Master 2 Recherche Biologie Géosciences Agroressources Environnement Parcours Biodiversité Écologie Évolution Dounia SALEH

Dimension: px
Commencer à balayer dès la page:

Download "Master 2 Recherche Biologie Géosciences Agroressources Environnement Parcours Biodiversité Écologie Évolution 2008. Dounia SALEH"

Transcription

1 UNIVERSITÉ MONTPELLIER II SCIENCES ET TECHNIQUES DU LANGUEDOC CENTRE INTERNATIONAL D ÉTUDES SUPÉRIEURES EN SCIENCES AGRONOMIQUES - MONTPELLIER Master 2 Recherche Biologie Géosciences Agroressources Environnement Parcours Biodiversité Écologie Évolution 2008 Dounia SALEH Structuration génétique des populations de l aleurode Bemisia tabaci : Importance du biotype, de l origine géographique et de la plante-hôte chez un complexe d espèces phytophages. Stage principal effectué dans le laboratoire Centre de Biologie et de Gestion des Populations (CBGP) Sous la direction de Nathalie Gauthier et Jacques Fargues. Soutenu les 12 et 13 juin 2008 devant la commission d'examen. Membres du jury signataires du PV d examen : Michel. Raymond (Président), Marie-Laure Navas (Représentant SupAgro), Stephan Hättenschwiller et Emmanuel Douzery (Directeurs des études).

2 UNIVERSITE MONTPELLIER II SCIENCES ET TECHNIQUES DU LANGUEDOC CENTRE INTERNATIONAL D ÉTUDES SUPÉRIEURES EN SCIENCES AGRONOMIQUES - MONTPELLIER Master 2 Recherche Biologie Géosciences Agroressources Environnement Parcours Biolodiversité Écologie Évolution 2008 Dounia SALEH Structuration génétique des populations de l aleurode Bemisia tabaci : Importance du biotype, de l origine géographique et de la plante-hôte chez un complexe d espèces phytophages. Soutenu les 12 et 13 juin 2008 devant la commission d'examen. 1

3 Résumé Bemisia tabaci (Gennadius) (Homoptera : Aleyrodidae) est un insecte phytophage généraliste. Il fait partie des 100 pires espèces envahissantes au monde et c est un bioagresseur de plantes cultivées et ornementales. Il est défini par des populations de races-hôtes identiques morphologiquement mais très différentes d un point de vue génétique et écologique en rapport avec leur plantes-hôtes. Cette différenciation en biotypes le place au statut de complexe d espèces. Cette étude a eu pour but d analyser la structuration des populations de B. tabaci dans deux pays du Bassin méditerranéen, la Tunisie et la Grèce (en Crète). L étude a porté sur 24 échantillons, soit 703 individus collectés sur trois plantes-hôtes différentes : la tomate et l aubergine (Solanaceae) et le Lantana camara (Verbenaceae). Deux approches complémentaires ont été réalisées : une approche de génétique des populations basée sur 9 loci microsatellites et une approche phylogénétique basée sur le marqueur mitochondrial Cytochrome Oxydase I (COI). L étude a révélé une forte structuration des individus en deux populations génétiques bien différenciées correspondant aux deux biotypes B et Q. L origine géographique est aussi un facteur de différenciation des populations de B. tabaci. Les deux marqueurs ont montré la partition du biotype Q en deux sous-populations génétiques distinctes liées à l origine géographique. En revanche, la plante-hôte n est pas un facteur important de structuration dans chaque pays. Cependant, la répartition des biotypes sur les différentes plantes-hôtes n est pas la même dans les deux pays. D autre part, les individus collectés sur L. camara appartiennent principalement au biotype minoritaire dans chaque pays. Mots-clés : ADNmt, Bemisia tabaci, biotypes B et Q, complexe d espèces, génétique des populations, marqueurs microsatellites, phylogéographie, plante-hôte. Abstract: Bemisia tabaci (Gennadius) (Homoptera: Aleyrodidae) is a generalist phytophagous insect. It is one of the 100 of the world s worst invasive species and is a pest of cultivated and ornamental plants. It is divided into host-races that are morphologically identical but are genetically and ecologically different with respect to their host plants. This differentiation into biotypes leads to define its status as species complex. The aim of this study was to analyse B. tabaci population structure in two countries of the Mediterranean Basin, Tunisia and Greece (Crete). This study has been based on 24 samples, that is 703 individuals, collected from three host plants: tomato and eggplant (Solanaceae) and Lantana camara (Verbenaceae). Two complementary approaches have been used: a population genetics approach based on 9 microsatellites loci and a phylogenetical approach based on the Cytochrom Oxydase I (COI) marker. The study has revealed a strong structure with two distinct genetic populations that correspond to the two biotypes B and Q. Geographical origin is also a differentiation factor for B. tabaci populations. The two markers have shown a partition of biotype Q into two distinct genetic sub-populations, in relation with their geographical origins. On the other hand, host plant is not an important differentiation factor in each country. However the distribution of biotypes on different host plants is not the same depending on the country. It was also observed that individuals collected on L. camara mostly belong to the less frequent biotype in each country. Keywords: Bemisia tabaci, biotypes B and Q, host plant, microsatellite markers, mtdna, phylogeography, population genetics, species complex. 2

4 SOMMAIRE INTRODUCTION 1 Un insecte phytophage envahissant : Bemisia tabaci 1 Complexe d espèce : biotypes et diversité génétique 2 Situation dans le Bassin méditerranéen 3 Objectifs et approches utilisées 3 MATERIEL ET METHODES 5 I. Echantillonnage 5 II. Analyses de l ADN 5 1. Extraction de l ADN 5 2. Analyse de l ADN nucléaire 5 3. Analyse de l ADN mitochondrial : Cytochrome Oxydase I (COI) 6 III. Analyses génétiques 7 1. Les marqueurs microsatellites 7 2. Le marqueur mitochondrial : COI 10 RESULTATS 12 I. Les loci microsatellites 12 II. Structure des populations : nombre de populations génétiques 12 III. Identité des populations génétiques : détermination du biotype 13 IV. Répartition spatiale et par la plante-hôte des biotypes 15 V. Diversité génétique et différenciation entre les biotypes, les pays, les plantes-hôtes 15 VI. Diversité génétique des haplotypes et reconstruction phylogénétique 16 DISCUSSION 19 Structuration des populations Répartition des biotypes : importance de la compétition 22 Diversité et relations génétiques 23 Diagnostique moléculaire chez un complexe d espèces 25 Conclusion et perspectives 26 3

5 INTRODUCTION Le nombre d espèces envahissantes augmente chaque année et leurs impacts sur les écosystèmes naturels, la biodiversité notamment par le déplacement voire l exclusion des espèces locales et l homogénéisation des flores et des faunes et sur les êtres vivants sont de plus en plus importants (Lockwood et al., 2007). L extension des aires de répartition de ces espèces exotiques est favorisée par plusieurs facteurs, parmi lesquels les changements climatiques globaux et les activités humaines joueraient un rôle majeur. Faire face aux invasions de ces organismes est d autant plus difficile qu il existe un grand nombre d espèces cryptiques. Ce sont des populations génétiques avec des flux de gènes séparés, répondant donc au concept biologique d espèce, mais qui ne sont pas distinguables d un point de vue morphologique (Davis, 1996). Ainsi, la diversité d espèces invasives et leurs impacts sur les écosystèmes naturels et cultivés sont souvent sous-estimés. En particulier, un certain nombre d études sur des insectes parasites et phytophages montrent que des espèces que l on pensait généralistes sont en fait des complexes d espèces spécialistes (Hebert et al., 2004). L approche génétique pour la détection de ces espèces, pour l étude de leur dynamique à diverses échelles spatiales et de leur structure génétique dans les différents environnements occupés, constitue un élément nécessaire pour la compréhension des schémas d invasion et des conséquences sur les populations naturelles, mais aussi sur les populations de plantes cultivées. UN INSECTE PHYTOPHAGE ENVAHISSANT BIO-AGRESSEUR : BEMISIA TABACI Parmi les insectes phytophages à forte capacité d invasion figure l aleurode Bemisia tabaci (Homoptera : Aleyrodidae). C est un insecte piqueur-suceur de sève élaborée (Annexe 1), extrêmement polyphage pouvant se nourrir sur plus de 900 plantes-hôtes sauvages et cultivées dans les zones tropicales, subtropicales et méditerranéennes (Perring, 2001). B. tabaci, espèce d origine tropicale, probablement d Afrique du Sud-Est (Boykin et al., 2007) est dorénavant présente sur tous les continents excepté l Antarctique (Figure 1). Cette espèce opportuniste et thermophyle aurait bénéficié, surtout ces vingt dernières années, de l intensification des échanges commerciaux et probablement de certains épisodes de réchauffement climatique pour étendre son aire de répartition. Une fois établie, cette espèce se répand rapidement. Du fait de sa polyphagie, de son haut potentiel de transmission de phytovirus (vecteur de plus de 110 phytovirus) et de sa capacité à développer des résistances 4

6 aux insecticides, elle a récemment été classée parmi les «100 pires espèces invasives de bioagresseurs au monde» [Union Internationale pour la Conservation de la Nature et des Ressources Naturelles_ IUCN. L aleurode a été décrit pour la première fois en Grèce en 1889 où il a été appelé Aleyrodes tabaci, puis indépendamment sur tous les continents où lui ont été attribuées des dénominations différentes. Toutes ces espèces ont été par la suite regroupées sous le même nom d espèce de Bemisia tabaci (Tableau 1). Les concepts de races-hôtes ou biotypes ont été introduits dans les années 50 pour décrire ces différentes populations qui ne sont pas différenciables morphologiquement mais qui ont des traits biologiques différents en relations avec leurs hôtes, comme la gamme de plante-hôtes utilisées, l adaptabilité aux plantes-hôtes ou encore la transmission de phytovirus (Brown et al., 1995b ; Claridge et al., 1997). COMPLEXE D ESPECES : BIOTYPES ET DIVERSITE GENETIQUE L importante diversité génétique de B. tabaci, la complexité des interactions entre les biotypes, leurs faibles capacités à s hybrider et les flux de gènes limités entre eux (Dalmon et al., 2007) tendent à montrer que B. tabaci constituerait un complexe d espèces (Perring, 2001) Les études récentes s appliquent donc à développer des outils diagnostics, en particulier des outils moléculaires de plus en plus fiables, pour déterminer le biotype. Actuellement, 41 populations de B. tabaci ont été étudiées parmi lesquelles 24 ont été définies comme biotypes et 17 n ont pas encore reçu d assignations. Ces biotypes sont principalement désignés par une lettre allant de A à T mais certains ont une dénomination spécifique comme par exemple le biotype ZHJ1 endémique de Chine (Liu et al., 2007). Sur ces 24 biotypes, 20 ont d abord été identifiés à l aide de profils allozymes estérases (Brown et al., 1995a ; Costa & Brown, 1991 ; Perring, 2001). Ces dix dernières années, les RAPD-PCR 1 (Guirao et al., 1997 ; Horowitz et al., 2003 ; Moya et al., 2001), les RFLP 2 (Abdullahi et al., 2003), les AFLP 3 (Cervera et al., 2000), et les microsatellites (Simón et al., 2007 ; De Barro et al., 2003 ; Dalmon et al., 2007) sont devenus des outils de détermination de biotype et de caractérisation du niveau de variabilité génétique des populations et des biotypes de B. tabaci (De Barro et al., 2005 ; Brown, 2007 ; Tsagkarakou et al., 2007 ; Chu et al., 2008) 1 Random Amplified Polymorphic DNA-Polymerase Chain Reaction 2 Restriction Fragment Length Polymorphisms 3 Amplified Fragment Length Polymorphisms 5

