Séquence 1. Reproduction conforme de la cellule et réplication de l ADN Variabilité génétique et mutation de l ADN

Dimension: px
Commencer à balayer dès la page:

Download "Séquence 1. Reproduction conforme de la cellule et réplication de l ADN Variabilité génétique et mutation de l ADN"

Transcription

1 Séquence 1 Reproduction conforme de la cellule et réplication de l ADN Variabilité génétique et mutation de l ADN Sommaire 1. Reproduction conforme de la cellule et réplication de l ADN 2. Variabilité génétique et mutation de l ADN Synthèse de la séquence 1 Exercices de la séquence 1 Devoir autocorrectif n 1 Séquence 1 SN12 1

2 1 Reproduction conforme de la cellule et réplication de l ADN Pour s interroger Le développement d un être vivant à partir d une cellule œuf implique des divisions cellulaires et les cellules se différencient en types cellulaires spécifiques des organes qu elles constituent. L ADN, constituant des chromosomes est le support moléculaire de l information génétique contenue dans le noyau. Cette molécule, selon le moment du cycle de vie d une cellule peut se présenter sous différents degrés de condensation (d enroulement). Tantôt décondensé, l ADN forme la chromatine diffuse ; tantôt condensé il forme un chromosome visible au microscope Document 1 Une même matière sous deux formes rembobinage chromatine débobinage rembobinage chromosomes Comme la pelote est de la laine soigneusement enroulée, le chromosome est de la chromatine soigneusement enroulée. laine débobinée débobinage pelotes de laine L information génétique est intégralement transmise au cours d une division cellulaire. Le nombre de chromosomes dans une cellule humaine est constant : il y en a 23 de types différents dans les gamètes et 23 paires de chaque type dans les autres cellules. Ceci concerne tous les êtres vivants eucaryotes (dont les cellules possèdent un noyau différencié) comme par exemple le mouton Document 2 Cellule œuf de mouton à 54 chomosomes Mouton formé de cellules à 54 chomosomes Séquence 1 SN12 3

3 Quelles sont les modalités de la division cellulaire au niveau chromosomique et comment l information génétique estelle intégralement transmise d une cellule mère aux deux cellules filles obtenues par sa division? A Le cycle cellulaire et ses phases 1. Aspects du matériel génétique au cours d un cycle cellulaire Dans le noyau d une cellule humaine, les molécules d ADN sont enroulées autour de protéines spécifiques appelées histones. Le degré d enroulement de l ADN est variable au cours de la vie cellulaire. En dehors des périodes de mitose, l enroulement est relativement lâche, on dit que l ADN est décondensé. L association ADN-histones décondensé forme des filaments très fins appelés nucléofilaments (=filaments du noyau) uniquement visibles en microscopie électronique à très fort grossissement. L ensemble constitue la chromatine diffuse du noyau. Au contraire, lors des divisions cellulaires, le degré d enroulement de l ADN est plus important, l ADN se condense pour former les chromosomes. En début de division, chaque chromosome visible est constitué de deux chromatides unies entre-elles au niveau du centromère. Chaque chromatide est constituée d une molécule d ADN. Le schéma du document 3 illustre la structure d un chromosome condensé en période de division cellulaire. Activité 1 Document 3 Chromosomes et ADN au cours d un cycle cellulaire Recenser, extraire et organiser des informations Structure d un chromosome en période de division cellulaire Une chromatide L autre chromatide Centromère 4 Séquence 1 SN12

4 Document 4 En utilisant les figurés indiqués, repérer les différentes parties d un chromosome. Aspects du matériel génétique au cours de différentes phases du cycle cellulaire Cellule sanguine (leucocyte) observée au MET. Repasser en rouge le contour du noyau et compléter les légendes. Noyau observé au MET (x 4000). Quel est le constituant principal du noyau? Quel est sa nature moléculaire? Schématisation d une partie d un nucléofilament. Légender le schéma. L état de l ADN est État du matériel génétique en dehors de la Cellule de jacinthe au microscope optique (x 600) Représentation schématique de l ADN d une des deux chromatides d un chromosome. L état de l ADN est État du matériel génétique en période de la Compléter le tableau du document 4 indiquant les aspects du matériel génétique à différents moments de la vie cellulaire. À retenir En dehors de la division cellulaire (interphase), les molécules d ADN sont décondensées en chromatine diffuse. En début de division cellulaire (mitose), les molécules d ADN sont condensées en chromosomes à deux chromatides. Chaque chromatide est constituée d une molécule d ADN. Séquence 1 SN12 5

5 Document 5 Chromosome et ADN 2. Les modifications des structures cellulaires et le comportement des chromosomes au cours de la mitose On va approfondir les aspects chromosomiques de la mitose abordée dans les classes précédentes On a observé précédemment qu en interphase, le contenu nucléaire se présente sous forme de chromatine diffuse et lors de la mitose (du grec mitosis = bâton), le matériel nucléaire devient visible sous forme de chromosomes. Pour observer la mitose on choisit un organe en croissance rapide, par exemple dans une racine de jacinthe où des mitoses sont observables On distingue différentes étapes au cours desquelles le matériel nucléaire subit des modifications. On délimite arbitrairement plusieurs phases de la mitose pour en faciliter la description et on leur donne un nom. Chaque phase est caractérisée par un état nucléaire particulier Ici, sont présentées les différentes étapes de la mitose de cellules de racine de jacinthe observées au microscope optique (x 600). Microphotographie à gauche et interprétation schématique à droite. La première phase de la mitose (document 6) ou prophase est la phase la plus longue (de 15 à 60 min). Document 6 Prophase 6 Séquence 1 SN12

6 Les nucléofilaments se condensent pour constituer les chromosomes. À ce stade chaque chromosome correspond à deux chromatides unies au niveau du centromère. Un faisceau de fibres protéiques forme un fuseau de division qui se met en place autour du noyau cellulaire. La deuxième phase (document 7) ou métaphase ne dure que quelques minutes. Document 7 Métaphase Vue polaire Vue polaire Vue équatoriale L enveloppe nucléaire se fragmente et disparaît progressivement. Les chromosomes se rassemblent au centre de la cellule, au niveau du plan équatorial de la cellule, c est-à-dire à égale distance des deux pôles du fuseau de division. Chaque chromatide d un chromosome se fixe, par une structure particulière située près du centromère, à des fibres du fuseau reliées à l un ou l autre des pôles de la cellule. Remarque : c est à ce stade que sont réalisés les caryotypes (ensemble des chromosomes d une cellule) car le degré de condensation de l ADN est maximal et donc les chromosomes le mieux visibles. La troisième phase (document 8) ou anaphase ne dure que 2 à 3 min. Document 8 Anaphase Il y a clivage au centromère (chaque centromère se scinde en deux) et les deux chromatides de chaque chromosome se séparent. Les fibres du fuseau se raccourcissent et tractent les chromosomes à une chromatide vers l un ou l autre des pôles de la cellule (le centromère en avant, les «bras» du chromosome en arrière). Les chromosomes se déplacent à environ 1μm par seconde. À la fin de l anaphase, un lot complet de chromosomes à une chromatide se trouve à chacun des deux pôles de la cellule. La quatrième phase (document 9) ou telophase dure 15 à 60 minutes. Séquence 1 SN12 7

7 Document 9 Télophase L ADN se décondense, ce qui entraîne la «disparition» progressive des chromosomes et la reconstitution de la chromatine diffuse. Les fibres du fuseau de division disparaissent. Une enveloppe nucléaire se reconstitue pour former le futur noyau de chacune des deux cellules filles. La mitose s achève par la séparation des cytoplasmes des deux cellules filles (cytodiérèse) qui entrent en interphase. Les modalités diffèrent pour les cellules animales ou végétales (document10). Document 10 Séparation des cellules filles (animales ou végétales) en fin de mitose Pour une cellule animale, elle se réalise par un étranglement centripète jusqu à séparation des deux cellules filles. Chez les animaux : Une cellule mère donne deux cellules filles semblables entre elles et semblables à la cellule mère. Dans le cas d une cellule végétale, la séparation des cellules filles débute par la formation d une nouvelle paroi rigide au niveau du plan équatorial de la cellule mère. Cette nouvelle paroi se développe de manière centrifuge jusqu à se raccorder à la paroi existante de la cellule mère. Chez les végétaux : Une cellule mère donne deux cellules filles semblables entre elles et semblables à la cellule mère. La mitose est donc aussi une transformation du cytoplasme et de la taille des cellules. 8 Séquence 1 SN12

8 Activité 2 Repérage des différentes phases au cours d un cycle cellulaire Recenser, extraire et organiser des informations sous forme de schémas Le document 11 représente schématiquement les différentes étapes d un cycle cellulaire d une cellule «fictive» ayant 2 paires de chromosomes. Repasser en deux couleurs différentes chaque chromosome de chaque paire. Indiquer les noms de chaque étape du cycle cellulaire. Document 11 Schémas des différentes phases d un cycle cellulaire À retenir Les cellules se divisent au rythme de cycles cellulaires, chacun comprenant une interphase (période hors division) et une mitose (période de division). Le comportement des chromosomes permet de distinguer quatre phases au cours de la mitose : La prophase : la chromatine se condense en chromosomes à 2 chromatides ; l enveloppe nucléaire disparaît et un fuseau de division apparaît. La métaphase : les chromosomes sont condensés au maximum et se regroupent dans le plan équatorial de la cellule. L anaphase : il y a clivage des centromères et chaque chromatide de chaque chromosome migre à un pôle opposé de la cellule ; il y a donc une répartition égale du nombre de chromosome dans chaque future cellule fille. La télophase : la migration étant achevée, les chromosomes à une chromatide se décondensent ; les enveloppes nucléaires se reconstituent autour de chaque amas de chromatine. La division s achève par la séparation des deux cellules filles (cytodiérèse). Les cellules filles héritent de la même information génétique que celle de la cellule mère : les deux chromatides (donc les deux molécules d ADN) de chaque chromosome sont donc rigoureusement identiques. Séquence 1 SN12 9

9 } Document 12 Schéma bilan d un cycle cellulaire 1 chromosome à 2 chromatides Centromère 2 chromatides Disparition de la membrane nucléaire Condensation de la chromatine en chromosomes Chromatine = ensemble des chromosomes «déroulés» Interphase 1 cellule mère (2n=4) Métaphase Alignement des chromosomes à 2 chromatides Plaque équatoriale (2n = 4) Les chromosomes à 1 chromatide se décondensent Séparation des 2 cellules filles par formation d une paroi Mitose Fuseau mitodique Séparation des chromosomes en 2 au niveau des centromères Apparition de la membrane nucléaire Télophase (2n = 4) 2 cellules filles Anaphase Puis migration vers les pôles de chaque chromatide grâce au fuseau de division. Activité 3 Document 13 Relation entre nombre de chromosomes et nombre de molécules d ADN Comprendre le lien entre les phénomènes naturels et le langage mathématique. Le document 13 représente le caryotype de l espèce humaine (nombre de chromosomes contenus dans le noyau de chaque cellule humaine excepté les cellules reproductrices). Il est de 23 paires. Caryotype d une cellule humaine Combien y a-t-il de molécules d ADN dans une cellule humaine en début de mitose? Combien y a-t-il de molécules d ADN différentes? 3. Caryotypes et définition d une espèce Chez la plupart des êtres vivants les chromosomes sont répartis par paires. Dans l espèce humaine la majorité des cellules contient 46 chromosomes, soit 23 paires. On distingue 22 paires de chromosomes identiques (autosomes) pour les deux sexes et 1 paire de chromosomes sexuels : XX chez la femme et XY chez l homme. Les gamètes ne contiennent que 23 chromosomes (1 de chaque paire). Ainsi, lors de la fécondation, les 23 paires de chromosomes sont reconstituées dans la cellule œuf et a fortiori dans toutes les cellules de l individu qui en dérive par mitoses. 10 Séquence 1 SN12

10 Voici d autres exemples parmi des espèces animales ou végétales : la drosophile a 4 paires de chromosomes, la grenouille en a 24, le chien 39, le pommier 17 et le papillon Lysandria 190! Activité 4 Document 14 Comparaison de caryotypes d espèces différentes Utiliser ses connaissances et extraire des informations pour justifier une réponse. Caryotypes d espèces différentes Caryotype 1 Caryotype 2 Caryotype 3 Caryotype 4 Caryotype 5 Établir les constantes et les différences entre les différents caryotypes présentés. Attribuer chacun des caryotypes à l espèce lui correspondant. Justifier les choix. Repérer et expliquer la différence entre les caryotypes 3 et 4. À retenir Le caryotype d un individu est spécifique de l espèce à laquelle il appartient. C est donc un des fondements de la définition de l espèce. Séquence 1 SN12 11

