Espèces. Bactérie 0,92 1,03 Levure 1,80 1,00 Ail 1,73 1,01 Blé 1,22 0,98. Taux fort. Aucun Plutonium. Taux. moyen de fumée + plutonium

Dimension: px
Commencer à balayer dès la page:

Download "Espèces. Bactérie 0,92 1,03 Levure 1,80 1,00 Ail 1,73 1,01 Blé 1,22 0,98. Taux fort. Aucun Plutonium. Taux. moyen de fumée + plutonium"

Transcription

1 DS Chapitre 3 : L ADN, support de l information génétique Partie 1 : Restitution des connaissances. 1/ Définir : gène, mutation 2/ Citer le nom de la «brique» de base de la molécule d ADN. Représenter schématiquement une de ces «briques». SUJET C 3/ Rédiger une phrase pour exprimer une notion importante, en utilisant chaque groupe de mots pris dans cet ordre ou dans un ordre différent. a/ chromosome, gènes, ADN b/ mutations, allèles, gène, diversité Partie 2 : Utilisation des connaissances. Exercice 1 : Hémoglobine et myoglobine. On s intéresse à deux protéines : l hémoglobine et la myoglobine. L hémoglobine est une molécule permettant de transporter le dioxygène dans le sang. La myoglobine est une molécule que l on retrouve dans les muscles et qui est capable également de fixer le dioxygène. Le gène responsable de la synthèse de la myoglobine est situé sur les chromosomes n 22. Le tableau ci-dessous présent la séquence des 21 premières bases (hors ATG de départ) de l un des deux brins d ADN constituant le gène responsable de la fabrication d une partie de l hémoglobine. Séquences des bases d un brin de la molécule d ADN Conséquences sur l organisme Hémoglobine normale, pas d anémie* 1. GTGCACCTGACTCCTGAGGAG 2. GTGCATCTGACTCCTGAGGAG Hémoglobine normale, pas d anémie* 3. GTGCACCTGACTCCTAAGGAG Hémoglobine légèrement différente, anémie*. *anémie : caractérisée par un manque de globules rouges ou d hémoglobine. Les symptômes sont la fatigue, la pâleur et un essoufflement accru à l effort. 1/ Ecrire la séquence des bases complémentaires de la séquence 1 directement dans le tableau afin de reconstituer une molécule d ADN à structure complète. 2/ Montrer qu une modification dans la séquence des bases peut entraîner une modification de l information génétique. 3/ Deux séquences différentes ont-elles toujours une conséquence sur l information génétique? Justifier. 4/ Les 21 premières bases (hors ATG de départ) de l un des deux brins de l ADN du gène de la myoglobine sont : GGGCTCAGCGACGGG GAATGG. Montrer que la fabrication de la myoglobine dépend d un gène différent du gène de l hémoglobine. Exercice 2 : Influence d agents mutagènes. On a évalué le nombre de cancers des poumons chez des rats de laboratoire qui ont été exposés ou non à deux agents mutagènes chimiques : le dioxyde de plutonium et la fumée de cigarette. (On rappelle qu un agent mutagène est une substance gaz, produit liquide qui peut entraîner des mutations). 1/ Compléter le tableau à l aide du graphique (attention aux unités!) Agents mutagènes % de cancers Aucun Plutonium Taux moyen de fumée Taux moyen de fumée + plutonium Taux fort de fumée Taux fort de fumée + plutonium 0 0,20 0,05 0,60 0,10 0,75 2/ Expliquer le rôle de la fumée et du plutonium dans la fréquence des cancers du poumon. 3/ Proposer une hypothèse expliquant le rôle de ces substances sur le matériel héréditaire (information génétique). Exercice 3 : Les bases azotées de l ADN de plusieurs espèces. On a déterminé les nombres de bases azotées présentes dans l ADN de différentes espèces et établi les rapports présentés dans le tableau ci-dessous : Espèces Bactérie 0,92 1,03 Levure 1,80 1,00 Ail 1,73 1,01 Blé 1,22 0,98 1/ Rappeler ce qu est l appariement des bases. 2/ Expliquer pourquoi le rapport (A+G)/(T+C) est toujours très voisin de 1, quelle que soit l espèce. 3/ Expliquer pourquoi le rapport (A+T)/(C+G) diffère selon les espèces. 4/ Construire un modèle possible (plusieurs possibilités!) d un fragment d ADN qui comporterait 10 nucléotides par brin et dont le rapport (A+T)/(C+G) serait de 1,5. La représentation sera schématisée sous forme déroulée.

