du PV d examen : Michel. Raymond (Président), Marie-Laure Navas (Représentant SupAgro), Stephan Hättenschwiller et Emmanuel Douzery (Directeurs des études).

2 UNIVERSITE MONTPELLIER II SCIENCES ET TECHNIQUES DU LANGUEDOC CENTRE INTERNATIONAL D ÉTUDES SUPÉRIEURES EN SCIENCES AGRONOMIQUES - MONTPELLIER Master 2 Recherche Biologie Géosciences Agroressources Environnement Parcours Biolodiversité Écologie Évolution 2008 Dounia SALEH Structuration génétique des populations de l aleurode Bemisia tabaci : Importance du biotype, de l origine géographique et de la plante-hôte chez un complexe d espèces phytophages. Soutenu les 12 et 13 juin 2008 devant la commission d'examen. 1

3 Résumé Bemisia tabaci (Gennadius) (Homoptera : Aleyrodidae) est un insecte phytophage généraliste. Il fait partie des 100 pires espèces envahissantes au monde et c est un bioagresseur de plantes cultivées et ornementales. Il est défini par des populations de races-hôtes identiques morphologiquement mais très différentes d un point de vue génétique et écologique en rapport avec leur plantes-hôtes. Cette différenciation en biotypes le place au statut de complexe d espèces. Cette étude a eu pour but d analyser la structuration des populations de B. tabaci dans deux pays du Bassin méditerranéen, la Tunisie et la Grèce (en Crète). L étude a porté sur 24 échantillons, soit 703 individus collectés sur trois plantes-hôtes différentes : la tomate et l aubergine (Solanaceae) et le Lantana camara (Verbenaceae). Deux approches complémentaires ont été réalisées : une approche de génétique des populations basée sur 9 loci microsatellites et une approche phylogénétique basée sur le marqueur mitochondrial Cytochrome Oxydase I (COI). L étude a révélé une forte structuration des individus en deux populations génétiques bien différenciées correspondant aux deux biotypes B et Q. L origine géographique est aussi un facteur de différenciation des populations de B. tabaci. Les deux marqueurs ont montré la partition du biotype Q en deux sous-populations génétiques distinctes liées à l origine géographique. En revanche, la plante-hôte n est pas un facteur important de structuration dans chaque pays. Cependant, la répartition des biotypes sur les différentes plantes-hôtes n est pas la même dans les deux pays. D autre part, les individus collectés sur L. camara appartiennent principalement au biotype minoritaire dans chaque pays. Mots-clés : ADNmt, Bemisia tabaci, biotypes B et Q, complexe d espèces, génétique des populations, marqueurs microsatellites, phylogéographie, plante-hôte. Abstract: Bemisia tabaci (Gennadius) (Homoptera: Aleyrodidae) is a generalist phytophagous insect. It is one of the 100 of the world s worst invasive species and is a pest of cultivated and ornamental plants. It is divided into host-races that are morphologically identical but are genetically and ecologically different with respect to their host plants. This differentiation into biotypes leads to define its status as species complex. The aim of this study was to analyse B. tabaci population structure in two countries of the Mediterranean Basin, Tunisia and Greece (Crete). This study has been based on 24 samples, that is 703 individuals, collected from three host plants: tomato and eggplant (Solanaceae) and Lantana camara (Verbenaceae). Two complementary approaches have been used: a population genetics approach based on 9 microsatellites loci and a phylogenetical approach based on the Cytochrom Oxydase I (COI) marker. The study has revealed a strong structure with two distinct genetic populations that correspond to the two biotypes B and Q. Geographical origin is also a differentiation factor for B. tabaci populations. The two markers have shown a partition of biotype Q into two distinct genetic sub-populations, in relation with their geographical origins. On the other hand, host plant is not an important differentiation factor in each country. However the distribution of biotypes on different host plants is not the same depending on the country. It was also observed that individuals collected on L. camara mostly belong to the less frequent biotype in each country. Keywords: Bemisia tabaci, biotypes B and Q, host plant, microsatellite markers, mtdna, phylogeography, population genetics, species complex. 2

4 SOMMAIRE INTRODUCTION 1 Un insecte phytophage envahissant : Bemisia tabaci 1 Complexe d espèce : biotypes et diversité génétique 2 Situation dans le Bassin méditerranéen 3 Objectifs et approches utilisées 3 MATERIEL ET METHODES 5 I. Echantillonnage 5 II. Analyses de l ADN 5 1. Extraction de l ADN 5 2. Analyse de l ADN nucléaire 5 3. Analyse de l ADN mitochondrial : Cytochrome Oxydase I (COI) 6 III. Analyses génétiques 7 1. Les marqueurs microsatellites 7 2. Le marqueur mitochondrial : COI 10 RESULTATS 12 I. Les loci microsatellites 12 II. Structure des populations : nombre de populations génétiques 12 III. Identité des populations génétiques : détermination du biotype 13 IV. Répartition spatiale et par la plante-hôte des biotypes 15 V. Diversité génétique et différenciation entre les biotypes, les pays, les plantes-hôtes 15 VI. Diversité génétique des haplotypes et reconstruction phylogénétique 16 DISCUSSION 19 Structuration des populations Répartition des biotypes : importance de la compétition 22 Diversité et relations génétiques 23 Diagnostique moléculaire chez un complexe d espèces 25 Conclusion et perspectives 26 3

5 INTRODUCTION Le nombre d espèces envahissantes augmente chaque année et leurs impacts sur les écosystèmes naturels, la biodiversité notamment par le déplacement voire l exclusion des espèces locales et l homogénéisation des flores et des faunes et sur les êtres vivants sont de plus en plus importants (Lockwood et al., 2007). L extension des aires de répartition de ces espèces exotiques est favorisée par plusieurs facteurs, parmi lesquels les changements climatiques globaux et les activités humaines joueraient un rôle majeur. Faire face aux invasions de ces organismes est d autant plus difficile qu il existe un grand nombre d espèces cryptiques. Ce sont des populations génétiques avec des flux de gènes séparés, répondant donc au concept biologique d espèce, mais qui ne sont pas distinguables d un point de vue morphologique (Davis, 1996). Ainsi, la diversité d espèces invasives et leurs impacts sur les écosystèmes naturels et cultivés sont souvent sous-estimés. En particulier, un certain nombre d études sur des insectes parasites et phytophages montrent que des espèces que l on pensait généralistes sont en fait des complexes d espèces spécialistes (Hebert et al., 2004). L approche génétique pour la détection de ces espèces, pour l étude de leur dynamique à diverses échelles spatiales et de leur structure génétique dans les différents environnements occupés, constitue un élément nécessaire pour la compréhension des schémas d invasion et des conséquences sur les populations naturelles, mais aussi sur les populations de plantes cultivées. UN INSECTE PHYTOPHAGE ENVAHISSANT BIO-AGRESSEUR : BEMISIA TABACI Parmi les insectes phytophages à forte capacité d invasion figure l aleurode Bemisia tabaci (Homoptera : Aleyrodidae). C est un insecte piqueur-suceur de sève élaborée (Annexe 1), extrêmement polyphage pouvant se nourrir sur plus de 900 plantes-hôtes sauvages et cultivées dans les zones tropicales, subtropicales et méditerranéennes (Perring, 2001). B. tabaci, espèce d origine tropicale, probablement d Afrique du Sud-Est (Boykin et al., 2007) est dorénavant présente sur tous les continents excepté l Antarctique (Figure 1). Cette espèce opportuniste et thermophyle aurait bénéficié, surtout ces vingt dernières années, de l intensification des échanges commerciaux et probablement de certains épisodes de réchauffement climatique pour étendre son aire de répartition. Une fois établie, cette espèce se répand rapidement. Du fait de sa polyphagie, de son haut potentiel de transmission de phytovirus (vecteur de plus de 110 phytovirus) et de sa capacité à développer des résistances 4

6 aux insecticides, elle a récemment été classée parmi les «100 pires espèces invasives de bioagresseurs au monde» [Union Internationale pour la Conservation de la Nature et des Ressources Naturelles_ IUCN. L aleurode a été décrit pour la première fois en Grèce en 1889 où il a été appelé Aleyrodes tabaci, puis indépendamment sur tous les continents où lui ont été attribuées des dénominations différentes. Toutes ces espèces ont été par la suite regroupées sous le même nom d espèce de Bemisia tabaci (Tableau 1). Les concepts de races-hôtes ou biotypes ont été introduits dans les années 50 pour décrire ces différentes populations qui ne sont pas différenciables morphologiquement mais qui ont des traits biologiques différents en relations avec leurs hôtes, comme la gamme de plante-hôtes utilisées, l adaptabilité aux plantes-hôtes ou encore la transmission de phytovirus (Brown et al., 1995b ; Claridge et al., 1997). COMPLEXE D ESPECES : BIOTYPES ET DIVERSITE GENETIQUE L importante diversité génétique de B. tabaci, la complexité des interactions entre les biotypes, leurs faibles capacités à s hybrider et les flux de gènes limités entre eux (Dalmon et al., 2007) tendent à montrer que B. tabaci constituerait un complexe d espèces (Perring, 2001) Les études récentes s appliquent donc à développer des outils diagnostics, en particulier des outils moléculaires de plus en plus fiables, pour déterminer le biotype. Actuellement, 41 populations de B. tabaci ont été étudiées parmi lesquelles 24 ont été définies comme biotypes et 17 n ont pas encore reçu d assignations. Ces biotypes sont principalement désignés par une lettre allant de A à T mais certains ont une dénomination spécifique comme par exemple le biotype ZHJ1 endémique de Chine (Liu et al., 2007). Sur ces 24 biotypes, 20 ont d abord été identifiés à l aide de profils allozymes estérases (Brown et al., 1995a ; Costa & Brown, 1991 ; Perring, 2001). Ces dix dernières années, les RAPD-PCR 1 (Guirao et al., 1997 ; Horowitz et al., 2003 ; Moya et al., 2001), les RFLP 2 (Abdullahi et al., 2003), les AFLP 3 (Cervera et al., 2000), et les microsatellites (Simón et al., 2007 ; De Barro et al., 2003 ; Dalmon et al., 2007) sont devenus des outils de détermination de biotype et de caractérisation du niveau de variabilité génétique des populations et des biotypes de B. tabaci (De Barro et al., 2005 ; Brown, 2007 ; Tsagkarakou et al., 2007 ; Chu et al., 2008) 1 Random Amplified Polymorphic DNA-Polymerase Chain Reaction 2 Restriction Fragment Length Polymorphisms 3 Amplified Fragment Length Polymorphisms 5