11 Anomalies chromosomiques et explications Des erreurs peuvent parfois se produire lors de la formation des gamètes ou de la mitose des autres types de cellules ce qui entraîne des anomalies chromosomiques dans les cellules filles. On distingue des anomalies de nombre et de structure. a- Les anomalies de nombre peuvent se traduire par l absence de un ou plusieurs chromosomes. L absence d un autosome chez un nouveau-né est exceptionnelle du fait sans doute de leur élimination dès le début de la vie embryonnaire. L absence d un chromosome X est moins rare (syndrome de Turner). Il est beaucoup plus fréquent que l anomalie soit due à la présence d un ou plusieurs chromosomes surnuméraires. On observe ainsi des trisomies (présence d un chromosome surnuméraire) : trisomie 21 (syndrome de Dawn), 18 et 13 (syndrome de Patau) pour les plus fréquentes. Les trisomies des chromosomes sexuels sont très fréquentes : XXX, XXY (syndrome de Klinefelter), XYY. Il existe aussi des anomalies de nombre plus importantes : XXXX Document 15 Caryotypes de différents individus présentant une anomalie chromosomique de nombre. Caryotype 1 Caryotype 2 Caryotype 3 Caryotype 4 Activité 5 Quelques exemples d anomalies chromosomiques de nombre Extraire des informations pour justifier une réponse. Repérer et nommer, en le justifiant, les anomalies chromosomiques de nombre illustrées dans le document 15. Ces anomalies de nombre peuvent être homogènes (présentes dans toutes les cellules) ou en mosaïque (non présentes dans toutes les cellules). 12 Séquence 1 SN12

12 Quand elles sont homogènes, elles s expliquent le plus souvent par un déroulement anormal de la formation des gamètes : deux chromosomes d une même paire au lieu d un seul peuvent alors se retrouver dans un même gamète. Si ce gamète est fécondé par un gamète normal, l œuf qui en résultera sera donc trisomique ; si le gamète ne contient aucun chromosome de la paire considérée, l œuf sera monosomique. Quand elles sont en mosaïque, elles résultent de la non séparation d une paire de chromosomes après quelques mitoses de la cellule œuf qui initialement avait un caryotype normal. L individu issu de cet œuf possèdera donc des cellules au caryotype normal et des cellules au caryotype anormal. Enfin il existe des polyploïdies dont la plus fréquente est la triploïdie caractérisée par la présence de trois chromosomes de chaque type. Elle est due à des accidents de la fécondation dont le plus fréquent est une dispermie (ovule fécondé par deux spermatozoïdes). b- Les anomalies de structure peuvent concerner un ou plusieurs chromosomes. Elles sont présentes dès la conception (dans les gamètes) ou se forment lors des premières mitoses de la cellule œuf. Elles sont habituellement la conséquence de cassures chromosomiques suivies par une ou plusieurs soudures anormales. Ces anomalies de structure résultent principalement de délétions, translocations ou inversions. Une délétion résulte de la perte d un fragment de chromosome. Elles s accompagnent de symptômes cliniques sévères chez le nouveauné. La perte peut se situer à un seul bout de chromosome ou aux deux bouts ; elle peut également se situer au milieu d un chromosome. Une translocation résulte de la soudure d un fragment de chromosome sur un autre chromosome qui a lui-même subi une cassure. Une inversion résulte de deux cassures d un chromosome. Au lieu d être éliminé, le fragment situé entre les deux cassures reste en place. Il n a subi qu une rotation de 180 qui bouleverse la séquence des gènes sur le chromosome. L individu porteur de cette anomalie n a ni perte ni gain de matériel génétique et le réarrangement est dit équilibré. Normalement, il n y a aucun symptôme clinique à la naissance. Document 16 Différents types d anomalies chromosomiques de structure Anomalie 1 Séquence 1 SN12 13

13 Anomalie 2 Anomalie 3 Anomalie 4 Anomalie 5 Activité 6 Quelques exemples d anomalies chromosomiques de structure Extraire des informations pour justifier une réponse. Repérer et nommer, en le justifiant, les anomalies chromosomiques de structure illustrées dans le document 16. Parfois, lors d une translocation, c est un chromosome entier qui est transloqué sur un autre chromosome. Par exemple certains individus ont un de leurs chromosomes 21 soudé à un chromosome 14. Il n y a pas d anomalie clinique chez le sujet porteur car il n y a ni perte ni gain de matériel génétique. On dit que la translocation est équilibrée. Mais si cette personne produit des gamètes avec un chromosome 21 normal et un chromosome 14 transloqué, elle risque d avoir un enfant trisomique 21. Document 17 Translocation d un chromosome 21 sur un chromosome Séquence 1 SN12

14 Activité 7 Origine d une anomalie chromosomique de structure Extraire des informations pour justifier une réponse Quel individu du couple présente une anomalie chromosomique de structure? Justifier la réponse. À retenir Des erreurs lors de la formation des gamètes ou de la mitose d autres types de cellules peuvent être à l origine d anomalies chromosomiques de nombre ou de structure dans le caryotype. Les anomalies de nombre se traduisent par un chromosome en plus ou en moins dans le caryotype. Les anomalies de structure se traduisent par des fragments de chromosomes manquants ou supplémentaires. La multiplicité des exemples montre que le matériel chromosomique est très malléable. Une cellule mère possède la même information que les deux cellules filles issues de sa mitose. Les deux chromatides de chaque chromosome de la cellule mère sont donc identiques. La cellule mère possède deux fois la même information génétique en début de mitose. Problème : Par quels mécanismes et à quel moment? B Les mécanismes de la reproduction conforme à l échelle moléculaire Dans les classes précédentes, vous avez appris que le support moléculaire de l information génétique est l ADN porté par les chromosomes. Une molécule d ADN est formée de 2 brins ou chaînes enroulés en une double hélice. Chaque brin est constitué d unités élémentaires enchaînées appelées nucléotides. Il existe 4 nucléotides différents se distinguant par la nature d un de leurs constituants appelé bases azotées : l adénine (A), la cytosine(c), la guanine (G) et la thymine (T). Les 2 brins sont associés sur toute leur longueur de telle sorte que A est toujours en face de T et G en face de C : on dit que les 2 brins sont complémentaires. Une molécule d ADN est caractérisée par sa séquence, c est-à-dire le nombre, la nature et l ordre dans lequel les nucléotides s enchaînent. Activité 8 Rappel sur la structure d une molécule d ADN Recenser, extraire et organiser des informations pour compléter un schéma. Compléter la séquence nucléotidique des 2 brins de la molécule du document 18 pour illustrer une séquence nucléotidique de votre choix d un fragment d une molécule d ADN. Séquence 1 SN12 15

15 Document 18 L ADN, une molécule formée de deux brins complémentaires Activité 9 Document 19 Relations entre chromosomes et ADN au cours de la mitose Chromosomes, ADN, transmission de l information génétique. A cellule en B cellule en 16 Séquence 1 SN12

16 Mobiliser ses connaissances La cellule du document 19 est diploïde ; identifier le stade de mitose de la cellule du cadre A ainsi que les paires de chromosomes homologues, en les coloriant différemment. Rappel : une cellule est diploïde lorsqu elle possède des chromosomes homologues, c est-à-dire semblables morphologiquement deux à deux ; les chromosomes homologues d une paire ont la même taille et le centromère à la même hauteur. Communiquer par un schéma Schématiser le plus simplement possible, dans la case libre sous cette photo, le caryotype de cette cellule, Mobiliser ses connaissances Identifier le stade de mitose du cadre B et rappeler l événement chromosomique marquant cette phase. Communiquer par un schéma Schématiser dans la case libre sous cette photo, le caryotype de cette cellule, en utilisant le même code qu à la question 2. D après ses connaissances, adopter une démarche déductive Les caryotypes des cellules filles et de la cellule mère sont identiques entre eux. Indiquer quel phénomène chromosomique doit alors se produire dans la cellule mère et à quel moment de son cycle cellulaire? D après ses connaissances, adopter une démarche déductive Indiquer si une cellule haploïde (ne possédant qu un seul exemplaire de chaque type de chromosome) peut subir une mitose? Justifier la réponse. Exprimer graphiquement des résultats, mobiliser ses connaissances en relation avec le problème Le dosage de la quantité d ADN dans le noyau puis dans chacun des lots de chromosomes présents dans une cellule en division a donné les résultats consignés dans le document 20 : Document 20 Quantité d ADN en fonction du temps dans une cellule en division Temps (heures) Quantité d ADN (u.a) Temps (heures) Quantité d ADN (u.a) u.a : unité arbitraire a- Tracer le graphe de la quantité d ADN en fonction du temps. Echelles : 1 cm pour 1 heure et 1cm pour 1 unité arbitraire d ADN. Séquence 1 SN12 17

17 Aide à la réalisation du graphique La grandeur étudiée (ce que l on mesure), est représentée en ordonnées. La courbe représente l évolution de cette grandeur en fonction de ce qui est représenté en abscisses. Le titre est une phrase du type «variation de y en fonction de x». Les axes tracés à la règle se terminent par une flèche. Il faut reporter la signification des axes (paramètre mesuré et unité). Choisir une échelle proportionnée pour les deux axes. Reporter les points suivant les valeurs données. b- Certaines variations de la quantité d ADN correspondent à des anaphase télophase de mitose : les identifier et les repasser en rouge sur le graphe. Justifier le choix. c- Indiquer à quoi peuvent correspondre les autres variations de la quantité d ADN? Justifier la réponse. d- Sachant que pour ces cellules, la mitose dure une heure, que la prophase et la métaphase représentent 75% du temps de division, délimiter sur le graphe le début et la fin d une mitose. e- Délimiter sur le graphe la durée de l interphase et d un cycle cellulaire entier. C est donc la réduction de moitié de la quantité d ADN qui permet de repérer la mitose d une cellule. Cette réduction correspond à la séparation des chromatides des chromosomes de chaque paire. La prophase et la métaphase ont lieu un peu avant, la télophase et la cytodiérèse ont lieu un peu après. La durée qui sépare une mitose de la suivante correspond à l interphase qui dure de quelques heures à plusieurs semaines ou plus encore. À retenir L évolution de la quantité d ADN au cours d un cycle cellulaire permet de délimiter ses différentes phases. En interphase, on distingue trois périodes : Durant la phase qui suit la mitose (phase G1, G pour gap of time en anglais c est-à-dire intervalle de temps en français), la quantité d ADN est constante et caractéristique des cellules de l espèce (quantité Q). Durant la phase où la quantité d ADN double (quantité 2Q), il y a réplication de l ADN (phase S de synthèse). La phase S est suivie d une phase où la quantité d ADN reste constante à 2Q (phase G2). En fin d interphase la cellule est prête à subir la mitose. Au cours de la phase S il est possible d observer des zones de dédoublement des nucléofilaments appelées «yeux de réplication» qui correspondent aux endroits où l ADN se réplique. 18 Séquence 1 SN12

18 Document 21 Yeux de réplication au niveau de l ADN d une cellule de Hamster en phase S (MET). Yeux de réplication Interprétation graphique (microscopie électronique) Nucléofilament Oeil de réplication Deux futures chromatides d un chromosome Ancien brin Nouveau brin Document 22 Bilan Je repère : - la cellule mère : - les cellules filles : - les images de mitose : - les images d interphase : - l ADN en phase G1 : - l ADN en phase S : - l ADN en phase G2 : - l ADN de la chromatine : - l ADN des chromosomes : Activité 10 Évolution de la structure de l ADN au cours d un cycle cellulaire Mobiliser ses connaissances à partir d une représentation schématique Associer chaque image du document 22 au repère correspondant. Les mécanismes de réplication de l ADN Rappels sur la structure de l ADN : C est une grosse molécule (macromolécule) formée de deux chaînes ou brins enroulés en une double hélice. Chaque brin comprend quatre types Séquence 1 SN12 19

19 d unités appelés nucléotides qui se distinguent par un de leur constituant appelé base azotée. On symbolise chaque base azotée par une lettre : A, C, T et G. Les deux brins d une molécule d ADN sont reliés l un à l autre sur toute leur longueur par leurs bases azotées, qui forment toujours le même couple : A est toujours associé à T et C à G. Chaque brin est donc complémentaire de l autre. Activité 11 Découverte des mécanismes de la réplication de l ADN Pratiquer une démarche scientifique, raisonner avec rigueur pour valider ou invalider une hypothèse Deux hypothèses relatives aux mécanismes de la réplication peuvent être émises : Hypothèse1 : réplication conservative : après ouverture de la molécule d ADN, chaque brin sert de matrice à la synthèse par complémentarité de bases de 2 nouveaux brins, qui s assemblent pour former la nouvelle molécule d ADN. Hypothèse 2 : réplication semi conservative : après ouverture de la molécule d ADN, chaque brin sert de matrice et sera complété par complémentarité, jusqu à la séparation totale des brins initiaux ; 2 molécules sont ainsi formées. Sachant que les bactéries ne possèdent qu un chromosome, et donc qu une seule molécule d ADN par cellule, représenter schématiquement les molécules d ADN de première génération pour chaque hypothèse en utilisant la représentation simplifiée d une molécule d ADN proposée et une couleur rouge pour les brins nouveaux d ADN. Afin de valider une des deux hypothèses, Meselson et Stahl (1951) ont travaillé sur une bactérie très commune, Escherichia Coli et ont réalisé différentes expériences. Document 23 Principe et protocole Principe : La destinée des molécules d une cellule peut être suivie en utilisant des isotopes marqueurs, par exemple 15 N, l isotope lourd de l azote 14 N. L azote 15 N s incorpore sans discrimination dans tous les composés azotés de la cellule, y compris l ADN. Les molécules d ADN marquées avec 15 N sont plus lourdes que celles contenant 14 N ; elles peuvent être séparées par centrifugation en gradient de densité et leur densité peut être évaluée. 20 Séquence 1 SN12