2 Partie 1. Eléments de correction de l évaluation sur le chapitre 3 : ADN, support de l information génétique SUJET C 1/ Gène : portion d ADN portant une information génétique codée par la succession des nucléotides. Mutation : modification aléatoire d un nucléotide au sein d une séquence. 2/ Un nucléotide est composé de trois éléments : acide phosphorique, sucre (désoxyribose) et une base azotée (adénine, thymine, guanine ou cytosine). 3/ a/ Un chromosome est essentiellement constitué d ADN. Il comporte de nombreux gènes. b/ Des mutations permettent la mise en place de différentes versions d un même gène : ce sont les allèles. Ces allèles peuvent expliquer la diversité des êtres vivants. Partie 2. Exercice 1 : 1/ Il suffit de compléter en respectant la règle d appariement des bases : CAC G T G G A C T G A G G A C T C C T C GTG C A C C T G A C T C C T G A G G A G 2/ La séquence 3 diffère de la séquence 1 par le remplacement, en position 16, d une guanine par une adénine. Or on voit dans le tableau que cette substitution a pour conséquence une hémoglobine légèrement différente et une anémie. On conclut donc qu une modification dans la séquence des bases peut entraîner une modification de l information génétique. 3/ La séquence 2 diffère de la séquence 1 par le remplacement, en position 6, d une cytosine par une thymine. Or on voit dans le tableau que cette substitution n a pas de conséquence sur l hémoglobine. On conclut que deux séquences différentes n ont pas toujours de conséquence sur l information génétique. 4/ Les 21 premières bases de la séquence du gène de la myoglobine présente beaucoup de différences avec celle du gène de l hémoglobine. Ces deux protéines (hémoglobine et myoglobine) sont donc produites à partir de deux gènes différents. Exercice 2 : 1/ voir le tableau du sujet! 2/ La fumée et le plutonium augmente le nombre de cellules cancéreuses. Plus il y a de fumée (seule), plus le nombre de cellules cancéreuses augmente. Lorsque la fumée est combinée au plutonium, il y a beaucoup plus de cellules cancéreuses. 3/ La fumée et le plutonium peuvent causer des mutations qui vont modifier l information génétique des cellules. Cette information génétique modifiée peut se caractériser par un développement anarchique des cellules (ce qui définit des cellules cancéreuses). Exercice 3 : 1/ L appariement de base correspond à l association d une adénine avec une thymine d une part, d une cytosine avec une guanine d autre part. 2/ Puisque A = T et C = G (à cause de l appariement), le rapport (A+G)/(T+C) peut s écrire (T+C)/(T+C) ce qui correspond bien à un résultat égal à 1. 3/ Ce rapport est différent d une espèce à l autre car il n existe aucun lien entre le nombre de paires (A+T) et les paires (C+G), donc le résultat de cette division est différent selon les espèces qui n ont pas la même information génétique. 4/ Je lis attentivement les informations du sujet : - «10 nucléotides par brin» : je dois donc écrire 20 nucléotides en tout, 10 «à gauche» et 10 «à droite». - Rapport de 1,5 : le nombre de paires (A+T) doit être 1,5 fois plus grand que le nombre de paires (C+G)