7 SITUATION DANS LE BASSIN MEDITERRANEEN La présence de B. tabaci dans le Bassin méditerranéen est connue depuis longtemps (Gerling, 1996). Tout d abord reconnu comme bio-agresseur dans la partie Est du Bassin méditerranéen (Israël, Turquie, Egypte), les recensements se sont étendus vers l Ouest (Algérie, Italie, Espagne, France) (Perring 2001). B. tabaci a été identifié pour la première fois en Espagne dans les années quarante hors serres et en France en 1989 en serres. Le sud de la France représente la limite nord de répartition hors serres de B. tabaci en Europe. Cette limite passe par l Espagne, l Italie, la Croatie, l Albanie et la Grèce (Dalmon et al., 2007). Au moins cinq biotypes ont été recensés dans le Bassin méditerranéen mais les biotypes B et Q sont les plus envahissants (Simón et al., 2007). La première épidémie de phytovirus transmis par B. tabaci dans le Bassin méditerranéen a été attribuée au biotype B, reconnu pour son fort potentiel à transmettre des Begomovirus, notamment le TYLCV (Tomato Yellow Leaf Curl Virus). Le biotype Q, moins bon vecteur de virus phytopathogènes mais caractérisé par un fort potentiel de développement de résistance aux insecticides (Wilson et al., 2007), a été décrit plus tard. Il est par la suite devenu le seul biotype détecté en Espagne (Simón et al., 2007), en France (Dalmon et al., 2007), et en Grèce (Tsagkarakou et al., 2007). L expansion du biotype Q en Méditerranée et son origine géographique sont encore mal connus (Simón et al., 2007) mais il aurait pour aire de répartition initiale l ouest du bassin méditerranéen à l Egypte alors que le biotype B serait originaire de la région s étendant du Moyen-Orient à l Asie Mineure. OBJECTIFS ET APPROCHES UTILISEES Dans le Bassin méditerranéen, il peut exister des situations contrastées : certaines régions ne présentent qu un seul biotype et dans d autres, plusieurs biotypes peuvent être détectés. Peu d information existe sur les flux de gènes entre biotypes à différentes échelles spatiales et sur ce qui détermine ces situations. Dans ce contexte, le premier objectif a consisté à mieux caractériser ces biotypes et comprendre leur prévalence et relations. Nous avons donc étudié deux pays reflétant a priori ces situations : la présence des biotypes B et Q au sein d un même pays, la Tunisie (Chermiti et al., 1997), et la présence du seul biotype Q, en Grèce (Tsagkarakou et al., 2007). Un large échantillonnage d individus représentant : (i) deux régions très maraîchères au nord-est et au sud de la Tunisie, (ii) deux régions maraîchères et une zone urbaine en Crète, a été collecté sur trois plantes-hôtes. Il s agit de deux espèces cultivées annuelles de la famille des Solanacées, la tomate (Solanum lycopersicum) et l aubergine (Solanum 6

8 melongena), et une plante ornementale pérenne de la famille des Verbénacées, Lantana camara, trouvée à l état sauvage ou cultivé auprès des habitations. Le second objectif a consisté à évaluer la diversité et la structuration génétique des populations de Tunisie et de Crète en fonction de trois facteurs potentiellement structurant : le biotype, l origine géographique et la plante-hôte. Cette étude a permis d estimer les niveaux de différenciation et les flux de gènes à diverses échelles spatiales. Elle a été complétée par l inférence des relations phylogénétiques entre certains individus de ces populations et des individus issus d autres populations d origine méditerranéenne. L étude de tels aspects de diagnostic de biotype, de génétique des populations et de phylogéographie requiert des marqueurs sélectivement neutres, variables et informatifs. Des outils moléculaires déjà reportés dans la littérature, les séquences d un fragment d ADN mitochondrial et des profils de digestions enzymatiques ont été décrits comme fiables dans l identification des biotypes (Fröhlich et al., 1999 ; Horowitz et al., 2005 ; Khasdan et al., 2005 ; Tsagkarakou et al., 2007). La validité d autres marqueurs, des loci microsatellites, a été testée dans cette étude. Les microsatellites sont des marqueurs neutres à évolution rapide qui ont largement contribué à la résolution d études de structuration des populations sur de nombreux organismes dont B. tabaci (Jarne & Lagoda, 1996). Au moins 30 loci microsatellites ont été isolés et caractérisés chez B. tabaci (De Barro et al., 2003 ; Tsagkarakou & Roditakis, 2003 ; Delatte et al., 2005 ; Gauthier et al., 2008). L ADN mitochondrial, dont le Cytochrome Oxydase I (COI), est le marqueur privilégié dans l inférence des relations phylogéographiques (Avise, 2000) et il s est effectivement avéré très informatif chez B. tabaci (Fröhlich et al., 1999). Afin de mieux comprendre ce qui caractérise et contribue à la répartition observée des populations et biotypes de B. tabaci dans des pays méditerranéens représentant des situations très contrastées («coexistence» ou non entre les biotypes B et Q), nous avons, par une approche multilocus, étudié la diversité génétique et l influence de certains facteurs sur la structuration et la différenciation des populations. 7

9 MATERIEL ET METHODES I. ECHANTILLONNAGE Nous avons disposé de 24 échantillons d aleurodes collectés sur deux années, 2006 et 2007, dans deux pays du Bassin méditerranéen, la Tunisie et la Grèce (Tableau 2). Les 18 échantillons tunisiens proviennent de 2 régions maraîchères, le «Sahel» au Nord-Est du pays et la région Kébili au Sud. Les 6 échantillons grecs provenaient de deux zones rurales et d une zone urbaine de Crète (Tableau 2, Figure 2). Chaque échantillon correspondait à un groupe d individus collectés sur plusieurs plantes (pour limiter la collecte d individus apparentés) de la même espèce sur le même site et ces individus ont été conservés dans des tubes à -20 C dans de l alcool à 70%. Les échantillons ont été triés sous loupe afin d éliminer des individus appartenant à l espèce Trialeurodes vaporariorum (trialeurode), une autre espèce de mouche blanche sympatrique difficilement différenciable de B. tabaci à l œil nu. Les individus ont ensuite été sexés sous loupe binoculaire (Annexe 1) et seules les femelles ont été utilisées du fait de leur état diploïde. II. ANALYSES DE L ADN 1. Extraction de l ADN L extraction d ADN génomique des femelles B. tabaci a été réalisée selon un protocole au Nonidet P-40 (Delatte et al., 2005, Annexe 2). 2. Analyse de l ADN nucléaire Les marqueurs microsatellites En tout, 703 individus ont été génotypés avec 10 marqueurs microsatellites dinucléotidiques (TC n ou TG n ) : 9 loci antérieurement décrits par Gauthier et al. (2008) (BtIs1.1, BtIs1.2, BtIs1.9, BtIs1.11, BtIs1.13, BtIs1.14, BtIs1.17, BtIs2.3, BtIs2.4) et un locus non publié (BtIs1.8) (Tableau 3). Amplification par Polymerase Chain Reaction (PCR) Les réactions d amplification de l ADN pour chaque multiplex de loci (Tableau 3) ont été conduites dans un volume réactionnel total de 10µl contenant : 1µl d extrait d ADN non dilué d un individu ( 40ng), 5µl (2X) du tampon de réaction QIAGEN Multiplex PCR Master Mix 8

10 (Tampon 10X, 3mM MgCl 2, Taq, dntps), 0.2µM de chaque amorce F* 4 et R correspondant à un même locus, 3µl d eau ultrapure. Les conditions d amplification ont suivi une procédure de Touchdown (Gauthier et al., 2008) (Annexe 2). Génotypage Pour le génotypage, 2µl de produit de PCR dilué au 1/5 ème a été additionné de 8µl d un marqueur de taille ET-ROX 400 et analysé sur séquenceur automatique 96 capillaires (Megabace 1000 DNA Sequencer de chez Amersham Bioscience). Le logiciel MEGABACE GENETIC PROFILER a été utilisé pour assigner une taille à chaque allèle. La lecture a été faite en double aveugle et les ADN d individus pour lesquels le signal était incertain ou absent ont été repassés. En règle générale, si l incertitude ou le signal n étaient pas résolus au bout du troisième passage, la donnée a été considérée comme manquante. 3. Analyse de l ADN mitochondrial : Cytochrome Oxydase I (COI) L amplification par PCR d un fragment du COI Un fragment d environ 816pb du gène Cytochrome Oxydase I mitochondrial a été amplifié selon le protocole décrit par Fröhlich et al. (1999) avec quelques modifications. Les PCR ont été conduites dans un volume réactionnel total de 25µl contenant : 2.5 µl d extrait d ADN non dilué d un individu, 2.5µl (1X) du tampon d amplification (QIAGEN), 1.5µl de MgCl 2, 1.6µl de DNTPs, 1.3µl de chaque amorce (C1-J-2195, L2-N-3014) 5 (10µM), 0.3µl de Taq Polymerase (QIAGEN), 14.5µl d eau ultrapure. Les conditions d amplification de l ADN sont décrites dans l Annexe 2. La bonne amplification du fragment (bande unique d environ 800pb en référence au marqueur SmartLadder 200pb) de chaque produit PCR a été vérifiée par migration de 2 à 3µl d amplicon additionné de 2µl de bleu de charge sur gel d électrophorèse à 1.5% d agarose (tampon TAE 0.5X ; 135V pendant 30 min.). L ADN migré a été révélé sous UV après un passage dans un bain de Bromure d Ethidium (BET). Le fragment amplifié a été utilisé pour le séquençage d une part, et des digestions enzymatiques d autre part. Ces deux analyses ont servi à confirmer le biotype d appartenance des individus et à tester leur proximité phylogénétique avec ceux issus d un jeu de données 4 Amorce marquée en 5 par un fluorochrome soit FAM (bleu), NED (jaune), HEX (vert) 5 Amorces (Fröhlich et al., 1999) C1-J-2195 : TTGATTTTTTGGTCATCCAGAAGT L2-N-3014 : TCCAATGCACTAATCTGCCATATTA 9

11 disponible non publié relatif à des B. tabaci majoritairement collectés dans des pays du Bassin Méditerranéen. Ainsi, le COI de 15 individus grecs et 6 tunisiens parmi les 703 génotypés ont été partiellement séquencés (Tableau 2), ainsi que 8 autres femelles B. tabaci issues d autres sites de Tunisie. Séquençage La quantité d ADN dans les produits de PCR a été quantifiée sur gel d agarose 1.5% (TAE 0.5X) en comparaison avec le marqueur Phage λ (Sigma). Seuls les produits PCR de concentration au moins égale à 10ng/µl ont été séquencés (sens 5 3 ) par la Société Cogenics (Grenoble) sur séquenceur automatique (ABI3730XL). Digestion enzymatique : PCR-RFLP (Restriction Fragment Lenght Polymorphism) Par digestion du COI en des sites spécifiques, les enzymes de restriction VspI (Horowitz et al., 2005 ; Khasdan et al., 2005), TaqI (Bosco et al., 2006) et AluI (Tsagkarakou et al., 2007) permettent la distinction entre les Biotypes B et Q. AluI permet en plus la distinction de deux sous-biotypes du biotype Q : Q et Q. Ainsi, de façon à compléter l information «biotypage» manquante ou contradictoire apportée par les loci microsatellites et corroborer l aspect diagnostic de certains loci microsatellites, le biotype d une centaine d individus a été caractérisé par RFLP. La procédure expérimentale suivie est décrite dans l Annexe 2. Chaque digestion enzymatique a eu lieu en thermocycleur (MJ Research, Eppendorf). Les 15µl de la digestion additionnés de 5µl de bleu de charge ont été déposés sur gels d agarose 3% (TAE 0.5X). Les produits séparés par électrophorèse (100V pendant 1h30) ont ensuite été révélés sous UV après un passage dans un bain de Bromure d Ethidium. Leur taille a été estimée en référence à 2 marqueurs de taille [PCR Low Ladder Marker Set (bandes toutes les 20pb et 100pb) et/ou Smart Ladder 200pb] et comparée aux profils RFLP de la littérature (Annexe 3). III. ANALYSES GENETIQUES 1. Les marqueurs microsatellites Les loci microsatellites Avant de commencer des analyses génétiques, l indépendance génotypique des loci, l hypothèse d équilibre de Hardy-Weinberg (HWE) et les erreurs de génotypage ou 10

