Biologie Moléculaire & Génie Génétique. 6GT SG&SB FWB A.R. d Esneux Maître de Stage: Sylvie Bossrez Stagiaire: Pierre LECOCQ

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimension: px
Commencer à balayer dès la page:

Download "Biologie Moléculaire & Génie Génétique. 6GT SG&SB FWB A.R. d Esneux Maître de Stage: Sylvie Bossrez Stagiaire: Pierre LECOCQ"

Transcription

1 Biologie Moléculaire & Génie Génétique 6GT SG&SB FWB A.R. d sneux Maître de Stage: Sylvie Bossrez Stagiaire: Pierre LCOCQ 1

2 Introduction & Plan du cours N Les leçons proposées dans ce document s adressent aux élèves de 6-ième Générale/Transition, Sciences Générales (2P/sem) ou/et Sciences de Base (1P/sem). lles portent sur l acquisition de compétences/connaissances en matière d ADN, ARN et Protéines et de méthodologie expérimentale. Le contenu est identique pour les 6GTSG et 6GTSB. Toutefois les 6GTSB n auront pas la possibilité de mettre réellement en pratique la partie expérimentale. Mais ils pourront la visualiser sur base de résultats obtenus par les 6GTSG (en temps réel ou via photos / documents). De plus les 6GTSB disposeront du contenu mais ne recevront pas nécessairement l input direct concernant certains exemples d application (exemple: VIH) Outre la partie expérimentale (mise en pratique), les évaluations données en fin de document sont également différentes (même si elles portent sur la même matière). Leçons Titre/Contenu 6 GT SG 1 ADN, Transgénèse, Plasmides, nzymes de Restrictions, PCR, Clonage et Séquençage. 6 GT SG 2 ADN, Transgénèse, Plasmides, nzymes de Restrictions, PCR, Clonage et Séquençage + Intro aux Labos d lectrophorèse et de Transformation Cellulaire. 6 GT SG 3 Labos d lectrophorèse et de Transformation Cellulaire. 6 GT SG 4 Analyse des Résultats expérimentaux + Thérapie Génique, Next Generation Sequencing, VIH, Bioinformatics 6 GT SG 5 Thérapie Génique, Next Generation Sequencing, VIH, Bioinformatics + Info. valuation. 6 GT SG 6 valuation. 6 GT SB 1 ADN, Transgénèse, Plasmides, nzymes de Restrictions, PCR, Clonage et Séquençage. 6 GT SB 2 ADN, Transgénèse, Plasmides, nzymes de Restrictions, PCR, Clonage et Séquençage + Info. valuation. 6 GT SB 3 valuation + Thérapie Génique, Next Generation Sequencing, VIH Bioinformatics (selon temps disponible) lèves N/B lèves Couleur P Professeur N Ne pas imprimer 2

3 ADN, ARN & Protéines: valuation des Connaissances (1a) Comme la mémoire fait parfois défaut et qu en sus il s agit d une question de 1ier BAC Ulg (cours de M. Thiry): Travail de groupe (3-4) & «Consultation autorisée». Soit le fragment d ADN ci-dessous où les bases soulignées représentent des sites potentiels d initiation de la transcription et où les bases en minuscule représentent des introns. 5 - AAGCGGCTACaatgccgcTCGCCTATgccaccccgtGCCCCGCCTAGccgctaaGGGATT TTCGCCGATGttacggcgAGCGGATAcggtggggcaCGGGGCGGATCggcgattCCCTAA TCAGCTAGCGGATTAAGCATAT AGTCGATCGCCTAATTCGTATA -5 L un de ces deux brins code pour un petit peptide. 1. Identifiez le brin sens. Justifiez votre réponse. 2. crivez la séquence de l'arnm, telle qu elle se présente dans le cytoplasme. 3. Donnez la séquence en acides aminés du polypeptide obtenu après traduction. 4. Ce fragment d ADN pourrait-il correspondre à un gène bactérien? Justifiez. 5. Lorsque les cellules contenant ce gène sont soumises à un choc thermique, un épissage alternatif excluant l exon 3 se produit. Quelle répercussion cela aura-t-il sur le peptide produit? Pour vous faciliter la tâche voici (figure 1) le code International Union of Pure and Applied Chemistry (IUPAC; 1970). Figure 1 Vous avez 15 minutes à partir de maintenant! Source: New ngland Biolabs 3

4 ADN, ARN & Protéines: valuation des Connaissances (1a) Comme la mémoire fait parfois défaut et qu en sus il s agit d une question de 1ier BAC Ulg (cours de M. Thiry): Travail de groupe (3-4) & «Consultation autorisée». Soit le fragment d ADN ci-dessous où les bases soulignées représentent des sites potentiels d initiation de la transcription et où les bases en minuscule représentent des introns. 5 - AAGCGGCTACaatgccgcTCGCCTATgccaccccgtGCCCCGCCTAGccgctaaGGGATT TTCGCCGATGttacggcgAGCGGATAcggtggggcaCGGGGCGGATCggcgattCCCTAA TCAGCTAGCGGATTAAGCATAT AGTCGATCGCCTAATTCGTATA Identifiez le brin sens. Justifiez votre réponse. L un de ces deux brins code pour un petit peptide. 2. crivez la séquence de l'arnm, telle qu elle se présente dans le cytoplasme. 3. Donnez la séquence en acides aminés du polypeptide obtenu après traduction. 4. Ce fragment d ADN pourrait-il correspondre à un gène bactérien? Justifiez. 5. Lorsque les cellules contenant ce gène sont soumises à un choc thermique, un épissage alternatif excluant l exon 3 se produit. Quelle répercussion cela aura-t-il sur le peptide produit? Vous avez 15 minutes à partir de maintenant! 4

5 ADN, ARN & Protéines: valuation des Connaissances (1b) 1. Identifiez le brin sens. Justifiez votre réponse. P On «oublie» les introns (minuscules car ils vont disparaitre lors de la maturation de l ARNm) T ce qui est en amont (coté 5 ) du site d initiation de la transcription (tout simplement parce que cela ne fera pas partie de l ARNm primaire = «Transcrit»). On démarre en 5 au site d initiation et on cherche un ATG (le premier) et ensuite le premier codon STOP en phase. Ce qui donne donc (couleurs pour faciliter la visualisation): 5 -AAGCGGCTACTCGCCTATGCCCCGCCTAGGGGATTTCAGCTAGCGGATTAAGCATAT-3 3 -TTCGCCGATGAGCGGATACGGGGCGGATCCCCTAAAGTCGATCGCCTAATTCGTATA-5 Réponse: C est le brin du haut le seul à posséder la séquence 5 -ATG - 3 Remarque: n pratique on prend le premier ATG qu on trouve après le site d initiation de la transcription. Mais la «Nature» est la championne du monde pour nous réserver des surprises! t on ne trouve pas toujours un codon Stop car la séquence communiquée peutêtre incomplète ou/et incorrecte (ou l on trouve un faux codon Stop) 2. crivez la séquence de l'arnm, telle qu elle se présente dans le cytoplasme. Attention: Il s agit d une ARN (T / U) et dans le cytoplasme = après maturation! Splicing (épissage) des introns (voir point 1) Coiffe (7méthylGuanosine) et queue poly A (stabilité du ARNm) au signal de polyadénylation (AAUAAA mais variantes ) 3. Donnez la séquence en acides aminés du polypeptide obtenu après traduction. 4. Ce fragment d ADN pourrait-il correspondre à un gène bactérien? Justifiez. xons/introns Uniquement (presque) chez les ukaryotes! 5. Lorsque les cellules contenant ce gène sont soumises à un choc thermique, un épissage alternatif excluant l exon 3 se produit. Quelle répercussion cela aura-t-il sur le peptide produit? 5