7 SITUATION DANS LE BASSIN MEDITERRANEEN La présence de B. tabaci dans le Bassin méditerranéen est connue depuis longtemps (Gerling, 1996). Tout d abord reconnu comme bio-agresseur dans la partie Est du Bassin méditerranéen (Israël, Turquie, Egypte), les recensements se sont étendus vers l Ouest (Algérie, Italie, Espagne, France) (Perring 2001). B. tabaci a été identifié pour la première fois en Espagne dans les années quarante hors serres et en France en 1989 en serres. Le sud de la France représente la limite nord de répartition hors serres de B. tabaci en Europe. Cette limite passe par l Espagne, l Italie, la Croatie, l Albanie et la Grèce (Dalmon et al., 2007). Au moins cinq biotypes ont été recensés dans le Bassin méditerranéen mais les biotypes B et Q sont les plus envahissants (Simón et al., 2007). La première épidémie de phytovirus transmis par B. tabaci dans le Bassin méditerranéen a été attribuée au biotype B, reconnu pour son fort potentiel à transmettre des Begomovirus, notamment le TYLCV (Tomato Yellow Leaf Curl Virus). Le biotype Q, moins bon vecteur de virus phytopathogènes mais caractérisé par un fort potentiel de développement de résistance aux insecticides (Wilson et al., 2007), a été décrit plus tard. Il est par la suite devenu le seul biotype détecté en Espagne (Simón et al., 2007), en France (Dalmon et al., 2007), et en Grèce (Tsagkarakou et al., 2007). L expansion du biotype Q en Méditerranée et son origine géographique sont encore mal connus (Simón et al., 2007) mais il aurait pour aire de répartition initiale l ouest du bassin méditerranéen à l Egypte alors que le biotype B serait originaire de la région s étendant du Moyen-Orient à l Asie Mineure. OBJECTIFS ET APPROCHES UTILISEES Dans le Bassin méditerranéen, il peut exister des situations contrastées : certaines régions ne présentent qu un seul biotype et dans d autres, plusieurs biotypes peuvent être détectés. Peu d information existe sur les flux de gènes entre biotypes à différentes échelles spatiales et sur ce qui détermine ces situations. Dans ce contexte, le premier objectif a consisté à mieux caractériser ces biotypes et comprendre leur prévalence et relations. Nous avons donc étudié deux pays reflétant a priori ces situations : la présence des biotypes B et Q au sein d un même pays, la Tunisie (Chermiti et al., 1997), et la présence du seul biotype Q, en Grèce (Tsagkarakou et al., 2007). Un large échantillonnage d individus représentant : (i) deux régions très maraîchères au nord-est et au sud de la Tunisie, (ii) deux régions maraîchères et une zone urbaine en Crète, a été collecté sur trois plantes-hôtes. Il s agit de deux espèces cultivées annuelles de la famille des Solanacées, la tomate (Solanum lycopersicum) et l aubergine (Solanum 6

8 melongena), et une plante ornementale pérenne de la famille des Verbénacées, Lantana camara, trouvée à l état sauvage ou cultivé auprès des habitations. Le second objectif a consisté à évaluer la diversité et la structuration génétique des populations de Tunisie et de Crète en fonction de trois facteurs potentiellement structurant : le biotype, l origine géographique et la plante-hôte. Cette étude a permis d estimer les niveaux de différenciation et les flux de gènes à diverses échelles spatiales. Elle a été complétée par l inférence des relations phylogénétiques entre certains individus de ces populations et des individus issus d autres populations d origine méditerranéenne. L étude de tels aspects de diagnostic de biotype, de génétique des populations et de phylogéographie requiert des marqueurs sélectivement neutres, variables et informatifs. Des outils moléculaires déjà reportés dans la littérature, les séquences d un fragment d ADN mitochondrial et des profils de digestions enzymatiques ont été décrits comme fiables dans l identification des biotypes (Fröhlich et al., 1999 ; Horowitz et al., 2005 ; Khasdan et al., 2005 ; Tsagkarakou et al., 2007). La validité d autres marqueurs, des loci microsatellites, a été testée dans cette étude. Les microsatellites sont des marqueurs neutres à évolution rapide qui ont largement contribué à la résolution d études de structuration des populations sur de nombreux organismes dont B. tabaci (Jarne & Lagoda, 1996). Au moins 30 loci microsatellites ont été isolés et caractérisés chez B. tabaci (De Barro et al., 2003 ; Tsagkarakou & Roditakis, 2003 ; Delatte et al., 2005 ; Gauthier et al., 2008). L ADN mitochondrial, dont le Cytochrome Oxydase I (COI), est le marqueur privilégié dans l inférence des relations phylogéographiques (Avise, 2000) et il s est effectivement avéré très informatif chez B. tabaci (Fröhlich et al., 1999). Afin de mieux comprendre ce qui caractérise et contribue à la répartition observée des populations et biotypes de B. tabaci dans des pays méditerranéens représentant des situations très contrastées («coexistence» ou non entre les biotypes B et Q), nous avons, par une approche multilocus, étudié la diversité génétique et l influence de certains facteurs sur la structuration et la différenciation des populations. 7

9 MATERIEL ET METHODES I. ECHANTILLONNAGE Nous avons disposé de 24 échantillons d aleurodes collectés sur deux années, 2006 et 2007, dans deux pays du Bassin méditerranéen, la Tunisie et la Grèce (Tableau 2). Les 18 échantillons tunisiens proviennent de 2 régions maraîchères, le «Sahel» au Nord-Est du pays et la région Kébili au Sud. Les 6 échantillons grecs provenaient de deux zones rurales et d une zone urbaine de Crète (Tableau 2, Figure 2). Chaque échantillon correspondait à un groupe d individus collectés sur plusieurs plantes (pour limiter la collecte d individus apparentés) de la même espèce sur le même site et ces individus ont été conservés dans des tubes à -20 C dans de l alcool à 70%. Les échantillons ont été triés sous loupe afin d éliminer des individus appartenant à l espèce Trialeurodes vaporariorum (trialeurode), une autre espèce de mouche blanche sympatrique difficilement différenciable de B. tabaci à l œil nu. Les individus ont ensuite été sexés sous loupe binoculaire (Annexe 1) et seules les femelles ont été utilisées du fait de leur état diploïde. II. ANALYSES DE L ADN 1. Extraction de l ADN L extraction d ADN génomique des femelles B. tabaci a été réalisée selon un protocole au Nonidet P-40 (Delatte et al., 2005, Annexe 2). 2. Analyse de l ADN nucléaire Les marqueurs microsatellites En tout, 703 individus ont été génotypés avec 10 marqueurs microsatellites dinucléotidiques (TC n ou TG n ) : 9 loci antérieurement décrits par Gauthier et al. (2008) (BtIs1.1, BtIs1.2, BtIs1.9, BtIs1.11, BtIs1.13, BtIs1.14, BtIs1.17, BtIs2.3, BtIs2.4) et un locus non publié (BtIs1.8) (Tableau 3). Amplification par Polymerase Chain Reaction (PCR) Les réactions d amplification de l ADN pour chaque multiplex de loci (Tableau 3) ont été conduites dans un volume réactionnel total de 10µl contenant : 1µl d extrait d ADN non dilué d un individu ( 40ng), 5µl (2X) du tampon de réaction QIAGEN Multiplex PCR Master Mix 8

10 (Tampon 10X, 3mM MgCl 2, Taq, dntps), 0.2µM de chaque amorce F* 4 et R correspondant à un même locus, 3µl d eau ultrapure. Les conditions d amplification ont suivi une procédure de Touchdown (Gauthier et al., 2008) (Annexe 2). Génotypage Pour le génotypage, 2µl de produit de PCR dilué au 1/5 ème a été additionné de 8µl d un marqueur de taille ET-ROX 400 et analysé sur séquenceur automatique 96 capillaires (Megabace 1000 DNA Sequencer de chez Amersham Bioscience). Le logiciel MEGABACE GENETIC PROFILER a été utilisé pour assigner une taille à chaque allèle. La lecture a été faite en double aveugle et les ADN d individus pour lesquels le signal était incertain ou absent ont été repassés. En règle générale, si l incertitude ou le signal n étaient pas résolus au bout du troisième passage, la donnée a été considérée comme manquante. 3. Analyse de l ADN mitochondrial : Cytochrome Oxydase I (COI) L amplification par PCR d un fragment du COI Un fragment d environ 816pb du gène Cytochrome Oxydase I mitochondrial a été amplifié selon le protocole décrit par Fröhlich et al. (1999) avec quelques modifications. Les PCR ont été conduites dans un volume réactionnel total de 25µl contenant : 2.5 µl d extrait d ADN non dilué d un individu, 2.5µl (1X) du tampon d amplification (QIAGEN), 1.5µl de MgCl 2, 1.6µl de DNTPs, 1.3µl de chaque amorce (C1-J-2195, L2-N-3014) 5 (10µM), 0.3µl de Taq Polymerase (QIAGEN), 14.5µl d eau ultrapure. Les conditions d amplification de l ADN sont décrites dans l Annexe 2. La bonne amplification du fragment (bande unique d environ 800pb en référence au marqueur SmartLadder 200pb) de chaque produit PCR a été vérifiée par migration de 2 à 3µl d amplicon additionné de 2µl de bleu de charge sur gel d électrophorèse à 1.5% d agarose (tampon TAE 0.5X ; 135V pendant 30 min.). L ADN migré a été révélé sous UV après un passage dans un bain de Bromure d Ethidium (BET). Le fragment amplifié a été utilisé pour le séquençage d une part, et des digestions enzymatiques d autre part. Ces deux analyses ont servi à confirmer le biotype d appartenance des individus et à tester leur proximité phylogénétique avec ceux issus d un jeu de données 4 Amorce marquée en 5 par un fluorochrome soit FAM (bleu), NED (jaune), HEX (vert) 5 Amorces (Fröhlich et al., 1999) C1-J-2195 : TTGATTTTTTGGTCATCCAGAAGT L2-N-3014 : TCCAATGCACTAATCTGCCATATTA 9