12 de fixation des amorces ont été vérifiés afin de déterminer si certains loci devaient être éliminés de l analyse. Le déséquilibre de liaison génotypique entre chaque paire de loci a été testé par des tests exacts réalisés par le logiciel GENEPOP (Raymond & Rousset, 1995). L hypothèse de panmixie au sein des échantillons a été également testée par les estimations des F IS selon Weir & Cockerham (1984) et des tests exacts de déficit en hétérozygotie observée (H O ) par rapport à l hétérozygotie attendue (H E ) sous Equilibre de Hardy-Weinberg (HWE). La significativité des valeurs observées par rapport à celles attendues a été testée au seuil de 5% sous GENEPOP (Raymond & Rousset, 1995). L écart à l équilibre de Hardy-Weinberg est souvent lié à un déficit en hétérozygotes suite à une structuration génétique au sein de l échantillonnage, un régime de reproduction très fermé ou encore à des erreurs de génotypage. Trois grand types d erreurs de génotypage peuvent affecter les données moléculaires : les plus souvent évoqués sont les allèles nuls 6, les «dropouts» alléliques et les allèles faux 7, les «stutterings» 8 (Pompanon et al., 2005). Le logiciel FreeNA (Chapuis & Estoup, 2007), a été utilisé pour l estimation pour chaque locus et échantillon des fréquences d allèles nuls, erreur la plus souvent rencontrée. D autre part, les paramètres de variabilité génétique tels que le nombre d allèles par locus, la gamme de taille allélique, les hétérozygoties observées et attendues de chaque locus ont été estimés par locus, et par échantillon sur l ensemble de loci. Une première représentation de la répartition génétique globale des individus échantillonnés en fonction d axes factoriels définis par les allèles (Analyse de la Fonction des Correspondances_AFC) a été réalisée à l aide du logiciel GENETIX 4.03 (Belkhir et al., 2001). Assignation des individus à des populations génétiques L estimation de la plupart des paramètres génétiques notamment les F-statistiques s appuie sur la définition préalable de groupes naturels d individus appartenant à la même population génétique. La délimitation de ces populations n est pas forcément reflétée dans la proximité géographique des individus puisque des individus proches géographiquement peuvent correspondre à des populations génétiques différentes et une même population génétique être représentée par des individus à répartition géographique très large. 6 allèle nul. allèle non amplifié à cause d une mutation au niveau du site de fixation de l amorce 7 «dropout» et allèle faux dus à une faible quantité d ADN cible ou amplification préférentielle des allèles de petite taille 8 «stutterings». erreurs d amplication par la Taq au niveau des motifs microsatellites 11

13 Afin de partir sans a priori, une approche multi-locus bayésienne a été utilisée pour déterminer le nombre le plus probable (K) de populations génétiquement différenciées dans l échantillonnage étudié et la probabilité (Q) d assignation de chaque individu à chacune des K populations sur la base de 7 loci microsatellites (3 des 10 loci sont diagnostics du biotype et influenceraient fortement les groupes). Elle a été appliquée par le logiciel STRUCTURE 2.2 (Pritchard et al. 2000) sous les modèles de mixité ou admixture 9 et de fréquences alléliques corrélées. Chaque analyse a consisté en une «phase d allumage» (Burn-in period) de chaînes de Markov Monte Carlo (MCMC) et une phase stationnaire de MCMC. Les estimations du log de vraisemblance, c est-à-dire la probabilité d observer les données sachant le nombre de groupes K [Ln P(D) ou Pr ( X K ) ] ont été calculées pour des valeurs de K allant de 1 à 9 avec 5 répétitions pour chaque afin de tester la reproductibilité des résultats. La meilleure estimation de K est la valeur de K maximale avant le plateau de la courbe représentant Ln P(D) en fonction de K (Pritchard et al. 2000). Ce type d analyse a été refait pour détecter des sous-populations génétiques. Suite à la définition de cette valeur K, la diversité génétique des K (sous)-populations génétiques a été estimée. Différenciation génétique entre les populations, facteurs de différenciation Les valeurs de F ST global, entre les 24 échantillons et entre les populations génétiques définies par le logiciel STRUCTURE ont été estimées à l aide du logiciel GENEPOP selon la formule de Weir & Cockerham (1984). La significativité des valeurs observées a été testée par un Test exact de Fisher (1000 répétitions, P<0.05). La structure et le niveau de différenciation de ces populations ont également été calculés à l aide d Analyses Hiérarchiques de Variance Moléculaire (AMOVA) réalisées par le logiciel ARLEQUIN (Excoffier et al., 2005). Il s agit d une analyse de variance hiérarchique dont les données sont les distances génétiques entre individus et dont les hypothèses sont testées par des tests de permutation. Cette analyse requiert de spécifier des groupes d individus et d assigner chaque individu à une sous-population au sein des groupes. Différents niveaux de structuration ont donc été définis pour tester l importance relative de plusieurs facteurs potentiellement structurant chez B. tabaci, tels que le biotype, l origine géographique et la plante-hôte. L AMOVA décompose la variance totale en 4 composantes : qui sont attribuées aux différences entre les groupes définis (F CT ), entre les populations à l intérieur des groupes définis (F SC ), entre les individus au sein des populations (F IS ) entre les 9 admixture les individus peuvent être assignés à plusieurs populations génétiques s ils proviennent d une hybridation entre individus appartenant à des populations différentes 12

14 individus sur l ensemble des populations (F IT ). L hypothèse nulle du test spécifie que les individus, quel que soit leur groupe ou quel que soit leur «sous-population» au sens de l AMOVA (sens différent de celui de STRUCTURE), appartiennent à une même population génétique et la significativité des hypothèses alternatives a été testée pour toutes les valeurs par 1000 permutations (logiciel ARLEQUIN) (P<0.05). Les effets groupe et sous-population sont supposés additifs, stochastiques et non corrélés. Cette dernière hypothèse n est probablement pas remplie mais l AMOVA fonctionnant sur des tests de permutations, les tests sont assez robustes pour être légitimes. Le test d isolement par la distance, test de Mantel, montrant une éventuelle corrélation entre distance génétique, basée sur la formule F ( ) 1 et distance géographique en log ST F ST (km) des échantillons a été réalisé grâce au logiciel GENEPOP. C est un test exact dont l hypothèse nulle suppose que la pente de régression distance génétique/distance géographique est nulle. Ce test a été réalisé pour 15 échantillons sur les 24 génotypés selon 4 modalités de regroupement : tous les individus typés avec 9 loci (sans le locus BtIs 1.8), tous les individus typés sans les loci diagnostics de biotype (soit 7 loci), les individus de biotype B avec les 9 loci et les individus de biotype Q avec les 9 loci. Finalement, de façon à avoir une estimation des flux de gènes entre les divers sites et planteshôtes, une estimation multiloci du nombre efficace de migrants (Nm) a été faite grâce au logiciel GENEPOP (Raymond & Rousset, 1995). 2. Le marqueur mitochondrial : COI Diversité génétique du COI Chaque séquence obtenue dans les 2 sens a été vérifiée dans l éditeur de séquences BioEdit de façon à créer la séquence consensus correspondante. Les 29 séquences consensus et 34 autres disponibles ont été alignées avec le logiciel CLUSTALW (sous BioEdit) et comparées entre elles. Seules les séquences représentant des haplotypes 10 différents ont ensuite été incluses dans les analyses. Les indices standards de variations génétiques [nombres de sites polymorphes, nombre de sites informatifs et de singletons, diversité haplotypique (Hd)] ont été calculés au moyen du logiciel DNAsp (Rozas et al., 2003). 10 haplotype : une séquence unique 13

15 Identification du biotype L identification du biotype des individus séquencés a été obtenue par comparaison de leur haplotype COI d appartenance avec les séquences disponibles dans GenBank en réalisant un Blast ( Une identité nucléotidique élevée (% de nucléotides partagés de l ordre de 96%) avec des séquences COI de B. tabaci au biotype déjà déterminé permet d assigner un biotype à quasiment chaque individu. Pour certains des individus génotypés non séquencés, la détermination ou la confirmation de leur biotype a été réalisée par comparaison des 3 profils de digestion (VspI, TaqI, AluI) de leur produit COI amplifié avec les profils PCR-RFLP de référence (individus B. tabaci de biotype connu, Horowitz et al., 2005 ; Khasdan et al., 2005 ; Bosco et al., 2006 ; Tsagkarakou et al., 2007) (Annexe 3). Finalement, compte tenu de l existence de ces 2 méthodes fiables de biotypage, nous avons recherché l éventuelle présence de marqueurs diagnostics parmi nos 10 loci microsatellites par une AFC et une ACM (Analyse des Correspondances Multiples). Reconstructions phylogénétiques La proximité phylogénétique entre les 20 haplotypes tunisiens et grecs de cette étude et des séquences d autres pays du Bassin Méditerranéen (34 Gauthier ; 13 Genbank) (Tableau 4) a été estimée par 3 méthodes : 1) basée sur la distance génétique, ici la distance de Kimura- 2 [Neighbour-Joining (NJ), Saitou & Nei, 1987], 2) basée sur le critère de Maximum de Parcimonie [MP, Fitch, 1971], 3) basée sur le critère de Maximum de Vraisemblance [ML, Felsenstein, 1981). Ces analyses ont été réalisées dans PAUP* (Swofford, 2002). Pour le ML, le logiciel MODELTEST (Posada & Crandall, 1998) a été utilisé pour déterminer le modèle de substitutions de l ADN le plus adapté à notre jeu de données (valeur du critère AIC minimale). Le modèle TIM+G 11 a ainsi été retenu pour la reconstruction des arbres. La robustesse des branches et de ce fait des «groupements» a été évaluée par 500 répétitions de Bootstrap. Les reconstructions ont été enracinées avec des séquences homologues de 2 spécimens de l espèce Bemisia afer (Genbank accession numbers AJ784260, AF418673). 11 TIM + G : Transitional Model plus Gamma (fréquence des bases 0.432, 0.125, 0.246, Ts / Tv = ) 14