6 Introduction à la «biologie moléculaire»: La Transgénèse (exemple.coli) Source: Figure 2 Résultat: La bactérie synthétise la protéine humaine grâce au transgène présent dans son ADN recombiné. Question: Comment? Quelles méthodes utilise-t-on? Remarque importante à propos du transgène Il ne doit pas contenir d introns mais uniquement la séquence codante de l ATG (Méthionine) au codon STOP car la bactérie ne fait pas d épissage, n utilise pas le promoteur ucaryote ni la «queue PolyA+» 6

7 Travail de groupe (3-4) La PCR (Polymerase Chain Reaction) (1a/4) N Visionnez attentivement la video (prenez des notes). Puis répondez aux questions qui suivent. Vocabulaire (Anglais vs. Français) Sample chantillon Small Petit Target Cible Single Unique Primer Amorce Fingerprinting mpreinte DNA ADN Involving Impliquant Amount Quantité Carry out Réaliser, générer, créer Polimerase Polymerase (erreur) Annealing Appariemment Length Longueur (taille en bp) 7

8 La PCR (Polymerase Chain Reaction) (1b/4) Travail de groupe (3-4). Visionnez attentivement la video (prenez des notes). Puis essayez de répondre aux questions. Vocabulaire (Anglais vs. Français) Sample chantillon Small Petit Target Cible Single Unique Primer Amorce Fingerprinting mpreinte DNA ADN Involving Impliquant Amount Quantité Carry out Réaliser, générer, créer Polimerase Polymerase (erreur) Annealing Appariement Length Longueur (taille en bp) Questions. Un chercheur de chez Janssen Diagnostics (JnJ) a isolé l ARN du virus VIH (rétrovirus, SIDA) à partir d un échantillon de sang d un patient. Il en a fait une copie ADN double-brin (partielle; la région codant pour la Protéase du virus) en utilisant une Reverse Transcriptase. Avant de procéder au séquençage (double brin) de ce fragment, il doit l amplifier par PCR. Il sait que le VIH est un virus qui a la particularité de modifier (mutations) très fortement la séquence codante pour la protéase (soulignée) mais par contre pas les régions en amont et en aval de celle-ci. Aidez-le à faire le «design» de 2 amorces pour amplifier l entièreté de la région codante de la Protéase sur base de la séquence nucléotidique (brin codant 5 vers 3 ) ci-dessous en sachant que : 1. La taille minimale d une amorce doit être de 18 nucléotides 2. Il est préférable que l amorce se termine en 3 par un G ou un C 3. n première approximation la température d appariement (mt ) doit être au minimum de 54 C et que les 2 les amorces doivent avoir approximativement (+/- 2 C) les mêmes mt. Formule de Wallace pour le calcul: mt = 4 x Σ GC + 2 x Σ AT (en C) Séquence du variant HXB2, le VIH utilisé comme référence pour l analyse des séquences VIH. 8

9 La PCR (Polymerase Chain Reaction) (2/4) 2161 ccaccagaag agagcttcag gtctggggta gagacaacaa ctccccctca gaagcaggag 2221 ccgatagaca aggaactgta tcctttaact tccctcaggt cactctttgg caacgacccc 2281 tcgtcacaat aaagataggg gggcaactaa aggaagctct attagataca ggagcagatg 2341 atacagtatt agaagaaatg agtttgccag gaagatggaa accaaaaatg atagggggaa 2401 ttggaggttt tatcaaagta agacagtatg atcagatact catagaaatc tgtggacata 2461 aagctatagg tacagtatta gtaggaccta cacctgtcaa cataattgga agaaatctgt 2521 tgactcagat tggttgcact ttaaattttc ccattagccc tattgagact gtaccagtaa 2581 aattaaagcc aggaatggat ggcccaaaag ttaaacaatg gccattgaca gaagaaaaaa La région en rouge (soulignée dans l énoncé) est celle dont le chercheur souhaite (au final) obtenir la séquence nucléotidique. Toutes les amorces doivent donc être choisies en amont et en aval. Oublions le séquençage et la RT-PCR, concentrons-nous sur l amplification! Amont: 5 ccaccagaagagagcttcaggtctggggtagagacaacaactccccctca 3 5 gaagcaggagccgatagacaaggaactgtatcctttaacttc Wallace mt Cumulative mt Position from Aval (séquence complémentaire réécrite 5 vers 3!!!): 5 ttttttcttctgtcaatggccattgtttaacttttgggccatccattcct 3 5 ggctttaattttactggtacagtctcaatagggctaatggg Wallace mt Cumulative mt Position from amorces utilisables (mt = 68 C) en PCR pourraient être: Amont: 5 caaggaactgtatcctttaacttc 3 (24 mer) Aval: 5 acagtctcaatagggctaatggg 3 (23 mer) 9

10 La PCR (Polymerase Chain Reaction) (3/4) L'amplification en chaîne par polymérase ou réaction en chaîne par polymérase (PCR est l'abréviation anglaise de Polymerase Chain Reaction) est une méthode de biologie moléculaire d'amplification génique in vitro, qui permet de dupliquer en grand nombre (avec un facteur de multiplication de l'ordre du milliard) une séquence d'adn ou d'arn connue, à partir d'une faible quantité (de l'ordre de quelques picogrammes) d'acide nucléique (séquence spécifique d ADN (l Amplicon)) et d'amorces spécifiques constituées d'oligonucléotides de synthèse de 20 à 25 nucléotides). On peut ainsi, par exemple, détecter la présence du virus VIH ou de mesurer une charge virale (concentration du virus dans le plasma), des traces d'ogm (organismes génétiquement modifiés), ou encore des virus d'hépatites B, C et D. De plus en plus utilisée en criminalistique, cette technique se fonde sur la combinaison de deux facteurs : 1. Les propriétés de synthèse enzymatique et d initiation spécifique à l'adn double brins spécifique des ADN polymérases dépendantes à l'adn thermostables. 2. Les propriétés d hybridation et de déshybridation des brins complémentaires d ADN en fonction de la température. Ces éléments permettent de contrôler l activité enzymatique grâce à des transitions de température (assurées par un thermocycleur) répétées de manière cyclique (cf. réaction en chaîne). Les premières ADN polymérases utilisées provenaient d'une bactérie thermophile (résistante à des températures très élevées), par exemple Thermus aquaticus (Taq polymérase) ou encore Pyrococcus furiosus (Pfu polymérase), Thermococcus litoralis (Vent ou Tli polymérase), Thermus thermophilus (Tth polymérase). De nos jours, les enzymes utilisées sont dites recombinantes (créées par construction génétique), ce qui simplifie considérablement leur obtention, et leurs propriétés ont été largement modifiées pour les rendre plus efficaces, plus fidèles La figure 3 page suivante schématise le processus de PCR. 10

