Master 2 Recherche Biologie Géosciences Agroressources Environnement Parcours Biodiversité Écologie Évolution Dounia SALEH

Dimension: px
Commencer à balayer dès la page:

Download "Master 2 Recherche Biologie Géosciences Agroressources Environnement Parcours Biodiversité Écologie Évolution 2008. Dounia SALEH"

Transcription

1 UNIVERSITÉ MONTPELLIER II SCIENCES ET TECHNIQUES DU LANGUEDOC CENTRE INTERNATIONAL D ÉTUDES SUPÉRIEURES EN SCIENCES AGRONOMIQUES - MONTPELLIER Master 2 Recherche Biologie Géosciences Agroressources Environnement Parcours Biodiversité Écologie Évolution 2008 Dounia SALEH Structuration génétique des populations de l aleurode Bemisia tabaci : Importance du biotype, de l origine géographique et de la plante-hôte chez un complexe d espèces phytophages. Stage principal effectué dans le laboratoire Centre de Biologie et de Gestion des Populations (CBGP) Sous la direction de Nathalie Gauthier et Jacques Fargues. Soutenu les 12 et 13 juin 2008 devant la commission d'examen. Membres du jury signataires du PV d examen : Michel. Raymond (Président), Marie-Laure Navas (Représentant SupAgro), Stephan Hättenschwiller et Emmanuel Douzery (Directeurs des études).

2 UNIVERSITE MONTPELLIER II SCIENCES ET TECHNIQUES DU LANGUEDOC CENTRE INTERNATIONAL D ÉTUDES SUPÉRIEURES EN SCIENCES AGRONOMIQUES - MONTPELLIER Master 2 Recherche Biologie Géosciences Agroressources Environnement Parcours Biolodiversité Écologie Évolution 2008 Dounia SALEH Structuration génétique des populations de l aleurode Bemisia tabaci : Importance du biotype, de l origine géographique et de la plante-hôte chez un complexe d espèces phytophages. Soutenu les 12 et 13 juin 2008 devant la commission d'examen. 1

3 Résumé Bemisia tabaci (Gennadius) (Homoptera : Aleyrodidae) est un insecte phytophage généraliste. Il fait partie des 100 pires espèces envahissantes au monde et c est un bioagresseur de plantes cultivées et ornementales. Il est défini par des populations de races-hôtes identiques morphologiquement mais très différentes d un point de vue génétique et écologique en rapport avec leur plantes-hôtes. Cette différenciation en biotypes le place au statut de complexe d espèces. Cette étude a eu pour but d analyser la structuration des populations de B. tabaci dans deux pays du Bassin méditerranéen, la Tunisie et la Grèce (en Crète). L étude a porté sur 24 échantillons, soit 703 individus collectés sur trois plantes-hôtes différentes : la tomate et l aubergine (Solanaceae) et le Lantana camara (Verbenaceae). Deux approches complémentaires ont été réalisées : une approche de génétique des populations basée sur 9 loci microsatellites et une approche phylogénétique basée sur le marqueur mitochondrial Cytochrome Oxydase I (COI). L étude a révélé une forte structuration des individus en deux populations génétiques bien différenciées correspondant aux deux biotypes B et Q. L origine géographique est aussi un facteur de différenciation des populations de B. tabaci. Les deux marqueurs ont montré la partition du biotype Q en deux sous-populations génétiques distinctes liées à l origine géographique. En revanche, la plante-hôte n est pas un facteur important de structuration dans chaque pays. Cependant, la répartition des biotypes sur les différentes plantes-hôtes n est pas la même dans les deux pays. D autre part, les individus collectés sur L. camara appartiennent principalement au biotype minoritaire dans chaque pays. Mots-clés : ADNmt, Bemisia tabaci, biotypes B et Q, complexe d espèces, génétique des populations, marqueurs microsatellites, phylogéographie, plante-hôte. Abstract: Bemisia tabaci (Gennadius) (Homoptera: Aleyrodidae) is a generalist phytophagous insect. It is one of the 100 of the world s worst invasive species and is a pest of cultivated and ornamental plants. It is divided into host-races that are morphologically identical but are genetically and ecologically different with respect to their host plants. This differentiation into biotypes leads to define its status as species complex. The aim of this study was to analyse B. tabaci population structure in two countries of the Mediterranean Basin, Tunisia and Greece (Crete). This study has been based on 24 samples, that is 703 individuals, collected from three host plants: tomato and eggplant (Solanaceae) and Lantana camara (Verbenaceae). Two complementary approaches have been used: a population genetics approach based on 9 microsatellites loci and a phylogenetical approach based on the Cytochrom Oxydase I (COI) marker. The study has revealed a strong structure with two distinct genetic populations that correspond to the two biotypes B and Q. Geographical origin is also a differentiation factor for B. tabaci populations. The two markers have shown a partition of biotype Q into two distinct genetic sub-populations, in relation with their geographical origins. On the other hand, host plant is not an important differentiation factor in each country. However the distribution of biotypes on different host plants is not the same depending on the country. It was also observed that individuals collected on L. camara mostly belong to the less frequent biotype in each country. Keywords: Bemisia tabaci, biotypes B and Q, host plant, microsatellite markers, mtdna, phylogeography, population genetics, species complex. 2

4 SOMMAIRE INTRODUCTION 1 Un insecte phytophage envahissant : Bemisia tabaci 1 Complexe d espèce : biotypes et diversité génétique 2 Situation dans le Bassin méditerranéen 3 Objectifs et approches utilisées 3 MATERIEL ET METHODES 5 I. Echantillonnage 5 II. Analyses de l ADN 5 1. Extraction de l ADN 5 2. Analyse de l ADN nucléaire 5 3. Analyse de l ADN mitochondrial : Cytochrome Oxydase I (COI) 6 III. Analyses génétiques 7 1. Les marqueurs microsatellites 7 2. Le marqueur mitochondrial : COI 10 RESULTATS 12 I. Les loci microsatellites 12 II. Structure des populations : nombre de populations génétiques 12 III. Identité des populations génétiques : détermination du biotype 13 IV. Répartition spatiale et par la plante-hôte des biotypes 15 V. Diversité génétique et différenciation entre les biotypes, les pays, les plantes-hôtes 15 VI. Diversité génétique des haplotypes et reconstruction phylogénétique 16 DISCUSSION 19 Structuration des populations Répartition des biotypes : importance de la compétition 22 Diversité et relations génétiques 23 Diagnostique moléculaire chez un complexe d espèces 25 Conclusion et perspectives 26 3

5 INTRODUCTION Le nombre d espèces envahissantes augmente chaque année et leurs impacts sur les écosystèmes naturels, la biodiversité notamment par le déplacement voire l exclusion des espèces locales et l homogénéisation des flores et des faunes et sur les êtres vivants sont de plus en plus importants (Lockwood et al., 2007). L extension des aires de répartition de ces espèces exotiques est favorisée par plusieurs facteurs, parmi lesquels les changements climatiques globaux et les activités humaines joueraient un rôle majeur. Faire face aux invasions de ces organismes est d autant plus difficile qu il existe un grand nombre d espèces cryptiques. Ce sont des populations génétiques avec des flux de gènes séparés, répondant donc au concept biologique d espèce, mais qui ne sont pas distinguables d un point de vue morphologique (Davis, 1996). Ainsi, la diversité d espèces invasives et leurs impacts sur les écosystèmes naturels et cultivés sont souvent sous-estimés. En particulier, un certain nombre d études sur des insectes parasites et phytophages montrent que des espèces que l on pensait généralistes sont en fait des complexes d espèces spécialistes (Hebert et al., 2004). L approche génétique pour la détection de ces espèces, pour l étude de leur dynamique à diverses échelles spatiales et de leur structure génétique dans les différents environnements occupés, constitue un élément nécessaire pour la compréhension des schémas d invasion et des conséquences sur les populations naturelles, mais aussi sur les populations de plantes cultivées. UN INSECTE PHYTOPHAGE ENVAHISSANT BIO-AGRESSEUR : BEMISIA TABACI Parmi les insectes phytophages à forte capacité d invasion figure l aleurode Bemisia tabaci (Homoptera : Aleyrodidae). C est un insecte piqueur-suceur de sève élaborée (Annexe 1), extrêmement polyphage pouvant se nourrir sur plus de 900 plantes-hôtes sauvages et cultivées dans les zones tropicales, subtropicales et méditerranéennes (Perring, 2001). B. tabaci, espèce d origine tropicale, probablement d Afrique du Sud-Est (Boykin et al., 2007) est dorénavant présente sur tous les continents excepté l Antarctique (Figure 1). Cette espèce opportuniste et thermophyle aurait bénéficié, surtout ces vingt dernières années, de l intensification des échanges commerciaux et probablement de certains épisodes de réchauffement climatique pour étendre son aire de répartition. Une fois établie, cette espèce se répand rapidement. Du fait de sa polyphagie, de son haut potentiel de transmission de phytovirus (vecteur de plus de 110 phytovirus) et de sa capacité à développer des résistances 4

6 aux insecticides, elle a récemment été classée parmi les «100 pires espèces invasives de bioagresseurs au monde» [Union Internationale pour la Conservation de la Nature et des Ressources Naturelles_ IUCN. L aleurode a été décrit pour la première fois en Grèce en 1889 où il a été appelé Aleyrodes tabaci, puis indépendamment sur tous les continents où lui ont été attribuées des dénominations différentes. Toutes ces espèces ont été par la suite regroupées sous le même nom d espèce de Bemisia tabaci (Tableau 1). Les concepts de races-hôtes ou biotypes ont été introduits dans les années 50 pour décrire ces différentes populations qui ne sont pas différenciables morphologiquement mais qui ont des traits biologiques différents en relations avec leurs hôtes, comme la gamme de plante-hôtes utilisées, l adaptabilité aux plantes-hôtes ou encore la transmission de phytovirus (Brown et al., 1995b ; Claridge et al., 1997). COMPLEXE D ESPECES : BIOTYPES ET DIVERSITE GENETIQUE L importante diversité génétique de B. tabaci, la complexité des interactions entre les biotypes, leurs faibles capacités à s hybrider et les flux de gènes limités entre eux (Dalmon et al., 2007) tendent à montrer que B. tabaci constituerait un complexe d espèces (Perring, 2001) Les études récentes s appliquent donc à développer des outils diagnostics, en particulier des outils moléculaires de plus en plus fiables, pour déterminer le biotype. Actuellement, 41 populations de B. tabaci ont été étudiées parmi lesquelles 24 ont été définies comme biotypes et 17 n ont pas encore reçu d assignations. Ces biotypes sont principalement désignés par une lettre allant de A à T mais certains ont une dénomination spécifique comme par exemple le biotype ZHJ1 endémique de Chine (Liu et al., 2007). Sur ces 24 biotypes, 20 ont d abord été identifiés à l aide de profils allozymes estérases (Brown et al., 1995a ; Costa & Brown, 1991 ; Perring, 2001). Ces dix dernières années, les RAPD-PCR 1 (Guirao et al., 1997 ; Horowitz et al., 2003 ; Moya et al., 2001), les RFLP 2 (Abdullahi et al., 2003), les AFLP 3 (Cervera et al., 2000), et les microsatellites (Simón et al., 2007 ; De Barro et al., 2003 ; Dalmon et al., 2007) sont devenus des outils de détermination de biotype et de caractérisation du niveau de variabilité génétique des populations et des biotypes de B. tabaci (De Barro et al., 2005 ; Brown, 2007 ; Tsagkarakou et al., 2007 ; Chu et al., 2008) 1 Random Amplified Polymorphic DNA-Polymerase Chain Reaction 2 Restriction Fragment Length Polymorphisms 3 Amplified Fragment Length Polymorphisms 5