16 RESULTATS I. LES LOCI MICROSATELLITES En tout, 703 femelles ont été génotypées avec 9 des 10 loci microsatellites. Le locus BtIs1.8 n a pu être étudié de la même manière que les autres loci puisque, les amorces se fixant sur trois sites différents du génome, les individus pouvaient présenter 4 allèles pour ce seul locus. Cependant les sites de fixation semblant porter une information en termes de structuration génétique, il a été analysé selon une approche statistique différente. Aucun déséquilibre de liaison significatif n a été détecté entre les différents loci sur l ensemble des 24 échantillons (p>0.05) témoignant de l indépendance de l information apportée par chacun. En revanche, certains tests n ont pas pu être réalisés notamment entre les loci BtIs1.1 et BtIs1.14 du fait de la présence d allèles fixés. L hypothèse d HWE n est pas vérifiée pour 6 loci sur les 9 (test exact, P<0.05) car un déficit significatif en hétérozygotes à ces loci a été observé (Tableau 4). Cet excès d homozygotes observés ne semble pas lié à des fréquences très significatives d allèles nuls dans les données génotypiques car sur 216 combinaisons loci x échantillons, 12.5% de fréquences d allèles nuls sont supérieures à 0.20, majoritairement aux loci BtIs1.17 et BtIs1.9. La richesse allélique observée sur l ensemble des 24 échantillons varie de 4 allèles pour le BtIs1.13 à 37 pour le locus BtIs1.2 (Tableau 4). L analyse du polymorphisme pour chaque site d échantillonnage sur l ensemble des 9 loci montre une grande variabilité en termes de richesse allélique (environ 2 à 6 allèles) et d hétérozygoties (0.09<H O <0.45 _ 0.10<H E <0.55) qui ne semble pas être caractéristique d une zone géographique particulière. Chaque site échantillonné présente un déficit significatif d hétérozygotes (test exact U, P<0,05) qui pourrait en partie s expliquer par un régime de reproduction fermé (0.17<F IS <0.61) ou bien encore une sous-structuration des individus au sein de chaque site ou entre certains sites (Tableau 5). L estimation des valeurs de F ST (0.02 à 0.66) et de F IT (0.19 à 0.90) sur l ensemble des 9 loci révèle l existence d une grande variabilité entre les échantillons et sur l ensemble des individus. II. STRUCTURE DES POPULATIONS : NOMBRE DE POPULATIONS GENETIQUES Une AFC en trois dimensions réalisée sous GENETIX a montré la répartition des individus en deux nuages de points clairement distincts avec les échantillons tunisiens sur 15

17 tomate et aubergine et grecs sur L. camara d un côté, et les échantillons tunisiens sur L. camara et grecs sur tomate et aubergine de l autre (Annexe 4). La première analyse Bayésienne réalisée avec le logiciel STRUCTURE pour des valeurs de K allant de 1 à 9 révèle la partition la plus probable de l ensemble des individus en 2 populations génétiques, K1 et K2. En effet, la valeur de Ln P(D) avant le plateau atteint est de 2 (Figure 3, Figure 4). Pour K supérieur à 2, aucun gain de vraisemblance n est noté. La grande majorité des individus a été fortement assignée soit à K1 soit à K2 avec des probabilités Q supérieures à 0.8. Pour des probabilités d assignation comprises entre 0.8 et 0.7, l assignation se fait à la population la plus probable. En dessous de 0.70, compte tenu du type de modèle choisi (admixture), ces individus pourraient être des hybrides. Globalement, la majorité des individus d un même échantillon semble relever de la même population quelle que soit l origine géographique, Tunisie ou Grèce. Des analyses séparées de K1 et K2 sur STRUCTURE pour des valeurs de K allant de 1 à 9, ont révélé une partition de la population génétique K2 en deux sous-groupes K2a et K2b, significativement basés sur l origine géographique des échantillons (Tunisie et Crète) (Figure 5). Aucun sous-groupe génétique n a été mis en évidence pour K1. III. IDENTITE DES POPULATIONS GENETIQUES : DETERMINATION DU BIOTYPE Trois méthodes ont été utilisées pour déterminer le biotype des individus dont 2 utilisées couramment dans la littérature : le séquençage d un fragment COI et les digestions enzymatiques de ce fragment (PCR-RFLP). Une méthode basée sur des tailles d allèles de loci microsatellites diagnostics, BtIs1.2 et BtIs1.9 a été vérifiée ici. Le locus BtIs1.8 a aussi fait l objet d une analyse indépendante pour appuyer les résultats. 1. Loci microsatellites diagnostics Les loci BtIs1.2 et BtIs1.9 faisant partie des 9 loci utilisés pour le génotypage, le biotype des 703 individus a pu être systématiquement identifié par ces loci, sauf pour quelques individus pour lesquels il manquait des données. Ces 2 loci présentent un grand polymorphisme (Tableau 4) en particulier le locus BtIs1.2 qui en présente 37 sur l ensemble des individus. Deux types de patrons de tailles alléliques spécifiques du biotype B ou Q ont 16

18 été identifiés pour chaque locus (Tableau 6) et l assignation d un individu à un biotype s est basée sur ces profils. Quand il y avait contradiction entre les 2 loci, le locus BtIs1.9 a été privilégié du fait d un nombre d allèles moindre et d une lecture plus fiable. Biotype (population génétique) Locus B (K2) Q (K1) BtIs1.2 [ pb] [ pb] BtIs1.9 [ pb] [ pb] Tableau 6 : Gammes des tailles alléliques des loci BtIs1.2 et BtIs1.9 diagnostics du biotype et correspondances avec les biotypes B et Q. Ainsi, les individus de la population génétique K1 ont été identifiés comme appartenant au biotype B et les individus de la population génétique K2 au biotype Q. L identification du biotype sur la base de ces 2 loci s est avérée concordante avec la délimitation stricte des 2 populations génétiques à l exception de 5 individus mal assignés. 13 autres individus n ont pu être assignés ni à un biotype ni à une population génétique. Cela peut provenir soit d erreurs de lecture, soit d hybridation entre les deux biotypes. * Une analyse de la séquence du clone référence du locus Bts1.8 a mis en évidence 3 sites de fixation possibles pour les 12 premières paires de bases de l amorce Forward (Annexe 5). Une AFC sur le premier site de fixation du locus BtIs1.8 a permis de réaliser une typologie des échantillons et une ACM sur les 3 sites de fixation du locus BtIs1.8 a permis de réaliser une typologie des individus concordante avec le biotype et les patrons alléliques observés (Annexe 6). L amorce F se fixe sur le site S1 pour tous les individus. Quand les individus sont homozygotes à ce site, alors il n y pas de fixation au site S2 mais fixation au site S3. Ces individus correspondent au biotype Q. Quand les individus sont hétérozygotes au site S1, alors il y a fixation systématique au site S2. Ces individus correspondent au biotype B. Pour le moment aucune information en termes de biotypes, relative à l état homozygote ou hétérozygote aux sites S2 et S3, n a été identifiée (Tableau 7). Biotype Locus BtIs1.8 B Q Sites de fixation S S1 S2 S3 S1 S2 S3 Génotype(s) observés en S (237239) (255255) (237239) (255257) - _ (237237) (237237) [ ] Homoou Hétérozygote - Tableau 7 : Correspondance entre profils génotypiques du locus BtIs1.8 et les biotypes. 17

19 2. Fiabilité des méthodes diagnostics : Séquençage du COI et PCR-RFLP Seuls 21 individus issus des échantillons de mon étude ont pu être séquencés. La séquence a corroboré les résultats d appartenance des individus à l un ou l autre des biotypes donnée par l analyse sous STRUCTURE (9 loci) et ceux des profils de digestions enzymatiques (Figure 6). IV. REPARTITION SPATIALE ET PAR PLANTE-HOTE DES BIOTYPES L assignation des individus aux biotypes B et Q est très concordante avec une distribution géographique. Les B. tabaci collectés en Tunisie sont à 57.3% de biotype B (42.7% de Q) et ceux de Crète à 84.3% de biotype Q (15.2% de B) (Tableau 8). Au sein du biotype Q, les individus clairement assignés à Q1 par STRUCTURE (avec une probabilité supérieure à 0.70) sont à 80.4% tunisiens, ceux de Q2 à 74.1% crétois (Tableau 9). Globalement, chaque site d échantillonnage est soit de biotype B ou Q. Les individus de biotypes différents ne coexistent pas ou peu en un même site. Les individus de chaque biotype sont globalement présents sur les 3 plantes hôtes mais au sein d un pays les résultats montrent qu en Crète, 100% des individus du biotype minoritaire B sont sur L. camara, et en Tunisie, 74.8% des individus du minoritaire Q sont présents sur L. camara (Tableau 8). V. DIVERSITE GENETIQUE ET DIFFERENCIATION ENTRE LES BIOTYPES, LES PAYS, LES PLANTES-HOTES Les paramètres estimés de nombre d allèles moyen, d hétérozygoties observées et attendues sous hypothèse de HWE sur l ensemble des 9 loci (Tableau 10), et le nombre d allèles par locus (Figure 7) mettent en évidence une diversité génétique significativement plus importante pour le biotype Q que pour le biotype B. La valeur de F ST total entre les 2 biotypes est égale à 0.51 ; elle est de 0.55 entre B et Q1 et 0.63 entre B et Q2. Cela indique une différenciation très significative entre les 2 biotypes avec une estimation du nombre de migrants de 0.13/génération sur l ensemble des individus. Au sein du biotype Q, la valeur de F ST entre Q1 et Q2 est de 0.24 et confirme l existence d au moins 2 groupes génétiques distincts. Les valeurs estimées de F ST tenant non seulement compte de la composante biotype mais aussi origine géographique et plantes-hôtes sont reportées dans le Tableau 11. Trois niveaux de différenciation génétique apparaissent traduits par 3 gammes de valeurs de F ST : 18