11 La PCR (Polymerase Chain Reaction) (4/4) L'amplification en chaîne par polymérase ou réaction en chaîne par polymérase (PCR) Figure 3 Source: 11

Biologie Moléculaire & Génie Génétique

Biologie Moléculaire & Génie Génétique Biologie Moléculaire & Génie Génétique 6GT SG&SB FWB A.R. d sneux Maître de Stage: Sylvie Bossrez Stagiaire: Pierre LCOCQ Important! Les leçons seront publiées intégralement APRS avoir été données sur

Plus en détail

Biologie Moléculaire 6 GT SG FWB Leçon n 5

Biologie Moléculaire 6 GT SG FWB Leçon n 5 Biologie Moléculaire 6 GT SG FWB Leçon n 5 Tests de paternité (fin labo électrophorèse) Un test de paternité consiste à analyser l'adn de deux personnes dans le but d'établir un lien de parenté génétique.

Plus en détail

LE GÉNIE GÉNÉTIQUE ET LA BIOLOGIE MOLÉCULAIRE

LE GÉNIE GÉNÉTIQUE ET LA BIOLOGIE MOLÉCULAIRE LE GÉNIE GÉNÉTIQUE ET LA BIOLOGIE MOLÉCULAIRE Plan Introduction I - Qu est ce Que le génie génétique? II - Quels sont les outils du génie génétique? II.1- Les Enzymes II.1.1- Enzymes de restriction II.1.2-

Plus en détail

L2 microbiologie TD08: méthodes de la microbiologie moléculaire

L2 microbiologie TD08: méthodes de la microbiologie moléculaire # Andrew Tolonen (atolonen@gmail.com) # avril 2013 L2 microbiologie TD08: méthodes de la microbiologie moléculaire Exercise 1: amplification d'un gène d'intéret par PCR Vous êtes un médecin travaillant

Plus en détail

Voir en annexe, un tableau résumant toutes les techniques de la génétique moléculaire.

Voir en annexe, un tableau résumant toutes les techniques de la génétique moléculaire. Séance 5. Chapitre 4 : LA BIOLOGIE MOLECULAIRE ET SES APPLICATIONS I/ Les outils de la génétique moléculaire. Voir en annexe, un tableau résumant toutes les techniques de la génétique moléculaire. 1. Découverte

Plus en détail

Structure de l Opéron Tryptophane

Structure de l Opéron Tryptophane Régulation de la transcription (procaryote) Structure de l Opéron Tryptophane Opéron anabolique 5 gènes de structure nécessaires à la synthèse du tryptophane Trp Trp Trp Trp Trp 1 Régulation de la transcription

Plus en détail

ED Biologie moléculaire. E. Turpin J. Lehmann-Che 5-6 novembre 2007

ED Biologie moléculaire. E. Turpin J. Lehmann-Che 5-6 novembre 2007 ED Biologie moléculaire E. Turpin J. Lehmann-Che 5-6 novembre 2007 PCR 1983: Kary Mullis Amplification in vitro par une méthode enzymatique d'un fragmentd'adn en présence de deux oligonucléotides spécifiques

Plus en détail

Mise en évidence des agents infectieux par Biologie Moléculaire

Mise en évidence des agents infectieux par Biologie Moléculaire UE de l agent infectieux à l hôte Janvier 2012 Mise en évidence des agents infectieux par Biologie Moléculaire Dr Isabelle GARRIGUE Laboratoire de Virologie Professeur FLEURY isabelle.garrigue@chu-bordeaux.fr

Plus en détail

Principe des études moléculaires en génétique médicale Méthodes d analyse des microlésions du génome

Principe des études moléculaires en génétique médicale Méthodes d analyse des microlésions du génome Mercredi 23 Octobre LECLERCQ Barbara L2 GM Pr Krahn 10 pages Principe des études moléculaires en génétique médicale Méthodes d analyse des microlésions du génome Plan A. Introduction B. Techniques courantes

Plus en détail

Technologie de l ADN recombinant. Complément de cours sur: «Les Méthodes d Etude de la Cellule»

Technologie de l ADN recombinant. Complément de cours sur: «Les Méthodes d Etude de la Cellule» Technologie de l ADN recombinant Complément de cours sur: «Les Méthodes d Etude de la Cellule» 1 Les techniques de l ADN Recombinant But: isoler des fragments d ADN de génomes complexes et les recombiner

Plus en détail

Ingénierie des protéines

Ingénierie des protéines Ingénierie des protéines Stéphane Delbecq EA 4558 Vaccination antiparasitaire Laboratoire de Biologie Cellulaire et Moléculaire Faculté de Pharmacie - Montpellier Rappel: transcription et traduction Universalité

Plus en détail

De la biologie molécualire à la génomique

De la biologie molécualire à la génomique De la biologie molécualire à la génomique Pierre Neuvial École Nationale de la Statistique et de l Administration Économique Méthodes statistiques pour la biologie Plan du cours 1 Introduction à la biologie

Plus en détail

8. Amplification et séquençage des acides nucléiques

8. Amplification et séquençage des acides nucléiques 8. Amplification et séquençage des acides nucléiques ADN chromosomique, plasmides (ADN bactérienne), ARN messager Rupture cellulaire Isolation et purification des acides nucléiques Concentration et amplification

Plus en détail

Le monde des bio-puces

Le monde des bio-puces Le monde des bio-puces D1 Le «dogme central» de la biologie moléculaire Transcription Epissage Traduction ADN ARNpm ARNm Protéines Génome Transcriptome Protéome D2 Puces à ADN Techniques de génomique fonctionnelle

Plus en détail

DEVOIR A LA MAISON. BMGG (temps recommandé : 2H00)

DEVOIR A LA MAISON. BMGG (temps recommandé : 2H00) Pour jeudi 12/02/2014 DEVOIR A LA MAISON BMGG (temps recommandé : 2H00) Calculatrice non autorisée Dictionnaire anglais/français autorisé. Clonage et PCR En 1983, Kary Mullis conçut l'idée de la réaction

Plus en détail

Mise en évidence des agents infectieux par Biologie Moléculaire

Mise en évidence des agents infectieux par Biologie Moléculaire UE de l agent infectieux à l hôte Février 2015 Mise en évidence des agents infectieux par Biologie Moléculaire Dr Isabelle GARRIGUE UMR CNRS MFP Microbiologie Fondamentale et Pathogénicité isabelle.garrigue@chu-bordeaux.fr

Plus en détail

L'ADN peut être copié au travers des générations cellulaires successives de manière fidèle, c'est la réplication de l'adn.