7 SITUATION DANS LE BASSIN MEDITERRANEEN La présence de B. tabaci dans le Bassin méditerranéen est connue depuis longtemps (Gerling, 1996). Tout d abord reconnu comme bio-agresseur dans la partie Est du Bassin méditerranéen (Israël, Turquie, Egypte), les recensements se sont étendus vers l Ouest (Algérie, Italie, Espagne, France) (Perring 2001). B. tabaci a été identifié pour la première fois en Espagne dans les années quarante hors serres et en France en 1989 en serres. Le sud de la France représente la limite nord de répartition hors serres de B. tabaci en Europe. Cette limite passe par l Espagne, l Italie, la Croatie, l Albanie et la Grèce (Dalmon et al., 2007). Au moins cinq biotypes ont été recensés dans le Bassin méditerranéen mais les biotypes B et Q sont les plus envahissants (Simón et al., 2007). La première épidémie de phytovirus transmis par B. tabaci dans le Bassin méditerranéen a été attribuée au biotype B, reconnu pour son fort potentiel à transmettre des Begomovirus, notamment le TYLCV (Tomato Yellow Leaf Curl Virus). Le biotype Q, moins bon vecteur de virus phytopathogènes mais caractérisé par un fort potentiel de développement de résistance aux insecticides (Wilson et al., 2007), a été décrit plus tard. Il est par la suite devenu le seul biotype détecté en Espagne (Simón et al., 2007), en France (Dalmon et al., 2007), et en Grèce (Tsagkarakou et al., 2007). L expansion du biotype Q en Méditerranée et son origine géographique sont encore mal connus (Simón et al., 2007) mais il aurait pour aire de répartition initiale l ouest du bassin méditerranéen à l Egypte alors que le biotype B serait originaire de la région s étendant du Moyen-Orient à l Asie Mineure. OBJECTIFS ET APPROCHES UTILISEES Dans le Bassin méditerranéen, il peut exister des situations contrastées : certaines régions ne présentent qu un seul biotype et dans d autres, plusieurs biotypes peuvent être détectés. Peu d information existe sur les flux de gènes entre biotypes à différentes échelles spatiales et sur ce qui détermine ces situations. Dans ce contexte, le premier objectif a consisté à mieux caractériser ces biotypes et comprendre leur prévalence et relations. Nous avons donc étudié deux pays reflétant a priori ces situations : la présence des biotypes B et Q au sein d un même pays, la Tunisie (Chermiti et al., 1997), et la présence du seul biotype Q, en Grèce (Tsagkarakou et al., 2007). Un large échantillonnage d individus représentant : (i) deux régions très maraîchères au nord-est et au sud de la Tunisie, (ii) deux régions maraîchères et une zone urbaine en Crète, a été collecté sur trois plantes-hôtes. Il s agit de deux espèces cultivées annuelles de la famille des Solanacées, la tomate (Solanum lycopersicum) et l aubergine (Solanum 6

8 melongena), et une plante ornementale pérenne de la famille des Verbénacées, Lantana camara, trouvée à l état sauvage ou cultivé auprès des habitations. Le second objectif a consisté à évaluer la diversité et la structuration génétique des populations de Tunisie et de Crète en fonction de trois facteurs potentiellement structurant : le biotype, l origine géographique et la plante-hôte. Cette étude a permis d estimer les niveaux de différenciation et les flux de gènes à diverses échelles spatiales. Elle a été complétée par l inférence des relations phylogénétiques entre certains individus de ces populations et des individus issus d autres populations d origine méditerranéenne. L étude de tels aspects de diagnostic de biotype, de génétique des populations et de phylogéographie requiert des marqueurs sélectivement neutres, variables et informatifs. Des outils moléculaires déjà reportés dans la littérature, les séquences d un fragment d ADN mitochondrial et des profils de digestions enzymatiques ont été décrits comme fiables dans l identification des biotypes (Fröhlich et al., 1999 ; Horowitz et al., 2005 ; Khasdan et al., 2005 ; Tsagkarakou et al., 2007). La validité d autres marqueurs, des loci microsatellites, a été testée dans cette étude. Les microsatellites sont des marqueurs neutres à évolution rapide qui ont largement contribué à la résolution d études de structuration des populations sur de nombreux organismes dont B. tabaci (Jarne & Lagoda, 1996). Au moins 30 loci microsatellites ont été isolés et caractérisés chez B. tabaci (De Barro et al., 2003 ; Tsagkarakou & Roditakis, 2003 ; Delatte et al., 2005 ; Gauthier et al., 2008). L ADN mitochondrial, dont le Cytochrome Oxydase I (COI), est le marqueur privilégié dans l inférence des relations phylogéographiques (Avise, 2000) et il s est effectivement avéré très informatif chez B. tabaci (Fröhlich et al., 1999). Afin de mieux comprendre ce qui caractérise et contribue à la répartition observée des populations et biotypes de B. tabaci dans des pays méditerranéens représentant des situations très contrastées («coexistence» ou non entre les biotypes B et Q), nous avons, par une approche multilocus, étudié la diversité génétique et l influence de certains facteurs sur la structuration et la différenciation des populations. 7

9 MATERIEL ET METHODES I. ECHANTILLONNAGE Nous avons disposé de 24 échantillons d aleurodes collectés sur deux années, 2006 et 2007, dans deux pays du Bassin méditerranéen, la Tunisie et la Grèce (Tableau 2). Les 18 échantillons tunisiens proviennent de 2 régions maraîchères, le «Sahel» au Nord-Est du pays et la région Kébili au Sud. Les 6 échantillons grecs provenaient de deux zones rurales et d une zone urbaine de Crète (Tableau 2, Figure 2). Chaque échantillon correspondait à un groupe d individus collectés sur plusieurs plantes (pour limiter la collecte d individus apparentés) de la même espèce sur le même site et ces individus ont été conservés dans des tubes à -20 C dans de l alcool à 70%. Les échantillons ont été triés sous loupe afin d éliminer des individus appartenant à l espèce Trialeurodes vaporariorum (trialeurode), une autre espèce de mouche blanche sympatrique difficilement différenciable de B. tabaci à l œil nu. Les individus ont ensuite été sexés sous loupe binoculaire (Annexe 1) et seules les femelles ont été utilisées du fait de leur état diploïde. II. ANALYSES DE L ADN 1. Extraction de l ADN L extraction d ADN génomique des femelles B. tabaci a été réalisée selon un protocole au Nonidet P-40 (Delatte et al., 2005, Annexe 2). 2. Analyse de l ADN nucléaire Les marqueurs microsatellites En tout, 703 individus ont été génotypés avec 10 marqueurs microsatellites dinucléotidiques (TC n ou TG n ) : 9 loci antérieurement décrits par Gauthier et al. (2008) (BtIs1.1, BtIs1.2, BtIs1.9, BtIs1.11, BtIs1.13, BtIs1.14, BtIs1.17, BtIs2.3, BtIs2.4) et un locus non publié (BtIs1.8) (Tableau 3). Amplification par Polymerase Chain Reaction (PCR) Les réactions d amplification de l ADN pour chaque multiplex de loci (Tableau 3) ont été conduites dans un volume réactionnel total de 10µl contenant : 1µl d extrait d ADN non dilué d un individu ( 40ng), 5µl (2X) du tampon de réaction QIAGEN Multiplex PCR Master Mix 8

10 (Tampon 10X, 3mM MgCl 2, Taq, dntps), 0.2µM de chaque amorce F* 4 et R correspondant à un même locus, 3µl d eau ultrapure. Les conditions d amplification ont suivi une procédure de Touchdown (Gauthier et al., 2008) (Annexe 2). Génotypage Pour le génotypage, 2µl de produit de PCR dilué au 1/5 ème a été additionné de 8µl d un marqueur de taille ET-ROX 400 et analysé sur séquenceur automatique 96 capillaires (Megabace 1000 DNA Sequencer de chez Amersham Bioscience). Le logiciel MEGABACE GENETIC PROFILER a été utilisé pour assigner une taille à chaque allèle. La lecture a été faite en double aveugle et les ADN d individus pour lesquels le signal était incertain ou absent ont été repassés. En règle générale, si l incertitude ou le signal n étaient pas résolus au bout du troisième passage, la donnée a été considérée comme manquante. 3. Analyse de l ADN mitochondrial : Cytochrome Oxydase I (COI) L amplification par PCR d un fragment du COI Un fragment d environ 816pb du gène Cytochrome Oxydase I mitochondrial a été amplifié selon le protocole décrit par Fröhlich et al. (1999) avec quelques modifications. Les PCR ont été conduites dans un volume réactionnel total de 25µl contenant : 2.5 µl d extrait d ADN non dilué d un individu, 2.5µl (1X) du tampon d amplification (QIAGEN), 1.5µl de MgCl 2, 1.6µl de DNTPs, 1.3µl de chaque amorce (C1-J-2195, L2-N-3014) 5 (10µM), 0.3µl de Taq Polymerase (QIAGEN), 14.5µl d eau ultrapure. Les conditions d amplification de l ADN sont décrites dans l Annexe 2. La bonne amplification du fragment (bande unique d environ 800pb en référence au marqueur SmartLadder 200pb) de chaque produit PCR a été vérifiée par migration de 2 à 3µl d amplicon additionné de 2µl de bleu de charge sur gel d électrophorèse à 1.5% d agarose (tampon TAE 0.5X ; 135V pendant 30 min.). L ADN migré a été révélé sous UV après un passage dans un bain de Bromure d Ethidium (BET). Le fragment amplifié a été utilisé pour le séquençage d une part, et des digestions enzymatiques d autre part. Ces deux analyses ont servi à confirmer le biotype d appartenance des individus et à tester leur proximité phylogénétique avec ceux issus d un jeu de données 4 Amorce marquée en 5 par un fluorochrome soit FAM (bleu), NED (jaune), HEX (vert) 5 Amorces (Fröhlich et al., 1999) C1-J-2195 : TTGATTTTTTGGTCATCCAGAAGT L2-N-3014 : TCCAATGCACTAATCTGCCATATTA 9