3 Un modèle possible : On vérifie le rapport : (A+T) / (C+G) = 12/8 = 3/2 = 1,5

4 DS Chapitre 3 : L ADN, support de l information génétique. SUJET D Partie 1 : Restitution des connaissances. 1/ Définir : allèle, mutation génétique 2/ Citer le nom de la «brique» de base de la molécule d ADN. Représenter schématiquement une de ces «briques». 3/ Rédiger une phrase pour exprimer une notion importante, en utilisant chaque groupe de mots pris dans cet ordre ou dans un ordre différent. a/ message codé, séquence, nucléotides, gène b/ chaînes d ADN, nucléotides, complémentaires Partie 2 : Utilisation des connaissances. Exercice 1 : Lutte biologique contre les chenilles. Des chercheurs ont découvert qu une Bactérie, Bacillus thuringiensis, synthétise une protéine toxique pour les chenilles de Papillon qui causent des dégâts aux cultures. Le gène responsable de la synthèse de cette protéine toxique a été isolé, et introduit dans les cellules de tabac (espèce végétale) en culture, lesquelles ont régénéré des plantes entières possédant le gène fonctionnel. Ce gène leur donne une protection contre les chenilles. La séquence d un des deux brins de la molécule d ADN d une portion du gène codant pour la protéine toxique est la suivante : T T T A G A G T A A G A G C A C A A 1/ Donner la définition de transgénèse. 2/ Reconstituer le brin manquant de la molécule d ADN (directement sur le sujet) à partir du brin donné. 3/ Expliquer pourquoi les nouveaux plants de tabac sont protégés contre les chenilles. Exercice 2 : Comparaison de l ADN de plusieurs espèces. On a déterminé les nombres de bases azotées présentes dans l ADN de différentes espèces et établi les rapports (divisions) présentés dans le tableau ci-dessous : Espèces Oursin Drosophile Souris Homme (A+T) / (C+G) 1,90 1,48 1,42 1,52 (A+C) / (T+G) 1,00 1,01 1,06 0,95 1/ Rappeler la règle d appariement des nucléotides de la molécule d ADN. 2/ Expliquer pourquoi le rapport (A+C)/(T+G) est toujours très voisin de 1, quelle que soit l espèce. 3/ Expliquer pourquoi le rapport (A+T)/(C+G) diffère selon les espèces. 4/ Construire un modèle possible (plusieurs possibilités!) d un fragment d ADN qui comporterait 9 nucléotides par brin et dont le rapport (A+T)/(C+G) serait de 2. La représentation sera schématisée sous forme déroulée. Exercice 3 : Influence de facteurs alimentaires sur l ADN. Dans l expérience suivante, on a étudié l influence de facteurs alimentaires sur l ADN de cellules de rats exposés à des rayons gamma (pour simplifier : des rayons radioactifs). Les résultats sont donnés dans le graphique ci-dessous : Proportion de cellules cancéreuses en fonction des éléments nutritifs fournis en plus des rayons. 1/ Expliquer l intérêt de la première condition d expérience. 2/ Comparer les résultats pour les différentes conditions d expérience. 3/ Expliquer le(s) rôle(s) des substances ajoutées dans les différentes conditions. 4/ Proposer une hypothèse sur l application que l on pourrait faire de cette expérience dans la vie courante.

5 Partie 1. Eléments de correction de l évaluation sur le chapitre 3 : ADN, support de l information génétique SUJET D 1/ Allèle : version d un gène qui diffère d une autre version par le changement de quelques nucléotides. Mutation : modification aléatoire d un nucléotide au sein d une séquence. 2/ Un nucléotide est composé de trois éléments : acide phosphorique, sucre (désoxyribose) et une base azotée (adénine, thymine, guanine ou cytosine). 3/ a/ Un gène est une portion d ADN portant une information sous la forme d un message codé par la séquence des nucléotides. b/ Les deux chaînes d ADN sont constituées de nucléotides complémentaires. Partie 2. Exercice 1 : 1/ La transgénèse correspond au transfert d un gène d un organisme à un organisme d une autre espèce. 2/ Il suffit de compléter en respectant la règle d appariement des bases : A A A T C T C A T T C T C G T G T T T T T A G A G T A A G A G C A C A A 3/ (les explications sont sur le schéma, en italique). Exercice 2 : 1/ L appariement de base correspond à l association d une adénine avec une thymine d une part, d une cytosine avec une guanine d autre part. 2/ Puisque A = T et C = G (à cause de l appariement), le rapport (A+G)/(T+C) peut s écrire (T+C)/(T+C) ce qui correspond bien à un résultat égal à 1. 3/ Ce rapport est différent d une espèce à l autre car il n existe aucun lien entre le nombre de paires (A+T) et les paires (C+G), donc le résultat de cette division est différent selon les espèces qui n ont pas la même information génétique. 4/ Je lis attentivement les informations du sujet : - «9 nucléotides par brin» : je dois donc écrire 18 nucléotides en tout, 9 «à gauche» et 9 «à droite».

6 - Rapport de 2 : le nombre de paires (A+T) doit être 2 fois plus grand que le nombre de paires (C+G) Un modèle possible : Vérification du rapport : (A+T) / (C+G) = 12/6 = 2 Exercice 3 : 1/ La première expérience est une expérience témoin : elle permet de vérifier l effet des rayons seuls et de comparer avec les conditions d expérience suivantes. 2/ Lorsqu on ajoute les facteurs alimentaires (conditions 2, 3 et 4) le nombre de cellules cancéreuses est de 2 pour cellules alors que sans ces facteurs alimentaires, le nombre de cellules cancéreuses est de 8 pour cellules. 3/ Les substances ajoutées semblent diminuer l effet nocif des rayons : elles protègent l ADN de l apparition de mutations et donc de la modification de l information génétique. 4/ On pourrait supposer que l apport de ces facteurs alimentaires dans l alimentation quotidienne pourrait prévenir l apparition de certains cancers.