20 Protocole : des bactéries sont cultivées pendant plusieurs générations sur un milieu contenant des sels d ammonium tous marqués par 15 N. Quand tout l ADN des bactéries contient du 15 N, on transfère ces dernières sur un milieu à 14 N. Elles poursuivent leurs divisions de façon synchrone ; on prélève des bactéries à des temps correspondant au doublement de la population et on mesure la densité de l ADN extrait de ces bactéries. Pour chaque hypothèse, quels résultats peut-on prévoir après une génération sur milieu 14 N? Répondre en complétant le document 24. Les résultats s expriment en % d ADN lourd, léger ou hybride. Document 24 hypothèse 1 hypothèse 2 densité de l ADN de première génération sur 14 N Représenter schématiquement les molécules d ADN de première et deuxième génération pour chaque hypothèse. Reprendre le même figuré que pour la question 1 avec en noir 1 brin «léger» et en rouge 1 brin «lourd». Indiquer alors les résultats prévisibles (% d ADN lourd, léger, hybride) après deux générations sur milieu 14 N, en complétant le document 25. Document 25 hypothèse 1 hypothèse 2 densité de l ADN de première génération sur 14 N Séquence 1 SN12 21

21 Document 26 Expérience et résultats obtenus par Meselson et Stahl Technique expérimentale de la centrifugation en gradient de densité : Elle permet de séparer des molécules en fonction de leur poids moléculaire. On utilise du CsCl (chlorure de césium) car il a une densité proche de celle de l ADN. Quand une solution de CsCl est centrifugée, le CsCl forme un gradient continu de densité plus élevée au fond du tube qu au sommet du tube. Donc un échantillon d ADN s équilibrera dans le CsCl à l endroit où la densité de la solution de CsCl sera équivalente à sa propre densité. L ADN15 aura donc une position d équilibre dans le tube (densité de 1.724) inférieure à celle de l ADN14 (densité de 1.710). Remarque : on localise l ADN à l aide d un faisceau de rayons UV. Les informations tirées des résultats permettent-elles de valider une des hypothèses et de réfuter l autre? Préciser la réponse et justifier. Activité 12 Relation entre chromosome métaphasique et ADN Mobiliser ses connaissances en relation avec le problème Le schéma du document 27 représente un chromosome en métaphase et la molécule d ADN qui constitue une de ses deux chromatides. Compléter ce schéma en représentant la molécule d ADN correspondant à la deuxième chromatide. Justifier la réponse. Document 27 Chromosome en métaphase 22 Séquence 1 SN12

22 À retenir L ADN se réplique selon un mode semi conservatif. Les deux brins de la molécule d ADN s écartent par rupture des liaisons chimiques qui unissent les bases complémentaires. Des nucléotides libres fournis par les nutriments se positionnent en face de leurs bases complémentaires et se lient entre eux pour former un nouveau brin d ADN. Ainsi les molécules d ADN filles identiques entre elles et à la molécule mère contiennent chacune un brin de la molécule mère et un brin néoformé. Cette synthèse nécessite aussi un complexe enzymatique (ADN polymérase) et de l énergie fournie par les nutriments. Après la réplication, les deux molécules d ADN identiques nouvellement formées constitueront en se condensant les deux chromatides d un chromosome unies par un centromère. La vitesse de réplication de l ADN La PCR (réaction de polymérisation en chaîne) est une technique qui permet d amplifier (en plusieurs millions d exemplaires) un fragment d ADN bien précis (microsatellite). La PCR se déroule in-vitro. Le fragment d ADN à amplifier est placé dans l appareil à PCR. Première étape : la dénaturation On dénature le fragment d ADN à séquencer à une température de 95 C pendant une minute, afin de séparer les deux brins de l ADN. Deuxième étape : l hybridation A une température de 50 C pendant une minute, on ajoute de courtes amorces nucléotidiques de synthèse monobrins, complémentaires des deux extrémités de la séquence du fragment d ADN à amplifier. Troisième étape : la polymérisation A une température de 72 C pendant une minute, des enzymes (ADN polymérases qui interviennent naturellement dans le processus de réplication) sont ajoutées pour permettre la synthèse d un brin complémentaire de chacun des deux brins séparés. On ajoute quatre nucléotides (désoxyribonucléotides ou dntp) : datp, dttp, dctp, dgtp qui par complémentarité vont se lier à chacun des deux brins. L élongation commence à partir des amorces et se poursuit jusqu à l obtention de deux copies de l ADN initial. Les trois étapes sont répétées pendant n cycles. On obtient ainsi 2, 4, 8 jusqu à copies au bout de 25 cycles! Document 28 Premier cycle : trois phases Principe de la PCR 1) Chauffage à 95 brin ancien brin nouveau 2) Refroidissement à 50 T T T T TT 3) Chauffage à 72 Deuxième cycle Séquence 1 SN12 23

23 Deuxième cycle : 1) Chauffage à 95 2) Refroidissement à 50 3) Chauffage à 72 Troisième cycle : puis 72 Bilan microsatellite que l on veut étudier 1 er cycle 2 ème cycle 3 ème cycle 4 ème cycle... dans un tout petit tube Ainsi chez certaines bactéries, la PCR a montré que la copie d un brin d ADN se fait à une vitesse d environ 1500 nucléotides par seconde. Activité 13 Estimation de la vitesse de réplication Comprendre le lien entre les phénomènes naturels et le langage mathématique. Mobiliser ses connaissances en relation avec le problème. Considérons que le seul chromosome et donc la seule molécule d ADN que possède une bactérie, contient 4,7 millions de paires de bases. On peut admettre que la vitesse de réplication de l ADN in-vivo équivaut à celle qui se réalise avec la PCR. Combien faut-il de temps, au minimum, pour une réplication complète de la molécule d ADN chez ces bactéries? Remarque : L élongation d un nouveau brin s effectue à la vitesse de seulement 50 nucléotides par seconde pour l ADN humain. Chez tous les eucaryotes, l ouverture de la molécule d ADN s effectue en de nombreux points sous forme d yeux de réplication (document 29), ce qui permet d augmenter considérablement la vitesse de réplication. On estime qu il suffit de quelques heures pour que la totalité de l ADN (environ 6 milliards de paires de bases) d une cellule humaine soit répliqué. 24 Séquence 1 SN12

24 À retenir Chez les eucaryotes, la vitesse de réplication de la molécule d ADN peut atteindre plusieurs dizaines de nucléotides par seconde et il suffit de quelques heures pour que la totalité de l ADN d une cellule soit répliqué. Document 29 Schéma bilan de la réplication semi-conservative de l ADN Bilan du chapitre Deux mécanismes fondamentaux assurent la transmission de l intégralité de l information génétique au cours d un cycle cellulaire : La réplication semi-conservative de l ADN au cours de l interphase. Elle permet à une cellule d avoir des chromosomes à deux chromatides dont l information génétique est rigoureusement identique. La mitose qui suit l interphase. Elle permet la répartition des chromosomes en deux lots identiques. En effet, les deux cellules filles issues de la mitose héritent de la totalité de l information génétique de la cellule mère sous la forme d un lot complet de chromosomes à une chromatide. La réplication de l ADN assure donc une stabilité qualitative de l information génétique et la mitose assure sa stabilité quantitative. Quantité d ADN par cellule (unités arbitraires) 8 4 Temps (h) Séquence 1 SN12 25

25 2 Variabilité génétique et mutation de l ADN J ai deux gènes codant pour la couleur de mon pelage, comme toutes les souris. Mon pelage me montre que l un de mes gènes porte l allèle souris grise Mon cadet me montre que mon autre gène du pelage porte l information souris blanche PAPA MAMAN Je suis bien le fils de mes parents car le caractère souris grise l emporte sur le caractère souris blanche Fils ainé Fils cadet Pour s interroger Vous avez appris dans les classes précédentes que les gènes sont responsables de l expression des caractères d un individu. Au sein d une espèce, un gène peut présenter de multiples variantes appelées allèles. Pour l ensemble de ses gènes, un individu possède deux allèles (identiques ou différents) pour chaque gène. Les 2 chromosomes d une même paire sont génétiquement différents chez un individu et différents de ceux de tous les individus de l espèce à laquelle ils appartiennent. L ADN, molécule constituant les gènes, est une molécule relativement instable et peut subir des modifications spontanées ou provoquées appelées mutations (avec perte, gain ou remplacement d un ou plusieurs nucléotides). Les mutations sont à l origine du polyallélisme des gènes. De fait, la variation génétique des individus repose sur la variabilité de l ADN. L endommagement de la molécule d ADN à l origine d éventuelles mutations peut-il être réparé par la cellule? Quels sont les différents types de mutations conservées et leurs conséquences sur les individus porteurs? En quoi les mutations sont-elles un fondement de la biodiversité? 26 Séquence 1 SN12

26 Mobiliser les acquis : Activité 1 Rappels sur la notion de diversité génétique Raisonner, recenser et extraire des informations Depuis les dernières décennies, les outils de la biotechnologie moléculaire ont permis de séquencer l ADN. Il est ainsi possible de comparer des séquences d ADN de différents gènes ou d allèles différents d un même gène. Le document 1 représente les séquences d un des 2 brins de l ADN de deux gènes permettant la synthèse de 2 hormones : le gène codant pour la synthèse d ADH (hormone qui permet la réabsorption de l eau au niveau du rein) et le gène codant pour l insuline (une des hormones qui régule la glycémie, c est-à-dire le taux de glucose sanguin). Document 1 Séquence nucléotidique des gènes de l ADH et de l insuline ADH Insuline TGCTACTTCCAGAACTGCCCGAGGGGC AAACACTTGGTTGTGGACAGCCCGAGTGTGGAC..TTCTGG En quoi diffère la séquence des 2 gènes? Le document 2 représente les séquences partielles d ADN d un des 2 brins, de 2 allèles d un même gène : le gène codant pour une molécule marqueur des groupes sanguins du système ABO. Le reste de la séquence non représentée est rigoureusement identique. Remarque : chaque allèle comprend 1062 nucléotides Document 2 Séquences nucléotidiques partielles des allèles A et B Allèle A Allèle B GTGCGCGCCTAC..CCGGCT.TACCTGGGGGGGT.. GTGGGCGCCTAC..CCAGCT..TACATGGGGGCGT.. Comparer la séquence des deux allèles. Définir alors à partir de cet exemple la mutation d un gène? Le document 3 schématise la localisation de 4 gènes sur une des 23 paires de chromosomes chez deux individus appartenant à l espèce humaine. Séquence 1 SN12 27

27 Exploiter le document 3 pour rappeler en quoi consiste la diversité génétique au sein d une population d individus appartenant à la même espèce. Aide Déterminer le nombre d allèles différents pour chaque individu et le nombre d allèles différents pour les 2 individus. Compléter le tableau. Individu 1 Individu 2 Individus 1 et 2 = population Gène a Gène b Gène c Gène d Gène e A L ADN est une molécule endommageable Pendant sa réplication ou en dehors, l ADN est soumis en permanence à des activités métaboliques intracellulaires et à des facteurs extracellulaires ou environnementaux qui peuvent l endommager. Chaque jour, jusqu à 1 million de nucléotides d une cellule humaine sont endommagés. Il existe plusieurs systèmes de réparation, dont la vitesse et l efficacité dépendent de nombreux paramètres : type et âge de la cellule, facteurs environnementaux. 28 Séquence 1 SN12