20 - F ST > 0.4 : inter biotypes quelles que soient les plantes-hôtes et le pays > F ST >0.4 : intra Q entre les plantes-hôtes de Tunisie et de Crète (pas de biotype Q sur L. Camara en Crète) - F ST < 0.15 : intra B, intra pays quelle que soit la plante-hôte Ces résultats expriment l importance relative des 3 composantes dans la différenciation observée à savoir le biotype, le pays et peut être la plante-hôte. Les AMOVA confirment que la variance moléculaire observée est d abord inter biotypes (38%-48%), inter-individus ( 32%, tous les individus ont quasiment tous des profils alléliques propres) intra biotype Q (19%) ce qui revient à dire inter pays (Q1 majoritairement en Tunisie et Q1 en Crète). En revanche, la plante hôte n explique que 4,32% de la variance moléculaire et ne constitue donc pas un facteur déterminant. Concernant la composante géographique, il y a 3 aspects différents à considérer : l origine (AMOVA), la distance (Test de Mantel) et les migrants (N m ). Les graphes représentant les distances génétiques entre échantillons en fonction de leur distance géographique permettent de visualiser l importance du biotype Les tests de Mantel ne sont pas significatifs puisque les pentes des droites de régression ne sont pas significativement différentes de 0. Il n y pas d isolement par la distance (Annexe 7) Le nombre efficace de migrants estimé par GENEPOP entre la Tunisie et la Crète est de 3,40. Il est inférieur entre biotypes d un même pays (N m =0,40 pour la Crète, N m =0,19 pour la Tunisie) et supérieur entre pays d un même biotype (N m =3,03 pour le biotype B, N m =5.30 pour le biotype Q). Il y a donc plus d échanges entre les individus d un même biotype mais provenant de pays différents, qu entre les individus de biotypes différents mais provenant du même pays. VI. DIVERSITE GENETIQUE DES HAPLOTYPES ET RECONSTRUCTION PHYLOGENETIQUE L alignement entre les 63 séquences partielles du COI a résulté en un fragment commun de 676pb. Les 136 sites variables (77.6% de transitions) ont abouti à la définition de 20 haplotypes (Tableaux 12, 13, Figure 8). Six de ces haplotypes ont été assignés au Biotype B, 13 au Biotype Q et 1 est resté de biotype indéterminé (il présentait 96% d identité nucléotidique avec un biotype inconnu sur GenBank). La majorité des haplotypes (12/20) identifiés sont uniques (1 seul spécimen). Quant aux haplotypes partagés, ils regroupent des séquences de spécimens issus soit de pays différents (H1, H15, ) soit d un même pays (H9 : 12 individus sur les 13 de biotype Q séquencés ; H13 : 7 individus sur les 9 de biotype Q 19

Isolement et Diversité Génétique des Dugongs de Nouvelle Calédonie

Isolement et Diversité Génétique des Dugongs de Nouvelle Calédonie Isolement et Diversité Génétique des Dugongs de Nouvelle Calédonie Rapport final Marc OREMUS, Claire GARRIGUE & Christophe CLEGUER Opération Cétacés B.P. 12 827, 98802 Nouméa, Nouvelle-Calédonie Tél. /

Plus en détail

4. Résultats et discussion

4. Résultats et discussion 17 4. Résultats et discussion La signification statistique des gains et des pertes bruts annualisés pondérés de superficie forestière et du changement net de superficie forestière a été testée pour les

Plus en détail

Gènes Diffusion - EPIC 2010

Gènes Diffusion - EPIC 2010 Gènes Diffusion - EPIC 2010 1. Contexte. 2. Notion de génétique animale. 3. Profil de l équipe plateforme. 4. Type et gestion des données biologiques. 5. Environnement Matériel et Logiciel. 6. Analyses

Plus en détail

GénoToul 2010, Hôtel de Région Midi Pyrénées, Toulouse, 10 décembre 2010

GénoToul 2010, Hôtel de Région Midi Pyrénées, Toulouse, 10 décembre 2010 GénoToul 2010, Hôtel de Région Midi Pyrénées, Toulouse, 10 décembre 2010 Analyse de la diversité moléculaire des régions génomiques de 30 gènes du développement méristématique dans une core collection

Plus en détail

Plateforme. DArT (Diversity Array Technology) Pierre Mournet

Plateforme. DArT (Diversity Array Technology) Pierre Mournet Plateforme DArT (Diversity Array Technology) Pierre Mournet Lundi 8 avril 203 Pourquoi des DArT? Développement rapide et peu onéreux de marqueurs : Pas d information de séquence nécessaire. Pas de pré-requis

Plus en détail

Biostatistiques Biologie- Vétérinaire FUNDP Eric Depiereux, Benoît DeHertogh, Grégoire Vincke

Biostatistiques Biologie- Vétérinaire FUNDP Eric Depiereux, Benoît DeHertogh, Grégoire Vincke www.fundp.ac.be/biostats Module 140 140 ANOVA A UN CRITERE DE CLASSIFICATION FIXE...2 140.1 UTILITE...2 140.2 COMPARAISON DE VARIANCES...2 140.2.1 Calcul de la variance...2 140.2.2 Distributions de référence...3

Plus en détail

Annales du Contrôle National de Qualité des Analyses de Biologie Médicale

Annales du Contrôle National de Qualité des Analyses de Biologie Médicale Annales du Contrôle National de Qualité des Analyses de Biologie Médicale ARN du virus de l hépatite C : ARN-VHC ARN-VHC 03VHC1 Novembre 2003 Edité : mars 2006 Annales ARN-VHC 03VHC1 1 / 8 ARN-VHC 03VHC1

Plus en détail

Tests de comparaison de moyennes. Dr Sahar BAYAT MASTER 1 année 2009-2010 UE «Introduction à la biostatistique»

Tests de comparaison de moyennes. Dr Sahar BAYAT MASTER 1 année 2009-2010 UE «Introduction à la biostatistique» Tests de comparaison de moyennes Dr Sahar BAYAT MASTER 1 année 2009-2010 UE «Introduction à la biostatistique» Test de Z ou de l écart réduit Le test de Z : comparer des paramètres en testant leurs différences

Plus en détail

Incertitude et variabilité : la nécessité de les intégrer dans les modèles

Incertitude et variabilité : la nécessité de les intégrer dans les modèles Incertitude et variabilité : la nécessité de les intégrer dans les modèles M. L. Delignette-Muller Laboratoire de Biométrie et Biologie Evolutive VetAgro Sup - Université de Lyon - CNRS UMR 5558 24 novembre

Plus en détail

MABioVis. Bio-informatique et la

MABioVis. Bio-informatique et la MABioVis Modèles et Algorithmes pour la Bio-informatique et la Visualisation Visite ENS Cachan 5 janvier 2011 MABioVis G GUY MELANÇON (PR UFR Maths Info / EPI GRAVITE) (là, maintenant) - MABioVis DAVID

Plus en détail

3: Clonage d un gène dans un plasmide

3: Clonage d un gène dans un plasmide 3: Clonage d un gène dans un plasmide Le clonage moléculaire est une des bases du génie génétique. Il consiste à insérer un fragment d'adn (dénommé insert) dans un vecteur approprié comme un plasmide par

Plus en détail

Principe d un test statistique

Principe d un test statistique Biostatistiques Principe d un test statistique Professeur Jean-Luc BOSSON PCEM2 - Année universitaire 2012/2013 Faculté de Médecine de Grenoble (UJF) - Tous droits réservés. Objectifs pédagogiques Comprendre

Plus en détail

P opulation. ATLAS DES POPULATIONS IMMIGRÉES en Ile-de-France / Regards sur l immigration / Population 2. Photo : Philippe Desmazes/AFP

P opulation. ATLAS DES POPULATIONS IMMIGRÉES en Ile-de-France / Regards sur l immigration / Population 2. Photo : Philippe Desmazes/AFP P opulation Photo : Philippe Desmazes/AFP Près de 40 % des immigrés résidant en métropole vivent en Ile-de-France en 1999. Environ 15 % de la population francilienne est immigrée, c est une proportion

Plus en détail

SERVICES DE SEQUENÇAGE

SERVICES DE SEQUENÇAGE MARCH 16, 2014 SERVICES DE SEQUENÇAGE Centre d innovation Génome Québec et Université McGill Services de Validation et détection de SNP Technologie de Séquençage de Nouvelle Génération Guide de l utilisateur

Plus en détail

Génétique et génomique Pierre Martin

Génétique et génomique Pierre Martin Génétique et génomique Pierre Martin Principe de la sélections Repérage des animaux intéressants X Accouplements Programmés Sélection des meilleurs mâles pour la diffusion Index diffusés Indexation simultanée

Plus en détail

Chapitre 3. Les distributions à deux variables

Chapitre 3. Les distributions à deux variables Chapitre 3. Les distributions à deux variables Jean-François Coeurjolly http://www-ljk.imag.fr/membres/jean-francois.coeurjolly/ Laboratoire Jean Kuntzmann (LJK), Grenoble University 1 Distributions conditionnelles

Plus en détail

Item 169 : Évaluation thérapeutique et niveau de preuve

Item 169 : Évaluation thérapeutique et niveau de preuve Item 169 : Évaluation thérapeutique et niveau de preuve COFER, Collège Français des Enseignants en Rhumatologie Date de création du document 2010-2011 Table des matières ENC :...3 SPECIFIQUE :...3 I Différentes

Plus en détail

CHAPITRE 3 LA SYNTHESE DES PROTEINES

CHAPITRE 3 LA SYNTHESE DES PROTEINES CHAITRE 3 LA SYNTHESE DES ROTEINES On sait qu un gène détient dans sa séquence nucléotidique, l information permettant la synthèse d un polypeptide. Ce dernier caractérisé par sa séquence d acides aminés

Plus en détail

Biochimie I. Extraction et quantification de l hexokinase dans Saccharomyces cerevisiae 1. Assistants : Tatjana Schwabe Marcy Taylor Gisèle Dewhurst

Biochimie I. Extraction et quantification de l hexokinase dans Saccharomyces cerevisiae 1. Assistants : Tatjana Schwabe Marcy Taylor Gisèle Dewhurst Biochimie I Extraction et quantification de l hexokinase dans Saccharomyces cerevisiae 1 Daniel Abegg Sarah Bayat Alexandra Belfanti Assistants : Tatjana Schwabe Marcy Taylor Gisèle Dewhurst Laboratoire

Plus en détail

TABLE DES MATIÈRES. PRINCIPES D EXPÉRIMENTATION Planification des expériences et analyse de leurs résultats. Pierre Dagnelie

TABLE DES MATIÈRES. PRINCIPES D EXPÉRIMENTATION Planification des expériences et analyse de leurs résultats. Pierre Dagnelie PRINCIPES D EXPÉRIMENTATION Planification des expériences et analyse de leurs résultats Pierre Dagnelie TABLE DES MATIÈRES 2012 Presses agronomiques de Gembloux pressesagro.gembloux@ulg.ac.be www.pressesagro.be

Plus en détail

AGRÉGATION DE SCIENCES DE LA VIE - SCIENCES DE LA TERRE ET DE L UNIVERS

AGRÉGATION DE SCIENCES DE LA VIE - SCIENCES DE LA TERRE ET DE L UNIVERS AGRÉGATION DE SCIENCES DE LA VIE - SCIENCES DE LA TERRE ET DE L UNIVERS CONCOURS EXTERNE ÉPREUVES D ADMISSION session 2010 TRAVAUX PRATIQUES DE CONTRE-OPTION DU SECTEUR A CANDIDATS DES SECTEURS B ET C

Plus en détail

L indice de SEN, outil de mesure de l équité des systèmes éducatifs. Une comparaison à l échelle européenne

L indice de SEN, outil de mesure de l équité des systèmes éducatifs. Une comparaison à l échelle européenne L indice de SEN, outil de mesure de l équité des systèmes éducatifs. Une comparaison à l échelle européenne Sophie Morlaix To cite this version: Sophie Morlaix. L indice de SEN, outil de mesure de l équité

Plus en détail

UFR de Sciences Economiques Année 2008-2009 TESTS PARAMÉTRIQUES

UFR de Sciences Economiques Année 2008-2009 TESTS PARAMÉTRIQUES Université Paris 13 Cours de Statistiques et Econométrie I UFR de Sciences Economiques Année 2008-2009 Licence de Sciences Economiques L3 Premier semestre TESTS PARAMÉTRIQUES Remarque: les exercices 2,