CHAPITRE 3 LA SYNTHESE DES PROTEINES

CHAPITRE 3 LA SYNTHESE DES PROTEINES CHAITRE 3 LA SYNTHESE DES ROTEINES On sait qu un gène détient dans sa séquence nucléotidique, l information permettant la synthèse d un polypeptide. Ce dernier caractérisé par sa séquence d acides aminés

Plus en détail

LA A RESPIRATION CELLULAIRE

LA A RESPIRATION CELLULAIRE Instructions aux professeurs Domaine : 1.1 Le transport de substances, réaction chimique de la respiration cellulaire, p. 6 Travail à réaliser : Les élèves répondent aux questions. Matériel : Feuilles

Plus en détail

Chapitre 2 : Respiration, santé et environnement.

Chapitre 2 : Respiration, santé et environnement. Chapitre 2 : Respiration, santé et environnement. Rappels : L air qui nous entoure contient 3 gaz principaux: 71% d azote, 21% d oxygène, 0,03 % de CO2 et quelques gaz rares. L eau de chaux se trouble

Plus en détail

lire les Étiquettes et trouver les sucres cachés

lire les Étiquettes et trouver les sucres cachés lire les Étiquettes et trouver les sucres cachés Objectif : Sensibiliser les élèves à ce qui se trouve dans leur nourriture et les aider à se méfi er des sucres cachés. Matériel Feuille à imprimer : Chaîne

Plus en détail

Les tests génétiques à des fins médicales

Les tests génétiques à des fins médicales Les tests génétiques à des fins médicales Les tests génétiques à des fins médicales Nous avons tous hérité d une combinaison unique de gènes de la part de nos parents. Cette constitution originale et l

Plus en détail

Activité 38 : Découvrir comment certains déchets issus de fonctionnement des organes sont éliminés de l organisme

Activité 38 : Découvrir comment certains déchets issus de fonctionnement des organes sont éliminés de l organisme Activité 38 : Découvrir comment certains déchets issus de fonctionnement des organes sont éliminés de l organisme 1. EXTRAITS REFERENTIELS DU BO Partie du programme : Fonctionnement de l organisme et besoin

Plus en détail

Univers Vivant Révision. Notions STE

Univers Vivant Révision. Notions STE Univers Vivant Révision Notions STE Chap. 13) L Écologie 1) a) Qu est-ce que l empreinte écologique? L empreinte écologique correspond à la surface terrestre et aquatique totale nécessaire à un individu,

Plus en détail

Les renseignements suivants sont destinés uniquement aux personnes qui ont reçu un diagnostic de cancer

Les renseignements suivants sont destinés uniquement aux personnes qui ont reçu un diagnostic de cancer Information importante pour les personnes atteintes d un cancer du poumon non à petites cellules de stade avancé Les renseignements suivants sont destinés uniquement aux personnes qui ont reçu un diagnostic

Plus en détail

Leucémies de l enfant et de l adolescent

Leucémies de l enfant et de l adolescent Janvier 2014 Fiche tumeur Prise en charge des adolescents et jeunes adultes Leucémies de l enfant et de l adolescent GENERALITES COMMENT DIAGNOSTIQUE-T-ON UNE LEUCEMIE AIGUË? COMMENT TRAITE-T-ON UNE LEUCEMIE

Plus en détail

Séquence 6. Mais ces espèces pour autant ne sont pas identiques et parfois d ailleurs ne se ressemblent pas vraiment.

Séquence 6. Mais ces espèces pour autant ne sont pas identiques et parfois d ailleurs ne se ressemblent pas vraiment. Sommaire Séquence 6 Nous avons vu dans les séances précédentes qu au cours des temps géologiques des espèces différentes se sont succédé, leur apparition et leur disparition étant le résultat de modifications

Plus en détail

Journée SITG, Genève 15 octobre 2013. Nicolas Lachance-Bernard M.ATDR Doctorant, Laboratoire de systèmes d information géographique

Journée SITG, Genève 15 octobre 2013. Nicolas Lachance-Bernard M.ATDR Doctorant, Laboratoire de systèmes d information géographique Monitorint spatio-temporel intégré de la mobilité urbaine Monitoring spatio-temporel de l ADN urbain Une réponse aux défis, problèmes, enjeux et risques des milieux urbains Nicolas Lachance-Bernard M.ATDR