11 disponible non publié relatif à des B. tabaci majoritairement collectés dans des pays du Bassin Méditerranéen. Ainsi, le COI de 15 individus grecs et 6 tunisiens parmi les 703 génotypés ont été partiellement séquencés (Tableau 2), ainsi que 8 autres femelles B. tabaci issues d autres sites de Tunisie. Séquençage La quantité d ADN dans les produits de PCR a été quantifiée sur gel d agarose 1.5% (TAE 0.5X) en comparaison avec le marqueur Phage λ (Sigma). Seuls les produits PCR de concentration au moins égale à 10ng/µl ont été séquencés (sens 5 3 ) par la Société Cogenics (Grenoble) sur séquenceur automatique (ABI3730XL). Digestion enzymatique : PCR-RFLP (Restriction Fragment Lenght Polymorphism) Par digestion du COI en des sites spécifiques, les enzymes de restriction VspI (Horowitz et al., 2005 ; Khasdan et al., 2005), TaqI (Bosco et al., 2006) et AluI (Tsagkarakou et al., 2007) permettent la distinction entre les Biotypes B et Q. AluI permet en plus la distinction de deux sous-biotypes du biotype Q : Q et Q. Ainsi, de façon à compléter l information «biotypage» manquante ou contradictoire apportée par les loci microsatellites et corroborer l aspect diagnostic de certains loci microsatellites, le biotype d une centaine d individus a été caractérisé par RFLP. La procédure expérimentale suivie est décrite dans l Annexe 2. Chaque digestion enzymatique a eu lieu en thermocycleur (MJ Research, Eppendorf). Les 15µl de la digestion additionnés de 5µl de bleu de charge ont été déposés sur gels d agarose 3% (TAE 0.5X). Les produits séparés par électrophorèse (100V pendant 1h30) ont ensuite été révélés sous UV après un passage dans un bain de Bromure d Ethidium. Leur taille a été estimée en référence à 2 marqueurs de taille [PCR Low Ladder Marker Set (bandes toutes les 20pb et 100pb) et/ou Smart Ladder 200pb] et comparée aux profils RFLP de la littérature (Annexe 3). III. ANALYSES GENETIQUES 1. Les marqueurs microsatellites Les loci microsatellites Avant de commencer des analyses génétiques, l indépendance génotypique des loci, l hypothèse d équilibre de Hardy-Weinberg (HWE) et les erreurs de génotypage ou 10

12 de fixation des amorces ont été vérifiés afin de déterminer si certains loci devaient être éliminés de l analyse. Le déséquilibre de liaison génotypique entre chaque paire de loci a été testé par des tests exacts réalisés par le logiciel GENEPOP (Raymond & Rousset, 1995). L hypothèse de panmixie au sein des échantillons a été également testée par les estimations des F IS selon Weir & Cockerham (1984) et des tests exacts de déficit en hétérozygotie observée (H O ) par rapport à l hétérozygotie attendue (H E ) sous Equilibre de Hardy-Weinberg (HWE). La significativité des valeurs observées par rapport à celles attendues a été testée au seuil de 5% sous GENEPOP (Raymond & Rousset, 1995). L écart à l équilibre de Hardy-Weinberg est souvent lié à un déficit en hétérozygotes suite à une structuration génétique au sein de l échantillonnage, un régime de reproduction très fermé ou encore à des erreurs de génotypage. Trois grand types d erreurs de génotypage peuvent affecter les données moléculaires : les plus souvent évoqués sont les allèles nuls 6, les «dropouts» alléliques et les allèles faux 7, les «stutterings» 8 (Pompanon et al., 2005). Le logiciel FreeNA (Chapuis & Estoup, 2007), a été utilisé pour l estimation pour chaque locus et échantillon des fréquences d allèles nuls, erreur la plus souvent rencontrée. D autre part, les paramètres de variabilité génétique tels que le nombre d allèles par locus, la gamme de taille allélique, les hétérozygoties observées et attendues de chaque locus ont été estimés par locus, et par échantillon sur l ensemble de loci. Une première représentation de la répartition génétique globale des individus échantillonnés en fonction d axes factoriels définis par les allèles (Analyse de la Fonction des Correspondances_AFC) a été réalisée à l aide du logiciel GENETIX 4.03 (Belkhir et al., 2001). Assignation des individus à des populations génétiques L estimation de la plupart des paramètres génétiques notamment les F-statistiques s appuie sur la définition préalable de groupes naturels d individus appartenant à la même population génétique. La délimitation de ces populations n est pas forcément reflétée dans la proximité géographique des individus puisque des individus proches géographiquement peuvent correspondre à des populations génétiques différentes et une même population génétique être représentée par des individus à répartition géographique très large. 6 allèle nul. allèle non amplifié à cause d une mutation au niveau du site de fixation de l amorce 7 «dropout» et allèle faux dus à une faible quantité d ADN cible ou amplification préférentielle des allèles de petite taille 8 «stutterings». erreurs d amplication par la Taq au niveau des motifs microsatellites 11

13 Afin de partir sans a priori, une approche multi-locus bayésienne a été utilisée pour déterminer le nombre le plus probable (K) de populations génétiquement différenciées dans l échantillonnage étudié et la probabilité (Q) d assignation de chaque individu à chacune des K populations sur la base de 7 loci microsatellites (3 des 10 loci sont diagnostics du biotype et influenceraient fortement les groupes). Elle a été appliquée par le logiciel STRUCTURE 2.2 (Pritchard et al. 2000) sous les modèles de mixité ou admixture 9 et de fréquences alléliques corrélées. Chaque analyse a consisté en une «phase d allumage» (Burn-in period) de chaînes de Markov Monte Carlo (MCMC) et une phase stationnaire de MCMC. Les estimations du log de vraisemblance, c est-à-dire la probabilité d observer les données sachant le nombre de groupes K [Ln P(D) ou Pr ( X K ) ] ont été calculées pour des valeurs de K allant de 1 à 9 avec 5 répétitions pour chaque afin de tester la reproductibilité des résultats. La meilleure estimation de K est la valeur de K maximale avant le plateau de la courbe représentant Ln P(D) en fonction de K (Pritchard et al. 2000). Ce type d analyse a été refait pour détecter des sous-populations génétiques. Suite à la définition de cette valeur K, la diversité génétique des K (sous)-populations génétiques a été estimée. Différenciation génétique entre les populations, facteurs de différenciation Les valeurs de F ST global, entre les 24 échantillons et entre les populations génétiques définies par le logiciel STRUCTURE ont été estimées à l aide du logiciel GENEPOP selon la formule de Weir & Cockerham (1984). La significativité des valeurs observées a été testée par un Test exact de Fisher (1000 répétitions, P<0.05). La structure et le niveau de différenciation de ces populations ont également été calculés à l aide d Analyses Hiérarchiques de Variance Moléculaire (AMOVA) réalisées par le logiciel ARLEQUIN (Excoffier et al., 2005). Il s agit d une analyse de variance hiérarchique dont les données sont les distances génétiques entre individus et dont les hypothèses sont testées par des tests de permutation. Cette analyse requiert de spécifier des groupes d individus et d assigner chaque individu à une sous-population au sein des groupes. Différents niveaux de structuration ont donc été définis pour tester l importance relative de plusieurs facteurs potentiellement structurant chez B. tabaci, tels que le biotype, l origine géographique et la plante-hôte. L AMOVA décompose la variance totale en 4 composantes : qui sont attribuées aux différences entre les groupes définis (F CT ), entre les populations à l intérieur des groupes définis (F SC ), entre les individus au sein des populations (F IS ) entre les 9 admixture les individus peuvent être assignés à plusieurs populations génétiques s ils proviennent d une hybridation entre individus appartenant à des populations différentes 12

14 individus sur l ensemble des populations (F IT ). L hypothèse nulle du test spécifie que les individus, quel que soit leur groupe ou quel que soit leur «sous-population» au sens de l AMOVA (sens différent de celui de STRUCTURE), appartiennent à une même population génétique et la significativité des hypothèses alternatives a été testée pour toutes les valeurs par 1000 permutations (logiciel ARLEQUIN) (P<0.05). Les effets groupe et sous-population sont supposés additifs, stochastiques et non corrélés. Cette dernière hypothèse n est probablement pas remplie mais l AMOVA fonctionnant sur des tests de permutations, les tests sont assez robustes pour être légitimes. Le test d isolement par la distance, test de Mantel, montrant une éventuelle corrélation entre distance génétique, basée sur la formule F ( ) 1 et distance géographique en log ST F ST (km) des échantillons a été réalisé grâce au logiciel GENEPOP. C est un test exact dont l hypothèse nulle suppose que la pente de régression distance génétique/distance géographique est nulle. Ce test a été réalisé pour 15 échantillons sur les 24 génotypés selon 4 modalités de regroupement : tous les individus typés avec 9 loci (sans le locus BtIs 1.8), tous les individus typés sans les loci diagnostics de biotype (soit 7 loci), les individus de biotype B avec les 9 loci et les individus de biotype Q avec les 9 loci. Finalement, de façon à avoir une estimation des flux de gènes entre les divers sites et planteshôtes, une estimation multiloci du nombre efficace de migrants (Nm) a été faite grâce au logiciel GENEPOP (Raymond & Rousset, 1995). 2. Le marqueur mitochondrial : COI Diversité génétique du COI Chaque séquence obtenue dans les 2 sens a été vérifiée dans l éditeur de séquences BioEdit de façon à créer la séquence consensus correspondante. Les 29 séquences consensus et 34 autres disponibles ont été alignées avec le logiciel CLUSTALW (sous BioEdit) et comparées entre elles. Seules les séquences représentant des haplotypes 10 différents ont ensuite été incluses dans les analyses. Les indices standards de variations génétiques [nombres de sites polymorphes, nombre de sites informatifs et de singletons, diversité haplotypique (Hd)] ont été calculés au moyen du logiciel DNAsp (Rozas et al., 2003). 10 haplotype : une séquence unique 13