Plus en détail

Normes internationales pour les mesures phytosanitaires (NIMPs)

Normes internationales pour les mesures phytosanitaires (NIMPs) 105 Annexe 3 Normes internationales pour les mesures phytosanitaires (NIMPs) On trouvera ci-après une description succincte des NIMP adoptées. Le texte intégral des NIMP peut être consulté sur le Site

Plus en détail

Les usagers de drogues âgés de 40 ans et plus pris en charge dans les structures de soins pour leurs problèmes d addiction

Les usagers de drogues âgés de 40 ans et plus pris en charge dans les structures de soins pour leurs problèmes d addiction Les usagers de drogues âgés de 40 ans et plus pris en charge dans les structures de soins pour leurs problèmes d addiction OFDT Note n 2010-12 Saint-Denis, le 09/08/2010 Introduction Les premières structures

Plus en détail

Bases de données des mutations

Bases de données des mutations Bases de données des mutations CFMDB CFTR2 CFTR-France / Registre Corinne THEZE, Corinne BAREIL Laboratoire de génétique moléculaire Montpellier Atelier Muco, Lille, 25-27 septembre 2014 Accès libre http://www.genet.sickkids.on.ca/app

Plus en détail

UNIVERSITE D ANTANANARIVO FACULTE DES SCIENCES DEPARTEMENT DE BIOLOGIE ET ECOLOGIE VEGETALES

UNIVERSITE D ANTANANARIVO FACULTE DES SCIENCES DEPARTEMENT DE BIOLOGIE ET ECOLOGIE VEGETALES UNIVERSITE D ANTANANARIVO FACULTE DES SCIENCES DEPARTEMENT DE BIOLOGIE ET ECOLOGIE VEGETALES Mémoire pour l obtention de Diplôme d Etudes Approfondies (D.E.A.) en Biologie et Ecologie Végétales Option

Plus en détail

Régionalisation des régimes de perturbations et implications pour l aménagement dans un contexte de changement climatique

Régionalisation des régimes de perturbations et implications pour l aménagement dans un contexte de changement climatique Régionalisation des régimes de perturbations et implications pour l aménagement dans un contexte de changement climatique Sylvie Gauthier, Chercheuse scientifique, successions forestières RNCan-SCF-CFL

Plus en détail

Conception d un CD interactif : simulation d une sortie en écologie végétale

Conception d un CD interactif : simulation d une sortie en écologie végétale Conception d un CD interactif : simulation d une sortie en écologie végétale A. El Ghorfi *, M. Boulanouar *, M. Cheggour*, N. Zahid ** * Département de biologie, ENS Marrakech ** Département d informatique,

Plus en détail

Notice d utilisation M5-01-002. Epigenomics AG, 10178 Berlin, Allemangne

Notice d utilisation M5-01-002. Epigenomics AG, 10178 Berlin, Allemangne Notice d utilisation Avant d utiliser ce kit, veuillez lire attentivement la notice et suivre scrupuleusement les instructions afin de garantir la fiabilité et la pertinence des résultats des tests. IFU

Plus en détail

EVALUATION DE LA QUALITE DES SONDAGES EN LIGNE : CAS D UN SONDAGE D OPINION AU BURKINA FASO

EVALUATION DE LA QUALITE DES SONDAGES EN LIGNE : CAS D UN SONDAGE D OPINION AU BURKINA FASO EVALUATION DE LA QUALITE DES SONDAGES EN LIGNE : CAS D UN SONDAGE D OPINION AU BURKINA FASO Auteur Baguinébié Bazongo 1 Ingénieur Statisticien Economiste Chef de l Unité de recherche à l Institut national

Plus en détail

Format de l avis d efficience

Format de l avis d efficience AVIS D EFFICIENCE Format de l avis d efficience Juillet 2013 Commission évaluation économique et de santé publique Ce document est téléchargeable sur www.has-sante.fr Haute Autorité de santé Service documentation

Plus en détail

Les simulations dans l enseignement des sondages Avec le logiciel GENESIS sous SAS et la bibliothèque Sondages sous R

Les simulations dans l enseignement des sondages Avec le logiciel GENESIS sous SAS et la bibliothèque Sondages sous R Les simulations dans l enseignement des sondages Avec le logiciel GENESIS sous SAS et la bibliothèque Sondages sous R Yves Aragon, David Haziza & Anne Ruiz-Gazen GREMAQ, UMR CNRS 5604, Université des Sciences

Plus en détail

Mise en place d un réseau d Arboretums pour une valorisation coordonnée des ressources ligneuses ex situ

Mise en place d un réseau d Arboretums pour une valorisation coordonnée des ressources ligneuses ex situ ENGREF. Mise en place d un réseau d Arboretums pour une valorisation coordonnée des ressources ligneuses ex situ Stéphanie BRACHET Chargée des missions scientifiques ENGREF - Arboretum national des Barres

Plus en détail

Les hommes sont des obsédés, les femmes sont vénales (nous l avons mesuré)

Les hommes sont des obsédés, les femmes sont vénales (nous l avons mesuré) MIRATECH FRANCE CONCEPT7 PAYS BAS EYEFACT DANEMARK CHECON PESQUISA BRESIL BUNNYFOOT ANGLETERRE UNIVERSITAT POMPEU FABRA ESPAGNE CUSTOMER EXPERIENCE LABS ETATS-UNIS Les hommes sont des obsédés, les femmes

Plus en détail

Comparaison des enjeux énergétiques de la France et de l Allemagne

Comparaison des enjeux énergétiques de la France et de l Allemagne Comparaison des enjeux énergétiques de la France et de l Allemagne Dans la perspective de la première conférence franco-allemande sur l énergie qui se tiendra le 2 juillet prochain à Paris 1, il paraît

Plus en détail

Au-delà du coalescent : quels modèles pour expliquer la di

Au-delà du coalescent : quels modèles pour expliquer la di Au-delà du coalescent : quels modèles pour expliquer la diversité génétique? LPMA, Université Paris 6, CMAP Polytechnique 13 octobre 2009 A partir de travaux conjoints avec N. Berestycki, V. Limic, J.

Plus en détail

M. F. PITA Departamento de Geografía Física. Universidad de Sevilla. C/ María de Padilla s.n. 41.002-SEVILLA (Espagne). mfpita@cica.

M. F. PITA Departamento de Geografía Física. Universidad de Sevilla. C/ María de Padilla s.n. 41.002-SEVILLA (Espagne). mfpita@cica. Un nouvel indice de sécheresse pour les domaines méditerranéens. Application au bassin du Guadalquivir (sudo-uest de l Espagne). En: Un nouvel indice de sécheresse pour les domaines méditerranéens. Application

Plus en détail

Les exploitations de grandes cultures face à la variabilité de leurs revenus : quels outils de gestion des risques pour pérenniser les structures?

Les exploitations de grandes cultures face à la variabilité de leurs revenus : quels outils de gestion des risques pour pérenniser les structures? Les exploitations de grandes cultures face à la variabilité de leurs revenus : quels outils de gestion des risques pour pérenniser les structures? Benoît Pagès 1, Valérie Leveau 1 1 ARVALIS Institut du

Plus en détail

FAITS SAILLANTS : 1. CONDITIONS CLIMATIQUES ET ENVIRONNEMENTALES EN AFRIQUE

FAITS SAILLANTS : 1. CONDITIONS CLIMATIQUES ET ENVIRONNEMENTALES EN AFRIQUE African Centre of Meteorological Application for Development Centre Africain pour les Applications de la Météorologie au Développement N 5, Mai 2015 FAITS SAILLANTS : Les zones favorables à une vigilance

Plus en détail

La classification automatique de données quantitatives

La classification automatique de données quantitatives La classification automatique de données quantitatives 1 Introduction Parmi les méthodes de statistique exploratoire multidimensionnelle, dont l objectif est d extraire d une masse de données des informations

Plus en détail

Simulation d application des règles CNAV AGIRC ARRCO sur des carrières type de fonctionnaires d Etat

Simulation d application des règles CNAV AGIRC ARRCO sur des carrières type de fonctionnaires d Etat CONSEIL D ORIENTATION DES RETRAITES Séance plénière du 10 avril 2014 à 9 h 30 «Carrières salariales et retraites dans les secteurs et public» Document N 9 Document de travail, n engage pas le Conseil Simulation

Plus en détail

Exercices de génétique classique partie II

Exercices de génétique classique partie II Exercices de génétique classique partie II 1. L idiotie phénylpyruvique est une maladie héréditaire dont sont atteints plusieurs membres d une famille, dont voici l arbre généalogique : 3 4 5 6 7 8 9 10

Plus en détail

Rapport Scientifique Seine-Aval 3

Rapport Scientifique Seine-Aval 3 Rapport Scientifique Seine-Aval 3 Séminaire Seine-Aval 2008 Fiches de synthèse des propositions SA4 THEME 3 : TABLEAU DE BORD ET INDICATEURS OPERATIONNELS PUCES A ADN CHEZ MYTILUS EDULIS - 2005 - Danger

Plus en détail

Chapitre 3 : Principe des tests statistiques d hypothèse. José LABARERE

Chapitre 3 : Principe des tests statistiques d hypothèse. José LABARERE UE4 : Biostatistiques Chapitre 3 : Principe des tests statistiques d hypothèse José LABARERE Année universitaire 2010/2011 Université Joseph Fourier de Grenoble - Tous droits réservés. Plan I. Introduction

Plus en détail

Mesures et incertitudes

Mesures et incertitudes En physique et en chimie, toute grandeur, mesurée ou calculée, est entachée d erreur, ce qui ne l empêche pas d être exploitée pour prendre des décisions. Aujourd hui, la notion d erreur a son vocabulaire

Plus en détail

INF6304 Interfaces Intelligentes

INF6304 Interfaces Intelligentes INF6304 Interfaces Intelligentes filtres collaboratifs 1/42 INF6304 Interfaces Intelligentes Systèmes de recommandations, Approches filtres collaboratifs Michel C. Desmarais Génie informatique et génie

Plus en détail

Résonance Magnétique Nucléaire : RMN

Résonance Magnétique Nucléaire : RMN 21 Résonance Magnétique Nucléaire : RMN Salle de TP de Génie Analytique Ce document résume les principaux aspects de la RMN nécessaires à la réalisation des TP de Génie Analytique de 2ème année d IUT de

Plus en détail

ÉVALUATION DE L UTILISABILITÉ D UN SITE WEB : TESTS D UTILISABILITÉ VERSUS ÉVALUATION HEURISTIQUE

ÉVALUATION DE L UTILISABILITÉ D UN SITE WEB : TESTS D UTILISABILITÉ VERSUS ÉVALUATION HEURISTIQUE ÉVALUATION DE L UTILISABILITÉ D UN SITE WEB : TESTS D UTILISABILITÉ VERSUS ÉVALUATION HEURISTIQUE BOUTIN MARIO Centre de recherche informatique de Montréal (CRIM), 550, rue Sherbrooke Ouest, Bureau 100,

Plus en détail

Relation entre deux variables : estimation de la corrélation linéaire

Relation entre deux variables : estimation de la corrélation linéaire CHAPITRE 3 Relation entre deux variables : estimation de la corrélation linéaire Parmi les analyses statistiques descriptives, l une d entre elles est particulièrement utilisée pour mettre en évidence

Plus en détail

CBBC Canadian Business & Biodiversity Council

CBBC Canadian Business & Biodiversity Council CBBC Canadian Business & Biodiversity Council Centre de la Science de la Biodiversité du Québec 72 chercheurs et 350 étudiants en thèse distribués sur un réseau de 8 partenaires universitaires et 2 institutions.