28 De nombreux gènes codant pour des protéines impliquées dans la durée de vie cellulaire interviennent dans la réparation de l ADN endommagé. Grâce à certaines de ces protéines spécifiques, la cellule détecte les dommages ou lésions. Ces protéines se fixent aux structures anormales telles que une base azotée modifiée, une rupture des liaisons chimiques entre bases, un fragment d ADN monobrin ou une déformation de la double hélice d ADN. Avant la réparation, les structures anormales sont supprimées. Des enzymes (glycosylase par exemple) interviennent pour les éliminer. La réparation consiste à la synthèse d un brin complémentaire du brin restant non endommagé. Deux enzymes principales interviennent, l ADN polymérase (pour la synthèse du nouveau brin) et l ADN ligase (pour suturer les 2 brins). Ces mécanismes, quand ils sont efficaces, maintiennent donc l intégrité des cellules quand elles se divisent ou pendant leur durée de vie. Si la réparation n est pas efficace, il apparaît une mutation de l ADN. Les cellules mutées, si elles poursuivent de façon incontrôlée leurs divisions, transmettent cette mutation à leurs cellules filles. Ce qui peut être à l origine de cancers d origine génétique (cancer du sein, du colon ). Elles peuvent aussi entrer en dormance irréversible (sénescence) ou subir une mort par suicide cellulaire (apoptose). Activité 2 Conséquences des endommagements de l ADN Recenser et extraire des informations Indiquer des endommagements possibles de l ADN. Citer les deux étapes permettant la réparation de l ADN endommagé. Quelles conséquences peuvent avoir une non réparation d un endommagement de l ADN d une cellule? À retenir L ADN peut être endommagé lors de la réplication ou durant la vie de la cellule. En général, des protéines dont certaines enzymes, permettent une réparation. Si l endommagement n est pas réparé et si la cellule survit, il apparaît une mutation. Cette mutation est transmissible si elle poursuit ses divisions. Quelles sont les conséquences des mutations? B Conséquences des mutations Une mutation est spontanée et aléatoire. Au sein d une population de cellules, la fréquence des mutations est faible. On admet une probabilité d environ 10-6, c est-à-dire qu une mutation touche 1 cellule sur Séquence 1 SN12 29

29 1 million. Mais étant donné le nombre de gènes chez un individu, la probabilité qu une mutation d un gène apparaisse n est pas négligeable, d autant plus que l individu est exposé à l action d agents favorisant les mutations et qualifiés de mutagènes. Activité 3 Probabilité de la mutation d un gène Comprendre le lien entre les phénomènes naturels et le langage mathématique. Sachant que le nombre de gènes dans l espèce humaine est d environ 30000, évaluez la probabilité qu une mutation apparaisse dans une cellule. Exemple de l influence de l irradiation d une culture de levures par des UV Nous savons que les mutations sont à l origine des différents allèles des gènes. Activité 4 Conséquences d une exposition aux rayons ultra-violets Recenser, extraire et organiser des informations / Comprendre le lien entre les phénomènes naturels et le langage mathématique / Communiquer dans un langage scientifiquement approprié (tableau) / Exprimer des résultats en utilisant un tableur Des études expérimentales ont été réalisées chez des populations de levures. Information n 1 : Par division, les levures forment des colonies constituées de millions de cellules. D une taille de quelques millimètres en moyenne, les colonies sont visibles à l œil nu. Les souches sauvages (les plus fréquentes dans la nature) forment des colonies blanches. Une souche moins fréquente forme des colonies rouges. Ces colonies sont donc facilement repérables. La couleur rouge de ces levures a pour origine l accumulation dans les cellules, d une molécule qui s oxyde au contact de l 0 2 formant un pigment rouge. On a étudié expérimentalement l influence des rayons ultra-violets sur le taux de mutation de l ADN des levures. Information n 2 : Les UV altèrent la structure de la molécule d ADN Les rayons ultra-violets(uv) transportent de l énergie. Un photon UV qui est de courte longueur d onde transporte une grande quantité d énergie. En plus de chauffer les molécules, les rayons UV peuvent les fragmenter, les découper. Ainsi la molécule d ADN absorbe la lumière UV à 254 nm ce qui provoque des cassures dans sa structure. Des processus de réparation faisant in- 30 Séquence 1 SN12

30 tervenir des protéines spécialisées existent. Si ces protéines sont trop sollicitées elles ne pourront cependant pas empêcher la formation de lésions irréversibles. On pose alors l hypothèse suivante : les rayons ultra-violets sont responsables de mutations. Pour éprouver cette hypothèse, on a réalisé une expérience : Matériel biologique : on utilise des cellules de levures faciles à cultiver sur un milieu de culture en boîte de pétri. Au bout de quelques jours, elles forment «des colonies» constituées de millions de levures toutes identiques. Indiquer ce que l on appelle «colonie» de levures et comment elle s est formée. Principe de l expérience : On ensemence plusieurs milieux avec le même nombre de levures formant des colonies rouges (couleur due à la présence d un allèle «couleur rouge» du gène responsable de la couleur des levures). Chaque boîte est placée sous une lampe UV pendant une durée déterminée. Au bout de 3 jours, des colonies blanches sont apparues et elles sont d autant plus nombreuses que le temps d exposition aux UV a été long.. Document 3 Exposition des levures de couleur rouge aux UV 10 secondes 5 secondes 2 secondes 0 seconde Quelle est la conséquence de l exposition des levures aux UV? Pourquoi peut-on dire qu une mutation est intervenue dans le génome des levures? Une étude expérimentale quantitative est réalisée : Des boîtes contenant 50 cellules de levure de couleur rouge ont été exposées aux UV pendant des temps différents : 0, 2, 5 et 10 secondes. On considère alors comme expérience témoin la culture n ayant pas subi d exposition aux UV. Séquence 1 SN12 31

31 Les résultats expérimentaux sont consignés dans le tableau ci-dessous : Culture 1 Culture 2 Culture 3 Culture 4 Temps d exposition aux UV (secondes) Nombre total de colonies au bout de trois jours Colonies rouges Colonies crèmes Que met en évidence la culture n 1? Aide Calculer le pourcentage de colonies survivantes dans chaque culture ainsi que le taux de mutation dans chaque boîte en % (Taux de mutation = (nombre de colonies mutées x 100) / nombre de colonies au départ. Reporter les résultats dans un tableau. Tracer le graphique de la survie des levures (% de colonies survivantes en fonction du temps d exposition aux UV) puis exploitez-le (= décrire, déduire ou expliquer). Tracer le graphique montrant l évolution du taux de mutation en fonction du temps d exposition aux UV puis exploiter-le. Conclusion : L hypothèse formulée au départ est-elle validée? Aide à la réalisation du graphique à l aide du logiciel Open Office Calc version 3 : Ouvrir un fichier dans le classeur de Open Office. Décrire = écrire les constats, aucune explication n est demandée. Déduire = donner une réponse au problème que soulève les constats. Expliquer = dire pourquoi on observe telle chose. On connaît l explication, il faut donc utiliser les connaissances acquises précédemment. On rédige alors une phrase du type : je sais que (on énonce ses connaissances), c est pourquoi (on énonce ce que l on doit expliquer). Construire et remplir un tableau de mesures : Inscrire la signification et les valeurs de la variable X (qui apparaîtront en abscisses) dans la colonne de gauche. Inscrire la signification et les valeurs de la variable Y (qui apparaîtront en ordonnées) dans la seconde colonne. 32 Séquence 1 SN12

32 Construire un graphique du type Y = f(x) : Cliquer la 1 re cellule des valeurs de la colonne X (ou de son intitulé pour faire apparaître le nom des courbes dans le cadre «Légende» du diagramme) et étendre la sélection à l ensemble du tableau avec la souris. OpenOffice mettra automatiquement en X les données de la première colonne de gauche et en Y celles des différentes colonnes de droite. Cliquer insertion Cliquer sur Dans Assistant de diagramme : 1- «Type de diagramme» Choisir et «points et lignes» Cliquer Suivant 2- «Plage de données» Sélectionner la 1 re ligne comme étiquette Cliquer suivant 2 fois 3- «Éléments du diagramme» Taper le titre du diagramme et les titres des axes X et Y Cliquer terminer Imprimer le graphique : Agrandir le graphe avec la souris en maintenant la touche shift ( ) enfoncée pour faire apparaître entièrement le titre Sélectionner toutes les colonnes de données Cliquer droit sur le graphe et copier-coller dans un fichier de traitement de texte avant d imprimer Quelques exemples dans les populations humaines Activité 5 Conséquences possibles d une mutation Recenser, extraire et organiser des informations Exploiter les textes du document 4 afin de compléter le tableau proposé, justifiant les affirmations suivantes : Séquence 1 SN12 33

33 Document 4 «Suivant qu elles affectent des cellules germinales (à l origine des cellules sexuelles) ou des cellules somatiques (autres que les gamètes), les mutations sont ou non transmissibles à la descendance. Elles peuvent conduire à une variabilité génétique non pathologique ou à des cancers, dans lesquels l environnement joue un rôle non négligeable, ou encore à des maladies héréditaires plus ou moins graves.» A- 25 ans après Tchernobyl Le 26 avril 1986, l explosion d un réacteur de la centrale de Tchernobyl provoquait un rejet de radioactivité dans l atmosphère durant plus de 10 jours Le principal effet sanitaire depuis l accident a été une augmentation du nombre de cancers de la thyroïde (glande à la base du cou) chez les enfants de moins de 15 ans (700 cas déclarés au lieu de quelques dizaines en temps normal) L augmentation apparaît chez les enfants nés avant la catastrophe ou exposés durant la grossesse de leur mère, mais pas chez ceux nés plus tard Certains rayons radioactifs peuvent provoquer des lésions variées : ruptures au niveau des liaisons entre les bases azotées de l ADN, ce qui sépare les deux brins de la molécule, modifications chimiques de certaines bases azotées Selon la dose de radiation absorbée, le métabolisme ou le processus de développement peuvent être modifiés C- Dans l espèce humaine, la plupart des gènes existent sous différents allèles à l origine de caractères «normaux». Par exemple, le gène responsable du caractère «groupe sanguin du système ABO» présente 3 versions alléliques : A, B et O. Selon les 2 allèles possédés, un individu un individu sera de groupe A, B, AB ou O. B- Soleil et ADN L exposition prolongée au rayonnement solaire peut déclencher, surtout chez les individus à peau claire, des lésions de l ADN des cellules de la peau. En effet, le soleil émet des rayons très pénétrants, les UV, qui peuvent altérer considérablement le matériel génétique Certaines de ces mutations sont à l origine d une prolifération de clones cellulaires ; il se forme des tumeurs qui évoluent fréquemment en cancers. En France, près de cas de cancers de la peau sont diagnostiqués tous les ans et l augmentation annuelle est d environ 10%. L un des cancers, le mélanome malin, est la première cause de cancer chez les adultes. D- La mucoviscidose est une maladie grave qui atteint 1 enfant sur en France, filles et garçons confondus. Le gène responsable est localisé sur le chromosome 7. La séquence des allèles de ce gène a été déterminée. La maladie ne se déclare que si les deux chromosomes 7 des cellules d un individu sont porteurs du même allèle responsable de la maladie. Type de cellule Transmissibilité Conséquences Exemples 34 Séquence 1 SN12

34 À retenir Les mutations affectent tous les types de cellules. Pour un gène la fréquence des mutations spontanées est faible (1 copie pour un million) mais elle peut augmenter par l action d agents environnementaux dits mutagènes. Les agents mutagènes accentuent les lésions spontanées de l ADN et les mutations sont les conséquences de ces lésions non réparées et donc conservées. Les agents mutagènes sont de deux ordres : agents physiques (rayons X, rayons gamma, rayons UV) et agents chimiques (benzène, acide nitreux ). Les mutations affectant les cellules somatiques (cellules autres que les gamètes) se retrouvent dans le clone issu de leurs divisions mais disparaissent à la mort de l individu porteur. Elles peuvent être à l origine de caractères pathologiques ou non. Les mutations affectant les cellules germinales (gamètes) peuvent être transmises aux générations suivantes et deviennent alors héréditaires. Quels sont les différents types de mutations? C Les différents types de mutations Rappel : Vous avez appris en seconde qu une mutation d un gène se définit comme un ou plusieurs changements de sa séquence de nucléotides. Il s agit cette année de caractériser précisément les différents types de mutations pouvant affecter un gène à l origine de son polyallélisme. Reprenons l exemple d un gène polyallélique : le gène déterminant les groupes sanguins ABO Document 5 Le déterminisme des groupes sanguins du système ABO Les groupes sanguins sont liés à la présence à la surface des hématies (globules rouges) de molécules appelées marqueurs. Ces molécules sont synthétisées lors de réactions biochimiques dont l une d elle est catalysée par une enzyme codée par un gène situé sur le chromosome 9. Ce gène possède 3 allèles : les allèles A et B permettent la synthèse d une enzyme fonctionnelle A ou B, l allèle O la synthèse d une enzyme inactive. Séquence 1 SN12 35