15 Identification du biotype L identification du biotype des individus séquencés a été obtenue par comparaison de leur haplotype COI d appartenance avec les séquences disponibles dans GenBank en réalisant un Blast (http://www.ncbi.nlm.nih.gov/blast/blast.cgi). Une identité nucléotidique élevée (% de nucléotides partagés de l ordre de 96%) avec des séquences COI de B. tabaci au biotype déjà déterminé permet d assigner un biotype à quasiment chaque individu. Pour certains des individus génotypés non séquencés, la détermination ou la confirmation de leur biotype a été réalisée par comparaison des 3 profils de digestion (VspI, TaqI, AluI) de leur produit COI amplifié avec les profils PCR-RFLP de référence (individus B. tabaci de biotype connu, Horowitz et al., 2005 ; Khasdan et al., 2005 ; Bosco et al., 2006 ; Tsagkarakou et al., 2007) (Annexe 3). Finalement, compte tenu de l existence de ces 2 méthodes fiables de biotypage, nous avons recherché l éventuelle présence de marqueurs diagnostics parmi nos 10 loci microsatellites par une AFC et une ACM (Analyse des Correspondances Multiples). Reconstructions phylogénétiques La proximité phylogénétique entre les 20 haplotypes tunisiens et grecs de cette étude et des séquences d autres pays du Bassin Méditerranéen (34 Gauthier ; 13 Genbank) (Tableau 4) a été estimée par 3 méthodes : 1) basée sur la distance génétique, ici la distance de Kimura- 2 [Neighbour-Joining (NJ), Saitou & Nei, 1987], 2) basée sur le critère de Maximum de Parcimonie [MP, Fitch, 1971], 3) basée sur le critère de Maximum de Vraisemblance [ML, Felsenstein, 1981). Ces analyses ont été réalisées dans PAUP* (Swofford, 2002). Pour le ML, le logiciel MODELTEST (Posada & Crandall, 1998) a été utilisé pour déterminer le modèle de substitutions de l ADN le plus adapté à notre jeu de données (valeur du critère AIC minimale). Le modèle TIM+G 11 a ainsi été retenu pour la reconstruction des arbres. La robustesse des branches et de ce fait des «groupements» a été évaluée par 500 répétitions de Bootstrap. Les reconstructions ont été enracinées avec des séquences homologues de 2 spécimens de l espèce Bemisia afer (Genbank accession numbers AJ784260, AF418673). 11 TIM + G : Transitional Model plus Gamma (fréquence des bases 0.432, 0.125, 0.246, Ts / Tv = ) 14

16 RESULTATS I. LES LOCI MICROSATELLITES En tout, 703 femelles ont été génotypées avec 9 des 10 loci microsatellites. Le locus BtIs1.8 n a pu être étudié de la même manière que les autres loci puisque, les amorces se fixant sur trois sites différents du génome, les individus pouvaient présenter 4 allèles pour ce seul locus. Cependant les sites de fixation semblant porter une information en termes de structuration génétique, il a été analysé selon une approche statistique différente. Aucun déséquilibre de liaison significatif n a été détecté entre les différents loci sur l ensemble des 24 échantillons (p>0.05) témoignant de l indépendance de l information apportée par chacun. En revanche, certains tests n ont pas pu être réalisés notamment entre les loci BtIs1.1 et BtIs1.14 du fait de la présence d allèles fixés. L hypothèse d HWE n est pas vérifiée pour 6 loci sur les 9 (test exact, P<0.05) car un déficit significatif en hétérozygotes à ces loci a été observé (Tableau 4). Cet excès d homozygotes observés ne semble pas lié à des fréquences très significatives d allèles nuls dans les données génotypiques car sur 216 combinaisons loci x échantillons, 12.5% de fréquences d allèles nuls sont supérieures à 0.20, majoritairement aux loci BtIs1.17 et BtIs1.9. La richesse allélique observée sur l ensemble des 24 échantillons varie de 4 allèles pour le BtIs1.13 à 37 pour le locus BtIs1.2 (Tableau 4). L analyse du polymorphisme pour chaque site d échantillonnage sur l ensemble des 9 loci montre une grande variabilité en termes de richesse allélique (environ 2 à 6 allèles) et d hétérozygoties (0.09<H O <0.45 _ 0.10<H E <0.55) qui ne semble pas être caractéristique d une zone géographique particulière. Chaque site échantillonné présente un déficit significatif d hétérozygotes (test exact U, P<0,05) qui pourrait en partie s expliquer par un régime de reproduction fermé (0.17<F IS <0.61) ou bien encore une sous-structuration des individus au sein de chaque site ou entre certains sites (Tableau 5). L estimation des valeurs de F ST (0.02 à 0.66) et de F IT (0.19 à 0.90) sur l ensemble des 9 loci révèle l existence d une grande variabilité entre les échantillons et sur l ensemble des individus. II. STRUCTURE DES POPULATIONS : NOMBRE DE POPULATIONS GENETIQUES Une AFC en trois dimensions réalisée sous GENETIX a montré la répartition des individus en deux nuages de points clairement distincts avec les échantillons tunisiens sur 15

17 tomate et aubergine et grecs sur L. camara d un côté, et les échantillons tunisiens sur L. camara et grecs sur tomate et aubergine de l autre (Annexe 4). La première analyse Bayésienne réalisée avec le logiciel STRUCTURE pour des valeurs de K allant de 1 à 9 révèle la partition la plus probable de l ensemble des individus en 2 populations génétiques, K1 et K2. En effet, la valeur de Ln P(D) avant le plateau atteint est de 2 (Figure 3, Figure 4). Pour K supérieur à 2, aucun gain de vraisemblance n est noté. La grande majorité des individus a été fortement assignée soit à K1 soit à K2 avec des probabilités Q supérieures à 0.8. Pour des probabilités d assignation comprises entre 0.8 et 0.7, l assignation se fait à la population la plus probable. En dessous de 0.70, compte tenu du type de modèle choisi (admixture), ces individus pourraient être des hybrides. Globalement, la majorité des individus d un même échantillon semble relever de la même population quelle que soit l origine géographique, Tunisie ou Grèce. Des analyses séparées de K1 et K2 sur STRUCTURE pour des valeurs de K allant de 1 à 9, ont révélé une partition de la population génétique K2 en deux sous-groupes K2a et K2b, significativement basés sur l origine géographique des échantillons (Tunisie et Crète) (Figure 5). Aucun sous-groupe génétique n a été mis en évidence pour K1. III. IDENTITE DES POPULATIONS GENETIQUES : DETERMINATION DU BIOTYPE Trois méthodes ont été utilisées pour déterminer le biotype des individus dont 2 utilisées couramment dans la littérature : le séquençage d un fragment COI et les digestions enzymatiques de ce fragment (PCR-RFLP). Une méthode basée sur des tailles d allèles de loci microsatellites diagnostics, BtIs1.2 et BtIs1.9 a été vérifiée ici. Le locus BtIs1.8 a aussi fait l objet d une analyse indépendante pour appuyer les résultats. 1. Loci microsatellites diagnostics Les loci BtIs1.2 et BtIs1.9 faisant partie des 9 loci utilisés pour le génotypage, le biotype des 703 individus a pu être systématiquement identifié par ces loci, sauf pour quelques individus pour lesquels il manquait des données. Ces 2 loci présentent un grand polymorphisme (Tableau 4) en particulier le locus BtIs1.2 qui en présente 37 sur l ensemble des individus. Deux types de patrons de tailles alléliques spécifiques du biotype B ou Q ont 16

18 été identifiés pour chaque locus (Tableau 6) et l assignation d un individu à un biotype s est basée sur ces profils. Quand il y avait contradiction entre les 2 loci, le locus BtIs1.9 a été privilégié du fait d un nombre d allèles moindre et d une lecture plus fiable. Biotype (population génétique) Locus B (K2) Q (K1) BtIs1.2 [ pb] [ pb] BtIs1.9 [ pb] [ pb] Tableau 6 : Gammes des tailles alléliques des loci BtIs1.2 et BtIs1.9 diagnostics du biotype et correspondances avec les biotypes B et Q. Ainsi, les individus de la population génétique K1 ont été identifiés comme appartenant au biotype B et les individus de la population génétique K2 au biotype Q. L identification du biotype sur la base de ces 2 loci s est avérée concordante avec la délimitation stricte des 2 populations génétiques à l exception de 5 individus mal assignés. 13 autres individus n ont pu être assignés ni à un biotype ni à une population génétique. Cela peut provenir soit d erreurs de lecture, soit d hybridation entre les deux biotypes. * Une analyse de la séquence du clone référence du locus Bts1.8 a mis en évidence 3 sites de fixation possibles pour les 12 premières paires de bases de l amorce Forward (Annexe 5). Une AFC sur le premier site de fixation du locus BtIs1.8 a permis de réaliser une typologie des échantillons et une ACM sur les 3 sites de fixation du locus BtIs1.8 a permis de réaliser une typologie des individus concordante avec le biotype et les patrons alléliques observés (Annexe 6). L amorce F se fixe sur le site S1 pour tous les individus. Quand les individus sont homozygotes à ce site, alors il n y pas de fixation au site S2 mais fixation au site S3. Ces individus correspondent au biotype Q. Quand les individus sont hétérozygotes au site S1, alors il y a fixation systématique au site S2. Ces individus correspondent au biotype B. Pour le moment aucune information en termes de biotypes, relative à l état homozygote ou hétérozygote aux sites S2 et S3, n a été identifiée (Tableau 7). Biotype Locus BtIs1.8 B Q Sites de fixation S S1 S2 S3 S1 S2 S3 Génotype(s) observés en S (237239) (255255) (237239) (255257) - _ (237237) (237237) [ ] Homoou Hétérozygote - Tableau 7 : Correspondance entre profils génotypiques du locus BtIs1.8 et les biotypes. 17

19 2. Fiabilité des méthodes diagnostics : Séquençage du COI et PCR-RFLP Seuls 21 individus issus des échantillons de mon étude ont pu être séquencés. La séquence a corroboré les résultats d appartenance des individus à l un ou l autre des biotypes donnée par l analyse sous STRUCTURE (9 loci) et ceux des profils de digestions enzymatiques (Figure 6). IV. REPARTITION SPATIALE ET PAR PLANTE-HOTE DES BIOTYPES L assignation des individus aux biotypes B et Q est très concordante avec une distribution géographique. Les B. tabaci collectés en Tunisie sont à 57.3% de biotype B (42.7% de Q) et ceux de Crète à 84.3% de biotype Q (15.2% de B) (Tableau 8). Au sein du biotype Q, les individus clairement assignés à Q1 par STRUCTURE (avec une probabilité supérieure à 0.70) sont à 80.4% tunisiens, ceux de Q2 à 74.1% crétois (Tableau 9). Globalement, chaque site d échantillonnage est soit de biotype B ou Q. Les individus de biotypes différents ne coexistent pas ou peu en un même site. Les individus de chaque biotype sont globalement présents sur les 3 plantes hôtes mais au sein d un pays les résultats montrent qu en Crète, 100% des individus du biotype minoritaire B sont sur L. camara, et en Tunisie, 74.8% des individus du minoritaire Q sont présents sur L. camara (Tableau 8). V. DIVERSITE GENETIQUE ET DIFFERENCIATION ENTRE LES BIOTYPES, LES PAYS, LES PLANTES-HOTES Les paramètres estimés de nombre d allèles moyen, d hétérozygoties observées et attendues sous hypothèse de HWE sur l ensemble des 9 loci (Tableau 10), et le nombre d allèles par locus (Figure 7) mettent en évidence une diversité génétique significativement plus importante pour le biotype Q que pour le biotype B. La valeur de F ST total entre les 2 biotypes est égale à 0.51 ; elle est de 0.55 entre B et Q1 et 0.63 entre B et Q2. Cela indique une différenciation très significative entre les 2 biotypes avec une estimation du nombre de migrants de 0.13/génération sur l ensemble des individus. Au sein du biotype Q, la valeur de F ST entre Q1 et Q2 est de 0.24 et confirme l existence d au moins 2 groupes génétiques distincts. Les valeurs estimées de F ST tenant non seulement compte de la composante biotype mais aussi origine géographique et plantes-hôtes sont reportées dans le Tableau 11. Trois niveaux de différenciation génétique apparaissent traduits par 3 gammes de valeurs de F ST : 18