Plus en détail

CAC, DAX ou DJ : lequel choisir?

CAC, DAX ou DJ : lequel choisir? CAC, DAX ou DJ : lequel choisir? 1. Pourquoi cette question Tout trader «travaillant 1» sur les indices s est, à un moment ou un autre, posé cette question : «je sais que la tendance est bien haussière

Plus en détail

SEQUENÇAGE LI-COR DNA 4200

SEQUENÇAGE LI-COR DNA 4200 SEQUENÇAGE LI-COR DNA 4200 Le gel de séquence contient 64 puits au maximum soit 16 clones traités en parallèle. Les oligos utilisés (modifiés en 5 ) fluorescent à 700/800 nm. Une amorce permet de séquencer

Plus en détail

Tableau 1 : Structure du tableau des données individuelles. INDIV B i1 1 i2 2 i3 2 i4 1 i5 2 i6 2 i7 1 i8 1

Tableau 1 : Structure du tableau des données individuelles. INDIV B i1 1 i2 2 i3 2 i4 1 i5 2 i6 2 i7 1 i8 1 UN GROUPE D INDIVIDUS Un groupe d individus décrit par une variable qualitative binaire DÉCRIT PAR UNE VARIABLE QUALITATIVE BINAIRE ANALYSER UN SOUS-GROUPE COMPARER UN SOUS-GROUPE À UNE RÉFÉRENCE Mots-clés

Plus en détail

CAPTEURS - CHAINES DE MESURES

CAPTEURS - CHAINES DE MESURES CAPTEURS - CHAINES DE MESURES Pierre BONNET Pierre Bonnet Master GSI - Capteurs Chaînes de Mesures 1 Plan du Cours Propriétés générales des capteurs Notion de mesure Notion de capteur: principes, classes,

Plus en détail

SUIVI CINETIQUE PAR SPECTROPHOTOMETRIE (CORRECTION)

SUIVI CINETIQUE PAR SPECTROPHOTOMETRIE (CORRECTION) Terminale S CHIMIE TP n 2b (correction) 1 SUIVI CINETIQUE PAR SPECTROPHOTOMETRIE (CORRECTION) Objectifs : Déterminer l évolution de la vitesse de réaction par une méthode physique. Relier l absorbance

Plus en détail

données en connaissance et en actions?

données en connaissance et en actions? 1 Partie 2 : Présentation de la plateforme SPSS Modeler : Comment transformer vos données en connaissance et en actions? SPSS Modeler : l atelier de data mining Large gamme de techniques d analyse (algorithmes)

Plus en détail

Brest (29) Lessay (50), 12-13 Mars 2012

Brest (29) Lessay (50), 12-13 Mars 2012 Conclusions Projet Aquamanche Aquatic management of catchments for health and environment Gestion des eaux des bassin versants pour la santé et l environnement Brest (29) Lessay (50), 12-13 Mars 2012 Les

Plus en détail

Focus. Lien entre rémunération du travail et allocation de chômage

Focus. Lien entre rémunération du travail et allocation de chômage Focus Lien entre rémunération du travail et allocation de chômage Introduction Le travailleur qui devient chômeur et qui est admissible sur base de prestations de travail se voit, en application du principe

Plus en détail

Séquence 6. Mais ces espèces pour autant ne sont pas identiques et parfois d ailleurs ne se ressemblent pas vraiment.

Séquence 6. Mais ces espèces pour autant ne sont pas identiques et parfois d ailleurs ne se ressemblent pas vraiment. Sommaire Séquence 6 Nous avons vu dans les séances précédentes qu au cours des temps géologiques des espèces différentes se sont succédé, leur apparition et leur disparition étant le résultat de modifications

Plus en détail

Raisonnement probabiliste

Raisonnement probabiliste Plan Raisonnement probabiliste IFT-17587 Concepts avancés pour systèmes intelligents Luc Lamontagne Réseaux bayésiens Inférence dans les réseaux bayésiens Inférence exacte Inférence approximative 1 2 Contexte

Plus en détail

Document d orientation sur les allégations issues d essais de non-infériorité

Document d orientation sur les allégations issues d essais de non-infériorité Document d orientation sur les allégations issues d essais de non-infériorité Février 2013 1 Liste de contrôle des essais de non-infériorité N o Liste de contrôle (les clients peuvent se servir de cette

Plus en détail

LA NOTATION STATISTIQUE DES EMPRUNTEURS OU «SCORING»

LA NOTATION STATISTIQUE DES EMPRUNTEURS OU «SCORING» LA NOTATION STATISTIQUE DES EMPRUNTEURS OU «SCORING» Gilbert Saporta Professeur de Statistique Appliquée Conservatoire National des Arts et Métiers Dans leur quasi totalité, les banques et organismes financiers

Plus en détail

β-galactosidase A.2.1) à 37 C, en tampon phosphate de sodium 0,1 mol/l ph 7 plus 2-mercaptoéthanol 1 mmol/l et MgCl 2 1 mmol/l (tampon P)

β-galactosidase A.2.1) à 37 C, en tampon phosphate de sodium 0,1 mol/l ph 7 plus 2-mercaptoéthanol 1 mmol/l et MgCl 2 1 mmol/l (tampon P) bioch/enzymo/tp-betagal-initiation-michaelis.odt JF Perrin maj sept 2008-sept 2012 page 1/6 Etude de la β-galactosidase de E. Coli : mise en évidence d'un comportement Michaélien lors de l'hydrolyse du

Plus en détail

Les méthodes de luttes : De la protection «systématique» à la Protection Intégrée (P.B.I.)

Les méthodes de luttes : De la protection «systématique» à la Protection Intégrée (P.B.I.) Les méthodes de luttes : De la protection «systématique» à la Protection Intégrée (P.B.I.) Protection Biologique Intégrée Lutte phytosanitaire De la lutte «systématique» à la lutte raisonnée La lutte «systématique»

Plus en détail

Cours (7) de statistiques à distance, élaboré par Zarrouk Fayçal, ISSEP Ksar-Said, 2011-2012 LES STATISTIQUES INFERENTIELLES

Cours (7) de statistiques à distance, élaboré par Zarrouk Fayçal, ISSEP Ksar-Said, 2011-2012 LES STATISTIQUES INFERENTIELLES LES STATISTIQUES INFERENTIELLES (test de Student) L inférence statistique est la partie des statistiques qui, contrairement à la statistique descriptive, ne se contente pas de décrire des observations,

Plus en détail

Collaborations avec la Thaïlande Enseignement, Recherche

Collaborations avec la Thaïlande Enseignement, Recherche Collaborations avec la Thaïlande Enseignement, Recherche (non exhaustif ) Un pays économiquement avancé Un réseau d'universités, des centres de recherche Des structures de coopération en place (CIRAD,

Plus en détail

Introduction au Data-Mining

Introduction au Data-Mining Introduction au Data-Mining Alain Rakotomamonjy - Gilles Gasso. INSA Rouen -Département ASI Laboratoire PSI Introduction au Data-Mining p. 1/25 Data-Mining : Kèkecé? Traduction : Fouille de données. Terme

Plus en détail

2.0 Interprétation des cotes d évaluation des risques relatifs aux produits

2.0 Interprétation des cotes d évaluation des risques relatifs aux produits 2.0 Interprétation des cotes d évaluation des risques relatifs aux produits L interprétation des cotes attribuées dans le cadre des évaluations des risques relatifs aux produits décrite plus loin repose

Plus en détail

Base de données bibliographiques Pubmed-Medline

Base de données bibliographiques Pubmed-Medline Chapitre 1 ; Domaine 1 ; Documentation ; Champs référentiels 1.1.1, 1.1.2 et 1.1.3 Base de données bibliographiques Pubmed-Medline D r Patrick Deschamps,, 30 mai 2007 PLAN C2i métiers de la santé Introduction

Plus en détail

Feuille d exercices 2 : Espaces probabilisés

Feuille d exercices 2 : Espaces probabilisés Feuille d exercices 2 : Espaces probabilisés Cours de Licence 2 Année 07/08 1 Espaces de probabilité Exercice 1.1 (Une inégalité). Montrer que P (A B) min(p (A), P (B)) Exercice 1.2 (Alphabet). On a un

Plus en détail

Comité du développement et de la propriété intellectuelle (CDIP)

Comité du développement et de la propriété intellectuelle (CDIP) F CDIP/12/INF/4 ORIGINAL : ANGLAIS DATE : 3 OCTOBRE 2013 Comité du développement et de la propriété intellectuelle (CDIP) Douzième session Genève, 18 21 novembre 2013 RÉSUMÉ DE L ÉTUDE SUR LA PROPRIÉTÉ

Plus en détail

Thème sélection génétique des plantes hybridation et génie génétique

Thème sélection génétique des plantes hybridation et génie génétique Thème sélection génétique des plantes hybridation et génie génétique Exemple d activité : recenser, extraire et exploiter des informations afin de comprendre les caractéristiques et les limites de la modification

Plus en détail

Cet article s attache tout d abord

Cet article s attache tout d abord Méthodes internationales pour comparer l éducation et l équité Comparaison entre pays des coûts de l éducation : des sources de financement aux dépenses Luc Brière Marguerite Rudolf Bureau du compte de

Plus en détail

Vers une approche Adaptative pour la Découverte et la Composition Dynamique des Services

Vers une approche Adaptative pour la Découverte et la Composition Dynamique des Services 69 Vers une approche Adaptative pour la Découverte et la Composition Dynamique des Services M. Bakhouya, J. Gaber et A. Koukam Laboratoire Systèmes et Transports SeT Université de Technologie de Belfort-Montbéliard

Plus en détail

Le scoring est-il la nouvelle révolution du microcrédit?