Plus en détail

Bases moléculaires des mutations Marc Jeanpierre

Bases moléculaires des mutations Marc Jeanpierre Bases moléculaires des mutations Marc Jeanpierre Chaque enfant qui naît hérite de 10 à 30 nouvelles mutations ponctuelles. L essentiel des ces mutations sont heureusement des variations neutres de séquence

Plus en détail

La surveillance biologique des salariés Surveiller pour prévenir

La surveillance biologique des salariés Surveiller pour prévenir Evaluer et prévenir le risque radiologique professionnel dans les opérations de radiographie industrielle La surveillance biologique des salariés Surveiller pour prévenir Dr Irène Sari-Minodier Service

Plus en détail

Le but de la radioprotection est d empêcher ou de réduire les LES PRINCIPES DE LA RADIOPROTECTION

Le but de la radioprotection est d empêcher ou de réduire les LES PRINCIPES DE LA RADIOPROTECTION LES PRINCIPES DE LA RADIOPROTECTION TOUT PUBLIC 1. Source de rayonnements ionisants 2. Les différents rayonnements ionisants et leur capacité à traverser le corps humain 3. Ecran de protection absorbant

Plus en détail

2 C est quoi la chimie?

2 C est quoi la chimie? PARTIE 1 AVANT LA CHIMIE VERTE... 2 C est quoi la chimie? L inconnu étant source d angoisse, nous allons essayer de définir les grands domaines de la chimie pour mieux la connaître, l appréhender et donc

Plus en détail

L universalité et la variabilité de l ADN

L universalité et la variabilité de l ADN L universalité et la variabilité de l DN Unité 4 3 μm hromosomes observés en microscopie électronique à balayage. Les chromosomes, présents dans le noyau, sont constitués d acide désoxyribonucléique (DN).

Plus en détail

Thème sélection génétique des plantes hybridation et génie génétique

Thème sélection génétique des plantes hybridation et génie génétique Thème sélection génétique des plantes hybridation et génie génétique Exemple d activité : recenser, extraire et exploiter des informations afin de comprendre les caractéristiques et les limites de la modification

Plus en détail

Transfusions sanguines, greffes et transplantations

Transfusions sanguines, greffes et transplantations Transfusions sanguines, greffes et transplantations Chiffres clés en 2008 La greffe d organes est pratiquée depuis plus de 50 ans. 4 620 malades ont été greffés. 1 563 personnes ont été prélevées. 222

Plus en détail

GUIDE D INFORMATIONS A LA PREVENTION DE L INSUFFISANCE RENALE

GUIDE D INFORMATIONS A LA PREVENTION DE L INSUFFISANCE RENALE GUIDE D INFORMATIONS A LA PREVENTION DE L INSUFFISANCE RENALE SOURCES : ligues reins et santé A LA BASE, TOUT PART DES REINS Organes majeurs de l appareil urinaire, les reins permettent d extraire les

Plus en détail

Dr E. CHEVRET UE2.1 2013-2014. Aperçu général sur l architecture et les fonctions cellulaires

Dr E. CHEVRET UE2.1 2013-2014. Aperçu général sur l architecture et les fonctions cellulaires Aperçu général sur l architecture et les fonctions cellulaires I. Introduction II. Les microscopes 1. Le microscope optique 2. Le microscope à fluorescence 3. Le microscope confocal 4. Le microscope électronique

Plus en détail

Chapitre 2 - Complexité des relations entre génotype et phénotype

Chapitre 2 - Complexité des relations entre génotype et phénotype Chapitre 2 - Complexité des relations entre génotype et phénotype Chaque chromosome est en double exemplaire Donc chaque gène (situé sur son locus) est en double exemplaires : et peut être sous différente

Plus en détail

«Peut-on jeûner sans risque pour la santé?»