11 disponible non publié relatif à des B. tabaci majoritairement collectés dans des pays du Bassin Méditerranéen. Ainsi, le COI de 15 individus grecs et 6 tunisiens parmi les 703 génotypés ont été partiellement séquencés (Tableau 2), ainsi que 8 autres femelles B. tabaci issues d autres sites de Tunisie. Séquençage La quantité d ADN dans les produits de PCR a été quantifiée sur gel d agarose 1.5% (TAE 0.5X) en comparaison avec le marqueur Phage λ (Sigma). Seuls les produits PCR de concentration au moins égale à 10ng/µl ont été séquencés (sens 5 3 ) par la Société Cogenics (Grenoble) sur séquenceur automatique (ABI3730XL). Digestion enzymatique : PCR-RFLP (Restriction Fragment Lenght Polymorphism) Par digestion du COI en des sites spécifiques, les enzymes de restriction VspI (Horowitz et al., 2005 ; Khasdan et al., 2005), TaqI (Bosco et al., 2006) et AluI (Tsagkarakou et al., 2007) permettent la distinction entre les Biotypes B et Q. AluI permet en plus la distinction de deux sous-biotypes du biotype Q : Q et Q. Ainsi, de façon à compléter l information «biotypage» manquante ou contradictoire apportée par les loci microsatellites et corroborer l aspect diagnostic de certains loci microsatellites, le biotype d une centaine d individus a été caractérisé par RFLP. La procédure expérimentale suivie est décrite dans l Annexe 2. Chaque digestion enzymatique a eu lieu en thermocycleur (MJ Research, Eppendorf). Les 15µl de la digestion additionnés de 5µl de bleu de charge ont été déposés sur gels d agarose 3% (TAE 0.5X). Les produits séparés par électrophorèse (100V pendant 1h30) ont ensuite été révélés sous UV après un passage dans un bain de Bromure d Ethidium. Leur taille a été estimée en référence à 2 marqueurs de taille [PCR Low Ladder Marker Set (bandes toutes les 20pb et 100pb) et/ou Smart Ladder 200pb] et comparée aux profils RFLP de la littérature (Annexe 3). III. ANALYSES GENETIQUES 1. Les marqueurs microsatellites Les loci microsatellites Avant de commencer des analyses génétiques, l indépendance génotypique des loci, l hypothèse d équilibre de Hardy-Weinberg (HWE) et les erreurs de génotypage ou 10

12 de fixation des amorces ont été vérifiés afin de déterminer si certains loci devaient être éliminés de l analyse. Le déséquilibre de liaison génotypique entre chaque paire de loci a été testé par des tests exacts réalisés par le logiciel GENEPOP (Raymond & Rousset, 1995). L hypothèse de panmixie au sein des échantillons a été également testée par les estimations des F IS selon Weir & Cockerham (1984) et des tests exacts de déficit en hétérozygotie observée (H O ) par rapport à l hétérozygotie attendue (H E ) sous Equilibre de Hardy-Weinberg (HWE). La significativité des valeurs observées par rapport à celles attendues a été testée au seuil de 5% sous GENEPOP (Raymond & Rousset, 1995). L écart à l équilibre de Hardy-Weinberg est souvent lié à un déficit en hétérozygotes suite à une structuration génétique au sein de l échantillonnage, un régime de reproduction très fermé ou encore à des erreurs de génotypage. Trois grand types d erreurs de génotypage peuvent affecter les données moléculaires : les plus souvent évoqués sont les allèles nuls 6, les «dropouts» alléliques et les allèles faux 7, les «stutterings» 8 (Pompanon et al., 2005). Le logiciel FreeNA (Chapuis & Estoup, 2007), a été utilisé pour l estimation pour chaque locus et échantillon des fréquences d allèles nuls, erreur la plus souvent rencontrée. D autre part, les paramètres de variabilité génétique tels que le nombre d allèles par locus, la gamme de taille allélique, les hétérozygoties observées et attendues de chaque locus ont été estimés par locus, et par échantillon sur l ensemble de loci. Une première représentation de la répartition génétique globale des individus échantillonnés en fonction d axes factoriels définis par les allèles (Analyse de la Fonction des Correspondances_AFC) a été réalisée à l aide du logiciel GENETIX 4.03 (Belkhir et al., 2001). Assignation des individus à des populations génétiques L estimation de la plupart des paramètres génétiques notamment les F-statistiques s appuie sur la définition préalable de groupes naturels d individus appartenant à la même population génétique. La délimitation de ces populations n est pas forcément reflétée dans la proximité géographique des individus puisque des individus proches géographiquement peuvent correspondre à des populations génétiques différentes et une même population génétique être représentée par des individus à répartition géographique très large. 6 allèle nul. allèle non amplifié à cause d une mutation au niveau du site de fixation de l amorce 7 «dropout» et allèle faux dus à une faible quantité d ADN cible ou amplification préférentielle des allèles de petite taille 8 «stutterings». erreurs d amplication par la Taq au niveau des motifs microsatellites 11

13 Afin de partir sans a priori, une approche multi-locus bayésienne a été utilisée pour déterminer le nombre le plus probable (K) de populations génétiquement différenciées dans l échantillonnage étudié et la probabilité (Q) d assignation de chaque individu à chacune des K populations sur la base de 7 loci microsatellites (3 des 10 loci sont diagnostics du biotype et influenceraient fortement les groupes). Elle a été appliquée par le logiciel STRUCTURE 2.2 (Pritchard et al. 2000) sous les modèles de mixité ou admixture 9 et de fréquences alléliques corrélées. Chaque analyse a consisté en une «phase d allumage» (Burn-in period) de chaînes de Markov Monte Carlo (MCMC) et une phase stationnaire de MCMC. Les estimations du log de vraisemblance, c est-à-dire la probabilité d observer les données sachant le nombre de groupes K [Ln P(D) ou Pr ( X K ) ] ont été calculées pour des valeurs de K allant de 1 à 9 avec 5 répétitions pour chaque afin de tester la reproductibilité des résultats. La meilleure estimation de K est la valeur de K maximale avant le plateau de la courbe représentant Ln P(D) en fonction de K (Pritchard et al. 2000). Ce type d analyse a été refait pour détecter des sous-populations génétiques. Suite à la définition de cette valeur K, la diversité génétique des K (sous)-populations génétiques a été estimée. Différenciation génétique entre les populations, facteurs de différenciation Les valeurs de F ST global, entre les 24 échantillons et entre les populations génétiques définies par le logiciel STRUCTURE ont été estimées à l aide du logiciel GENEPOP selon la formule de Weir & Cockerham (1984). La significativité des valeurs observées a été testée par un Test exact de Fisher (1000 répétitions, P<0.05). La structure et le niveau de différenciation de ces populations ont également été calculés à l aide d Analyses Hiérarchiques de Variance Moléculaire (AMOVA) réalisées par le logiciel ARLEQUIN (Excoffier et al., 2005). Il s agit d une analyse de variance hiérarchique dont les données sont les distances génétiques entre individus et dont les hypothèses sont testées par des tests de permutation. Cette analyse requiert de spécifier des groupes d individus et d assigner chaque individu à une sous-population au sein des groupes. Différents niveaux de structuration ont donc été définis pour tester l importance relative de plusieurs facteurs potentiellement structurant chez B. tabaci, tels que le biotype, l origine géographique et la plante-hôte. L AMOVA décompose la variance totale en 4 composantes : qui sont attribuées aux différences entre les groupes définis (F CT ), entre les populations à l intérieur des groupes définis (F SC ), entre les individus au sein des populations (F IS ) entre les 9 admixture les individus peuvent être assignés à plusieurs populations génétiques s ils proviennent d une hybridation entre individus appartenant à des populations différentes 12

14 individus sur l ensemble des populations (F IT ). L hypothèse nulle du test spécifie que les individus, quel que soit leur groupe ou quel que soit leur «sous-population» au sens de l AMOVA (sens différent de celui de STRUCTURE), appartiennent à une même population génétique et la significativité des hypothèses alternatives a été testée pour toutes les valeurs par 1000 permutations (logiciel ARLEQUIN) (P<0.05). Les effets groupe et sous-population sont supposés additifs, stochastiques et non corrélés. Cette dernière hypothèse n est probablement pas remplie mais l AMOVA fonctionnant sur des tests de permutations, les tests sont assez robustes pour être légitimes. Le test d isolement par la distance, test de Mantel, montrant une éventuelle corrélation entre distance génétique, basée sur la formule F ( ) 1 et distance géographique en log ST F ST (km) des échantillons a été réalisé grâce au logiciel GENEPOP. C est un test exact dont l hypothèse nulle suppose que la pente de régression distance génétique/distance géographique est nulle. Ce test a été réalisé pour 15 échantillons sur les 24 génotypés selon 4 modalités de regroupement : tous les individus typés avec 9 loci (sans le locus BtIs 1.8), tous les individus typés sans les loci diagnostics de biotype (soit 7 loci), les individus de biotype B avec les 9 loci et les individus de biotype Q avec les 9 loci. Finalement, de façon à avoir une estimation des flux de gènes entre les divers sites et planteshôtes, une estimation multiloci du nombre efficace de migrants (Nm) a été faite grâce au logiciel GENEPOP (Raymond & Rousset, 1995). 2. Le marqueur mitochondrial : COI Diversité génétique du COI Chaque séquence obtenue dans les 2 sens a été vérifiée dans l éditeur de séquences BioEdit de façon à créer la séquence consensus correspondante. Les 29 séquences consensus et 34 autres disponibles ont été alignées avec le logiciel CLUSTALW (sous BioEdit) et comparées entre elles. Seules les séquences représentant des haplotypes 10 différents ont ensuite été incluses dans les analyses. Les indices standards de variations génétiques [nombres de sites polymorphes, nombre de sites informatifs et de singletons, diversité haplotypique (Hd)] ont été calculés au moyen du logiciel DNAsp (Rozas et al., 2003). 10 haplotype : une séquence unique 13