20 - F ST > 0.4 : inter biotypes quelles que soient les plantes-hôtes et le pays > F ST >0.4 : intra Q entre les plantes-hôtes de Tunisie et de Crète (pas de biotype Q sur L. Camara en Crète) - F ST < 0.15 : intra B, intra pays quelle que soit la plante-hôte Ces résultats expriment l importance relative des 3 composantes dans la différenciation observée à savoir le biotype, le pays et peut être la plante-hôte. Les AMOVA confirment que la variance moléculaire observée est d abord inter biotypes (38%-48%), inter-individus ( 32%, tous les individus ont quasiment tous des profils alléliques propres) intra biotype Q (19%) ce qui revient à dire inter pays (Q1 majoritairement en Tunisie et Q1 en Crète). En revanche, la plante hôte n explique que 4,32% de la variance moléculaire et ne constitue donc pas un facteur déterminant. Concernant la composante géographique, il y a 3 aspects différents à considérer : l origine (AMOVA), la distance (Test de Mantel) et les migrants (N m ). Les graphes représentant les distances génétiques entre échantillons en fonction de leur distance géographique permettent de visualiser l importance du biotype Les tests de Mantel ne sont pas significatifs puisque les pentes des droites de régression ne sont pas significativement différentes de 0. Il n y pas d isolement par la distance (Annexe 7) Le nombre efficace de migrants estimé par GENEPOP entre la Tunisie et la Crète est de 3,40. Il est inférieur entre biotypes d un même pays (N m =0,40 pour la Crète, N m =0,19 pour la Tunisie) et supérieur entre pays d un même biotype (N m =3,03 pour le biotype B, N m =5.30 pour le biotype Q). Il y a donc plus d échanges entre les individus d un même biotype mais provenant de pays différents, qu entre les individus de biotypes différents mais provenant du même pays. VI. DIVERSITE GENETIQUE DES HAPLOTYPES ET RECONSTRUCTION PHYLOGENETIQUE L alignement entre les 63 séquences partielles du COI a résulté en un fragment commun de 676pb. Les 136 sites variables (77.6% de transitions) ont abouti à la définition de 20 haplotypes (Tableaux 12, 13, Figure 8). Six de ces haplotypes ont été assignés au Biotype B, 13 au Biotype Q et 1 est resté de biotype indéterminé (il présentait 96% d identité nucléotidique avec un biotype inconnu sur GenBank). La majorité des haplotypes (12/20) identifiés sont uniques (1 seul spécimen). Quant aux haplotypes partagés, ils regroupent des séquences de spécimens issus soit de pays différents (H1, H15, ) soit d un même pays (H9 : 12 individus sur les 13 de biotype Q séquencés ; H13 : 7 individus sur les 9 de biotype Q 19

Polymorphismes de l ADN

Polymorphismes de l ADN Introduction Polymorphismes de l ADN Présentation et mise en évidence Recherche de gènes responsables de maladies génétiques : Analyse de pedigrees où la maladie est présente Sur quel chromosome? À quel

Plus en détail

TP de Biochimie Groupe 4 Forestier Michèle 25.05.2010 Fournier Coralie Freyre Christophe Manipulation d ADN

TP de Biochimie Groupe 4 Forestier Michèle 25.05.2010 Fournier Coralie Freyre Christophe Manipulation d ADN MANIPULATION D ADN Clonage du gène «venus» dans des plasmides et expression de celui-ci chez les bactéries E.Coli. Assistants: U. Loizides M. Umebayashi C. Gehin - 1 - 1. Résumé Lors de notre expérience,

Plus en détail

L'ADN mitochondrial a été découvert en 1962 par Margit MK Nass et Sylvan Nass par microscopie électronique.

L'ADN mitochondrial a été découvert en 1962 par Margit MK Nass et Sylvan Nass par microscopie électronique. L L'ADN mitochondrial a été découvert en 1962 par Margit MK Nass et Sylvan Nass par microscopie électronique. Figure 1 Mitochondries observées au microscope électronique à transmission Plus tard, cet ADN

Plus en détail

Les documents présentés dans ce cours sont issus : soit de travaux personnels soit de travaux présentés sur le web Leur utilisation ne doit donner

Les documents présentés dans ce cours sont issus : soit de travaux personnels soit de travaux présentés sur le web Leur utilisation ne doit donner Les documents présentés dans ce cours sont issus : soit de travaux personnels soit de travaux présentés sur le web Leur utilisation ne doit donner lieu à aucune exploitation commerciale D. LOCKER Professeur

Plus en détail

Interprétation des résultats et troubleshooting

Interprétation des résultats et troubleshooting Interprétation des résultats et troubleshooting Le Service de séquençage du Centre d innovation Génome Québec et Université McGill utilise des appareils 3730xl DNA Analyzer d Applied Biosystems. Cette

Plus en détail

Biodiversité, Taxonomie et Barcode moléculaire. Nicolas Puillandre puillandre@mnhn.fr

Biodiversité, Taxonomie et Barcode moléculaire. Nicolas Puillandre puillandre@mnhn.fr Biodiversité, Taxonomie et Barcode moléculaire Nicolas Puillandre puillandre@mnhn.fr Biodiversité : - les écosystèmes - les espèces - les gènes Taxonomie : Description des unités taxonomiques Classification

Plus en détail

Méthodes diagnostiques en génétique moléculaire

Méthodes diagnostiques en génétique moléculaire Méthodes diagnostiques en génétique moléculaire P. Latour Praticien Hospitalier Responsable UF 3427 Neurogénétique Moléculaire Laboratoire de Neurochimie Pr Renaud HCL Centre de Biologie Est DES Neurologie

Plus en détail

10b : La PCR (locus PV92)

10b : La PCR (locus PV92) 10b : La PCR (locus PV92) Cette expérience a été mise en place afin de remplacer le protocole intitulé "PCR (locus D1S80)". L amplification est en effet meilleure et les résultats plus simples à interpréter.

Plus en détail

Barcoding environnemental par séquençage haut débit

Barcoding environnemental par séquençage haut débit Barcoding environnemental par séquençage haut débit Potentiel et limites Jean-François Martin Échantillonnage Spécificités du barcoding environnemental Amplification (PCR) de marqueurs choisis Séquençage

Plus en détail

Approche pratique de la transgénèse :

Approche pratique de la transgénèse : Approche pratique de la transgénèse : Recherche et analyse fine d une modification génétique dans le génome murin octobre 2006 1) 2) 3) 7) 8) 9) 10) 11) 12) 13) 14) Plan / Introduction Extraction et Préparation

Plus en détail

Isolement et Diversité Génétique des Dugongs de Nouvelle Calédonie

Isolement et Diversité Génétique des Dugongs de Nouvelle Calédonie Isolement et Diversité Génétique des Dugongs de Nouvelle Calédonie Rapport final Marc OREMUS, Claire GARRIGUE & Christophe CLEGUER Opération Cétacés B.P. 12 827, 98802 Nouméa, Nouvelle-Calédonie Tél. /

Plus en détail

Cours d introduction à la génétique de la souris Notion de Souche

Cours d introduction à la génétique de la souris Notion de Souche Cours d introduction à la génétique de la souris Notion de Souche Introduction: - Réponse d un animal à l expérimentation (diapo 1) Facteurs environnementaux et propres à l animal - Notion d animal standardisé

Plus en détail

Clonage de Vénus et transformation de E.Coli.

Clonage de Vénus et transformation de E.Coli. Clonage de Vénus et transformation de E.Coli. Samueal Joseph, Romain Laverrière, Elias Laudato, Noé Mage Assisstants : Gisele Dewhurst, Charlotte Gehin, Miwa Umebayashi Résumé [1] L expérience consiste

Plus en détail

I. TOUITOU (Mise ligne 15/10/08 LIPCOM-RM) Faculté de Médecine Montpellier-Nîmes

I. TOUITOU (Mise ligne 15/10/08 LIPCOM-RM) Faculté de Médecine Montpellier-Nîmes er cycle PCEM MI5 Génétique moléculaire et clinique Année Universitaire 008-009 Comment apprécier la composante héréditaire des maladies?. Excès de cas familiaux - Les études familiales - - La plupart

Plus en détail

Mise en place d'un test de génotoxicité sur le gardon Rutilus rutilus introduit dans des lagunes de traitement de lixiviats.

Mise en place d'un test de génotoxicité sur le gardon Rutilus rutilus introduit dans des lagunes de traitement de lixiviats. Mise en place d'un test de génotoxicité sur le gardon Rutilus rutilus introduit dans des lagunes de traitement de lixiviats Ivan Starikov Encadrant: Lotfi Aleya Co-encadrant: Nicolas Capelli UMR CNRS 6249

Plus en détail

Présentation ADN Fishbase. Jolien Bamps

Présentation ADN Fishbase. Jolien Bamps Présentation ADN Fishbase Jolien Bamps Les lois de Mendel et la transmission de l hérédité Gregor Mendel Moine et botaniste hongrois (1822-1884), en charge de maintenir le potager de son monastère Considéré

Plus en détail

TP ENZYMES DE RESTRICTION, OUTILS DE LA BIOLOGIE MOLECULAIRE

TP ENZYMES DE RESTRICTION, OUTILS DE LA BIOLOGIE MOLECULAIRE THÈME : Des débuts de la génétique aux enjeux actuels des biotechnologies Niveau : Spécialité terminale S TP ENZYMES DE RESTRICTION, OUTILS DE LA BIOLOGIE MOLECULAIRE EXTRAIT DU BO: Notions et contenus

Plus en détail

4. Résultats et discussion

4. Résultats et discussion 17 4. Résultats et discussion La signification statistique des gains et des pertes bruts annualisés pondérés de superficie forestière et du changement net de superficie forestière a été testée pour les

Plus en détail

Lettres: A, T, G, C. Mots: à 3 lettres (codons) Phrase: gène (information pour synthétiser une protéine). Ponctuation

Lettres: A, T, G, C. Mots: à 3 lettres (codons) Phrase: gène (information pour synthétiser une protéine). Ponctuation 2- Les molécules d ADN constituent le génome 2-1 La séquence d ADN représente l information génétique Lettres: A, T, G, C Mots: à 3 lettres (codons) Phrase: gène (information pour synthétiser une protéine).