35 Schématisation des événements se déroulant à l intérieur d une hématie d un individu de groupe A on peut écrire : [A] allèle A marqueur A hématie du groupe A chromosome 9 enzyme A molécules présentes dans les cytoplasmes des cellules allèle B marqueur B hématie du groupe B chromosome 9 enzyme B Comment expliquer «génétiquement» l existence du groupe AB? Chez un individu de groupe AB, les hématies ont à la fois le marqueur A et le marqueur B : les deux enzymes sont synthétisées. Ceci est possible car dans nos cellules, nous avons deux allèles de chaque gène. On peut donc avoir l allèle A et B. On peut écrire la combinaison allélique possédée dans ce cas par (A//B). Activité 6 Relations entre les allèles ABO et les marqueurs synthétisés Recenser, extraire et organiser des informations D après le document 5, compléter le schéma précédent et les tableaux ci-dessous : Tableau indiquant, pour chaque allèle du gène, l enzyme résultant de son expression ainsi que le marqueur synthétisé ALLELE A ENZYME produite MARQUEUR présent à la surface des hématies B O Combinaison d allèles Tableau indiquant pour chaque combinaison d allèles possible les protéines synthétisées, les marqueurs fabriqués ainsi que le groupe sanguin en résultant : Enzyme(s) synthétisées Marqueur(s) synthétisé(s) Groupe sanguin (A//A) Enzyme A Marqueurs A [A] 36 Séquence 1 SN12

36 Activité 7 La nature des mutations à l origine des allèles ABO Recenser, extraire et organiser des informations. Raisonner pour proposer une explication. Données sur les allèles ABO : Le document 6 présente la comparaison d un des brins de l ADN des 3 allèles du gène des groupes sanguins du système ABO, à différents endroits de la séquence. Les parties de séquences présentées sont suffisantes pour comprendre les types de mutations qui ont été à l origine des 3 allèles. Document 6 Fin de séquence nucléotidique des 3 allèles Comparaison de la séquence des allèles A et O entre le 240 ème nucléotide et le 269 ème (en amont la séquence est rigoureusement identique) Comparaison de la séquence des allèles B et O entre le 240 ème nucléotide et le 269 ème (en amont la séquence est rigoureusement identique) Comparaison avec alignement des allèles A et O (l alignement consiste à aligner les portions de A et O contenant des séquences identiques face à face, même si dans la réalité elles sont décalées). En aval de la séquence présentée, il y a identité totale des nucléotides. Séquence 1 SN12 37

37 Comparaison avec alignement des allèles B et O. En aval de la séquence présentée, il y a identité totale des nucléotides Saisies des données. a- Reprendre le document 2 et rappeler les différences entre les deux allèles A et B. b- Combien de nucléotides comporte chaque allèle? c- D après la comparaison simple des allèles A et B par rapport à O, quels constats faites-vous? d- Que constatez-vous lorsque les portions de A et B par rapport à O sont alignées? Proposez une explication. Exploitations des données. a- L apparition d allèles nouveaux est expliquée par la survenue de mutations qui affectent des allèles déjà existants. Quels constats sont favorables à cette explication? b- On distingue plusieurs types de mutations dites ponctuelles car ne concernant qu un nucléotide de la séquence d un gène : Les mutations par substitution : remplacement d un nucléotide par un autre. Les mutations par insertion ou addition : ajout d un nucléotide entre 2 nucléotides de la séquence. Les mutations par délétion : perte d un nucléotide dans la séquence. Dans l histoire évolutive du gène étudié, les scientifiques ont montré que les allèles 0 et B sont apparus par mutation de l allèle A. Identifier les types de mutations à l origine de l apparition des allèles B et O. c- Dans l hypothèse où l allèle O est le plus ancien, proposez une explication sur l origine des allèles A et B. À retenir L étude des gènes des populations actuelles montre que leur polyallélisme résulte de l accumulation de mutations survenues au cours de l évolution. Les mutations d un gène sont à l origine d allèles nouveaux. Elles modifient aléatoirement la séquence nucléotidique du gène et consistent soit en : une substitution (changement d un ou plusieurs nucléotides) une insertion ou addition (gain d un ou plusieurs nucléotides) une délétion (perte d un ou plusieurs nucléotides) Ainsi la majorité des gènes sont polyalléliques. 38 Séquence 1 SN12

38 D Les mutations fondement de la biodiversité Une espèce, par définition, est un ensemble de populations d individus, interfécondes entre elles et isolées au point de vue reproductif de toute autre espèce. Nous avons appris qu au sein d une population, la plupart des gènes existe sous différentes versions ou allèles, chaque individu en possédant deux pour chaque gène. Reprenons l exemple du gène des groupes sanguins du système ABO pour caractériser la diversité allélique d une population au sein de l espèce humaine. Activité 8 Document 7 Étude de la fréquence des allèles A, B et O dans différentes populations humaines Recenser, extraire et organiser des informations. Raisonner. Répartition statistique des allèles A, B et O dans quelques populations (fréquence en %) Groupe Population A B O Français Chinois Russes Pygmées Hindous Suédois Ce tableau illustre le fait que des populations géographiquement éloignées possèdent toutes le gène. Ce qui les distingue, c est la fréquence relative des 3 allèles. Cette étude permet d illustrer la diversité allélique mais aussi de rendre caduque la notion de races humaines basée sur des critères morphologiques comme par exemple celui de la couleur de la peau. Aide Comparer judicieusement des populations dont la couleur de peau est différente (par exemple Russes et Pygmées) ou dont la couleur de peau est identique (par exemple Russes et Suédois). Rechercher d après les données du tableau, quelques exemples qui illustrent que la répartition statistique des allèles du gène du système sanguin ABO ne coïncide pas avec la notion de races humaines basée sur la couleur de la peau. Séquence 1 SN12 39

39 À retenir Au sein d une espèce, les populations partagent les mêmes gènes avec des fréquences alléliques différentes. Les mutations sont la source aléatoire de la diversité des allèles ; En cela, elles sont le fondement de la biodiversité génétique des populations. Bilan du chapitre L ADN est une molécule fragile qui peut subir des endommagements, notamment lors de la réplication, et être à l origine de mutations conservées transmissibles ou non selon les cellules concernées. Les mutations sont spontanées mais leur fréquence est augmentée par des agents favorisants appelés mutagènes. Aléatoires, les mutations sont la source de la diversité des allèles des différents gènes. En cela, elles fondent la biodiversité génétique des individus. 40 Séquence 1 SN12

40 S ynthèse de la séquence 1 Chez les Eucaryotes, les chromosomes qui portent l information génétique sont des structures constantes et permanentes des cellules. Au cours d un cycle cellulaire (interphase et mitose), ils sont dans un état de condensation variable. Pour les cellules somatiques, la mitose est une reproduction conforme en ce qui concerne le nombre et le type de chromosomes. Le caryotype est donc conservé au cours des générations cellulaires. Il existe cependant des anomalies chromosomiques qui peuvent altérer le caryotype et avoir des conséquences sur les caractéristiques de l individu porteur. L ADN est le support moléculaire des chromosomes. Chaque chromatide d un chromosome double contient une molécule d ADN. Lors de l interphase, en phase S, l ADN subit une réplication semi-conservative qui permet de conserver la même séquence de nucléotides et donc le même message génétique dans les deux molécules filles issues d une molécule mère. Ainsi, la réplication de l ADN au cours de l interphase et la répartition des chromosomes en deux lots identiques lors de la mitose sont les deux mécanismes cellulaires nécessaires à la reproduction conforme aux échelles moléculaire et cellulaire. Séquence 1 SN12 41

41 E xercices de la séquence 1 Exercice 1 Mobiliser ses connaissances Définir brièvement les termes suivants : Chromatide Mitose Phase S Réplication semi-conservative Chromatine. Rédiger une phrase correctement construite en associant les termes suivants : a- Chromosomes doubles Métaphase Plaque équatoriale. b- Chromosomes simples Anaphase deux lots. QCM : Entourer la ou les affirmations(s) exacte(s). a- Les chromosomes sont visibles durant tout le cycle cellulaire. b- Lors de la mitose, les chromosomes sont décondensés. c- Chaque chromatide est constituée d une molécule d ADN. d- La réplication de l ADN fait intervenir l ARN polymérase. e- La réplication de l ADN a lieu lors de la mitose. f- La réplication de l ADN a lieu durant l interphase. g- La réplication est dite semi-conservative car elle conserve la moitié des chromosomes. h- La réplication est dite semi-conservative car elle conserve un des deux brins des molécules d ADN. i- Une mutation est à l origine de la création d un nouveau gène. j- Une mutation est à l origine d un nouvel allèle d un gène. k- Une mutation par délétion rajoute un nucléotide dans la séquence d un gène. Exercice 2 Raisonner. Appliquer une démarche déductive La BrdU est une molécule analogue au nucléotide à thymine. Dans un milieu de culture contenant de la BrdU, les cellules l incorporent à la place des nucléotides à thymine au moment de la réplication de l ADN. Grâce à une méthode de coloration des chromosomes, l incorporation de BrdU a une conséquence observable : Si l ADN ne comporte plus de thymine, les chromatides sont peu colorées (pointillés sur le schéma). Si l incorporation de BrdU n est que partielle, les chromatides sont normalement colorées (en noir sur le schéma). 42 Séquence 1 SN12

42 Des cellules cultivées jusque-là sur un milieu avec thymine, sont placées en début d interphase dans un milieu de culture où la thymine est remplacée par la BrdU. Au cours d un des cycles cellulaires suivants, une observation est réalisée après coloration. Après avoir schématisé la structure d une portion de molécule d ADN initiale (longueur de la séquence limitée à 10 nucléotides), expliquez et illustrez son devenir dans le milieu de culture contenant la BrdU. Vous Indiquerez, en le justifiant, à quel moment précis et au cours de quel cycle cellulaire a été réalisée l observation traduite par le dessin. Immédiatement après la division cellulaire dessinée ici, les cellules filles sont replacées dans un milieu normal. Indiquez l aspect (ou les aspects) prévisible(s) des chromosomes à la mitose suivante. Justifiez. Exercice 3 Extraire et organiser des informations. Raisonner. Appliquer une démarche déductive. Formuler une hypothèse. ADN et formation des spermatozoïdes La spermatogenèse est le processus par lequel les spermatozoïdes sont formés. Les spermatozoïdes des animaux mâles se forment dans les testicules. Chez les mammifères, les cellules souches à l origine des spermatozoïdes sont les spermatogonies. Celles-ci se multiplient pour en- Séquence 1 SN12 43

43 tretenir un stock permanent de cellules souches. À partir de la puberté, lorsque la fonction de reproduction devient opérationnelle, certaines spermatogonies se transforment progressivement et se divisent en passant par différents stades (qui constituent la lignée spermatique). Les étapes de la spermatogenèse sont illustrées par le schéma suivant : Utiliser les informations du tableau suivant pour déterminer : Le(s) nom(s) des cellules qui subissent une mitose. Justifier la réponse. Le(s) nom(s) des cellules qui subissent une division différente de la mitose. Justifier la réponse. Formuler une hypothèse en ce qui concerne le caryotype des cellules issues d une division différente de la mitose. Aide La question 3 est difficile mais essayez d y réfléchir Anticiper le fait que les gamètes sont à l origine d une potentielle cellule œuf lors de la fécondation. La fécondation doit donc rétablir un caryotype à 2n chromosomes avec 2 exemplaires de chaque type (soit 23 paires dans l espèce humaine) qui sera celui de l individu qui en résultera. Raisonner en mettant en relation le taux d ADN dans les cellules et leur garniture chromosomique possible (nombre et type de chromosomes et nombre de chromatides par chromosome). 44 Séquence 1 SN12

DST DE SCIENCES DE LA VIE ET DE LA TERRE 1) RESTITUTION ORGANISÉE DES CONNAISSANCES (8 PTS)

DST DE SCIENCES DE LA VIE ET DE LA TERRE 1) RESTITUTION ORGANISÉE DES CONNAISSANCES (8 PTS) 1s_cntsvt_2011_11_16_corrigé.doc 1/6 CLASSE DE 1ère S - DURÉE 3H00 DST DE SCIENCES DE LA VIE ET DE LA TERRE CALCULATRICES INTERDITES 1) RESTITUTION ORGANISÉE DES CONNAISSANCES (8 PTS) Le cycle cellulaire

Plus en détail

Chapitre 2 - VARIABILITÉ GÉNÉTIQUE ET MUTATION DE L ADN

Chapitre 2 - VARIABILITÉ GÉNÉTIQUE ET MUTATION DE L ADN Chapitre 2 - VARIABILITÉ GÉNÉTIQUE ET MUTATION DE L ADN Les organismes ne peuvent survivre que si leur ADN est soigneusement répliqué et protégé des altérations chimiques et physiques qui pourraient changer

Plus en détail

Chapitre 4 Cycle cellulaire. Le cycle cellulaire comprend 2 périodes : L interphase, constituée de 3 phases :

Chapitre 4 Cycle cellulaire. Le cycle cellulaire comprend 2 périodes : L interphase, constituée de 3 phases : SYNTHESE Chapitre 4 Cycle cellulaire Le cycle cellulaire comprend 2 périodes : L interphase, constituée de 3 phases : G1 : phase de croissance cellulaire et d activités métaboliques normales. S : phase

Plus en détail

DAEU- cours de Sciences de la Nature et de la Vie- Marie Claire Garnier

DAEU- cours de Sciences de la Nature et de la Vie- Marie Claire Garnier Partie 3 : génétique Chapitre 1 : la transmission d un caractère au cours de la reproduction sexuée Rappel : la reproduction sexuée comprend 2 phénomènes fondamentaux successifs : La méiose lors de la

Plus en détail

DEVOIR DE SCIENCES DE LA VIE et de LA TERRE. Septembre 2014.