15 Identification du biotype L identification du biotype des individus séquencés a été obtenue par comparaison de leur haplotype COI d appartenance avec les séquences disponibles dans GenBank en réalisant un Blast (http://www.ncbi.nlm.nih.gov/blast/blast.cgi). Une identité nucléotidique élevée (% de nucléotides partagés de l ordre de 96%) avec des séquences COI de B. tabaci au biotype déjà déterminé permet d assigner un biotype à quasiment chaque individu. Pour certains des individus génotypés non séquencés, la détermination ou la confirmation de leur biotype a été réalisée par comparaison des 3 profils de digestion (VspI, TaqI, AluI) de leur produit COI amplifié avec les profils PCR-RFLP de référence (individus B. tabaci de biotype connu, Horowitz et al., 2005 ; Khasdan et al., 2005 ; Bosco et al., 2006 ; Tsagkarakou et al., 2007) (Annexe 3). Finalement, compte tenu de l existence de ces 2 méthodes fiables de biotypage, nous avons recherché l éventuelle présence de marqueurs diagnostics parmi nos 10 loci microsatellites par une AFC et une ACM (Analyse des Correspondances Multiples). Reconstructions phylogénétiques La proximité phylogénétique entre les 20 haplotypes tunisiens et grecs de cette étude et des séquences d autres pays du Bassin Méditerranéen (34 Gauthier ; 13 Genbank) (Tableau 4) a été estimée par 3 méthodes : 1) basée sur la distance génétique, ici la distance de Kimura- 2 [Neighbour-Joining (NJ), Saitou & Nei, 1987], 2) basée sur le critère de Maximum de Parcimonie [MP, Fitch, 1971], 3) basée sur le critère de Maximum de Vraisemblance [ML, Felsenstein, 1981). Ces analyses ont été réalisées dans PAUP* (Swofford, 2002). Pour le ML, le logiciel MODELTEST (Posada & Crandall, 1998) a été utilisé pour déterminer le modèle de substitutions de l ADN le plus adapté à notre jeu de données (valeur du critère AIC minimale). Le modèle TIM+G 11 a ainsi été retenu pour la reconstruction des arbres. La robustesse des branches et de ce fait des «groupements» a été évaluée par 500 répétitions de Bootstrap. Les reconstructions ont été enracinées avec des séquences homologues de 2 spécimens de l espèce Bemisia afer (Genbank accession numbers AJ784260, AF418673). 11 TIM + G : Transitional Model plus Gamma (fréquence des bases 0.432, 0.125, 0.246, Ts / Tv = ) 14

16 RESULTATS I. LES LOCI MICROSATELLITES En tout, 703 femelles ont été génotypées avec 9 des 10 loci microsatellites. Le locus BtIs1.8 n a pu être étudié de la même manière que les autres loci puisque, les amorces se fixant sur trois sites différents du génome, les individus pouvaient présenter 4 allèles pour ce seul locus. Cependant les sites de fixation semblant porter une information en termes de structuration génétique, il a été analysé selon une approche statistique différente. Aucun déséquilibre de liaison significatif n a été détecté entre les différents loci sur l ensemble des 24 échantillons (p>0.05) témoignant de l indépendance de l information apportée par chacun. En revanche, certains tests n ont pas pu être réalisés notamment entre les loci BtIs1.1 et BtIs1.14 du fait de la présence d allèles fixés. L hypothèse d HWE n est pas vérifiée pour 6 loci sur les 9 (test exact, P<0.05) car un déficit significatif en hétérozygotes à ces loci a été observé (Tableau 4). Cet excès d homozygotes observés ne semble pas lié à des fréquences très significatives d allèles nuls dans les données génotypiques car sur 216 combinaisons loci x échantillons, 12.5% de fréquences d allèles nuls sont supérieures à 0.20, majoritairement aux loci BtIs1.17 et BtIs1.9. La richesse allélique observée sur l ensemble des 24 échantillons varie de 4 allèles pour le BtIs1.13 à 37 pour le locus BtIs1.2 (Tableau 4). L analyse du polymorphisme pour chaque site d échantillonnage sur l ensemble des 9 loci montre une grande variabilité en termes de richesse allélique (environ 2 à 6 allèles) et d hétérozygoties (0.09<H O <0.45 _ 0.10<H E <0.55) qui ne semble pas être caractéristique d une zone géographique particulière. Chaque site échantillonné présente un déficit significatif d hétérozygotes (test exact U, P<0,05) qui pourrait en partie s expliquer par un régime de reproduction fermé (0.17<F IS <0.61) ou bien encore une sous-structuration des individus au sein de chaque site ou entre certains sites (Tableau 5). L estimation des valeurs de F ST (0.02 à 0.66) et de F IT (0.19 à 0.90) sur l ensemble des 9 loci révèle l existence d une grande variabilité entre les échantillons et sur l ensemble des individus. II. STRUCTURE DES POPULATIONS : NOMBRE DE POPULATIONS GENETIQUES Une AFC en trois dimensions réalisée sous GENETIX a montré la répartition des individus en deux nuages de points clairement distincts avec les échantillons tunisiens sur 15

17 tomate et aubergine et grecs sur L. camara d un côté, et les échantillons tunisiens sur L. camara et grecs sur tomate et aubergine de l autre (Annexe 4). La première analyse Bayésienne réalisée avec le logiciel STRUCTURE pour des valeurs de K allant de 1 à 9 révèle la partition la plus probable de l ensemble des individus en 2 populations génétiques, K1 et K2. En effet, la valeur de Ln P(D) avant le plateau atteint est de 2 (Figure 3, Figure 4). Pour K supérieur à 2, aucun gain de vraisemblance n est noté. La grande majorité des individus a été fortement assignée soit à K1 soit à K2 avec des probabilités Q supérieures à 0.8. Pour des probabilités d assignation comprises entre 0.8 et 0.7, l assignation se fait à la population la plus probable. En dessous de 0.70, compte tenu du type de modèle choisi (admixture), ces individus pourraient être des hybrides. Globalement, la majorité des individus d un même échantillon semble relever de la même population quelle que soit l origine géographique, Tunisie ou Grèce. Des analyses séparées de K1 et K2 sur STRUCTURE pour des valeurs de K allant de 1 à 9, ont révélé une partition de la population génétique K2 en deux sous-groupes K2a et K2b, significativement basés sur l origine géographique des échantillons (Tunisie et Crète) (Figure 5). Aucun sous-groupe génétique n a été mis en évidence pour K1. III. IDENTITE DES POPULATIONS GENETIQUES : DETERMINATION DU BIOTYPE Trois méthodes ont été utilisées pour déterminer le biotype des individus dont 2 utilisées couramment dans la littérature : le séquençage d un fragment COI et les digestions enzymatiques de ce fragment (PCR-RFLP). Une méthode basée sur des tailles d allèles de loci microsatellites diagnostics, BtIs1.2 et BtIs1.9 a été vérifiée ici. Le locus BtIs1.8 a aussi fait l objet d une analyse indépendante pour appuyer les résultats. 1. Loci microsatellites diagnostics Les loci BtIs1.2 et BtIs1.9 faisant partie des 9 loci utilisés pour le génotypage, le biotype des 703 individus a pu être systématiquement identifié par ces loci, sauf pour quelques individus pour lesquels il manquait des données. Ces 2 loci présentent un grand polymorphisme (Tableau 4) en particulier le locus BtIs1.2 qui en présente 37 sur l ensemble des individus. Deux types de patrons de tailles alléliques spécifiques du biotype B ou Q ont 16

18 été identifiés pour chaque locus (Tableau 6) et l assignation d un individu à un biotype s est basée sur ces profils. Quand il y avait contradiction entre les 2 loci, le locus BtIs1.9 a été privilégié du fait d un nombre d allèles moindre et d une lecture plus fiable. Biotype (population génétique) Locus B (K2) Q (K1) BtIs1.2 [ pb] [ pb] BtIs1.9 [ pb] [ pb] Tableau 6 : Gammes des tailles alléliques des loci BtIs1.2 et BtIs1.9 diagnostics du biotype et correspondances avec les biotypes B et Q. Ainsi, les individus de la population génétique K1 ont été identifiés comme appartenant au biotype B et les individus de la population génétique K2 au biotype Q. L identification du biotype sur la base de ces 2 loci s est avérée concordante avec la délimitation stricte des 2 populations génétiques à l exception de 5 individus mal assignés. 13 autres individus n ont pu être assignés ni à un biotype ni à une population génétique. Cela peut provenir soit d erreurs de lecture, soit d hybridation entre les deux biotypes. * Une analyse de la séquence du clone référence du locus Bts1.8 a mis en évidence 3 sites de fixation possibles pour les 12 premières paires de bases de l amorce Forward (Annexe 5). Une AFC sur le premier site de fixation du locus BtIs1.8 a permis de réaliser une typologie des échantillons et une ACM sur les 3 sites de fixation du locus BtIs1.8 a permis de réaliser une typologie des individus concordante avec le biotype et les patrons alléliques observés (Annexe 6). L amorce F se fixe sur le site S1 pour tous les individus. Quand les individus sont homozygotes à ce site, alors il n y pas de fixation au site S2 mais fixation au site S3. Ces individus correspondent au biotype Q. Quand les individus sont hétérozygotes au site S1, alors il y a fixation systématique au site S2. Ces individus correspondent au biotype B. Pour le moment aucune information en termes de biotypes, relative à l état homozygote ou hétérozygote aux sites S2 et S3, n a été identifiée (Tableau 7). Biotype Locus BtIs1.8 B Q Sites de fixation S S1 S2 S3 S1 S2 S3 Génotype(s) observés en S (237239) (255255) (237239) (255257) - _ (237237) (237237) [ ] Homoou Hétérozygote - Tableau 7 : Correspondance entre profils génotypiques du locus BtIs1.8 et les biotypes. 17

19 2. Fiabilité des méthodes diagnostics : Séquençage du COI et PCR-RFLP Seuls 21 individus issus des échantillons de mon étude ont pu être séquencés. La séquence a corroboré les résultats d appartenance des individus à l un ou l autre des biotypes donnée par l analyse sous STRUCTURE (9 loci) et ceux des profils de digestions enzymatiques (Figure 6). IV. REPARTITION SPATIALE ET PAR PLANTE-HOTE DES BIOTYPES L assignation des individus aux biotypes B et Q est très concordante avec une distribution géographique. Les B. tabaci collectés en Tunisie sont à 57.3% de biotype B (42.7% de Q) et ceux de Crète à 84.3% de biotype Q (15.2% de B) (Tableau 8). Au sein du biotype Q, les individus clairement assignés à Q1 par STRUCTURE (avec une probabilité supérieure à 0.70) sont à 80.4% tunisiens, ceux de Q2 à 74.1% crétois (Tableau 9). Globalement, chaque site d échantillonnage est soit de biotype B ou Q. Les individus de biotypes différents ne coexistent pas ou peu en un même site. Les individus de chaque biotype sont globalement présents sur les 3 plantes hôtes mais au sein d un pays les résultats montrent qu en Crète, 100% des individus du biotype minoritaire B sont sur L. camara, et en Tunisie, 74.8% des individus du minoritaire Q sont présents sur L. camara (Tableau 8). V. DIVERSITE GENETIQUE ET DIFFERENCIATION ENTRE LES BIOTYPES, LES PAYS, LES PLANTES-HOTES Les paramètres estimés de nombre d allèles moyen, d hétérozygoties observées et attendues sous hypothèse de HWE sur l ensemble des 9 loci (Tableau 10), et le nombre d allèles par locus (Figure 7) mettent en évidence une diversité génétique significativement plus importante pour le biotype Q que pour le biotype B. La valeur de F ST total entre les 2 biotypes est égale à 0.51 ; elle est de 0.55 entre B et Q1 et 0.63 entre B et Q2. Cela indique une différenciation très significative entre les 2 biotypes avec une estimation du nombre de migrants de 0.13/génération sur l ensemble des individus. Au sein du biotype Q, la valeur de F ST entre Q1 et Q2 est de 0.24 et confirme l existence d au moins 2 groupes génétiques distincts. Les valeurs estimées de F ST tenant non seulement compte de la composante biotype mais aussi origine géographique et plantes-hôtes sont reportées dans le Tableau 11. Trois niveaux de différenciation génétique apparaissent traduits par 3 gammes de valeurs de F ST : 18