L'ADN peut être copié au travers des générations cellulaires successives de manière fidèle, c'est la réplication de l'adn. 24/09/2014 REBOUL Nicolas L2 CR : Hamza BERGUIGUA Génétique Médicale Dr Martin KRAHN 8 pages Introduction à la Génétique Médicale : Les champs de la Génétique Médicale, La place de la Génétique Médicale

Plus en détail

Mlle ImaneSmaili SVI4. Encadré par: Responsable du cours de Biologie Moléculaire Pr. B. BELKADI

Mlle ImaneSmaili SVI4. Encadré par: Responsable du cours de Biologie Moléculaire Pr. B. BELKADI Mlle ImaneSmaili SVI4 Encadré par: Responsable du cours de Biologie Moléculaire Pr. B. BELKADI PLAN 1. Introduction 2.Définition 3. Principe 4.Les applications de la PCR Introduction La PCR «Polymerase

Plus en détail

Biologie Moléculaire & Génie Génétique. 6GT SG&SB FWB A.R. d Esneux Maître de Stage: Sylvie Bossrez Stagiaire: Pierre LECOCQ

Biologie Moléculaire & Génie Génétique. 6GT SG&SB FWB A.R. d Esneux Maître de Stage: Sylvie Bossrez Stagiaire: Pierre LECOCQ Biologie Moléculaire & Génie Génétique 6GT SG&SB FWB A.R. d Esneux Maître de Stage: Sylvie Bossrez Stagiaire: Pierre LECOCQ 1 Introduction & Plan du cours Les leçons proposées dans ce document s adressent

Plus en détail

Biologie Moléculaire et Organismes Modèles

Biologie Moléculaire et Organismes Modèles Biologie Moléculaire et Organismes Modèles Sami Khuri Department of Computer Science San José State University khuri@cs.sjsu.edu Usine de Protéines Les protéines sont responsables de la plupart des fonctions

Plus en détail

Baccalauréat général Sciences de la vie et de la Terre

Baccalauréat général Sciences de la vie et de la Terre Baccalauréat général Sciences de la vie et de la Terre Épreuve obligatoire série S Partie 1 (5 points) Thème 1-: Expression, stabilité, variation du patrimoine génétique. Sujet : On cherche à montrer,

Plus en détail

Le marquage moléculaire

Le marquage moléculaire Le marquage moléculaire Le marquage moléculaire regroupe un ensemble de techniques révélant des différences de séquences d (acide désoxyribonucléique) entre individus. Les marqueurs moléculaires permettent

Plus en détail

Digestion par les enzymes SalI et EcoRV. Digestion par les enzymes XhoI et SmaI

Digestion par les enzymes SalI et EcoRV. Digestion par les enzymes XhoI et SmaI 2 Digestion par les enzymes SalI et EcoRV Digestion par les enzymes XhoI et SmaI Klenow: sous-unité de l ADN Polymérase I d E. coli possédant une activité ADN polymérase 5-3 et une activité exonucléasique

Plus en détail

Taq'Ozyme Purple Mix MANUEL D UTILISATION

Taq'Ozyme Purple Mix MANUEL D UTILISATION Taq'Ozyme Purple Mix OZYA003-40 - 40 réactions OZYA003-200 - 200 réactions (avec supplément de MgCl 2 ) OZYA003-200XL - 200 réactions (avec supplément de MgCl 2 ) OZYA003-1000 - 1000 réactions (avec supplément

Plus en détail

BACCALAURÉAT TECHNOLOGIQUE

BACCALAURÉAT TECHNOLOGIQUE BACCALAURÉAT TECHNOLOGIQUE Série : Sciences et Technologies de Laboratoire Spécialité : Biotechnologies SESSION 2015 Sous-épreuve écrite de Biotechnologies Lundi 22 juin 2015 Coefficient de la sous-épreuve

Plus en détail

Taq Ozyme (Nouvelle Formulation) ADN polymérase thermostable

Taq Ozyme (Nouvelle Formulation) ADN polymérase thermostable Taq Ozyme (Nouvelle Formulation) OZYA001-1000 - 1000 unités OZYA001-5000 - 5000 unités OZYA001-1000D - 1000 unités + dntp Premix - 4x10 mm Stockage et stabilité : Taq Ozyme : 2 ans à -20 C dntp Premix

Plus en détail

I. Histoire de la biologie moléculaire (Q1 à Q5)

I. Histoire de la biologie moléculaire (Q1 à Q5) I. Histoire de la biologie moléculaire (Q1 à Q5) Q1. Concernant les premières lois sur l hérédité : Elles ont été établies grâce à des expériences menées sur la drosophile (Drosophila melanogaster). Elles

Plus en détail

Biologie Moléculaire (UE BI302) TD de Biologie Moléculaire (Procaryote) Année 2012/2013

Biologie Moléculaire (UE BI302) TD de Biologie Moléculaire (Procaryote) Année 2012/2013 Biologie Moléculaire (UE BI302) TD de Biologie Moléculaire (Procaryote) Année 2012/2013 M r Joshua Armitano Mr Thibault Sana M me Cécile Jourlin M me Amel Latifi M me Sandrine Pages Problème 1 : Amplification/clonage

Plus en détail

CHAPITRE III: Le Clonage

CHAPITRE III: Le Clonage BIOLOGIE MOLECULAIRE CHAPITRE III: Le Clonage I) Définition: Cloner un fragment d'adn consiste à: isoler physiquement ce fragment. en augmenter le nombre de copie (cf: amplification) II) Principe: Le clonage

Plus en détail

Chapitre 2. La synthèse protéique : la relation entre le génotype et le phénotype.