Le scoring est-il la nouvelle révolution du microcrédit? Retour au sommaire Le scoring est-il la nouvelle révolution du microcrédit? BIM n 32-01 octobre 2002 Frédéric DE SOUSA-SANTOS Le BIM de cette semaine se propose de vous présenter un ouvrage de Mark Schreiner

Plus en détail

I - CLASSIFICATION DU DIABETE SUCRE

I - CLASSIFICATION DU DIABETE SUCRE I - CLASSIFICATION DU DIABETE SUCRE 1- Définition : Le diabète sucré se définit par une élévation anormale et chronique de la glycémie. Cette anomalie est commune à tous les types de diabète sucré, mais

Plus en détail

APPENDIX 6 BONUS RING FORMAT

APPENDIX 6 BONUS RING FORMAT #4 EN FRANÇAIS CI-DESSOUS Preamble and Justification This motion is being presented to the membership as an alternative format for clubs to use to encourage increased entries, both in areas where the exhibitor

Plus en détail

CHAPITRE 2. Population, ménages et familles

CHAPITRE 2. Population, ménages et familles CHAPITRE 2 Population, ménages et familles Les faits saillants Enquête sur les conditions de vie en Haïti Distribution spatiale, structure par âge et par sexe de la population Le taux d urbanisation de

Plus en détail

Modélisation géostatistique des débits le long des cours d eau.

Modélisation géostatistique des débits le long des cours d eau. Modélisation géostatistique des débits le long des cours d eau. C. Bernard-Michel (actuellement à ) & C. de Fouquet MISTIS, INRIA Rhône-Alpes. 655 avenue de l Europe, 38334 SAINT ISMIER Cedex. Ecole des

Plus en détail

Une espèce exotique envahissante: Le Roseau commun. ou Phragmites australis

Une espèce exotique envahissante: Le Roseau commun. ou Phragmites australis Une espèce exotique envahissante: Le Roseau commun ou Phragmites australis Indigène vs exotique Il y a deux sous-espèces de Phragmites australis, L indigène: n envahit pas le milieu, cohabite avec les

Plus en détail

PLAN D ACTION DE SANTÉ DENTAIRE PUBLIQUE 2005 2015. Bilan régional des activités 2012 2013

PLAN D ACTION DE SANTÉ DENTAIRE PUBLIQUE 2005 2015. Bilan régional des activités 2012 2013 PLAN D ACTION DE SANTÉ DENTAIRE PUBLIQUE 2005 2015 Bilan régional des activités 2012 2013 PLAN D ACTION DE SANTÉ DENTAIRE PUBLIQUE 2005 2015 Bilan régional des activités 2012 2013 est une production

Plus en détail

TECHNIQUES: Principes de la chromatographie

TECHNIQUES: Principes de la chromatographie TECHNIQUES: Principes de la chromatographie 1 Définition La chromatographie est une méthode physique de séparation basée sur les différentes affinités d un ou plusieurs composés à l égard de deux phases

Plus en détail

La cohabitation des races ovines Ouled Jellal (OJ) et Beni Guil (BG) et développement de l'élevage ovin dans le système pastoral du Maroc Oriental

La cohabitation des races ovines Ouled Jellal (OJ) et Beni Guil (BG) et développement de l'élevage ovin dans le système pastoral du Maroc Oriental Mediterranean biodiversity as a tool for the sustainable development of the small ruminant sector: From traditional knowledge to innovation Institut Agronomique et Vétérinaire Hassan II Rabat, 16 décembre

Plus en détail

Comment se servir de cet ouvrage? Chaque chapitre présente une étape de la méthodologie

Comment se servir de cet ouvrage? Chaque chapitre présente une étape de la méthodologie Partie I : Séries statistiques descriptives univariées (SSDU) A Introduction Comment se servir de cet ouvrage? Chaque chapitre présente une étape de la méthodologie et tous sont organisés selon le même

Plus en détail

altona altona RealStar CMV PCR Kit 1.0 always a drop ahead. 04/2015 altona Diagnostics GmbH Mörkenstr. 12 22767 Hamburg Germany

altona altona RealStar CMV PCR Kit 1.0 always a drop ahead. 04/2015 altona Diagnostics GmbH Mörkenstr. 12 22767 Hamburg Germany altona DIAGNOSTICS altona DIAGNOSTICS RealStar CMV PCR Kit 1.0 04/2015 altona Diagnostics GmbH Mörkenstr. 12 22767 Hamburg Germany phone +49 40 548 06 76-0 fax +49 40 548 06 76-10 e-mail info@altona-diagnostics.com

Plus en détail

CONCOURS D ENTREE A L ECOLE DE 2007 CONCOURS EXTERNE. Cinquième épreuve d admissibilité STATISTIQUE. (durée : cinq heures)

CONCOURS D ENTREE A L ECOLE DE 2007 CONCOURS EXTERNE. Cinquième épreuve d admissibilité STATISTIQUE. (durée : cinq heures) CONCOURS D ENTREE A L ECOLE DE 2007 CONCOURS EXTERNE Cinquième épreuve d admissibilité STATISTIQUE (durée : cinq heures) Une composition portant sur la statistique. SUJET Cette épreuve est composée d un

Plus en détail

Perrothon Sandrine UV Visible. Spectrophotométrie d'absorption moléculaire Étude et dosage de la vitamine B 6

Perrothon Sandrine UV Visible. Spectrophotométrie d'absorption moléculaire Étude et dosage de la vitamine B 6 Spectrophotométrie d'absorption moléculaire Étude et dosage de la vitamine B 6 1 1.But et théorie: Le but de cette expérience est de comprendre l'intérêt de la spectrophotométrie d'absorption moléculaire

Plus en détail

Structuration des décisions de jurisprudence basée sur une ontologie juridique en langue arabe

Structuration des décisions de jurisprudence basée sur une ontologie juridique en langue arabe Structuration des décisions de jurisprudence basée sur une ontologie juridique en langue arabe Karima Dhouib, Sylvie Després Faiez Gargouri ISET - Sfax Tunisie, BP : 88A Elbustan ; Sfax karima.dhouib@isets.rnu.tn,

Plus en détail

t 100. = 8 ; le pourcentage de réduction est : 8 % 1 t Le pourcentage d'évolution (appelé aussi taux d'évolution) est le nombre :

t 100. = 8 ; le pourcentage de réduction est : 8 % 1 t Le pourcentage d'évolution (appelé aussi taux d'évolution) est le nombre : Terminale STSS 2 012 2 013 Pourcentages Synthèse 1) Définition : Calculer t % d'un nombre, c'est multiplier ce nombre par t 100. 2) Exemples de calcul : a) Calcul d un pourcentage : Un article coûtant

Plus en détail

RESERVES DE BIODIVERSITE POUR SEPT TERRITOIRES ET DE RESERVE AQUATIQUE POUR UN TERRITOIRE DANS LA REGION ADMINISTRATIVE DE L ABITIBI-TEMISCAMINGUE

RESERVES DE BIODIVERSITE POUR SEPT TERRITOIRES ET DE RESERVE AQUATIQUE POUR UN TERRITOIRE DANS LA REGION ADMINISTRATIVE DE L ABITIBI-TEMISCAMINGUE MÉMOIRE DEPOSE AU BUREAU D AUDIENCES PUBLIQUES SUR L ENVIRONNEMENT (BAPE) DANS LE CADRE DES AUDIENCES PUBLIQUES POUR LES PROJETS DE RESERVES DE BIODIVERSITE POUR SEPT TERRITOIRES ET DE RESERVE AQUATIQUE

Plus en détail

*-*-*-*-*-*-*-*-*-*-*-*-*-*-*-*-*-*-*-*-*-*

*-*-*-*-*-*-*-*-*-*-*-*-*-*-*-*-*-*-*-*-*-* Note détaillée Baromètre européen du rapport aux paiements Des pratiques uniformisées en Europe? Sondage Harris Interactive pour Crédit Agricole Cards & Payments Enquête réalisée en ligne du 19 au 29 septembre

Plus en détail

ÉVALUATION DU TYPE DE DOMMAGE CAUSÉ PAR LA PUNAISE PENTATOMIDE VERTE, ACROSTERNUM HILARE (SAY) SELON LE DÉVELOPPEMENT DES FRUITS

ÉVALUATION DU TYPE DE DOMMAGE CAUSÉ PAR LA PUNAISE PENTATOMIDE VERTE, ACROSTERNUM HILARE (SAY) SELON LE DÉVELOPPEMENT DES FRUITS ÉVALUATION DU TYPE DE DOMMAGE CAUSÉ PAR LA PUNAISE PENTATOMIDE VERTE, ACROSTERNUM HILARE (SAY) SELON LE DÉVELOPPEMENT DES FRUITS CAROLINE PROVOST, MANON LAROCHE, MAUD LEMAY LES OBJECTIFS Objectif principal:

Plus en détail

Réunion du réseau de génétique du Département EFPA

Réunion du réseau de génétique du Département EFPA 17 19 novembre 2014 Centre INRA de Nancy Lorraine Programme Lundi 17 novembre Salle Tilleul 13:00 Bus pour l'inra depuis la gare de Nancy 14:00 14:30 Introduction de la réunion tour de table 14:30 14:45

Plus en détail

Filtrage stochastique non linéaire par la théorie de représentation des martingales

Filtrage stochastique non linéaire par la théorie de représentation des martingales Filtrage stochastique non linéaire par la théorie de représentation des martingales Adriana Climescu-Haulica Laboratoire de Modélisation et Calcul Institut d Informatique et Mathématiques Appliquées de

Plus en détail

TD de Biochimie 4 : Coloration.

TD de Biochimie 4 : Coloration. TD de Biochimie 4 : Coloration. Synthèse de l expérience 2 Les questions posées durant l expérience 2 Exposé sur les méthodes de coloration des molécules : Générique Spécifique Autres Questions Pourquoi

Plus en détail

Observation des modalités et performances d'accès à Internet

Observation des modalités et performances d'accès à Internet Observation des modalités et performances d'accès à Internet Avant-propos La base de cette étude est constituée par les informations collectées par l'outil Cloud Observer d'iplabel (chargement des différents

Plus en détail

EXERCICE 2 : SUIVI CINETIQUE D UNE TRANSFORMATION PAR SPECTROPHOTOMETRIE (6 points)

EXERCICE 2 : SUIVI CINETIQUE D UNE TRANSFORMATION PAR SPECTROPHOTOMETRIE (6 points) BAC S 2011 LIBAN http://labolycee.org EXERCICE 2 : SUIVI CINETIQUE D UNE TRANSFORMATION PAR SPECTROPHOTOMETRIE (6 points) Les parties A et B sont indépendantes. A : Étude du fonctionnement d un spectrophotomètre

Plus en détail

METHODOLOGIE GENERALE DE LA RECHERCHE EPIDEMIOLOGIQUE : LES ENQUETES EPIDEMIOLOGIQUES

METHODOLOGIE GENERALE DE LA RECHERCHE EPIDEMIOLOGIQUE : LES ENQUETES EPIDEMIOLOGIQUES Enseignement du Deuxième Cycle des Etudes Médicales Faculté de Médecine de Toulouse Purpan et Toulouse Rangueil Module I «Apprentissage de l exercice médical» Coordonnateurs Pr Alain Grand Pr Daniel Rougé

Plus en détail

à la Consommation dans le monde à fin 2012

à la Consommation dans le monde à fin 2012 Le Crédit à la Consommation dans le monde à fin 2012 Introduction Pour la 5 ème année consécutive, le Panorama du Crédit Conso de Crédit Agricole Consumer Finance publie son étude annuelle sur l état du

Plus en détail