20 - F ST > 0.4 : inter biotypes quelles que soient les plantes-hôtes et le pays > F ST >0.4 : intra Q entre les plantes-hôtes de Tunisie et de Crète (pas de biotype Q sur L. Camara en Crète) - F ST < 0.15 : intra B, intra pays quelle que soit la plante-hôte Ces résultats expriment l importance relative des 3 composantes dans la différenciation observée à savoir le biotype, le pays et peut être la plante-hôte. Les AMOVA confirment que la variance moléculaire observée est d abord inter biotypes (38%-48%), inter-individus ( 32%, tous les individus ont quasiment tous des profils alléliques propres) intra biotype Q (19%) ce qui revient à dire inter pays (Q1 majoritairement en Tunisie et Q1 en Crète). En revanche, la plante hôte n explique que 4,32% de la variance moléculaire et ne constitue donc pas un facteur déterminant. Concernant la composante géographique, il y a 3 aspects différents à considérer : l origine (AMOVA), la distance (Test de Mantel) et les migrants (N m ). Les graphes représentant les distances génétiques entre échantillons en fonction de leur distance géographique permettent de visualiser l importance du biotype Les tests de Mantel ne sont pas significatifs puisque les pentes des droites de régression ne sont pas significativement différentes de 0. Il n y pas d isolement par la distance (Annexe 7) Le nombre efficace de migrants estimé par GENEPOP entre la Tunisie et la Crète est de 3,40. Il est inférieur entre biotypes d un même pays (N m =0,40 pour la Crète, N m =0,19 pour la Tunisie) et supérieur entre pays d un même biotype (N m =3,03 pour le biotype B, N m =5.30 pour le biotype Q). Il y a donc plus d échanges entre les individus d un même biotype mais provenant de pays différents, qu entre les individus de biotypes différents mais provenant du même pays. VI. DIVERSITE GENETIQUE DES HAPLOTYPES ET RECONSTRUCTION PHYLOGENETIQUE L alignement entre les 63 séquences partielles du COI a résulté en un fragment commun de 676pb. Les 136 sites variables (77.6% de transitions) ont abouti à la définition de 20 haplotypes (Tableaux 12, 13, Figure 8). Six de ces haplotypes ont été assignés au Biotype B, 13 au Biotype Q et 1 est resté de biotype indéterminé (il présentait 96% d identité nucléotidique avec un biotype inconnu sur GenBank). La majorité des haplotypes (12/20) identifiés sont uniques (1 seul spécimen). Quant aux haplotypes partagés, ils regroupent des séquences de spécimens issus soit de pays différents (H1, H15, ) soit d un même pays (H9 : 12 individus sur les 13 de biotype Q séquencés ; H13 : 7 individus sur les 9 de biotype Q 19

VI. L APPORT DES MARQUEURS MOLECULAIRES. A. Définitions

VI. L APPORT DES MARQUEURS MOLECULAIRES. A. Définitions VI. L APPORT DES MARQUEURS MOLECULAIRES Comme nous l avons vu précédemment, l étude des caractères quantitatifs est fondée sur l analyse statistique des performances mesurées des individus. Il en est de

Plus en détail

UNION INTERNATIONALE POUR LA PROTECTION DES OBTENTIONS VÉGÉTALES

UNION INTERNATIONALE POUR LA PROTECTION DES OBTENTIONS VÉGÉTALES ORIGINAL : anglais DATE : 21 octobre 2010 UNION INTERNATIONALE POUR LA PROTECTION DES OBTENTIONS VÉGÉTALES GENÈVE F DIRECTIVES CONCERNANT LES PROFILS D ADN : CHOIX DES MARQUEURS MOLECULAIRES ET CONSTRUCTION

Plus en détail

Utilisation des marqueurs ISSR pour l'étude du polymorphisme génétique d'artemisia herba-alba

Utilisation des marqueurs ISSR pour l'étude du polymorphisme génétique d'artemisia herba-alba Utilisation des marqueurs ISSR pour l'étude du polymorphisme génétique d'artemisia herba-alba Haouari M., Ferchichi A. in Ferchichi A. (comp.), Ferchichi A. (collab.). Réhabilitation des pâturages et des

Plus en détail

TP de Biochimie Groupe 4 Forestier Michèle 25.05.2010 Fournier Coralie Freyre Christophe Manipulation d ADN

TP de Biochimie Groupe 4 Forestier Michèle 25.05.2010 Fournier Coralie Freyre Christophe Manipulation d ADN MANIPULATION D ADN Clonage du gène «venus» dans des plasmides et expression de celui-ci chez les bactéries E.Coli. Assistants: U. Loizides M. Umebayashi C. Gehin - 1 - 1. Résumé Lors de notre expérience,

Plus en détail

LES MARQUEURS MOLECULAIRES

LES MARQUEURS MOLECULAIRES LES MARQUEURS MOLECULAIRES Il y a différents types de marqueurs : o Les caractères phénotypiques : limités, observations sur l arbre entier et sur différentes années o Les marqueurs biochimiques o Les

Plus en détail

UNION INTERNATIONALE POUR LA PROTECTION DES OBTENTIONS VÉGÉTALES

UNION INTERNATIONALE POUR LA PROTECTION DES OBTENTIONS VÉGÉTALES ORIGINAL: anglais DATE: 18 janvier 2007 UNION INTERNATIONALE POUR LA PROTECTION DES OBTENTIONS VÉGÉTALES GENÈVE F PROJET DIRECTIVES CONCERNANT LES PROFILS D ADN : CHOIX DES MARQUEURS MOLÉCULAIRES ET CONSTRUCTION

Plus en détail

Clonage de Vénus et transformation de E.Coli.

Clonage de Vénus et transformation de E.Coli. Clonage de Vénus et transformation de E.Coli. Samueal Joseph, Romain Laverrière, Elias Laudato, Noé Mage Assisstants : Gisele Dewhurst, Charlotte Gehin, Miwa Umebayashi Résumé [1] L expérience consiste

Plus en détail

Biodiversité, Taxonomie et Barcode moléculaire. Nicolas Puillandre puillandre@mnhn.fr

Biodiversité, Taxonomie et Barcode moléculaire. Nicolas Puillandre puillandre@mnhn.fr Biodiversité, Taxonomie et Barcode moléculaire Nicolas Puillandre puillandre@mnhn.fr Biodiversité : - les écosystèmes - les espèces - les gènes Taxonomie : Description des unités taxonomiques Classification

Plus en détail

Les documents présentés dans ce cours sont issus : soit de travaux personnels soit de travaux présentés sur le web Leur utilisation ne doit donner

Les documents présentés dans ce cours sont issus : soit de travaux personnels soit de travaux présentés sur le web Leur utilisation ne doit donner Les documents présentés dans ce cours sont issus : soit de travaux personnels soit de travaux présentés sur le web Leur utilisation ne doit donner lieu à aucune exploitation commerciale D. LOCKER Professeur

Plus en détail

Le marquage moléculaire

Le marquage moléculaire Le marquage moléculaire Le marquage moléculaire regroupe un ensemble de techniques révélant des différences de séquences d (acide désoxyribonucléique) entre individus. Les marqueurs moléculaires permettent

Plus en détail

Mariane ALLEAUME-BENHARIRA Sylvie ODDOU-MURATORIO François LEFEVRE. Ecologie des forêts méditerranéennes INRA AVIGNON - FRANCE

Mariane ALLEAUME-BENHARIRA Sylvie ODDOU-MURATORIO François LEFEVRE. Ecologie des forêts méditerranéennes INRA AVIGNON - FRANCE MODELISER L IMPACT DES CHANGEMENTS DEMOGRAPHIQUES ET ENVIRONNEMENTAUX SUR L EVOLUTION DES ARBRES Le module Luberon Version 2010 Mariane ALLEAUME-BENHARIRA Sylvie ODDOU-MURATORIO François LEFEVRE Ecologie

Plus en détail

Polymorphismes de l ADN

Polymorphismes de l ADN Introduction Polymorphismes de l ADN Présentation et mise en évidence Recherche de gènes responsables de maladies génétiques : Analyse de pedigrees où la maladie est présente Sur quel chromosome? À quel

Plus en détail

Deuxième partie. Calcul de fréquences de génotypes multilocus dans des pédigrees complexes XXVII

Deuxième partie. Calcul de fréquences de génotypes multilocus dans des pédigrees complexes XXVII Deuxième partie Calcul de fréquences de génotypes multilocus dans des pédigrees complexes XXVII Présentation Les programmes informatiques MDM et grafgen L analyse de schémas de construction de génotypes

Plus en détail

Cours d introduction à la génétique de la souris Notion de Souche

Cours d introduction à la génétique de la souris Notion de Souche Cours d introduction à la génétique de la souris Notion de Souche Introduction: - Réponse d un animal à l expérimentation (diapo 1) Facteurs environnementaux et propres à l animal - Notion d animal standardisé

Plus en détail

Incertitude et variabilité : la nécessité de les intégrer dans les modèles

Incertitude et variabilité : la nécessité de les intégrer dans les modèles Incertitude et variabilité : la nécessité de les intégrer dans les modèles M. L. Delignette-Muller Laboratoire de Biométrie et Biologie Evolutive VetAgro Sup - Université de Lyon - CNRS UMR 5558 24 novembre

Plus en détail

Mise en place d'un test de génotoxicité sur le gardon Rutilus rutilus introduit dans des lagunes de traitement de lixiviats.