Chapitre 2. La synthèse protéique : la relation entre le génotype et le phénotype. Chapitre 2. La synthèse protéique : la relation entre le génotype et le phénotype. Les maladies génétiques comme la drépanocytose ou l'albinisme sont liées à des modifications du génotype des individus

Plus en détail

Licence-Master Bioinformatique Contrôle continu 06/03/06. Correction

Licence-Master Bioinformatique Contrôle continu 06/03/06. Correction Licence-Master Bioinformatique Contrôle continu 06/03/06 Correction -«Vraies» questions de cours -«fausses» questions de cours: questions pour voir si pouviez imaginer une réponse crédible qui n était

Plus en détail

Expression des gènes Comparatif entre procaryotes et eucaryotes

Expression des gènes Comparatif entre procaryotes et eucaryotes Comparaison procaryotes/ 2TSbc Expression des gènes Comparatif entre procaryotes et eucaryotes La majeure partie des connaissances de biologie moléculaire a d'abord débuté par l'étude des phénomènes chez

Plus en détail

TD Révision BIO57. Connaissance et Technique du gène

TD Révision BIO57. Connaissance et Technique du gène TD Révision BIO57 Connaissance et Technique du gène Novembre 2007 Cécile BAUDOT cecile.baudot@medecine.univ-mrs.fr INSERM 910 «Génétique Médicale et Génomique Fonctionnelle» Maladies Neuromusculaires Le

Plus en détail

Approfondissement des connaissances en biologie moléculaire

Approfondissement des connaissances en biologie moléculaire Approfondissement des connaissances en biologie moléculaire nicolas.glaichenhaus@unice.fr Master IADE Année 2013-2014 Plan du cours Rappels de biologie moléculaire et de biologie cellulaire Les molécules

Plus en détail

La dégradation des ARN eucaryotes : de la régulation de l expression des gènes au contrôle de qualité

La dégradation des ARN eucaryotes : de la régulation de l expression des gènes au contrôle de qualité La dégradation des ARN eucaryotes : de la régulation de l expression des gènes au contrôle de qualité Conférence de Mr. B.Séraphin DOBOSZ Alicia MEIER Marie M2 BBMC bgm Année 2012-2013 INTRODUCTION ARNm

Plus en détail

Les propriétés physicochimiques de l ADN Structure des génomes La chromatine

Les propriétés physicochimiques de l ADN Structure des génomes La chromatine Cours de Biologie Moléculaire L2S3 Structure de l ADN Organisation des génomes 2ème cours (1h30) Les propriétés physicochimiques de l ADN Structure des génomes La chromatine L ADN est chargé négativement

Plus en détail

Projet I. Objectifs. Vérifier la carte de restriction d une insertion d ADN. Cartographie des plasmides inconnus

Projet I. Objectifs. Vérifier la carte de restriction d une insertion d ADN. Cartographie des plasmides inconnus Projet I Vérifier la carte de restriction d une insertion d ADN Objectifs Déterminer quel gène vous avez (Bioinfo) Générer une carte théorique (Bioinfo) Vérifier expérimentalement la carte Déterminer l

Plus en détail

SEMIOLOGIE- Applications de la biologie moléculaire à la médecine. Applications de la biologie moléculaire à la médecine.

SEMIOLOGIE- Applications de la biologie moléculaire à la médecine. Applications de la biologie moléculaire à la médecine. 30/04/12 Camille Garbarino Sémiologie Pr Barlier 6 pages SEMIOLOGIE- Applications de la biologie moléculaire à la médecine. Applications de la biologie moléculaire à la médecine. Plan : A) Principales

Plus en détail

LES MARQUEURS MOLECULAIRES

LES MARQUEURS MOLECULAIRES LES MARQUEURS MOLECULAIRES Il y a différents types de marqueurs : o Les caractères phénotypiques : limités, observations sur l arbre entier et sur différentes années o Les marqueurs biochimiques o Les

Plus en détail

PCR (Polymerase Chain Reaction)

PCR (Polymerase Chain Reaction) PCR (Polymerase Chain Reaction) DEFINITION En 1983, Karry Mullis met au point une technique d amplification de l ADN: la PCR (Polymerase Chain Reaction ou Réaction de Polymérisation en Chaîne). Aujourd

Plus en détail

Professeur Joël LUNARDI

Professeur Joël LUNARDI Biochimie - Biologie moléculaire Chapitre 5 : La transcription Professeur Joël LUNARDI MED@TICE PCEM1 - Année 2006/2007 Faculté de Médecine de Grenoble - Tous droits réservés. Chapitre 5. La transcription

Plus en détail

Pathologies et génétique moléculaire

Pathologies et génétique moléculaire Biochimie - Biologie moléculaire Pathologies et génétique moléculaire Julien Fauré Institut de Formation en Soins Infirmiers 1 ère Année Année universitaire 2014-2015 Plan Les outils de la génétique moléculaire

Plus en détail

GLOSSAIRE. Aperto libro

GLOSSAIRE. Aperto libro GLOSSAIRE Aperto libro 1089 1090 GLOSSAIRE Acide désoxyribonucléique ou ADN (angl. DNA) : dimère constitué de deux brins hélicoïdaux composés de nucléotides dont les bases azotées sont la thymine, l adénine,

Plus en détail

Université du Québec à Montréal

Université du Québec à Montréal RECUEIL D EXERCICES DE BICHIMIE 6. Les acides nucléiques 6.2. Réplication, transcription et traduction P P P CH 2 H N H N N NH NH 2 Université du Québec à Montréal 6.2. Réplication, transcription et traduction

Plus en détail

TP BC : ADN recombinant BCPST1, ENCPB

TP BC : ADN recombinant BCPST1, ENCPB TP BC : principe et analyse de résultats des technologies de l ADN recombinant = clonage moléculaire = génie génétique Sources des illustrations : Analyse génétique moderne, Griffith et al., De Boeck,

Plus en détail

Biologie moléculaire et Génie génétique

Biologie moléculaire et Génie génétique Module 1 : Biologie moléculaire et Génie génétique Section 1 : STRUCTURES ET FONCTIONS DES ACIDES NUCLEIQUES Plutôt que de rechercher l'exhaustivité, on s'attachera à la clarification et la structuration

Plus en détail

Méthodes et techniques de la biologie du développement

Méthodes et techniques de la biologie du développement Méthodes et techniques de la biologie du développement 1. Etude de l expression des gènes : Détecter les transcrits et les protéines au cours de l ontogenèse l outil anticorps 1.1. La RT-PCR La réaction

Plus en détail

P.C.R. POLYMERASE CHAIN REACTION ou AMPLIFICATION PAR POLYMERISATION EN CHAÎNE

P.C.R. POLYMERASE CHAIN REACTION ou AMPLIFICATION PAR POLYMERISATION EN CHAÎNE P.C.R. POLYMERASE CHAIN REACTION ou AMPLIFICATION PAR POLYMERISATION EN CHAÎNE P.C.R.: Méthode rapide d'amplification d'une séquence déterminée d'a.d.n. à partir d'une matrice. Elle permet d'obtenir plusieurs

Plus en détail

Les outils du génie génétique.