Plus en détail

S 4B0602: Biologie Moléculaire pour les Biotechnologies

S 4B0602: Biologie Moléculaire pour les Biotechnologies S 4B0602: Biologie Moléculaire pour les Biotechnologies 16h TP: Sexage de viande bovine Production d une protéine recombinante, la TAQ ADN Polymérase. 12h CM: Empreintes génétiques Détection d OGM Construction

Plus en détail

Mariane ALLEAUME-BENHARIRA Sylvie ODDOU-MURATORIO François LEFEVRE. Ecologie des forêts méditerranéennes INRA AVIGNON - FRANCE

Mariane ALLEAUME-BENHARIRA Sylvie ODDOU-MURATORIO François LEFEVRE. Ecologie des forêts méditerranéennes INRA AVIGNON - FRANCE MODELISER L IMPACT DES CHANGEMENTS DEMOGRAPHIQUES ET ENVIRONNEMENTAUX SUR L EVOLUTION DES ARBRES Le module Luberon Version 2010 Mariane ALLEAUME-BENHARIRA Sylvie ODDOU-MURATORIO François LEFEVRE Ecologie

Plus en détail

Le séquençage Roche 454

Le séquençage Roche 454 Le séquençage Roche 454 www.454.com Stéphane Fénart, Arnaud Mouchon Roscoff, Avril 2012 Systèmes Genome Sequencers Une stratégie unique en séquençage nouvelle génération Pionniers en séquençage de nouvelle

Plus en détail

Les différentes stratégies de quantification :

Les différentes stratégies de quantification : Les différentes stratégies de quantification : Ce chapitre présente les 2 principales stratégies de quantification relative utilisée classiquement : la méthode des droites standards et celle des Ct. Les

Plus en détail

AP SVT. Exercice 1. Exercice 2. Exercice 3.

AP SVT. Exercice 1. Exercice 2. Exercice 3. Exercice 1. AP SVT On cherche à comprendre le mode de transmission de deux caractères chez la Drosophile, organisme diploïde. Effectuez une analyse génétique pour expliquer les résultats des croisements

Plus en détail

Génotypage par Séquençage (GBS) : Création d une carte génétique haute densité de Tournesol Population INEDI (RILs PSC8 x XRQ)

Génotypage par Séquençage (GBS) : Création d une carte génétique haute densité de Tournesol Population INEDI (RILs PSC8 x XRQ) Génotypage par Séquençage (GBS) : Création d une carte génétique haute densité de Tournesol Population INEDI (RILs PSC8 x XRQ) Baptiste Mayjonade (IE-CDD SUNRISE) Génétique et génomique des réponses aux

Plus en détail

Kit d extraction PicoPure DNA

Kit d extraction PicoPure DNA Directement à la PCR Le kit PicoPure DNA permet une extraction simple et rapide de l ADN génomique prêt à l utilisation en PCR. Extraire et amplifier l ADN dans le même tube, sans phase d extraction organique

Plus en détail

2: Les enzymes de restriction

2: Les enzymes de restriction 2: Les enzymes de restriction Les enzymes de restriction sont des protéines synthétisées par des bactéries pour se protéger des infections de virus (bactériophages). Ces enzymes coupent l ADN viral à des

Plus en détail

LA PCR QUANTITATIVE EN TEMPS REEL OU LA "TAQMAN"

LA PCR QUANTITATIVE EN TEMPS REEL OU LA TAQMAN LA PCR QUANTITATIVE EN TEMPS REEL OU LA "TAQMAN" I- Terminologie Le terme TaqMan est souvent utilisé par abus de langage pour désigner : - la technique de PCR quantitative par détection en temps réel de

Plus en détail

MLVA Streptococcus pneumoniae

MLVA Streptococcus pneumoniae H.I.A. Robert Picqué Bordeaux Laboratoire de Biologie moléculaire Version Internet 2 MLVA Streptococcus pneumoniae 1. DESCRIPTION DES OPERATIONS 1.1 Culture et extraction des ADN NB : prévoir dans la série

Plus en détail

Génie génétique. Définition : Outils nécessaires : Techniques utilisées : Application du génie génétique : - Production de protéines

Génie génétique. Définition : Outils nécessaires : Techniques utilisées : Application du génie génétique : - Production de protéines Génie génétique Définition : Ensemble de méthodes d investigation et d expérimentation sur les gènes. Outils nécessaires : ADN recombinant, enzyme de restriction, vecteur, banque ADNc, sonde nucléique...

Plus en détail

Introduction aux Méthodes de Monte Carlo

Introduction aux Méthodes de Monte Carlo Méthodes de Monte Carlo pour la Modélisation et le Calcul Intensif Applications à la Physique Numérique et à la Biologie Séminaire CIMENT GRID Introduction aux Méthodes de Monte Carlo Olivier François

Plus en détail

TD Révision BIO57. Connaissance et Technique du gène

TD Révision BIO57. Connaissance et Technique du gène TD Révision BIO57 Connaissance et Technique du gène Novembre 2007 Cécile BAUDOT cecile.baudot@medecine.univ-mrs.fr INSERM 910 «Génétique Médicale et Génomique Fonctionnelle» Maladies Neuromusculaires Le

Plus en détail

Méthode automatisée de dosage colorimétrique du dioxyde de soufre total dans les vins

Méthode automatisée de dosage colorimétrique du dioxyde de soufre total dans les vins Méthode automatisée de dosage colorimétrique du dioxyde de soufre total dans les vins Marc DUBERNET* et Françoise GRASSET* Laboratoire DUBERNET - 9, quai d Alsace - 11100 Narbonne France 1. Objet Méthode

Plus en détail

La PCR en temps réel frederic.gevaudant@bordeaux.inra.fr

La PCR en temps réel frederic.gevaudant@bordeaux.inra.fr La PCR en temps réel frederic.gevaudant@bordeaux.inra.fr INRA Centre de recherche de Bordeaux UMR Biologie du Fruit et Pathologie Historique 1985 : Invention par Kary Mullis de la technique de (PCR). 1991

Plus en détail

Étude de la biodiversité fongique à l aide de techniques de pyroséquençage

Étude de la biodiversité fongique à l aide de techniques de pyroséquençage Étude de la biodiversité fongique à l aide de techniques de pyroséquençage Biodiversité fongique Biodiversité: diversité spécifique d une communauté écologique, correspondant au nombre d espèces et à leur

Plus en détail

Chapitre 3 L assortiment indépendant des gènes. Des génotypes supérieurs de cultures telles que le riz ont révolutionné l agriculture.

Chapitre 3 L assortiment indépendant des gènes. Des génotypes supérieurs de cultures telles que le riz ont révolutionné l agriculture. Chapitre 3 L assortiment indépendant des gènes Des génotypes supérieurs de cultures telles que le riz ont révolutionné l agriculture. La variation de deux caractères Croisements monohybrides: entre 2 individus

Plus en détail

Taq'Ozyme Purple Mix MANUEL D UTILISATION

Taq'Ozyme Purple Mix MANUEL D UTILISATION Taq'Ozyme Purple Mix OZYA003-40 - 40 réactions OZYA003-200 - 200 réactions (avec supplément de MgCl 2 ) OZYA003-200XL - 200 réactions (avec supplément de MgCl 2 ) OZYA003-1000 - 1000 réactions (avec supplément

Plus en détail

Deuxième partie. Calcul de fréquences de génotypes multilocus dans des pédigrees complexes XXVII

Deuxième partie. Calcul de fréquences de génotypes multilocus dans des pédigrees complexes XXVII Deuxième partie Calcul de fréquences de génotypes multilocus dans des pédigrees complexes XXVII Présentation Les programmes informatiques MDM et grafgen L analyse de schémas de construction de génotypes

Plus en détail

Licence d Informatique Année 2001-2002 Option: Introduction à la biologie moléculaire. LA P.C.R. Polymerase Chain Reaction

Licence d Informatique Année 2001-2002 Option: Introduction à la biologie moléculaire. LA P.C.R. Polymerase Chain Reaction Licence d Informatique Année 2001-2002 Option: Introduction à la biologie moléculaire LA P.C.R. Polymerase Chain Reaction "chercher une aiguille dans une meule de foin"? Chercher à repérer un gène particulier

Plus en détail

Quentin Rougemont, Guillaume Evanno, Sophie Launey INRA Rennes UMR ESE

Quentin Rougemont, Guillaume Evanno, Sophie Launey INRA Rennes UMR ESE Quentin Rougemont, Guillaume Evanno, Sophie Launey INRA Rennes UMR ESE Rennes Le 19/02/2013 Evolution de l anadromie chez les lamproies Contexte général Objectifs Méthodologie Etats des connaissances Résultats

Plus en détail

ATELIER EPIGENETIQUE

ATELIER EPIGENETIQUE Juin 2012 ATELIER EPIGENETIQUE Utilisation de la Q-PCR pour analyser des données de ChIP ou de MeDIP Emmanuèle Mouchel-Vielh I. La PCR quantitative: principe et généralités II. Interprétation des résultats

Plus en détail

Analyse Chromosomique sur Puce à ADN Applications en Prénatal

Analyse Chromosomique sur Puce à ADN Applications en Prénatal Analyse Chromosomique sur Puce à ADN Applications en Prénatal Véronique Satre, Charles Coutton, Gaëlle Vieville, Françoise Devillard et Florence Amblard Maladies génétiques Anomalies chromosomiques Cytogénétique

Plus en détail

Mise en place du NGS en routine diagnostic - Validation, Organisation, Développements

Mise en place du NGS en routine diagnostic - Validation, Organisation, Développements Mise en place du NGS en routine diagnostic - Validation, Organisation, Développements Atelier sur le Diagnostic Moléculaire de la Mucoviscidose 2014 - Lille Stratégie analytique Préparation library (1,5

Plus en détail

Les co-structures génétiques d un parasite (Schistosoma mansoni) et de ses hôtes (mammifères et. dulçaquicole de Guadeloupe

Les co-structures génétiques d un parasite (Schistosoma mansoni) et de ses hôtes (mammifères et. dulçaquicole de Guadeloupe Les co-structures génétiques d un parasite (Schistosoma mansoni) et de ses hôtes (mammifères et mollusques) dans la mangrove dulçaquicole de Guadeloupe Échelles spatiale, fonctionnelle et coévolutive.