DEVOIR DE SCIENCES DE LA VIE et de LA TERRE. Septembre 2014. DEVOIR DE SCIENCES DE LA VIE et de LA TERRE. Septembre 2014. Vous devez choisir pour chaque question proposée, zéro, une ou plusieurs réponses exactes parmi celles proposées ou bien répondez à la question.

Plus en détail

Chapitre 2. Les mutations, source de variabilité génétique

Chapitre 2. Les mutations, source de variabilité génétique Chapitre 2 Les mutations, source de variabilité génétique Les allèles sont dus à des modifications delaséquencedesgènes:lesmutations. Quelle est l origine de ces mutations? I. Les mutations sont des modifications

Plus en détail

A- Exploiter des animations pour repérer une mutation et étudier son mécanisme de réparation.

A- Exploiter des animations pour repérer une mutation et étudier son mécanisme de réparation. THEME 1A : Expression, stabilité et variation du patrimoine génétique Chapitre 2 : Variabilité Génétique et Mutation de l ADN TP-3-: Réparation de l ADN, mutations et polyallélisme Les mutations de l ADN

Plus en détail

Cahier de texte de la classe 1 ère 4 - SVT

Cahier de texte de la classe 1 ère 4 - SVT Cahier de texte de la classe 1 ère 4 - SVT DATE SEQUENCE lundi 12 : revoir la fiche méthodologique «utiliser le microscope optique» (disponible sur le site du lycée) Lundi 12 1 er contact avec les élèves.

Plus en détail

Cahier de texte de la classe 1 ère 3 - SVT

Cahier de texte de la classe 1 ère 3 - SVT Cahier de texte de la classe 1 ère 3 - SVT DATE SEQUENCE jeudi 8 : revoir la fiche méthodologique «utiliser le microscope optique» (disponible sur le site du lycée) Jeudi 8 1 er contact avec les élèves.

Plus en détail

LA MITOSE CUEEP - USTL DÉPARTEMENT SCIENCES BAHIJA DELATTRE

LA MITOSE CUEEP - USTL DÉPARTEMENT SCIENCES BAHIJA DELATTRE Biologie LA MITOSE CUEEP - USTL DÉPARTEMENT SCIENCES BAHIJA DELATTRE Février 2006 I. L'INTRODUCTION Chaque cellule d'un organisme supérieur provient de la multiplication d'une cellule préexistante (cellule

Plus en détail

GENETIQUE. la division cellule. durant la division cellule. Ai Aristote Mendel. Platon. Information génétique. Chromosome

GENETIQUE. la division cellule. durant la division cellule. Ai Aristote Mendel. Platon. Information génétique. Chromosome Molécules ADN Division cellulaire Synthèse des protéines. En Lien: Campbell, Reece,2déd./Biologie./chap.13 1 En Lien: Campbell, Reece,2déd./Biologie./chap.13 2 1 Chromosome Phénotype: l'apparence : structures

Plus en détail

1ere S THEME 1A CHAPITRE N 2: VARIABILITE GENETIQUE ET MUTATION DE L ADN

1ere S THEME 1A CHAPITRE N 2: VARIABILITE GENETIQUE ET MUTATION DE L ADN 1ere S THEME 1A CHAPITRE N 2: VARIABILITE GENETIQUE ET MUTATION DE L ADN Introduction Toutes ces coccinelles appartiennent au même genre cependant elles présentent toutes des différences. Ces différences

Plus en détail

Bases Structurales de l hérédité

Bases Structurales de l hérédité Bases Structurales de l hérédité I- La Génétique Partie de la biologie relative à l hérédité et à la variation. Unités héréditaires transmises d une génération à la suivante sont les gènes. Localisés le

Plus en détail

Chromosome et caryotype

Chromosome et caryotype Chromosome et caryotype Définition et généralités L étude du caryotype «classique» humain est l étude des chromosomes à un stade maximum de condensation (chromosomes mitotiques en métaphase). Caryotype

Plus en détail

Chapitre 5: Evolution de la biodiversité

Chapitre 5: Evolution de la biodiversité Chapitre 5: Evolution de la biodiversité Constat: Tous les êtres vivants ont la même structure (cellules, MO) et pourtant ils ont beaucoup évolué au cours des temps géologiques. Problème: Par quels mécanismes

Plus en détail

PHENOTYPE - GENOTYPE Le phénotype d un individu : - peut être observé uniquement à l échelle moléculaire et à l échelle cellulaire PROTEINES ENZYMES

PHENOTYPE - GENOTYPE Le phénotype d un individu : - peut être observé uniquement à l échelle moléculaire et à l échelle cellulaire PROTEINES ENZYMES REVISIONS DE 1 S. Vous devez indiquer pour chaque proposition si celle-ci est vraie (V) ou fausse (F) en cochant la case correspondante ; une abstention ou une réponse trop peu lisible seront considérées

Plus en détail

Titre de la leçon? Les mutations

Titre de la leçon? Les mutations Titre de la leçon? Les mutations I. La drépanocytose Globules rouges d un sujet normal Globules rouges d un sujet atteint de drépanocytose Circulation des globules rouges dans les capillaires (sujet atteint

Plus en détail

CHAPITRE 3 LA SYNTHESE DES PROTEINES

CHAPITRE 3 LA SYNTHESE DES PROTEINES CHAITRE 3 LA SYNTHESE DES ROTEINES On sait qu un gène détient dans sa séquence nucléotidique, l information permettant la synthèse d un polypeptide. Ce dernier caractérisé par sa séquence d acides aminés

Plus en détail

Principales techniques utilisées en génie génétique Ces différentes techniques peuvent également se combiner entre elles. Séquençage de l ADN

Principales techniques utilisées en génie génétique Ces différentes techniques peuvent également se combiner entre elles. Séquençage de l ADN Principales techniques utilisées en génie génétique Ces différentes techniques peuvent également se combiner entre elles Séquençage de l ADN 1- Un brin complémentaire de l ADN à séquencer est fabriqué

Plus en détail

INFORMATION CHAPITRE 3 GÉNÉTIQUE CE QUE JE SAIS...

INFORMATION CHAPITRE 3 GÉNÉTIQUE CE QUE JE SAIS... GÉNÉTIQUE CHAPITRE 3 INFORMATION Fœtus de trois mois (il mesure environ 10 cm). La division cellulaire est indispensable au développement embryonnaire mais aussi à la croissance de l enfant, de l'adolescent

Plus en détail

Cours 5. Transmission et remaniement de l information génétique. http://rna.igmors.u-psud.fr/gautheret/cours/

Cours 5. Transmission et remaniement de l information génétique. http://rna.igmors.u-psud.fr/gautheret/cours/ Cours 5 Transmission et remaniement de l information génétique http://rna.igmors.u-psud.fr/gautheret/cours/ 1 Plan Rappels sur la réplication de l ADN Le cycle cellulaire et ses contrôles La mitose Recombinaisons

Plus en détail

Figure 3-4 Fonction du nucléole dans la synthèse des ribosomes.

Figure 3-4 Fonction du nucléole dans la synthèse des ribosomes. III.1.6 Le Nucléole Ce sont des structures fibrillaires sphériques denses du noyau interphasique et prophasique des organismes supérieurs. Les nucléoles qui sont le site de formation des ribosomes fixent

Plus en détail

Chapitre 1 La révolution des sciences de la vie par la génétique

Chapitre 1 La révolution des sciences de la vie par la génétique Chapitre 1 La révolution des sciences de la vie par la génétique Variation génétique de la couleur des grains de maïs. Chaque grain représente un individu de constitution génétique distincte. La sélection

Plus en détail

La génétique : Science qui étudie les caractères héréditaires des individus, leur transmission au fil des générations et leurs variations.

La génétique : Science qui étudie les caractères héréditaires des individus, leur transmission au fil des générations et leurs variations. Reprendre l essentiel pour bien réussir son année en S.V.T. La génétique : Science qui étudie les caractères héréditaires des individus, leur transmission au fil des générations et leurs variations. En

Plus en détail

THEME 1 A EXPRESSION, STABILITE ET VARIATION DU PATRIMOINE GENETIQUE

THEME 1 A EXPRESSION, STABILITE ET VARIATION DU PATRIMOINE GENETIQUE THEME 1 A EXPRESSION, STABILITE ET VARIATION DU PATRIMOINE GENETIQUE CHAPITRE 3 L EXPRESSION DU PATRIMOINE GENETIQUE I. LA RELATION GENES-PROTEINES Les protéines interviennent dans le fonctionnement d

Plus en détail

Aujourd hui, il y a plus de consortium, ce qui permet des avancées plus rapides.

Aujourd hui, il y a plus de consortium, ce qui permet des avancées plus rapides. GFMOM 20/01/2012 Cours 2 partie 2 T. Bourgeron II. LA CYTOGENETIQUE Nous allons étudier les anomalies chromosomiques des plus grossières aux plus fines. Ces anomalies peuvent être retrouvées dans la population

Plus en détail

Chapitre 1 La méiose

Chapitre 1 La méiose Chapitre 1 La méiose Marie-Roberte Guichaoua La méiose est un phénomène unique de division cellulaire, propre à la gamétogenèse, au cours de laquelle elle joue un rôle capital en assurant la réduction

Plus en détail

Expérience de Griffith, Avery, Mac Leod,...

Expérience de Griffith, Avery, Mac Leod,... Expérience de Griffith, Avery, Mac Leod,... En 1928, un microbiologiste anglais, Fred Griffith, qui recherchait un vaccin contre la pneumonie, démontra que des pneumocoques tués par la chaleur pouvaient

Plus en détail

Nom : Groupe : Date : 1 LES RESPONSABLES DES CARACTÈRES CHEZ LES ÊTRES VIVANTS (p. 350-358)

Nom : Groupe : Date : 1 LES RESPONSABLES DES CARACTÈRES CHEZ LES ÊTRES VIVANTS (p. 350-358) CHAPITRE 811 STE Questions 1 à 17, A, B. Verdict 1 LES RESPONSABLES DES CARACTÈRES CHEZ LES ÊTRES VIVANTS (p. 350-358) 1. Observez les deux cellules ci-contre. a) Sous quelle forme apparaît l ADN dans

Plus en détail

UE1 Chromosomes Caryotypes anomalies 2009/2010. Les chromosomes, le caryotype et ses anomalies

UE1 Chromosomes Caryotypes anomalies 2009/2010. Les chromosomes, le caryotype et ses anomalies Les chromosomes, le caryotype et ses anomalies 1 I. Intérêt de l établissement du caryotype II. Structure t du chromosome métaphasique 1. Le centromère 2. Les télomères III. Le caryotype 1. Le rangement

Plus en détail

La réplication de l ADN:

La réplication de l ADN: Lors de chaque division cellulaire la totalité de l'adn doit être dupliquée. La duplication d'une molécule d'adn parent en deux molécules d'adn fille est appelée réplication. 1. ADN à répliquer 2. Séparation

Plus en détail

Immunogénétique COURS 1. Silvina GONZALEZ-RIZZO Laboratoire de Biologie Marine sgonzale@univ-ag.fr

Immunogénétique COURS 1. Silvina GONZALEZ-RIZZO Laboratoire de Biologie Marine sgonzale@univ-ag.fr Immunogénétique COURS 1 Silvina GONZALEZ-RIZZO Laboratoire de Biologie Marine sgonzale@univ-ag.fr PRESENTATION CM1 Définitions Rappels des concepts Chromosomes Anomalies chromosomiques CM2 Mutations géniques

Plus en détail

Délétion 1P36 3.3 ~ Trisomie 9P46. Présentation de la Maladie

Délétion 1P36 3.3 ~ Trisomie 9P46. Présentation de la Maladie Délétion 1P36 3.3 ~ Trisomie 9P46 Présentation de la Maladie deux cellules sexuelles parentales ou gamètes spermatozoïde ovocyte zygote (œuf). Chaque cellule possède un noyau, qui contient l'ensemble du

Plus en détail

L'ADN mitochondrial a été découvert en 1962 par Margit MK Nass et Sylvan Nass par microscopie électronique.