Les outils du génie génétique. Les outils du génie génétique. I\ Les enzymes. On va se servir des enzymes pour couper, coller et synthétiser des acides nucléiques. A\ Les polymérases. Toutes les polymérases agissent de 5 vers 3. En

Plus en détail

Fabrication des produits de thérapie génique : garantir la sécurité et la qualité des produits

Fabrication des produits de thérapie génique : garantir la sécurité et la qualité des produits Fabrication des produits de thérapie génique : garantir la sécurité et la qualité des produits DIAPOSITIVE 1 Cette présentation a trait à la fabrication des produits de thérapie génique, en termes de sécurité

Plus en détail

Bioinformatique dans l IUP

Bioinformatique dans l IUP Bioinformatique dans l IUP Intervenants Equipe Bioinfo (Laboratoire d Informatique Fondamentale de Lille) Cours : Jean-Stéphane Varré (jean-stephane.varre@lifl.fr) TD sur machine : Jean-Stéphane Varré,

Plus en détail

Chapitre 1. Histoire de la biologie moléculaire

Chapitre 1. Histoire de la biologie moléculaire Chapitre 1. Histoire de la biologie moléculaire 1. L idée que les caractères observables (le phénotype) d un individu puissent se transmettre de génération en génération par des «unités» héritées (le génotype)

Plus en détail

BIO6: Bioinformatique appliquée Correction du TD3

BIO6: Bioinformatique appliquée Correction du TD3 BIO6: Bioinformatique appliquée Correction du TD3 Exercice 1 : programmation dynamique voir le site web indiqué dans le TD pour corriger l'exercice Exercice 2 : similarité de séquence et distance évolutive

Plus en détail

REGULATION DE L EXPRESSION DES GENES.

REGULATION DE L EXPRESSION DES GENES. REGULATION DE L EXPRESSION DES GENES. Modification épigénétiques : viennent s ajouter à la séquence nucléotidique. La séquence nucléotidique est transmise intacte de la cellule mère à la cellule fille.

Plus en détail

Le gène, de l'adn aux protéines

Le gène, de l'adn aux protéines 13/10/2011 - Par Claude Sauter Le gène, de l'adn aux protéines La vie d'un gène, de sa duplication à la fabrication d'une protéine pour laquelle il code, est une succession d'étapes cruciales. Ce dossier

Plus en détail

FICHES REVISION UE 2

FICHES REVISION UE 2 FICHES REVISION UE 2 «Ce document est la propriété du TAM. Toute autorisation totale ou partielle sans son autorisation sera passible de poursuites selon les articles. L. 335-2 et 335-3 du Code de la Propriété

Plus en détail

LE SEQUENCAGE DU GENOME HUMAIN. Historique Séquençage Résultats

LE SEQUENCAGE DU GENOME HUMAIN. Historique Séquençage Résultats LE SEQUENCAGE DU GENOME HUMAIN Historique Séquençage Résultats Séquençage de Macromolécules Enchaînement d unités répétitives Petite molécule Couper de façon précise en sous-ensemble 50 25 25 reconstruire

Plus en détail

ECUE 2 (L 1 -S 2 ) : Microbiologie générale Microbiologie générale

ECUE 2 (L 1 -S 2 ) : Microbiologie générale Microbiologie générale Unité d enseignement UE 8 : Biologie Moléculaire - Microbiologie ECUE 2 (L 1 -S 2 ) : Microbiologie générale Microbiologie générale 1h30 de cours et 1h15 de Travaux pratiques Un examen écrit ; un examen

Plus en détail

Génie génétique. Définition : Outils nécessaires : Techniques utilisées : Application du génie génétique : - Production de protéines

Génie génétique. Définition : Outils nécessaires : Techniques utilisées : Application du génie génétique : - Production de protéines Génie génétique Définition : Ensemble de méthodes d investigation et d expérimentation sur les gènes. Outils nécessaires : ADN recombinant, enzyme de restriction, vecteur, banque ADNc, sonde nucléique...

Plus en détail

Licence d Informatique Année 2001-2002 Option: Introduction à la biologie moléculaire. LA P.C.R. Polymerase Chain Reaction

Licence d Informatique Année 2001-2002 Option: Introduction à la biologie moléculaire. LA P.C.R. Polymerase Chain Reaction Licence d Informatique Année 2001-2002 Option: Introduction à la biologie moléculaire LA P.C.R. Polymerase Chain Reaction "chercher une aiguille dans une meule de foin"? Chercher à repérer un gène particulier

Plus en détail

LA TRANSCRIPTION. Introduction. I. Modalité générale de la transcription. II. Transcription chez les Procaryotes

LA TRANSCRIPTION. Introduction. I. Modalité générale de la transcription. II. Transcription chez les Procaryotes LA TRANSCRIPTION Introduction I. Modalité générale de la transcription II. Transcription chez les Procaryotes 1. L'ARN polymérase 2. Etapes de la transcription a. Initiation b. Elongation c. Terminaison

Plus en détail

TP 2 : Les enzymes digestives.

TP 2 : Les enzymes digestives. TP 2 : Les enzymes digestives. Animation : Enzymes Ils existent des milliers d enzymes qui interviennent simultanément dans des réactions chimiques. Problèmes : Comment les enzymes agissent-elles sur leur

Plus en détail

CHAPITRE 3 LA SYNTHESE DES PROTEINES

CHAPITRE 3 LA SYNTHESE DES PROTEINES CHAITRE 3 LA SYNTHESE DES ROTEINES On sait qu un gène détient dans sa séquence nucléotidique, l information permettant la synthèse d un polypeptide. Ce dernier caractérisé par sa séquence d acides aminés

Plus en détail

GM- Support de l'information génétique ; structure et fonction du génome. Support de l'information génétique ; structure et fonction du génome

GM- Support de l'information génétique ; structure et fonction du génome. Support de l'information génétique ; structure et fonction du génome Mercredi 9 octobre ABECASSIS Anna L2 GM Pr Beroud 16 pages Support de l'information génétique ; structure et fonction du génome Plan A. Des gènes aux protéines I. Structure de l'adn II. Structure des gènes

Plus en détail

Interprétation des résultats

Interprétation des résultats Plateforme de séquençage Cochin Interprétation des résultats Grace à la base de données vous avez un accès direct à vos séquences. Pour valider la qualité de ces séquences vous devez visualiser leur chromatogramme.