Mise en place d'un test de génotoxicité sur le gardon Rutilus rutilus introduit dans des lagunes de traitement de lixiviats. Mise en place d'un test de génotoxicité sur le gardon Rutilus rutilus introduit dans des lagunes de traitement de lixiviats Ivan Starikov Encadrant: Lotfi Aleya Co-encadrant: Nicolas Capelli UMR CNRS 6249

Plus en détail

Gènes Diffusion - EPIC 2010

Gènes Diffusion - EPIC 2010 Gènes Diffusion - EPIC 2010 1. Contexte. 2. Notion de génétique animale. 3. Profil de l équipe plateforme. 4. Type et gestion des données biologiques. 5. Environnement Matériel et Logiciel. 6. Analyses

Plus en détail

Méthode automatisée de dosage colorimétrique du dioxyde de soufre total dans les vins

Méthode automatisée de dosage colorimétrique du dioxyde de soufre total dans les vins Méthode automatisée de dosage colorimétrique du dioxyde de soufre total dans les vins Marc DUBERNET* et Françoise GRASSET* Laboratoire DUBERNET - 9, quai d Alsace - 11100 Narbonne France 1. Objet Méthode

Plus en détail

AP SVT. Exercice 1. Exercice 2. Exercice 3.

AP SVT. Exercice 1. Exercice 2. Exercice 3. Exercice 1. AP SVT On cherche à comprendre le mode de transmission de deux caractères chez la Drosophile, organisme diploïde. Effectuez une analyse génétique pour expliquer les résultats des croisements

Plus en détail

ATELIER EPIGENETIQUE

ATELIER EPIGENETIQUE Juin 2012 ATELIER EPIGENETIQUE Utilisation de la Q-PCR pour analyser des données de ChIP ou de MeDIP Emmanuèle Mouchel-Vielh I. La PCR quantitative: principe et généralités II. Interprétation des résultats

Plus en détail

2.0 Interprétation des cotes d évaluation des risques relatifs aux produits

2.0 Interprétation des cotes d évaluation des risques relatifs aux produits 2.0 Interprétation des cotes d évaluation des risques relatifs aux produits L interprétation des cotes attribuées dans le cadre des évaluations des risques relatifs aux produits décrite plus loin repose

Plus en détail

Tests de comparaison de moyennes. Dr Sahar BAYAT MASTER 1 année 2009-2010 UE «Introduction à la biostatistique»

Tests de comparaison de moyennes. Dr Sahar BAYAT MASTER 1 année 2009-2010 UE «Introduction à la biostatistique» Tests de comparaison de moyennes Dr Sahar BAYAT MASTER 1 année 2009-2010 UE «Introduction à la biostatistique» Test de Z ou de l écart réduit Le test de Z : comparer des paramètres en testant leurs différences

Plus en détail

Annales du Contrôle National de Qualité des Analyses de Biologie Médicale

Annales du Contrôle National de Qualité des Analyses de Biologie Médicale Annales du Contrôle National de Qualité des Analyses de Biologie Médicale ARN du virus de l hépatite C : ARN-VHC ARN-VHC 03VHC1 Novembre 2003 Edité : mars 2006 Annales ARN-VHC 03VHC1 1 / 8 ARN-VHC 03VHC1

Plus en détail

Enquête mensuelle de conjoncture auprès des ménages

Enquête mensuelle de conjoncture auprès des ménages Note Méthodologique Dernière mise à jour : 27-1-214 Enquête mensuelle de conjoncture auprès des ménages Présentation de l enquête L Insee réalise depuis janvier 1987 l enquête mensuelle de conjoncture

Plus en détail

Interprétation des résultats et troubleshooting

Interprétation des résultats et troubleshooting Interprétation des résultats et troubleshooting Le Service de séquençage du Centre d innovation Génome Québec et Université McGill utilise des appareils 3730xl DNA Analyzer d Applied Biosystems. Cette

Plus en détail

Génotypage par Séquençage (GBS) : Création d une carte génétique haute densité de Tournesol Population INEDI (RILs PSC8 x XRQ)

Génotypage par Séquençage (GBS) : Création d une carte génétique haute densité de Tournesol Population INEDI (RILs PSC8 x XRQ) Génotypage par Séquençage (GBS) : Création d une carte génétique haute densité de Tournesol Population INEDI (RILs PSC8 x XRQ) Baptiste Mayjonade (IE-CDD SUNRISE) Génétique et génomique des réponses aux

Plus en détail

La méthode des quotas

La méthode des quotas La méthode des quotas Oliviero Marchese, décembre 2006 1 La méthode des quotas Principe de la méthode Point de départ et but recherché Caractère «intuitif» de la méthode A quoi ressemble une feuille de

Plus en détail

Taq'Ozyme Purple Mix MANUEL D UTILISATION

Taq'Ozyme Purple Mix MANUEL D UTILISATION Taq'Ozyme Purple Mix OZYA003-40 - 40 réactions OZYA003-200 - 200 réactions (avec supplément de MgCl 2 ) OZYA003-200XL - 200 réactions (avec supplément de MgCl 2 ) OZYA003-1000 - 1000 réactions (avec supplément

Plus en détail

SCI03 - Analyse de données expérimentales

SCI03 - Analyse de données expérimentales SCI03 - Analyse de données expérimentales Introduction à la statistique Thierry Denœux 1 1 Université de Technologie de Compiègne tél : 44 96 tdenoeux@hds.utc.fr Automne 2014 Qu est ce que la statistique?

Plus en détail

Introduction aux Méthodes de Monte Carlo

Introduction aux Méthodes de Monte Carlo Méthodes de Monte Carlo pour la Modélisation et le Calcul Intensif Applications à la Physique Numérique et à la Biologie Séminaire CIMENT GRID Introduction aux Méthodes de Monte Carlo Olivier François

Plus en détail

Modélisation coalescente pour la détection précoce d un cancer

Modélisation coalescente pour la détection précoce d un cancer Modélisation coalescente pour la détection précoce d un cancer Mathieu Emily 27 Novembre 2007 Bioinformatics Research Center - Université d Aarhus Danemark Mathieu Emily Coalescence et cancer 1 Introduction

Plus en détail

23. Interprétation clinique des mesures de l effet traitement

23. Interprétation clinique des mesures de l effet traitement 23. Interprétation clinique des mesures de l effet traitement 23.1. Critères de jugement binaires Plusieurs mesures (indices) sont utilisables pour quantifier l effet traitement lors de l utilisation d

Plus en détail

Séance génome : Explication PCR et électrophorèse

Séance génome : Explication PCR et électrophorèse Séance génome : Explication PCR et électrophorèse La PCR (Polymérase Chain Reaction) est une technique qui permet de démultiplier en de très nombreuses quantités une séquence de nucléotides parmi l ensemble

Plus en détail

Incohérences entre le Rapport URC ECO SSIAD et le système de tarification proposé

Incohérences entre le Rapport URC ECO SSIAD et le système de tarification proposé Incohérences entre le Rapport URC ECO SSIAD et le système de tarification proposé P.16 Les SSIAD de l échantillon représentent environ 1.8% des SSIAD et 2.4% des places installées. Les tarifs des soins

Plus en détail

COURS DE STATISTIQUES (24h)

COURS DE STATISTIQUES (24h) COURS DE STATISTIQUES (24h) Introduction Statistiques descriptives (4 h) Rappels de Probabilités (4 h) Echantillonnage(4 h) Estimation ponctuelle (6 h) Introduction aux tests (6 h) Qu est-ce que la statistique?

Plus en détail

4.3 Influence de la transgénèse sur les relations Plante-insecte, en particulier sur les interactions par voie chimique

4.3 Influence de la transgénèse sur les relations Plante-insecte, en particulier sur les interactions par voie chimique 4.3 Influence de la transgénèse sur les relations Plante-insecte, en particulier sur les interactions par voie chimique Ute Vogler, Anja Rott, Cesare Gessler 1, Silvia Dorn* ETH Zurich, Institute for Plant

Plus en détail

Étude de validation du Bluestar Forensic

Étude de validation du Bluestar Forensic Étude de validation du Bluestar Forensic I. Matériels et matières utilisés II. des tests 2.1. Détermination du seuil de sensibilité du kit Bluestar 2.2. Détermination de taches en fonction de leur volume

Plus en détail

Taq Ozyme (Nouvelle Formulation) ADN polymérase thermostable

Taq Ozyme (Nouvelle Formulation) ADN polymérase thermostable Taq Ozyme (Nouvelle Formulation) OZYA001-1000 - 1000 unités OZYA001-5000 - 5000 unités OZYA001-1000D - 1000 unités + dntp Premix - 4x10 mm Stockage et stabilité : Taq Ozyme : 2 ans à -20 C dntp Premix

Plus en détail

La qualité de l air liée au dioxyde d azote s améliore sur la plupart des axes routiers mais reste insatisfaisante

La qualité de l air liée au dioxyde d azote s améliore sur la plupart des axes routiers mais reste insatisfaisante En résumé Évaluation de l impact sur la qualité de l air des évolutions de circulation mises en oeuvre par la Mairie de Paris entre 2002 et 2007 Ce document présente les résultats de l évolution entre

Plus en détail

Les non-salariés pluri-actifs permanents

Les non-salariés pluri-actifs permanents Les non-salariés pluri-actifs Franck Evain* Les pluri-actifs, c est-à-dire les personnes qui cumulent de manière permanente activité salariée (hors fonction publique d État) et activité non salariée, sont

Plus en détail

I. LA VARIABILITE AU SEIN DES POPULATIONS

I. LA VARIABILITE AU SEIN DES POPULATIONS I. LA VARIABILITE AU SEIN DES POPULATIONS La notion de population recouvre un concept difficilement réductible à une définition unique. Au sens de la génétique, une population représente une entité de

Plus en détail

TS214 - Compression/Décompression d une image binaire

TS214 - Compression/Décompression d une image binaire Filière Télécommunications, 2 ème année TS214 - Compression/Décompression d une image binaire De nombreux télécopieurs utilisent la recommandation T.4 Groupe 3 de l International Telecommunications Union

Plus en détail

Méthodes diagnostiques en génétique moléculaire

Méthodes diagnostiques en génétique moléculaire Méthodes diagnostiques en génétique moléculaire P. Latour Praticien Hospitalier Responsable UF 3427 Neurogénétique Moléculaire Laboratoire de Neurochimie Pr Renaud HCL Centre de Biologie Est DES Neurologie

Plus en détail

L emploi atypique n est pas forcément synonyme de mal-être accru au travail. L exemple du type de contrat de travail en France

L emploi atypique n est pas forcément synonyme de mal-être accru au travail. L exemple du type de contrat de travail en France L emploi atypique n est pas forcément synonyme de mal-être accru au travail. L exemple du type de contrat de travail en France Baggio, S. & Sutter, PE. Résumé de la communication orale présentée au colloque

Plus en détail

e point en recherche Profils de la charge de consommation d énergie et d eau dans les collectifs d habitation introduction Programme de recherche

e point en recherche Profils de la charge de consommation d énergie et d eau dans les collectifs d habitation introduction Programme de recherche l Décembre 25 e point en recherche Série technique 5-119 Profils de la charge de consommation d énergie et d eau dans les collectifs d habitation introduction La recherche permet de commencer à comprendre

Plus en détail

Document d orientation sur les allégations issues d essais de non-infériorité

Document d orientation sur les allégations issues d essais de non-infériorité Document d orientation sur les allégations issues d essais de non-infériorité Février 2013 1 Liste de contrôle des essais de non-infériorité N o Liste de contrôle (les clients peuvent se servir de cette

Plus en détail

Principe des tests statistiques

Principe des tests statistiques Principe des tests statistiques Jean Vaillant Un test de signification est une procédure permettant de choisir parmi deux hypothèses celles la plus probable au vu des observations effectuées à partir d

Plus en détail

Analyse de données longitudinales continues avec applications

Analyse de données longitudinales continues avec applications Université de Liège Département de Mathématique 29 Octobre 2002 Analyse de données longitudinales continues avec applications David MAGIS 1 Programme 1. Introduction 2. Exemples 3. Méthodes simples 4.