L'ADN mitochondrial a été découvert en 1962 par Margit MK Nass et Sylvan Nass par microscopie électronique. L L'ADN mitochondrial a été découvert en 1962 par Margit MK Nass et Sylvan Nass par microscopie électronique. Figure 1 Mitochondries observées au microscope électronique à transmission Plus tard, cet ADN

Plus en détail

POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA

POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA Amplification spécifique Détection spécifique Clonage dans des vecteurs Amplification in vitro PCR Hybridation moléculaire - hôte cellulaire

Plus en détail

CYCLE CELLULAIRE et CANCER. L. Xerri, Institut Paoli-Calmettes, M2 Oncologie «Module Génomique Tumorale», Novembre 2011

CYCLE CELLULAIRE et CANCER. L. Xerri, Institut Paoli-Calmettes, M2 Oncologie «Module Génomique Tumorale», Novembre 2011 CYCLE CELLULAIRE et CANCER L. Xerri, Institut Paoli-Calmettes, M2 Oncologie «Module Génomique Tumorale», Introduction Le cycle cellulaire est l'ensemble des modifications qu'une cellule subit entre sa

Plus en détail

Chapitre 3 : conserver ou transmettre l information génétique.

Chapitre 3 : conserver ou transmettre l information génétique. Chapitre 3 : conserver ou transmettre l information génétique. Mais, que dois-je savoir? Pour rattraper un cours manquant, retrouve-le sur le site du collège dans la rubrique «enseignements» : http://colleges.acrouen.fr/courbet/spipuser/

Plus en détail

Chapitre 14: La génétique

Chapitre 14: La génétique Chapitre 14: La génétique A) Les gènes et les protéines, ça te gêne? 1) a) Quel est l élément de base des vivants? Les cellules b) Qu a-t-elle en son centre? Un noyau c) Qu y retrouve-t-on sous forme de

Plus en détail

Tâche complexe en 3 ème : la division cellulaire. N Document et origine. Documents proposés

Tâche complexe en 3 ème : la division cellulaire. N Document et origine. Documents proposés Tâche complexe en 3 ème : la division cellulaire Consigne : utiliser les documents suivants pour construire une situation déclenchante, élaborer une consigne et des fiches d aide, dans le but de faire

Plus en détail

Variabilité génétique et stabilité des espèces

Variabilité génétique et stabilité des espèces TP-TD 2 Variabilité génétique et stabilité des espèces Objectif et Compétences Faire preuve d'esprit logique et critique Analyser des documents Interpréter des observations Travail à faire : Sur une feuille

Plus en détail

1 les caractères des êtres humains.

1 les caractères des êtres humains. Quelques rappels des classes précédentes ACTIVITÉ livre pages 8 et 9 : apprendre le bilan de la page 9 Les êtres vivants sont répartis en espèces. Chaque être vivant est formé de cellules. schéma d une

Plus en détail

Lettres: A, T, G, C. Mots: à 3 lettres (codons) Phrase: gène (information pour synthétiser une protéine). Ponctuation

Lettres: A, T, G, C. Mots: à 3 lettres (codons) Phrase: gène (information pour synthétiser une protéine). Ponctuation 2- Les molécules d ADN constituent le génome 2-1 La séquence d ADN représente l information génétique Lettres: A, T, G, C Mots: à 3 lettres (codons) Phrase: gène (information pour synthétiser une protéine).

Plus en détail

Comment expliquer nos ressemblances et nos différences?

Comment expliquer nos ressemblances et nos différences? Chez l espèce humaine, comme chez toute espèce, il existe des ressemblances et des différences entre les individus, y compris à l intérieur d une même famille. Comment expliquer nos ressemblances et nos

Plus en détail

THÈME 3 : DU GÉNOTYPE AU PHÉNOTYPE. CHAPITRE 1 : la relation entre ADN et protéines

THÈME 3 : DU GÉNOTYPE AU PHÉNOTYPE. CHAPITRE 1 : la relation entre ADN et protéines THÈME 3 : DU GÉNOTYPE AU PHÉNOTYPE CHAPITRE 1 : la relation entre ADN et protéines Les caractères d un individu dépendent de plusieurs facteurs : certains dépendent des caractères présents dans la famille

Plus en détail

Information génétique

Information génétique chapitre 3 Information génétique et division cellulaire L étude de la division cellulaire est abordée pour découvrir comment est transmise et conservée l information génétique portée par les chromosomes.

Plus en détail

Chapitre 17 Les changements chromosomiques à grande échelle

Chapitre 17 Les changements chromosomiques à grande échelle Chapitre 17 Les changements chromosomiques à grande échelle Une translocation réciproque démontrée par une technique appelée coloration des chromosomes Les mutations chromosomiques Les mutations chromosomiques

Plus en détail

Chapitre 2 : Organisation de la cellule

Chapitre 2 : Organisation de la cellule Partie 1 : notions de biologie cellulaire DAEU- Cours Sciences de la Nature & de la Vie- Marc Cantaloube Chapitre 2 : Organisation de la cellule La cellule est l unité de base des êtres vivants. Il existe

Plus en détail

L'hybridation fluorescente (FISH)

L'hybridation fluorescente (FISH) L'hybridation fluorescente (FISH) fluorescent in situ hybridization DR Thierry PALUKU THEY-THEY LABO GENETIQUE ET PATHO MOLECULAIRE JUIN 2007 Définition repérer la présence d'anomalies chromosomiques par

Plus en détail

LE SUPPORT DE L INFORMATION 3 - MÉCANISME GÉNÉRAL DE LA BIOSYNTHÈSE DE L ADN : LA RÉPLICATION

LE SUPPORT DE L INFORMATION 3 - MÉCANISME GÉNÉRAL DE LA BIOSYNTHÈSE DE L ADN : LA RÉPLICATION LE SUPPORT DE L INFORMATION 3 - MÉCANISME GÉNÉRAL DE LA BIOSYNTHÈSE DE L ADN : LA RÉPLICATION En même temps que leur modèle, Watson et Crick proposaient des implications fondamentales à la structure secondaire

Plus en détail

I Les caractères de l'individu :

I Les caractères de l'individu : Partie 1, Chapitre 1 LES CARACTÈRES DE L'INDIVIDU ET LEUR TRANSMISSION Rappels : Un être vivant : c'est un être qui naît, grandit, mange, rejete des déchets, se reproduit et meurt. Il est constitué de

Plus en détail

Thème 1 : La Terre dans l'univers, la vie et l'évolution du vivant. Chapitre 3 : La vie des cellules, leur milieu de vie et l'information génétique.

Thème 1 : La Terre dans l'univers, la vie et l'évolution du vivant. Chapitre 3 : La vie des cellules, leur milieu de vie et l'information génétique. Thème 1 : La Terre dans l'univers, la vie et l'évolution du vivant. Chapitre 3 : La vie des cellules, leur milieu de vie et l'information génétique. SOMMAIRE 1- Les caractéristiques fonctionnelles des

Plus en détail

Réplication de l'adn

Réplication de l'adn 1) réplication chez les procaryotes : Réplication de l'adn - Synthèse de la nouvelle chaîne dans le sens 5'-3' : La synthèse de la nouvelle chaîne d'adn est réalisée par une ADN polymérase, qui ajoute

Plus en détail

Capacités et attitudes Activités Compétences Tâche complexe Extraire et organiser des Informations

Capacités et attitudes Activités Compétences Tâche complexe Extraire et organiser des Informations Constat : la méiose produit des gamètes génétiquement différents qui parfois comportent des anomalies qui peuvent empêcher l embryon de se développer ou de se développer normalement et entraîner alors

Plus en détail

Méthodes et techniques de la biologie du développement

Méthodes et techniques de la biologie du développement Méthodes et techniques de la biologie du développement 1. Etude de l expression des gènes : Détecter les transcrits et les protéines au cours de l ontogenèse l outil anticorps 1.1. La RT-PCR La réaction

Plus en détail

Ressources. Production attendue

Ressources. Production attendue Thème du programme : la tectonique des plaques histoire d un modèle Etape 1 : Concevoir une stratégie pour résoudre une situation problème proposer une démarche d investigation Contre arguments de la théorie

Plus en détail

1A 01 Brassage génétique et sa contribution à la diversité génétique Ex 2.1 SUJET 1

1A 01 Brassage génétique et sa contribution à la diversité génétique Ex 2.1 SUJET 1 SUJET 1 On réalise deux croisements expérimentaux chez la drosophile afin d étudier le devenir de deux caractères : la couleur du corps et l aspect des ailes au cours de la reproduction sexuée La longueur

Plus en détail

LA SYNTHÈSE DES PROTÉINES

LA SYNTHÈSE DES PROTÉINES LA SYNTHÈSE DES PROTÉINES La transcription Information : dans le noyau (sous forme d'adn) Synthèse des protéines : dans le cytoplasme (au niveau des ribosomes du reticulum endoplasmique) L'ADN ne sort

Plus en détail

I/ L information génétique se trouve dans les chromosomes du noyau.

I/ L information génétique se trouve dans les chromosomes du noyau. Chapitre 2 : localisation et organisation de l information génétique Mais, que dois-je savoir? Pour rattraper un cours manquant, retrouve-le sur le site du collège dans la rubrique «enseignements» : http://colleges.acrouen.fr/courbet/spipuser/

Plus en détail

Leçon 1 : Les caractères d un individu Date : Chaque être humain possède de nombreux caractères.

Leçon 1 : Les caractères d un individu Date : Chaque être humain possède de nombreux caractères. Leçon 1 : Les caractères d un individu Date : Chaque être humain possède de nombreux caractères. Certains caractères sont communs à tous les individus de notre espèce et permettent de nous distinguer des

Plus en détail

Série : STL Spécialité biotechnologies SESSION 2014 BACCALAURÉAT TECHNOLOGIQUE

Série : STL Spécialité biotechnologies SESSION 2014 BACCALAURÉAT TECHNOLOGIQUE BACCALAURÉAT TECHNLGIQUE Série : STL Spécialité biotechnologies SESSIN 2014 CBSV : sous épreuve coefficient 4 Biotechnologies : sous épreuve coefficient 4 Durée totale de l épreuve: 4 heures Les sujets

Plus en détail

Information Génétique et hérédité 1- Réplication, mitose, méiose

Information Génétique et hérédité 1- Réplication, mitose, méiose Information Génétique et hérédité 1- Réplication, mitose, méiose REPLICATION DE L ADN et CYCLE CELLULAIRE quantité d'adn 4C 2C G 1 S G 2 M G 1 5 12 15 16 duplication de l'adn mitose temps heures CYCLE

Plus en détail

UNITE ET DIVERSITE DES ËTRES HUMAINS

UNITE ET DIVERSITE DES ËTRES HUMAINS UNITE ET DIVERSITE DES ËTRES HUMAINS Rappels : - organisation du corps humain - La fécondation L HEREDITE ET SON SUPPORT Chaque individu possède des ressemblances et des différences même au sein d une

Plus en détail

Chapitre 10 L isolement et la manipulation de gènes. Injection d ADN étranger dans une cellule animale

Chapitre 10 L isolement et la manipulation de gènes. Injection d ADN étranger dans une cellule animale Chapitre 10 L isolement et la manipulation de gènes Injection d ADN étranger dans une cellule animale Comment amplifier un gène d intérêt? Amplification in vivo à l aide du clonage d ADN L ensemble formé

Plus en détail

AP SVT. Exercice 1. Exercice 2. Exercice 3.