Plus en détail

La médecine personnalisée Daniel Locker Professeur honoraire Université Orléans

La médecine personnalisée Daniel Locker Professeur honoraire Université Orléans La médecine personnalisée Daniel Locker Professeur honoraire Université Orléans Introduction En 1992, l introduction d'un anticorps monoclonal, l herceptine, pour le traitement du cancer du sein a donné

Plus en détail

Travaux dirigés de Biologie Moléculaire 7 semaine 9

Travaux dirigés de Biologie Moléculaire 7 semaine 9 Travaux dirigés de Biologie Moléculaire 7 semaine 9 Electron micrograph of transcription Exercice n 21 : transcription in vitro RNA polymerase/transcription and DNA polymerase/replication RNA pol DNA pol

Plus en détail

Méthodes d études. Chapitre 8 : Professeur Joël LUNARDI. UE1 : Biochimie Biologie moléculaire

Méthodes d études. Chapitre 8 : Professeur Joël LUNARDI. UE1 : Biochimie Biologie moléculaire Chapitre 8 : UE1 : Biochimie Biologie moléculaire Méthodes d études Professeur Joël LUNARDI Année universitaire 2010/2011 Université Joseph Fourier de Grenoble - Tous droits réservés. Chapitre 8. 8. Méthodes

Plus en détail

La synthèse des protéines transcription code génétique traduction

La synthèse des protéines transcription code génétique traduction CEC André-Chavanne BIO 3 OS La synthèse des protéines transcription code génétique traduction I. La «Transcription» : de l ADN à l ARNm. L'adresse suivante permet d accéder à une ANIMATION sur la TRANSCRIPTION.

Plus en détail

Identification et détection des virus. A) Détection symptomatologique

Identification et détection des virus. A) Détection symptomatologique Identification et détection des virus La détection et l'identification des virus font appel à différentes méthodes. Ces méthodes se caractérisent par leur spécificité et leur sensibilité. On peut citer

Plus en détail

Professeur Joël LUNARDI

Professeur Joël LUNARDI Biochimie - Biologie moléculaire Chapitre 9 : Applications médicales Professeur Joël LUNARDI MED@TICE PCEM1 - Année 2006/2007 Faculté de Médecine de Grenoble - Tous droits réservés. Chapitre 9. APPLICATIONS

Plus en détail

Lettres: A, T, G, C. Mots: à 3 lettres (codons) Phrase: gène (information pour synthétiser une protéine). Ponctuation

Lettres: A, T, G, C. Mots: à 3 lettres (codons) Phrase: gène (information pour synthétiser une protéine). Ponctuation 2- Les molécules d ADN constituent le génome 2-1 La séquence d ADN représente l information génétique Lettres: A, T, G, C Mots: à 3 lettres (codons) Phrase: gène (information pour synthétiser une protéine).

Plus en détail

PCR (POLYMERASE CHAIN REACTION)

PCR (POLYMERASE CHAIN REACTION) PCR (POLYMERASE CHAIN REACTION) Amplification des acides nucléiques PCR RT-PCR Et leurs applications PCR en temps réel La PCR : une révolution technologique en biologie moléculaire APPLICATIONS : - Médecine

Plus en détail

8.3.3 Réactifs. La polymérase catalyse la synthèse de brins complémentaires d ADN.

8.3.3 Réactifs. La polymérase catalyse la synthèse de brins complémentaires d ADN. 8.3.3 Réactifs 1. AD polymérase: La polymérase catalyse la synthèse de brins complémentaires d AD. Des polymérases qui sont résistantes à la chaleur sont utilisées, telles que la Taq polymérase (Thermus

Plus en détail

THEME 1 A EXPRESSION, STABILITE ET VARIATION DU PATRIMOINE GENETIQUE

THEME 1 A EXPRESSION, STABILITE ET VARIATION DU PATRIMOINE GENETIQUE THEME 1 A EXPRESSION, STABILITE ET VARIATION DU PATRIMOINE GENETIQUE CHAPITRE 3 L EXPRESSION DU PATRIMOINE GENETIQUE I. LA RELATION GENES-PROTEINES Les protéines interviennent dans le fonctionnement d

Plus en détail

Les grands enjeux scientifiques du début du XXIème siècle. Jean-Yves Le Déaut

Les grands enjeux scientifiques du début du XXIème siècle. Jean-Yves Le Déaut Les grands enjeux scientifiques du début du XXIème siècle Jean-Yves Le Déaut Séances sur les biotechnologies Séance 1 : 25 février 2009 Introduction sur les biotechnologies Avec Pierre TAMBOURIN, Directeur

Plus en détail

III/De la structure à la fonction.. Le B.A.-ba Principes généraux la réplication/la transcription/la traduction

III/De la structure à la fonction.. Le B.A.-ba Principes généraux la réplication/la transcription/la traduction III/De la structure à la fonction.. Le B.A.-ba Principes généraux la réplication/la transcription/la traduction Attention! Seuls les concepts généraux seront explicités en cours Mais vous pouvez approfondir

Plus en détail

L Expression génique, la transcription et sa régulation : Approches expérimentales.

L Expression génique, la transcription et sa régulation : Approches expérimentales. L Expression génique, la transcription et sa régulation : Approches expérimentales. I - Généralités I - 1 : Expression et niveaux de régulations d un gène eucaryote ADN Transcrit primaire Transcription

Plus en détail

Préparation et réalisation de réactions de séquence (Quick Start Kit, Beckman Coulter)

Préparation et réalisation de réactions de séquence (Quick Start Kit, Beckman Coulter) MODE OPERATOIRE Code : SSG / 001 UMR 1229 MGS Microbiologie et Géochimie des Sols 17 rue Sully BP86510 21065 Dijon Cedex Rédigé par : D. Bru Préparation et réalisation de réactions de séquence (Quick Start

Plus en détail

CORRECTION DES EXERCICES DE GENETIQUE SYNTHESE PROTEIQUE : P 136-137

CORRECTION DES EXERCICES DE GENETIQUE SYNTHESE PROTEIQUE : P 136-137 CORRECTION DES EXERCICES DE GENETIQUE SYNTHESE PROTEIQUE : P 136-137 Exercice 1 p 171 : définir en une phrase les mots suivants Polypeptide : chaine de plusieurs acides aminés. Séquence protéinique : séquence

Plus en détail

FLUX D INFORMATION GÉNÉTIQUE

FLUX D INFORMATION GÉNÉTIQUE FLUX D INFORMATION GÉNÉTIQUE 2 MÉCANISME GÉNÉRAL DE LA TRANSCRIPTION La transcription est une biosynthèse d ARN qui repose, comme celle de l ADN, sur la complémentarité des bases. Ce processus présente

Plus en détail

Activité Intitulé de l'activité Volume horaire

Activité Intitulé de l'activité Volume horaire Informations de l'unité d'enseignement Implantation Cursus de Institut Paul Lambin Bachelier en chimie Intitulé Biotechnologie 2 C2120 Cycle 1 Bloc 2 Quadrimestre 2 Pondération 1 Nombre de crédits 5 Nombre

Plus en détail

Jean-Louis Bergé-Lefranc

Jean-Louis Bergé-Lefranc Apport du séquençage du génome humain à la toxicologie: Toxicogénomique Jean-Louis Bergé-Lefranc QuickTime et un décompresseur TIFF (LZW) sont requis pour visionner cette image. QuickTime et un décompresseur

Plus en détail

Cours de Biologie moléculaire de Licence professionnelle 2011

Cours de Biologie moléculaire de Licence professionnelle 2011 Cours de Biologie moléculaire de Licence professionnelle 2011 Sommaire 1. Introduction 2.1. La structure de l ADN 2.2. La structure de l ARN 2.3. Du gène à la protéine 2.3.1. La réplication 2.3.2. La transcription

Plus en détail

L'ordre et la nature des acides aminés (ou séquence) d un polypeptide dépend de la séquence des nucléotides de l ADN du gène qui le code.