Plus en détail

Session B2: Assurance

Session B2: Assurance 33 èmes Journées des Économistes de la Santé Français 1 er et 2 décembre 2011 Session B2: Assurance Auteurs: Sophie Guthmuller et Jérôme Wittwer, Université Paris-Dauphine Référé: Aurore Pélissier, CERDI,

Plus en détail

L essentiel sur les tests statistiques

L essentiel sur les tests statistiques L essentiel sur les tests statistiques 21 septembre 2014 2 Chapitre 1 Tests statistiques Nous considérerons deux exemples au long de ce chapitre. Abondance en C, G : On considère une séquence d ADN et

Plus en détail

Annales du Contrôle National de Qualité des Analyses de Biologie Médicale

Annales du Contrôle National de Qualité des Analyses de Biologie Médicale Annales du Contrôle National de Qualité des Analyses de Biologie Médicale Carge virale du VHB : ADN-VHB ADN-VHB 11CHB1 Mars 2011 Edition : Septembre 2011 Afssaps -143/147, Bd Anatole France F-93285 Saint

Plus en détail

Méthodes et techniques de la biologie du développement

Méthodes et techniques de la biologie du développement Méthodes et techniques de la biologie du développement 1. Etude de l expression des gènes : Détecter les transcrits et les protéines au cours de l ontogenèse l outil anticorps 1.1. La RT-PCR La réaction

Plus en détail

Norme comptable internationale 26 Comptabilité et rapports financiers des régimes de retraite

Norme comptable internationale 26 Comptabilité et rapports financiers des régimes de retraite Norme comptable internationale 26 Comptabilité et rapports financiers des régimes de retraite Champ d application 1 La présente norme doit être appliquée aux états financiers présentés par les régimes

Plus en détail

Evaluation d impact de l accompagnement des demandeurs d emploi par les opérateurs privés de placement et le programme Cap vers l entreprise

Evaluation d impact de l accompagnement des demandeurs d emploi par les opérateurs privés de placement et le programme Cap vers l entreprise Evaluation d impact de l accompagnement des demandeurs d emploi par les opérateurs privés de placement et le programme Cap vers l entreprise Luc Behaghel, Bruno Crépon et Marc Gurgand Synthèse du rapport

Plus en détail

CONCLUSIONS. Par rapport aux résultats obtenus, on peut conclure les idées suivantes :

CONCLUSIONS. Par rapport aux résultats obtenus, on peut conclure les idées suivantes : CONCLUSIONS L application de la PNL à l entreprise est confrontée aux besoins des leaders d équipe, tels que: la gestion de son propre développement, du stress, la résolution des problèmes tels que les

Plus en détail

Les diplômés de l IB dans les universités australiennes : admission et résultats Étude de cas de deux établissements d enseignement supérieur

Les diplômés de l IB dans les universités australiennes : admission et résultats Étude de cas de deux établissements d enseignement supérieur RÉSUMÉ DE RECHERCHE Les diplômés de l IB dans les universités australiennes : admission et résultats Étude de cas de deux établissements d enseignement supérieur Fondé sur un rapport de recherche réalisé

Plus en détail

2: Les enzymes de restriction

2: Les enzymes de restriction 2: Les enzymes de restriction Les enzymes de restriction sont des protéines synthétisées par des bactéries pour se protéger des infections de virus (bactériophages). Ces enzymes coupent l ADN viral à des

Plus en détail

Les différentes stratégies de quantification :

Les différentes stratégies de quantification : Les différentes stratégies de quantification : Ce chapitre présente les 2 principales stratégies de quantification relative utilisée classiquement : la méthode des droites standards et celle des Ct. Les

Plus en détail

L'ADN mitochondrial a été découvert en 1962 par Margit MK Nass et Sylvan Nass par microscopie électronique.

L'ADN mitochondrial a été découvert en 1962 par Margit MK Nass et Sylvan Nass par microscopie électronique. L L'ADN mitochondrial a été découvert en 1962 par Margit MK Nass et Sylvan Nass par microscopie électronique. Figure 1 Mitochondries observées au microscope électronique à transmission Plus tard, cet ADN

Plus en détail

La formation continue dans le secteur de la presse écrite de 2004 à 2007, financée par l OPCA MEDIAFOR

La formation continue dans le secteur de la presse écrite de 2004 à 2007, financée par l OPCA MEDIAFOR La formation continue dans le secteur de la presse écrite de 2004 à 2007, financée par l OPCA MEDIAFOR Etude statistique des données fournies par MEDIAFOR Avant-propos Cette étude a été réalisée par l

Plus en détail

CAC/GL 62-2007 Page 1 de 5

CAC/GL 62-2007 Page 1 de 5 CAC/GL 62-2007 Page 1 de 5 PRINCIPES DE TRAVAIL POUR L ANALYSE DES RISQUES EN MATIÈRE DE SÉCURITÉ SANITAIRE DES ALIMENTS DESTINÉS À ÊTRE APPLIQUÉS PAR LES GOUVERNEMENTS CAC/GL 62-2007 CHAMP D APPLICATION

Plus en détail

Raisonnement probabiliste

Raisonnement probabiliste Plan Raisonnement probabiliste IFT-17587 Concepts avancés pour systèmes intelligents Luc Lamontagne Réseaux bayésiens Inférence dans les réseaux bayésiens Inférence exacte Inférence approximative 1 2 Contexte

Plus en détail

PROPOSITION D UNE APPROCHE DE SEGMENTATION D IMAGES HYPERSPECTRALES

PROPOSITION D UNE APPROCHE DE SEGMENTATION D IMAGES HYPERSPECTRALES PROPOSITION D UNE APPROCHE DE SEGMENTATION D IMAGES HYPERSPECTRALES Nathalie GORRETTA MONTEIRO 1 1 UMR Information et Technologies pour les Agro-Procédés, Cemagref Montpellier, France Présentée le 25 Février

Plus en détail

ANNEXE J POTEAUX TESTÉS SELON UN CHARGEMENT STATIQUE ET TESTÉS SELON UN CHARGEMENT CYCLIQUE ET STATIQUE

ANNEXE J POTEAUX TESTÉS SELON UN CHARGEMENT STATIQUE ET TESTÉS SELON UN CHARGEMENT CYCLIQUE ET STATIQUE 562 ANNEXE J POTEAUX TESTÉS SELON UN CHARGEMENT STATIQUE ET TESTÉS SELON UN CHARGEMENT CYCLIQUE ET STATIQUE 563 TABLE DES MATIÈRES ANNEXE J... 562 POTEAUX TESTÉS SELON UN CHARGEMENT STATIQUE ET TESTÉS

Plus en détail

Evaluation d un test diagnostique - Concordance

Evaluation d un test diagnostique - Concordance Evaluation d un test diagnostique - Concordance Michaël Genin Université de Lille 2 EA 2694 - Santé Publique : Epidémiologie et Qualité des soins michaelgenin@univ-lille2fr Plan 1 Introduction 2 Evaluation

Plus en détail

Recherche et analyse de polymorphismes SNP

Recherche et analyse de polymorphismes SNP Recherche et analyse de polymorphismes SNP 1- Tablet : Détection visuelle de SNP avec Tablet Tablet est un outil graphique de visualisation d assemblage et d alignement de séquences issues de NGS (Next

Plus en détail

BACCALAURÉAT GÉNÉRAL SCIENCES DE LA VIE ET DE LA TERRE

BACCALAURÉAT GÉNÉRAL SCIENCES DE LA VIE ET DE LA TERRE BACCALAURÉAT GÉNÉRAL SESSION 2013 SCIENCES DE LA VIE ET DE LA TERRE Série S Durée de l'épreuve : 3h30 Coefficient : 6 ENSEIGNEMENT OBLIGATOIRE L'usage de la calculatrice n'est pas autorisé. Dès que le

Plus en détail

11 OSMOLARITÉ, MULTIPLES SOURCES DE VARIATION

11 OSMOLARITÉ, MULTIPLES SOURCES DE VARIATION 11 OSMOLARITÉ, MULTIPLES SOURCES DE VARIATION Dans cette étude de cas nous nous retrouvons face à des données dont la variabilité court terme est très différente de celle à long terme. Les cartes de contrôle

Plus en détail

Shadow Manager Simulateur de gestion globale d entreprise. Introduction

Shadow Manager Simulateur de gestion globale d entreprise. Introduction Shadow Manager Simulateur de gestion globale d entreprise Introduction Le logiciel de simulation d entreprise Shadow Manager représente le nec plus ultra des outils pédagogiques de simulation de gestion

Plus en détail

TP ENZYMES DE RESTRICTION, OUTILS DE LA BIOLOGIE MOLECULAIRE

TP ENZYMES DE RESTRICTION, OUTILS DE LA BIOLOGIE MOLECULAIRE THÈME : Des débuts de la génétique aux enjeux actuels des biotechnologies Niveau : Spécialité terminale S TP ENZYMES DE RESTRICTION, OUTILS DE LA BIOLOGIE MOLECULAIRE EXTRAIT DU BO: Notions et contenus

Plus en détail

Recensement de la population

Recensement de la population Recensement de la population Ménages et familles 1. Définition des concepts Un ménage Un ménage regroupe l ensemble des occupants d une résidence principale, qu ils aient ou non des liens de parenté. Un

Plus en détail

Simulation d un système d assurance automobile

Simulation d un système d assurance automobile Simulation d un système d assurance automobile DESSOUT / PLESEL / DACHI Plan 1 Introduction... 2 Méthodes et outils utilisés... 2.1 Chaines de Markov... 2.2 Méthode de Monte Carlo... 2.3 Méthode de rejet...