AP SVT. Exercice 1. Exercice 2. Exercice 3. Exercice 1. AP SVT On cherche à comprendre le mode de transmission de deux caractères chez la Drosophile, organisme diploïde. Effectuez une analyse génétique pour expliquer les résultats des croisements

Plus en détail

Capacités Connaissances Attitudes Recenser, extraire et organiser des informations

Capacités Connaissances Attitudes Recenser, extraire et organiser des informations Préparer une «Situation complexe disciplinaire», situation d apprentissage et/ou d évaluation TITRE : L ADN, molécule support de l information génétique classe : 2 nde durée : 60 minutes Capacités Connaissances

Plus en détail

10.25/2. Shéma du processur de fibrose kystique sur une glande

10.25/2. Shéma du processur de fibrose kystique sur une glande Thème 1-A : Expression, stabilité et variation du patrimoine génétique TP 6 : La mucoviscidose : multiples échelons d un phénotype La mucoviscidose présente des indications visibles qui constituent un

Plus en détail

BASES DE GENETIQUE. Y.LAMBREY- genetique-ifsi-2006 1

BASES DE GENETIQUE. Y.LAMBREY- genetique-ifsi-2006 1 BASES DE GENETIQUE Y.LAMBREY- genetique-ifsi-2006 1 ADN ET PROTEINES Y.LAMBREY- genetique-ifsi-2006 2 2 éléments fondamentaux pour la vie, les protéines et l ADN - PROTEINES, présentes partout, exercent

Plus en détail

BACCALAURÉAT TECHNOLOGIQUE

BACCALAURÉAT TECHNOLOGIQUE BACCALAURÉAT TECHNOLOGIQUE Série : Sciences et Technologies de Laboratoire Spécialité : Biotechnologies SESSION 2013 Sous-épreuve écrite de Biotechnologies Coefficient de la sous-épreuve : 4 Ce sujet est

Plus en détail

BL01 : Environnement agro-industriel et cancer

BL01 : Environnement agro-industriel et cancer Note : ce document n est qu une prise de note rédigée pendant le cours de BL01. Il ne peut donc se substituer au cours d autant plus qu il est souvent incomplet (la 2 ème heure était souvent celle de la

Plus en détail

CHAPITRE 4 - LA COMPLEXITÉ DES RELATIONS ENRE GÈNES, PHÉNOTYPES ET ENVIRONNEMENT

CHAPITRE 4 - LA COMPLEXITÉ DES RELATIONS ENRE GÈNES, PHÉNOTYPES ET ENVIRONNEMENT CHAPITRE 4 - LA COMPLEXITÉ DES RELATIONS ENRE GÈNES, PHÉNOTYPES ET ENVIRONNEMENT Introduction Tous les individus de la même espèce possèdent le même patrimoine génétique, cependant chaque individu est

Plus en détail

Génétique kits. Kit de précipitation de l ADN. Réf : 117 029. Français p 1. Version : 8003

Génétique kits. Kit de précipitation de l ADN. Réf : 117 029. Français p 1. Version : 8003 kits Français p 1 Kit de précipitation de l ADN Version : 8003 1 Composition Quantité nécessaire pour 25 tests. - 25 ml de solution d ADN (de saumon) à 1mg/mL (tampon Tris-HCI 0,010 M, ph 8,0 en présence

Plus en détail

8.3.3 Réactifs. La polymérase catalyse la synthèse de brins complémentaires d ADN.

8.3.3 Réactifs. La polymérase catalyse la synthèse de brins complémentaires d ADN. 8.3.3 Réactifs 1. AD polymérase: La polymérase catalyse la synthèse de brins complémentaires d AD. Des polymérases qui sont résistantes à la chaleur sont utilisées, telles que la Taq polymérase (Thermus

Plus en détail

SOCLE COMMUN - La Compétence 3 Les principaux éléments de mathématiques et la culture scientifique et technologique

SOCLE COMMUN - La Compétence 3 Les principaux éléments de mathématiques et la culture scientifique et technologique SOCLE COMMUN - La Compétence 3 Les principaux éléments de mathématiques et la culture scientifique et technologique DOMAINE P3.C3.D1. Pratiquer une démarche scientifique et technologique, résoudre des

Plus en détail

TD Révision BIO57. Connaissance et Technique du gène

TD Révision BIO57. Connaissance et Technique du gène TD Révision BIO57 Connaissance et Technique du gène Novembre 2007 Cécile BAUDOT cecile.baudot@medecine.univ-mrs.fr INSERM 910 «Génétique Médicale et Génomique Fonctionnelle» Maladies Neuromusculaires Le

Plus en détail

PRODUCTION RESSOURCES- SVT RESSOURCES MUTUALISABLES SUR LE SITE ACADEMIQUE S.V.T 2012

PRODUCTION RESSOURCES- SVT RESSOURCES MUTUALISABLES SUR LE SITE ACADEMIQUE S.V.T 2012 PRODUCTION RESSOURCES- SVT RESSOURCES MUTUALISABLES SUR LE SITE ACADEMIQUE S.V.T 2012 24/02/2012 F.ANTOINE M.BELFROY PREMIERE S Frédérique et Martine ACTIVITES PRATIQUES Activité préparant l ECE en Première

Plus en détail

PAES 2010-2011 STAGE DE PRÉ RENTRÉE UE 2

PAES 2010-2011 STAGE DE PRÉ RENTRÉE UE 2 PAES 2010-2011 STAGE DE PRÉ RENTRÉE UE 2 Introduction Théorie cellulaire : toute cellule est issue d une cellule L information génétique est transmise aux 2 cellules filles à chaque division Le génome

Plus en détail

Génie génétique. Définition : Outils nécessaires : Techniques utilisées : Application du génie génétique : - Production de protéines

Génie génétique. Définition : Outils nécessaires : Techniques utilisées : Application du génie génétique : - Production de protéines Génie génétique Définition : Ensemble de méthodes d investigation et d expérimentation sur les gènes. Outils nécessaires : ADN recombinant, enzyme de restriction, vecteur, banque ADNc, sonde nucléique...

Plus en détail

Chapitre 5. Réplication, Réparation et Recombinaison de l ADN

Chapitre 5. Réplication, Réparation et Recombinaison de l ADN Chapitre 5 Réplication, Réparation et Recombinaison de l ADN Réplication de l ADN 1. La complémentarité des bases permet la réplication de l ADN 2. La synthèse de l ADN commence aux origines de réplication

Plus en détail

Dr E. CHEVRET UE2.1 2013-2014. Aperçu général sur l architecture et les fonctions cellulaires

Dr E. CHEVRET UE2.1 2013-2014. Aperçu général sur l architecture et les fonctions cellulaires Aperçu général sur l architecture et les fonctions cellulaires I. Introduction II. Les microscopes 1. Le microscope optique 2. Le microscope à fluorescence 3. Le microscope confocal 4. Le microscope électronique

Plus en détail

Chapitre 2. La synthèse protéique : la relation entre le génotype et le phénotype.

Chapitre 2. La synthèse protéique : la relation entre le génotype et le phénotype. Chapitre 2. La synthèse protéique : la relation entre le génotype et le phénotype. Les maladies génétiques comme la drépanocytose ou l'albinisme sont liées à des modifications du génotype des individus

Plus en détail

TP de Biochimie Groupe 4 Forestier Michèle 25.05.2010 Fournier Coralie Freyre Christophe Manipulation d ADN

TP de Biochimie Groupe 4 Forestier Michèle 25.05.2010 Fournier Coralie Freyre Christophe Manipulation d ADN MANIPULATION D ADN Clonage du gène «venus» dans des plasmides et expression de celui-ci chez les bactéries E.Coli. Assistants: U. Loizides M. Umebayashi C. Gehin - 1 - 1. Résumé Lors de notre expérience,

Plus en détail

La cytométrie de flux

La cytométrie de flux TD5 La cytométrie de flux Air sous-pression Signal de formation des gouttes Signal de charge des gouttes Cellules en suspension Liquide de Gaine Vibrateur Ultrason Dˇtecteur de Lumi re Arrt du Faisceau

Plus en détail

SCIENCES DE LA VIE ET DE LA TERRE

SCIENCES DE LA VIE ET DE LA TERRE BACCALAURÉAT GÉNÉRAL SESSION 2014 SCIENCES DE LA VIE ET DE LA TERRE Série S Durée de l'épreuve : 3h30 Coefficient : 6 ENSEIGNEMENT OBLIGATOIRE L'usage de la calculatrice n'est pas autorisé Dès que le sujet

Plus en détail

Différents types de chromosomes en Giemsa

Différents types de chromosomes en Giemsa Différents types de chromosomes en Giemsa Marquage Giemsa simple - Comptage d une mitose: 45, 46 ou 47 - Reconnaissance des groupes et certains chromosomes dans les groupes, mais pas dans leur structure,

Plus en détail

Du génotype au phénotype, relation avec l environnement

Du génotype au phénotype, relation avec l environnement Du génotype au phénotype, relation avec l environnement Pré-requis (troisième et seconde) : Chaque individu présente les caractères de l'espèce avec des variations qui lui sont propres. C'est le résultat

Plus en détail

Macromolécules et la Cellule

Macromolécules et la Cellule Macromolécules et la Cellule Macromolécules Campbell chapitre 5 Macromolécules Définition: Molécule géante formée par l assemblage de plusieurs petites molécules organiques Macromolécules Définition:

Plus en détail

Chapitre 1. La cellule : unité morphologique et fonctionnelle

Chapitre 1. La cellule : unité morphologique et fonctionnelle Chapitre 1. La cellule : unité morphologique et fonctionnelle 1. Historique de la biologie : Les premières cellules eucaryotes sont apparues il y a 3 milliards d années. Les premiers Homo Sapiens apparaissent

Plus en détail

Eléments primordiaux de biologie moléculaire

Eléments primordiaux de biologie moléculaire Eléments primordiaux de biologie moléculaire Pourquoi s intéresser au matériel génétique? Base de l information génétique Tissu Cellule Noyau Organisme entier Lieu où est localisé l ADN Mol d ADN qui est

Plus en détail

Cours de Biologie Cellulaire L1 2006/2007

Cours de Biologie Cellulaire L1 2006/2007 Cours de Biologie Cellulaire L1 2006/2007 Qu est ce que la biologie cellulaire? La biologie cellulaire étudie les cellules et leurs organites, les processus vitaux qui s'y déroulent ainsi que les mécanismes

Plus en détail

Connaissances d expliquer le constat effectué au premier chapitre, à savoir que toutes les cel- lules de l organisme, à l exception des cellules

Connaissances d expliquer le constat effectué au premier chapitre, à savoir que toutes les cel- lules de l organisme, à l exception des cellules 3 Multiplication Multiplication cellulaire et cancer PROGRAMME Connaissances Diversité et unité des êtres humains Les cellules de l organisme, à l exception des cellules reproductrices, possèdent la même

Plus en détail

INFORMATION GÉNÉTIQUE et REPRODUCTION SEXUÉE

INFORMATION GÉNÉTIQUE et REPRODUCTION SEXUÉE Partie 1, Chapitre 4 INFORMATION GÉNÉTIQUE et REPRODUCTION SEXUÉE Constat : à l'exception des jumeaux, chaque individu est unique. Ses caractères héréditaires dependent des info génétiques (allèles) portées

Plus en détail

Professeur Joël LUNARDI

Professeur Joël LUNARDI Biochimie - Biologie moléculaire Chapitre 3 : La réplication du matériel génétique Professeur Joël LUNARDI MED@TICE PCEM1 - Année 2006/2007 Faculté de Médecine de Grenoble - Tous droits réservés. Chapitre

Plus en détail

SBI3U Épreuve Génétique Nom:

SBI3U Épreuve Génétique Nom: SBI3U Épreuve Génétique Nom: PARTIE A (15) (Connaissances et compréhension) Inscrire la bonne réponse sur la carte SCANTRON 1. Une femme porteuse du gène d hémophilie et un homme hémophile sont croisés.

Plus en détail

L ADN. Schématisez un nucléotide et un nucléoside en précisant sur quel carbone du sucre se font les différents assemblages :

L ADN. Schématisez un nucléotide et un nucléoside en précisant sur quel carbone du sucre se font les différents assemblages : L ADN. I. GENERALITES. A. Les caractéristiques de l ADN. Donnez les 6 caractéristiques de l ADN : B. Les nucléotides/nucléosides : Schématisez un nucléotide et un nucléoside en précisant sur quel carbone

Plus en détail

Activité 1 : échantillonnage

Activité 1 : échantillonnage Activité échantillonnage, intervalle de fluctuation, prise de décision (à partir d un même thème) Les trois activités qui suivent s inspirent du document «ressources pour la classe de première générale

Plus en détail

Chapitre 1 Structure et diversité du génome humain

Chapitre 1 Structure et diversité du génome humain Chapitre 1 Structure et diversité du génome humain I. Préambule Le projet de séquençage du génome humain est certainement, après la conquête de la lune, l une des aventures humaines récentes les plus passionnantes

Plus en détail

BACCALAUREAT TECHNOLOGIQUE SCIENCES ET TECHNOLOGIES DE LA SANTE ET DU SOCIAL BIOLOGIE ET PHYSIOPATHOLOGIE HUMAINES SESSION 2010

BACCALAUREAT TECHNOLOGIQUE SCIENCES ET TECHNOLOGIES DE LA SANTE ET DU SOCIAL BIOLOGIE ET PHYSIOPATHOLOGIE HUMAINES SESSION 2010 BACCALAUREAT TECHNOLOGIQUE SCIENCES ET TECHNOLOGIES DE LA SANTE ET DU SOCIAL BIOLOGIE ET PHYSIOPATHOLOGIE HUMAINES SESSION 2010 Durée : 3 h 30 Coefficient : 7 Avant de composer, le candidat s assurera

Plus en détail

Chapitre 2 La diversification du vivant

Chapitre 2 La diversification du vivant Chapitre 2 La diversification du vivant 1 Introduction Méiose et fécondation : sources de diversité Mutations germinales : processus fondamental de diversification génétique, générateur de biodiversité

Plus en détail

Les outils du génie génétique.

Les outils du génie génétique. Les outils du génie génétique. I\ Les enzymes. On va se servir des enzymes pour couper, coller et synthétiser des acides nucléiques. A\ Les polymérases. Toutes les polymérases agissent de 5 vers 3. En

Plus en détail

Tutoriel pour les enseignants de lycée. Rappel du contenu des programmes au lycée en classe de seconde

Tutoriel pour les enseignants de lycée. Rappel du contenu des programmes au lycée en classe de seconde Tutoriel pour les enseignants de lycée Ce document sert à l enseignant pour préparer différentes séquences pédagogiques afin d aborder : les questions de la génétique, des maladies génétiques, et les métiers

Plus en détail