Plus en détail

L AMPLIFICATION GÉNIQUE PAR PCR. (Polymérase Chain Reaction)

L AMPLIFICATION GÉNIQUE PAR PCR. (Polymérase Chain Reaction) L AMPLIFICATION GÉNIQUE PAR PCR (Polymérase Chain Reaction) ATELIER DE FORMATION SUR LE DIAGNOSTIC DE LA FIEVRE APHTEUSE 21 mai 2012 Corinne SAILLEAU Corinne.sailleau@anses.fr Agence Nationale de Sécurité

Plus en détail

Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013

Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013 Sélectionner les propositions exactes Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013 QCM 1 La plupart des techniques de biologie moléculaire repose sur le principe de complémentarité

Plus en détail

10a: La PCR (locus D1S80)

10a: La PCR (locus D1S80) 10a: La PCR (locus D1S80) Pour des raisons techniques, ce protocole n'est plus utilisé. Il a été remplacé par le protocole "PCR locus PV92" ainsi que le nouveau protocole "PCR sensibilité au PTC". Il reste

Plus en détail

Gènes Diffusion - EPIC 2010

Gènes Diffusion - EPIC 2010 Gènes Diffusion - EPIC 2010 1. Contexte. 2. Notion de génétique animale. 3. Profil de l équipe plateforme. 4. Type et gestion des données biologiques. 5. Environnement Matériel et Logiciel. 6. Analyses

Plus en détail

Principales techniques utilisées en génie génétique Ces différentes techniques peuvent également se combiner entre elles. Séquençage de l ADN

Principales techniques utilisées en génie génétique Ces différentes techniques peuvent également se combiner entre elles. Séquençage de l ADN Principales techniques utilisées en génie génétique Ces différentes techniques peuvent également se combiner entre elles Séquençage de l ADN 1- Un brin complémentaire de l ADN à séquencer est fabriqué

Plus en détail

PRINCIPES THEORIQUES DE LA PCRq

PRINCIPES THEORIQUES DE LA PCRq PRINCIPES THEORIQUES DE LA PCRq Ce chapitre aborde les notions présentées rapidement dans l introduction (Ct, droite standard, principes de la quantification). Il détaille les différents formats de fluorescence

Plus en détail

Le laboratoire développe 6 axes d activités :

Le laboratoire développe 6 axes d activités : Le laboratoire développe 6 axes d activités : -Activités analytiques -Activités de développement de méthodes -Activités d appui scientifique et technique pour les tutelles -Activités de recherche -Activités

Plus en détail

PRINCIPALES TECHNIQUES UTILISEES EN GENOMIQUE

PRINCIPALES TECHNIQUES UTILISEES EN GENOMIQUE PRINCIPALES TECHNIQUES UTILISEES EN GENOMIQUE Définitions généralités Quelques chiffres 46 chromosomes 22 paires d autosomes (n=44) 1 paire de gonosomes (n=2) : XX/F et XY/H 300 bandes cytogénétiques =

Plus en détail

Jean-Louis Bergé-Lefranc

Jean-Louis Bergé-Lefranc Apport du séquençage du génome humain à la toxicologie: Toxicogénomique Jean-Louis Bergé-Lefranc QuickTime et un décompresseur TIFF (LZW) sont requis pour visionner cette image. QuickTime et un décompresseur

Plus en détail

Incertitude et variabilité : la nécessité de les intégrer dans les modèles

Incertitude et variabilité : la nécessité de les intégrer dans les modèles Incertitude et variabilité : la nécessité de les intégrer dans les modèles M. L. Delignette-Muller Laboratoire de Biométrie et Biologie Evolutive VetAgro Sup - Université de Lyon - CNRS UMR 5558 24 novembre

Plus en détail

Kits de travaux pratiques. Génétique - Biotechnologie CATALOGUE 2009-2010

Kits de travaux pratiques. Génétique - Biotechnologie CATALOGUE 2009-2010 Kits de travaux pratiques Génétique - Biotechnologie CATALOGUE 2009-2010 L École de l ADN est un centre de formation et d information sur les avancées des sciences biologiques. Sa mission principale consiste

Plus en détail

La PCR en temps réel

La PCR en temps réel La PCR en temps réel Hôpital La Rabta Tunis 6 juin 2013 Dr Sabine Favre-Bonté Maître de Conférences, Université Claude Bernard Lyon 1 UMR CNRS 5557 Ecologie Microbienne Equipe Multi-résistance environnementale

Plus en détail

Chapitre 10 L isolement et la manipulation de gènes. Injection d ADN étranger dans une cellule animale

Chapitre 10 L isolement et la manipulation de gènes. Injection d ADN étranger dans une cellule animale Chapitre 10 L isolement et la manipulation de gènes Injection d ADN étranger dans une cellule animale Comment amplifier un gène d intérêt? Amplification in vivo à l aide du clonage d ADN L ensemble formé

Plus en détail

Plateforme. DArT (Diversity Array Technology) Pierre Mournet

Plateforme. DArT (Diversity Array Technology) Pierre Mournet Plateforme DArT (Diversity Array Technology) Pierre Mournet Lundi 8 avril 203 Pourquoi des DArT? Développement rapide et peu onéreux de marqueurs : Pas d information de séquence nécessaire. Pas de pré-requis

Plus en détail

Modélisation coalescente pour la détection précoce d un cancer

Modélisation coalescente pour la détection précoce d un cancer Modélisation coalescente pour la détection précoce d un cancer Mathieu Emily 27 Novembre 2007 Bioinformatics Research Center - Université d Aarhus Danemark Mathieu Emily Coalescence et cancer 1 Introduction

Plus en détail

PRINCIPES DE BASES DE L ANALYSE DES CHROMOSOMES HUMAINS

PRINCIPES DE BASES DE L ANALYSE DES CHROMOSOMES HUMAINS PRINCIPES DE BASES DE L ANALYSE DES CHROMOSOMES HUMAINS II. Outils CONTEXTE CLINIQUE Jonction entre chromosomique et moléculaire Dr G. Lefort II. TECHNIQUE 1) Le caryotype conventionnel en bandes Nécessite

Plus en détail

Principe des études moléculaires en génétique médicale Méthodes d analyse des microlésions du génome

Principe des études moléculaires en génétique médicale Méthodes d analyse des microlésions du génome Mercredi 23 Octobre LECLERCQ Barbara L2 GM Pr Krahn 10 pages Principe des études moléculaires en génétique médicale Méthodes d analyse des microlésions du génome Plan A. Introduction B. Techniques courantes

Plus en détail

Méthodes et techniques de la biologie du développement

Méthodes et techniques de la biologie du développement Méthodes et techniques de la biologie du développement 1. Etude de l expression des gènes : Détecter les transcrits et les protéines au cours de l ontogenèse l outil anticorps 1.1. La RT-PCR La réaction

Plus en détail

Flux de gènes dans le complexe Beta vulgaris : diversité génétique comparée des betteraves mauvaises herbes et maritimes dans le Nord de la France

Flux de gènes dans le complexe Beta vulgaris : diversité génétique comparée des betteraves mauvaises herbes et maritimes dans le Nord de la France Les Actes du BRG, 4 (2003) 369-379 BRG, 2003 Article original Flux de gènes dans le complexe Beta vulgaris : diversité génétique comparée des betteraves mauvaises herbes et maritimes dans le Nord de la

Plus en détail

Guide d utilisation des kits Perfect Master Mix SYBR Green

Guide d utilisation des kits Perfect Master Mix SYBR Green Guide d utilisation des kits Perfect Master Mix SYBR Green Pour les produits AnyGenes : Cat # PMSX-F2S Cat # PMSX-F4S Cat # PMSX-F8S Cat # PMSX-F12S Cat # PMSX-F24S (* Cat # pour toutes les références

Plus en détail

Maladies communes (multifactorielles)

Maladies communes (multifactorielles) Maladies communes (multifactorielles) Des variations individuelles (polymorphismes) au niveau de certains gènes peuvent prédisposer (ou protéger) à une maladie en interaction avec des facteurs de l environnement

Plus en détail

Annales du Contrôle National de Qualité des Analyses de Biologie Médicale

Annales du Contrôle National de Qualité des Analyses de Biologie Médicale Annales du Contrôle National de Qualité des Analyses de Biologie Médicale ARN du virus de l hépatite C : ARN-VHC ARN-VHC 03VHC1 Novembre 2003 Edité : mars 2006 Annales ARN-VHC 03VHC1 1 / 8 ARN-VHC 03VHC1

Plus en détail

Marc DELPECH. CORATA La Rochelle le 21 mai 2008

Marc DELPECH. CORATA La Rochelle le 21 mai 2008 Marc DELPECH CORATA La Rochelle le 21 mai 2008 En 24 ans les progrès ont été considérables Premières utilisation des techniques de génétique moléculaire en diagnostic : 1984 Une palette de techniques très

Plus en détail

TUTORAT UE spécifiques 2010-2011

TUTORAT UE spécifiques 2010-2011 FACULTE de PHARMACIE TUTORAT UE spécifiques 2010-2011 Méthodes d étude et d analyse du génome Eric Badia, Bernard Carcy Séance préparée par Alexandre Leboucher (ATM²), Astrid Robert (ATP) QCM n 1: Synthèse

Plus en détail

Biostatistiques Biologie- Vétérinaire FUNDP Eric Depiereux, Benoît DeHertogh, Grégoire Vincke

Biostatistiques Biologie- Vétérinaire FUNDP Eric Depiereux, Benoît DeHertogh, Grégoire Vincke www.fundp.ac.be/biostats Module 140 140 ANOVA A UN CRITERE DE CLASSIFICATION FIXE...2 140.1 UTILITE...2 140.2 COMPARAISON DE VARIANCES...2 140.2.1 Calcul de la variance...2 140.2.2 Distributions de référence...3

Plus en détail

GénoToul 2010, Hôtel de Région Midi Pyrénées, Toulouse, 10 décembre 2010

GénoToul 2010, Hôtel de Région Midi Pyrénées, Toulouse, 10 décembre 2010 GénoToul 2010, Hôtel de Région Midi Pyrénées, Toulouse, 10 décembre 2010 Analyse de la diversité moléculaire des régions génomiques de 30 gènes du développement méristématique dans une core collection

Plus en détail

P opulation. ATLAS DES POPULATIONS IMMIGRÉES en Ile-de-France / Regards sur l immigration / Population 2. Photo : Philippe Desmazes/AFP

P opulation. ATLAS DES POPULATIONS IMMIGRÉES en Ile-de-France / Regards sur l immigration / Population 2. Photo : Philippe Desmazes/AFP P opulation Photo : Philippe Desmazes/AFP Près de 40 % des immigrés résidant en métropole vivent en Ile-de-France en 1999. Environ 15 % de la population francilienne est immigrée, c est une proportion

Plus en détail

PERCIMAP. Oreochromis niloticus. Construction d une carte RH à haute densité du génome de Tilapia CNRS UMR 6061

PERCIMAP. Oreochromis niloticus. Construction d une carte RH à haute densité du génome de Tilapia CNRS UMR 6061 PERCIMAP Construction d une carte RH à haute densité du génome de Tilapia Oreochromis niloticus CIRAD UPR20 Aquaculture et gestion des ressources aquatiques, Montpellier H. D Cotta E. Pepey J.F. Baroiller

Plus en détail

Chapitre 2 La diversification du vivant

Chapitre 2 La diversification du vivant Chapitre 2 La diversification du vivant 1 Introduction Méiose et fécondation : sources de diversité Mutations germinales : processus fondamental de diversification génétique, générateur de biodiversité

Plus en détail

Les co-structures génétiques d un parasite (Schistosoma

Les co-structures génétiques d un parasite (Schistosoma Les co-structures génétiques d un parasite (Schistosoma mansoni) et de ses hôtes (rongeurs et mollusques) dans la mangrove dulçaquicole de Guadeloupe : échelles spatiale, fonctionnelle et co-évolutive.