Plus en détail

Marketing Data Set: Follow-Up to Purchases of a Consumer Panel

Marketing Data Set: Follow-Up to Purchases of a Consumer Panel Marketing Data Set: Follow-Up to Purchases of a Consumer Panel Typologie des consommateurs et Mesure de la loyauté/fidélité Stéphanie Ledauphin-Menard, Sébastien Lê Face aux problèmes de pouvoir d achat

Plus en détail

PERCIMAP. Oreochromis niloticus. Construction d une carte RH à haute densité du génome de Tilapia CNRS UMR 6061

PERCIMAP. Oreochromis niloticus. Construction d une carte RH à haute densité du génome de Tilapia CNRS UMR 6061 PERCIMAP Construction d une carte RH à haute densité du génome de Tilapia Oreochromis niloticus CIRAD UPR20 Aquaculture et gestion des ressources aquatiques, Montpellier H. D Cotta E. Pepey J.F. Baroiller

Plus en détail

Les notes des candidats aux épreuves du baccalauréat général

Les notes des candidats aux épreuves du baccalauréat général Les notes des candidats aux épreuves du baccalauréat général Session 2001 Naghmeh ROBIN Ministère de la Jeunesse, de l Éducation nationale et de la Recherche Direction de la programmation et du développement

Plus en détail

Feuille de TP N 3 : Modèle log-linéaire - Travail guidé. 1 Cancers : modèle log-linéaire à deux facteurs croisés

Feuille de TP N 3 : Modèle log-linéaire - Travail guidé. 1 Cancers : modèle log-linéaire à deux facteurs croisés M1 MLG Année 2012 2013 Feuille de TP N 3 : Modèle log-linéaire - Travail guidé 1 Cancers : modèle log-linéaire à deux facteurs croisés Ce premier exercice reprend l exercice 1 de la feuille de TD n 3.

Plus en détail

Éléments hors bilan Rapport de vérification final Rapport N o 20/12 18 février 2013

Éléments hors bilan Rapport de vérification final Rapport N o 20/12 18 février 2013 Éléments hors bilan Rapport de vérification final Rapport N o 20/12 18 février 2013 Diffusion : Destinataires : Président et chef de la direction Premier vice-président et chef de la direction financière

Plus en détail

Chapitre 2 La diversification du vivant

Chapitre 2 La diversification du vivant Chapitre 2 La diversification du vivant 1 Introduction Méiose et fécondation : sources de diversité Mutations germinales : processus fondamental de diversification génétique, générateur de biodiversité

Plus en détail

Activité du 115 de Paris et évolution de la population des usagers du 115 et des EMA.

Activité du 115 de Paris et évolution de la population des usagers du 115 et des EMA. Activité du 115 de Paris et évolution de la population des usagers du 115 et des EMA. Carole Lardoux 1 Introduction Les données saisies par les agents de téléphonie du 115 de Paris sont extraites chaque

Plus en détail

ANALYSE BIVARIÉE DE VARIABLES QUALITATIVE ET QUANTITAVIE Analyse de Variance (ANOVA)

ANALYSE BIVARIÉE DE VARIABLES QUALITATIVE ET QUANTITAVIE Analyse de Variance (ANOVA) ANALYSE BIVARIÉE DE VARIABLES QUALITATIVE ET QUANTITAVIE Analyse de Variance (ANOVA) Dominique LAFFLY Maître de Conférences, Université de Pau Laboratoire Société Environnement Territoire UMR 5603 du CNRS

Plus en détail

Mortalité observée et mortalité attendue au cours de la vague de chaleur de juillet 2006 en France métropolitaine

Mortalité observée et mortalité attendue au cours de la vague de chaleur de juillet 2006 en France métropolitaine Mortalité observée et mortalité attendue au cours de la vague de chaleur de uillet en France métropolitaine FOUILLET A 1, REY G 1, JOUGLA E, HÉMON D 1 1 Inserm, U75, Villeuif, France. Inserm CépiDc, IFR9,

Plus en détail

STATISTIQUES A UNE VARIABLE EXERCICES CORRIGES

STATISTIQUES A UNE VARIABLE EXERCICES CORRIGES STATISTIQUES A UNE VARIALE EXERCICES CORRIGES Exercice n Les élèves d une classe ont obtenu les notes suivantes lors d un devoir : Note 4 5 8 0 4 5 8 0 Effectif 4 7 6 4 ) Déterminer l étendue et le mode

Plus en détail

Quentin Rougemont, Guillaume Evanno, Sophie Launey INRA Rennes UMR ESE

Quentin Rougemont, Guillaume Evanno, Sophie Launey INRA Rennes UMR ESE Quentin Rougemont, Guillaume Evanno, Sophie Launey INRA Rennes UMR ESE Rennes Le 19/02/2013 Evolution de l anadromie chez les lamproies Contexte général Objectifs Méthodologie Etats des connaissances Résultats

Plus en détail

II. LA DIVERSITE DE L'OCCUPATION DU TERRITOIRE

II. LA DIVERSITE DE L'OCCUPATION DU TERRITOIRE II. LA DIVERSITE DE L'OCCUPATION DU TERRITOIRE A. DEMOGRAPHIE 1. Evolution démographique 1.1. Dynamisme démographique 1.2. Structure de la population 1.3. Structure des ménages 2. Hypothèses d'évolution

Plus en détail

Distributions bayésiennes nonparamétriques sur les matrices binaires triangulaires infinies : Applications aux modèles graphiques

Distributions bayésiennes nonparamétriques sur les matrices binaires triangulaires infinies : Applications aux modèles graphiques Distributions bayésiennes nonparamétriques sur les matrices binaires triangulaires infinies : Applications aux modèles graphiques Patrick Dallaire Université Laval Département d informatique et de génie

Plus en détail

Lettres: A, T, G, C. Mots: à 3 lettres (codons) Phrase: gène (information pour synthétiser une protéine). Ponctuation

Lettres: A, T, G, C. Mots: à 3 lettres (codons) Phrase: gène (information pour synthétiser une protéine). Ponctuation 2- Les molécules d ADN constituent le génome 2-1 La séquence d ADN représente l information génétique Lettres: A, T, G, C Mots: à 3 lettres (codons) Phrase: gène (information pour synthétiser une protéine).

Plus en détail

Barcoding environnemental par séquençage haut débit

Barcoding environnemental par séquençage haut débit Barcoding environnemental par séquençage haut débit Potentiel et limites Jean-François Martin Échantillonnage Spécificités du barcoding environnemental Amplification (PCR) de marqueurs choisis Séquençage

Plus en détail

Probabilité mathématique et distributions théoriques

Probabilité mathématique et distributions théoriques Probabilité mathématique et distributions théoriques 3 3.1 Notion de probabilité 3.1.1 classique de la probabilité s Une expérience ou une épreuve est dite aléatoire lorsqu on ne peut en prévoir exactement

Plus en détail

Approche pratique de la transgénèse :

Approche pratique de la transgénèse : Approche pratique de la transgénèse : Recherche et analyse fine d une modification génétique dans le génome murin octobre 2006 1) 2) 3) 7) 8) 9) 10) 11) 12) 13) 14) Plan / Introduction Extraction et Préparation

Plus en détail

A- Exploiter des animations pour repérer une mutation et étudier son mécanisme de réparation.

A- Exploiter des animations pour repérer une mutation et étudier son mécanisme de réparation. THEME 1A : Expression, stabilité et variation du patrimoine génétique Chapitre 2 : Variabilité Génétique et Mutation de l ADN TP-3-: Réparation de l ADN, mutations et polyallélisme Les mutations de l ADN

Plus en détail

Chapitre 3 L assortiment indépendant des gènes. Des génotypes supérieurs de cultures telles que le riz ont révolutionné l agriculture.

Chapitre 3 L assortiment indépendant des gènes. Des génotypes supérieurs de cultures telles que le riz ont révolutionné l agriculture. Chapitre 3 L assortiment indépendant des gènes Des génotypes supérieurs de cultures telles que le riz ont révolutionné l agriculture. La variation de deux caractères Croisements monohybrides: entre 2 individus

Plus en détail

Étude de la biodiversité fongique à l aide de techniques de pyroséquençage

Étude de la biodiversité fongique à l aide de techniques de pyroséquençage Étude de la biodiversité fongique à l aide de techniques de pyroséquençage Biodiversité fongique Biodiversité: diversité spécifique d une communauté écologique, correspondant au nombre d espèces et à leur

Plus en détail

Analyse de la variance à deux facteurs

Analyse de la variance à deux facteurs 1 1 IRMA, Université Louis Pasteur Strasbourg, France Master 1 Psychologie du développement 06-10-2008 Contexte Nous nous proposons d analyser l influence du temps et de trois espèces ligneuses d arbre

Plus en détail

TD 5 : Génétique humaine

TD 5 : Génétique humaine TD 5 : Génétique humaine Exercice 1 (pour se mettre en forme...). Une femme de vision normale dont le père est daltonien (maladie héréditaire récessive, caractérisée par un défaut de vision des couleurs,

Plus en détail

Etat de la construction bois

Etat de la construction bois Etat de la construction bois en Belgique 2011-2014 Société L Artboiserie - Patrice Hennaut 7 % 7 % 2 % 1 % 83 % poursuite de l enquête 2011-2012 menée par Hout Info Bois Ossature en bois Bois massif empilé

Plus en détail

GENRE ET FECONDITE EN AFRIQUE SUBSAHARIENNE

GENRE ET FECONDITE EN AFRIQUE SUBSAHARIENNE GENRE ET FECONDITE EN AFRIQUE SUBSAHARIENNE Roger Armand WAKA MODJO Institut d Etudes Démographiques de l Université de Bordeaux IV. Introduction L Afrique subsaharienne reste de nos jours la sous région

Plus en détail

EVALUATION DE LA QUALITE DES SONDAGES EN LIGNE : CAS D UN SONDAGE D OPINION AU BURKINA FASO

EVALUATION DE LA QUALITE DES SONDAGES EN LIGNE : CAS D UN SONDAGE D OPINION AU BURKINA FASO EVALUATION DE LA QUALITE DES SONDAGES EN LIGNE : CAS D UN SONDAGE D OPINION AU BURKINA FASO Auteur Baguinébié Bazongo 1 Ingénieur Statisticien Economiste Chef de l Unité de recherche à l Institut national

Plus en détail

L acceptation de l homosexualité et de l adoption par les couples homosexuels à six mois de l élection présidentielle de 2012

L acceptation de l homosexualité et de l adoption par les couples homosexuels à six mois de l élection présidentielle de 2012 L acceptation de l homosexualité et de l adoption par les couples homosexuels à six mois de l élection présidentielle de 2012 Léa Morabito, Centre d Etudes Européennes, Sciences Po Paris. Manon Réguer-Petit,

Plus en détail

4. Résultats et discussion

4. Résultats et discussion 17 4. Résultats et discussion La signification statistique des gains et des pertes bruts annualisés pondérés de superficie forestière et du changement net de superficie forestière a été testée pour les

Plus en détail