L'ordre et la nature des acides aminés (ou séquence) d un polypeptide dépend de la séquence des nucléotides de l ADN du gène qui le code. L'ordre et la nature des acides aminés (ou séquence) d un polypeptide dépend de la séquence des nucléotides de l ADN du gène qui le code. Une mutation, peut entraîner une modification de la séquence des

Plus en détail

Université Bordeaux Segalen - PACES 2011-2012 ED UE9s Mars 2012

Université Bordeaux Segalen - PACES 2011-2012 ED UE9s Mars 2012 Sélectionner les propositions exactes Université Bordeaux Segalen - PACES 2011-2012 ED UE9s Mars 2012 QCM 1. La température de fusion (Tm) d une molécule d ADN : A. est mise en évidence par l augmentation

Plus en détail

Réaction en chaîne par polymérase

Réaction en chaîne par polymérase Page 1 sur 13 Réaction en chaîne par polymérase Un article de Wikipédia, l'encyclopédie libre. La réaction en chaîne par polymérase (PCR en anglais pour Polymerase Chain Reaction), est une méthode de biologie

Plus en détail

Collège Notre Dame de Jamhour. THEME 1A : Expression, stabilité et variation du patrimoine génétique

Collège Notre Dame de Jamhour. THEME 1A : Expression, stabilité et variation du patrimoine génétique Collège Notre Dame de Jamhour Classe : 1 ère S THEME 1A : Expression, stabilité et variation du patrimoine génétique Chapitre 3 : L expression du patrimoine génétique TD- 5 : La protéosynthèse, un processus

Plus en détail

L3-BH01 Cours n 10 Modifications post-transcriptionnelles

L3-BH01 Cours n 10 Modifications post-transcriptionnelles L3-BH01 Cours n 10 Modifications post-transcriptionnelles Ce cours est présent sur le web à l adresse suivante : http://www.univ-orleans.fr/sciences/biochimie/l/ressources.htm Plan (cours n 10 & 11) Introduction

Plus en détail

PRINCIPALES TECHNIQUES UTILISEES EN GENOMIQUE

PRINCIPALES TECHNIQUES UTILISEES EN GENOMIQUE PRINCIPALES TECHNIQUES UTILISEES EN GENOMIQUE Définitions généralités Quelques chiffres 46 chromosomes 22 paires d autosomes (n=44) 1 paire de gonosomes (n=2) : XX/F et XY/H 300 bandes cytogénétiques =

Plus en détail

Techniques de base de la biologie moléculaire

Techniques de base de la biologie moléculaire Techniques de base de la biologie moléculaire Présenté par : Addoun Hadjer Ait Saadi Taous Plan: Introduction Purification des acides nucléiques 1-extraction à partir de matériels biologiques 2-estimation

Plus en détail

III - Régulation du métabolisme A) X B) Transcription

III - Régulation du métabolisme A) X B) Transcription BPV : Physiologie Bactérienne UE: 5 Semaine : n 9 (du 02/11/2015 au 06/11/2015 Date : 03/11/2015 Heure : de 9h-10h Professeur : Pr. Romond Binôme : n 54 Correcteur : 53 Aucune remarque particulière du

Plus en détail

La Bioinformatique fonctionnelle Retrouver les Gènes

La Bioinformatique fonctionnelle Retrouver les Gènes Biologie moléculaire-2016 1 La Bioinformatique fonctionnelle Retrouver les Gènes Le séquençage est devenu chose tellement courante, que dans les dernières années nous avons obtenu les séquences complètes

Plus en détail

SERVICES DE SEQUENÇAGE

SERVICES DE SEQUENÇAGE JANUARY 30, 2012 SERVICES DE SEQUENÇAGE Centre d Innovation Génome Québec et Université McGill Services de détection de SNP et séquençage de novo par extension d amorce Technologie de type Sanger Guide

Plus en détail

Séance génome : Explication PCR et électrophorèse

Séance génome : Explication PCR et électrophorèse Séance génome : Explication PCR et électrophorèse La PCR (Polymérase Chain Reaction) est une technique qui permet de démultiplier en de très nombreuses quantités une séquence de nucléotides parmi l ensemble

Plus en détail

Clonage de Vénus et transformation de E.Coli.

Clonage de Vénus et transformation de E.Coli. Clonage de Vénus et transformation de E.Coli. Samueal Joseph, Romain Laverrière, Elias Laudato, Noé Mage Assisstants : Gisele Dewhurst, Charlotte Gehin, Miwa Umebayashi Résumé [1] L expérience consiste

Plus en détail

Université D Oran, Faculté de Médecine, Service D Histologie-Embryologie Dr Belarbi-Amar. Le virus. Les virus(acaryotes)

Université D Oran, Faculté de Médecine, Service D Histologie-Embryologie Dr Belarbi-Amar. Le virus. Les virus(acaryotes) Les virus(acaryotes) Le virus I-Généralités : Le virus (cellule acaryote) est une entité biologique incapable de se reproduire de façon autonome, nécessitant une cellule hôte, dont il utilise les constituants

Plus en détail

LA SYNTHÈSE DES PROTÉINES

LA SYNTHÈSE DES PROTÉINES LA SYNTHÈSE DES PROTÉINES La transcription Information : dans le noyau (sous forme d'adn) Synthèse des protéines : dans le cytoplasme (au niveau des ribosomes du reticulum endoplasmique) L'ADN ne sort

Plus en détail

Cahier de texte de la classe 1 ère 4 - SVT

Cahier de texte de la classe 1 ère 4 - SVT Cahier de texte de la classe 1 ère 4 - SVT DATE SEQUENCE lundi 12 : revoir la fiche méthodologique «utiliser le microscope optique» (disponible sur le site du lycée) Lundi 12 1 er contact avec les élèves.

Plus en détail

Chapitre 7 : IMMUNOLOGIE

Chapitre 7 : IMMUNOLOGIE Chapitre 7 : IMMUNOLOGIE (*) Introduction Définition : SYSTEME IMMUNITAIRE (SI) : C est un ensemble d organes, de cellules et de tissus dont la fonction est la défense du corps humain, c est à dire le

Plus en détail