Plus en détail

Explications théoriques

Explications théoriques Explications théoriques L'ADN: Définitions L'ADN (Acide Désoxyribo Nucléique) est la molécule qui est utilisée dans la nature comme support matériel de l'information génétique des êtres vivants, un peu

Plus en détail

Analyse de données longitudinales continues avec applications

Analyse de données longitudinales continues avec applications Université de Liège Département de Mathématique 29 Octobre 2002 Analyse de données longitudinales continues avec applications David MAGIS 1 Programme 1. Introduction 2. Exemples 3. Méthodes simples 4.

Plus en détail

Exercice 1. 1) Identifier les bases présentes dans les structures suivantes : A = adénosine et guanine, B = uracile, C = cytosine, D = thymine

Exercice 1. 1) Identifier les bases présentes dans les structures suivantes : A = adénosine et guanine, B = uracile, C = cytosine, D = thymine Exercice 1 1) Identifier les bases présentes dans les structures suivantes : A = adénosine et guanine, B = uracile, C = cytosine, D = thymine 2) Parmi ces bases, lesquelles : a) contiennent du ribose.

Plus en détail

TEST MMR POUR TUMEURS COLIQUES EN PRATIQUE COURANTE? Karen LEROY Hôpital Henri Mondor, Créteil

TEST MMR POUR TUMEURS COLIQUES EN PRATIQUE COURANTE? Karen LEROY Hôpital Henri Mondor, Créteil TEST MMR POUR TUMEURS COLIQUES EN PRATIQUE COURANTE? Karen LEROY Hôpital Henri Mondor, Créteil 47 Définition du phénotype MSI (MicroSatellite Instability) Environ 15% des cancers colo-rectaux présentent

Plus en détail

«Aix-Marseille Université»

«Aix-Marseille Université» «Aix-Marseille Université» Ecole Doctorale de la Santé et de la Vie Master de Recherche Sciences et Technologie. Mention «Bioinformatique, Biochimie structurale et Génomique» 2012-2013 Base de données

Plus en détail

Génotypage et Séquençage. Pierre Mournet

Génotypage et Séquençage. Pierre Mournet Génotypage et Séquençage Pierre Mournet Plan Séquençage/Génotypage Classique (usat, Sanger) Séquençage NGS (Next Generation Sequencing) Séquenceur Préparation Pré-NGS Exemple 1 NGS Exemple 2 NGS Génotypage

Plus en détail

A- Exploiter des animations pour repérer une mutation et étudier son mécanisme de réparation.

A- Exploiter des animations pour repérer une mutation et étudier son mécanisme de réparation. THEME 1A : Expression, stabilité et variation du patrimoine génétique Chapitre 2 : Variabilité Génétique et Mutation de l ADN TP-3-: Réparation de l ADN, mutations et polyallélisme Les mutations de l ADN

Plus en détail

Les Evolutions techniques. Marc Delpech Laboratoire de Génétique et Biologie moléculaires de l hôpital Cochin

Les Evolutions techniques. Marc Delpech Laboratoire de Génétique et Biologie moléculaires de l hôpital Cochin Les Evolutions techniques Marc Delpech Laboratoire de Génétique et Biologie moléculaires de l hôpital Cochin 1 Les principales étapes de l évolution technologique 1975 Southern blot 1977 Séquençage Sanger

Plus en détail

MEDIAPLANNING & HYBRIDATION APPLIQUE A L INTERNET

MEDIAPLANNING & HYBRIDATION APPLIQUE A L INTERNET MEDIAPLANNING & HYBRIDATION APPLIQUE A L INTERNET MOBILE Gaël Crochet 1 & Gilles Santini 2 1 Médiamétrie, 70 rue Rivay, 92532 Levallois-Perret, France, gcrochet@mediametrie.fr 2 Vintco SARL, 8 rue Jean

Plus en détail

Les communautés de nématodes en tant que bioindicateurs potentiels de la santé des sols urbain

Les communautés de nématodes en tant que bioindicateurs potentiels de la santé des sols urbain Les communautés de nématodes en tant que bioindicateurs potentiels de la santé des sols urbain Rochat Guy* *Laboratoires Biologie du sol et Sol & végétation, Institut de Biologie, Université de Neuchâtel

Plus en détail

P.C.R. POLYMERASE CHAIN REACTION ou AMPLIFICATION PAR POLYMERISATION EN CHAÎNE

P.C.R. POLYMERASE CHAIN REACTION ou AMPLIFICATION PAR POLYMERISATION EN CHAÎNE P.C.R. POLYMERASE CHAIN REACTION ou AMPLIFICATION PAR POLYMERISATION EN CHAÎNE P.C.R.: Méthode rapide d'amplification d'une séquence déterminée d'a.d.n. à partir d'une matrice. Elle permet d'obtenir plusieurs

Plus en détail

Apport de la PCR en temps réel en maladies infectieuses

Apport de la PCR en temps réel en maladies infectieuses Apport de la PCR en temps réel en maladies infectieuses Biologie moléculaire Amplification PCR I. Dénaturation ADN 95 C II. Hybridation t = Tm III. Extension t dépend de la polymérase employée PCR «classique»

Plus en détail

Quelques définitions

Quelques définitions Quelques définitions Sandrine Lagarrigue et Pascale Le Roy 1 Journée Technique SYSAAF La mise en œuvre des outils de la génomique : enjeux pour le SYSAAF et ses adhérents. 03 juin 2015. Rennes Le génome

Plus en détail

Techniques de base de la biologie moléculaire

Techniques de base de la biologie moléculaire Techniques de base de la biologie moléculaire Présenté par : Addoun Hadjer Ait Saadi Taous Plan: Introduction Purification des acides nucléiques 1-extraction à partir de matériels biologiques 2-estimation

Plus en détail

8.3.3 Réactifs. La polymérase catalyse la synthèse de brins complémentaires d ADN.

8.3.3 Réactifs. La polymérase catalyse la synthèse de brins complémentaires d ADN. 8.3.3 Réactifs 1. AD polymérase: La polymérase catalyse la synthèse de brins complémentaires d AD. Des polymérases qui sont résistantes à la chaleur sont utilisées, telles que la Taq polymérase (Thermus

Plus en détail

Introduction à l analyse statistique et bioinformatique des puces à ADN

Introduction à l analyse statistique et bioinformatique des puces à ADN Formation INSERM 10 février 2004 Introduction à l analyse statistique et bioinformatique des puces à ADN Gaëlle Lelandais lelandais@biologie.ens.fr 1 Première Partie Analyse d une puce à ADN : Le recherche

Plus en détail

Les virus dans les aliments : un nouveau défi pour les laboratoires de microbiologie

Les virus dans les aliments : un nouveau défi pour les laboratoires de microbiologie : un nouveau défi pour les laboratoires de microbiologie Véronique ZULIANI, Institut de la Filière Porcine Jean Christophe Augustin, ENVA, ASA Qu est ce qu un virus? Microorganisme de 15 à 40 nm Environ

Plus en détail

Entandrophragma cylindricum (Sprague) Sprague, au sud-est du Cameroun

Entandrophragma cylindricum (Sprague) Sprague, au sud-est du Cameroun Fabien Garcia * Gilles Moynot * Eric Forni ** Marie-Hélène Chevallier * * CIRAD-Forêt TA 10/C Programme forêts naturelles Campus international de Baillarguet 34398 Montpellier Cedex 5 France ** BP 2572

Plus en détail

Obtention de données génétiques à grande échelle

Obtention de données génétiques à grande échelle Obtention de données génétiques à grande échelle Stéphanie FERREIRA Ph.D. Campus de l Institut Pasteur de Lille 1, rue du Professeur Calmette 59000 LILLE Tel : 03 20 87 71 53 Fax : 03 20 87 72 64 contact@genoscreen.fr

Plus en détail

Génotypage par séquençage d une grande population (BCNAM) de sorgho.

Génotypage par séquençage d une grande population (BCNAM) de sorgho. Generation Challenge Programme Research Initiative II : Amélioration de la productivité et de la qualité du grain de sorgho dans les régions soudanosahéliennes. Génotypage par séquençage d une grande population

Plus en détail

Cindy Dallaire, agronome-phytopathologiste Direction de la phytoprotection

Cindy Dallaire, agronome-phytopathologiste Direction de la phytoprotection L UTILISATION DE LA PCR (POLYMERASE CHAIN REACTION), UN TEST DE LABORATOIRE PLUS RAPIDE POUR DÉTECTER ERWINIA TRACHEIPHILA, BACTÉRIE RESPONSABLE DU FLÉTRISSEMENT BACTÉRIEN CHEZ LES CUCURBITACÉES Cindy

Plus en détail

Feuille de TP N 3 : Modèle log-linéaire - Travail guidé. 1 Cancers : modèle log-linéaire à deux facteurs croisés

Feuille de TP N 3 : Modèle log-linéaire - Travail guidé. 1 Cancers : modèle log-linéaire à deux facteurs croisés M1 MLG Année 2012 2013 Feuille de TP N 3 : Modèle log-linéaire - Travail guidé 1 Cancers : modèle log-linéaire à deux facteurs croisés Ce premier exercice reprend l exercice 1 de la feuille de TD n 3.

Plus en détail

Département de biologie Page 1 sur 6

Département de biologie Page 1 sur 6 Département de biologie Page 1 sur 6 TP de Biologie Moléculaire : BIO 36 Marion Benoîst, Keith Dudley, Dominique Charmot Introduction Lors de ce TP vous allez cloner des molécules d ADN. L objectif est

Plus en détail

2: Les enzymes de restriction

2: Les enzymes de restriction 2: Les enzymes de restriction Les enzymes de restriction sont des protéines synthétisées par des bactéries pour se protéger des infections de virus (bactériophages). Ces enzymes coupent l ADN viral à des

Plus en détail

Génie de la biocatalyse et génie des procédés. «Production d enzymes industrielles»

Génie de la biocatalyse et génie des procédés. «Production d enzymes industrielles» Ministère de l Enseignement Supérieur et de la Recherche Scientifique Université Virtuelle de Tunis Génie de la biocatalyse et génie des procédés «Production d enzymes industrielles» Concepteur du cours:

Plus en détail