«Peut-on jeûner sans risque pour la santé?» Le FIGARO du 21/10/2013, page 13 : Cet article est un document culturel qui témoigne à quel degré l establishment médical français ignore le jeûne. À mettre au frigo, pour le ressortir le jour où l'essai

Plus en détail

Génétique et génomique Pierre Martin

Génétique et génomique Pierre Martin Génétique et génomique Pierre Martin Principe de la sélections Repérage des animaux intéressants X Accouplements Programmés Sélection des meilleurs mâles pour la diffusion Index diffusés Indexation simultanée

Plus en détail

L IRSN VOUS OUVRE TOUTES SES PORTES

L IRSN VOUS OUVRE TOUTES SES PORTES Dans le cadre des Journées Européennes du Patrimoine L IRSN VOUS OUVRE TOUTES SES PORTES SAMEDI 15 SEPTEMBRE 2012 ENTRÉE LIBRE DE 10H30 À 17H SUR PRÉSENTATION D UNE CARTE D IDENTITÉ 31, AVENUE DE LA DIVISION

Plus en détail

Chapitre 1 : Qu est ce que l air qui nous entoure?

Chapitre 1 : Qu est ce que l air qui nous entoure? Chapitre 1 : Qu est ce que l air qui nous entoure? Plan : 1. Qu est ce que l atmosphère terrestre? 2. De quoi est constitué l air qui nous entoure? 3. Qu est ce que le dioxygène? a. Le dioxygène dans la

Plus en détail

Séquence 4. La nature du vivant. Sommaire. 1. L unité structurale et chimique du vivant. 2. L ADN, support de l information génétique

Séquence 4. La nature du vivant. Sommaire. 1. L unité structurale et chimique du vivant. 2. L ADN, support de l information génétique Séquence 4 La nature du vivant Sommaire 1. L unité structurale et chimique du vivant 2. L ADN, support de l information génétique 3. Synthèse de la séquence 4. Exercices Devoir autocorrectif n 2 Séquence

Plus en détail

Epreuve écrite d admissibilité du Mercredi 15 Janvier 2014 DOSSIER REPONSE

Epreuve écrite d admissibilité du Mercredi 15 Janvier 2014 DOSSIER REPONSE SUJET DE CONCOURS COMMUN AUX CENTRES DE GESTION : CONCOURS D ADJOINT TECHNIQUE DE 1ERE CLASSE SESSION 2014 SPECIALITE «ENVIRONNEMENT, HYGIENE» Epreuve écrite d admissibilité du Mercredi 15 Janvier 2014

Plus en détail

Que faire lorsqu on considère plusieurs variables en même temps?

Que faire lorsqu on considère plusieurs variables en même temps? Chapitre 3 Que faire lorsqu on considère plusieurs variables en même temps? On va la plupart du temps se limiter à l étude de couple de variables aléatoires, on peut bien sûr étendre les notions introduites

Plus en détail

Chapitre 7: Dynamique des fluides

Chapitre 7: Dynamique des fluides Chapitre 7: Dynamique des fluides But du chapitre: comprendre les principes qui permettent de décrire la circulation sanguine. Ceci revient à étudier la manière dont les fluides circulent dans les tuyaux.

Plus en détail

De la physico-chimie à la radiobiologie: nouveaux acquis (I)

De la physico-chimie à la radiobiologie: nouveaux acquis (I) De la physico-chimie à la radiobiologie: nouveaux acquis (I) Collaboration: - Laboratoire de Radiotoxicologie et Oncologie (L. Sabatier) CEA, DSV - Laboratoire de Génotoxicité et Modulation de l Expression

Plus en détail

INSUFFISANCE HÉPATIQUE

INSUFFISANCE HÉPATIQUE INSUFFISANCE HÉPATIQUE EXISTE-T-IL DES TRAITEMENTS À BASE DE CELLULES SOUCHES POUR L INSUFFISANCE HÉPATIQUE? Bien qu aucun traitement à base de cellules souches pour l insuffisance hépatique ne soit approuvé

Plus en détail

Cancer et environnement

Cancer et environnement PATHOLOGIES Cancer et environnement Le cancer est une maladie caractérisée par une prolifération importante et anarchique de cellules anormales qui ont la capacité d envahir et de détruire les tissus sains

Plus en détail

DON DE SANG. Label Don de Soi

DON DE SANG. Label Don de Soi DON DE SANG Label Don de Soi 2015 SOMMAIRE Les différents types de dons p.3 Le don de sang total Le don de plasma Le don de plaquettes Le don de moelle osseuse Que soigne-t-on avec un don de sang? p.7

Plus en détail

COMMENTAiRES/ DECISIONS

COMMENTAiRES/ DECISIONS Plate-forme d'échanges affichage environnemental des PGC Date : 2009-12-21 Assistante: Lydia GIPTEAU Ligne directe : + 33 (0)1 41 62 84 20 Lydia.gipteau@afnor.org GT Méthodologie Numéro du document: N

Plus en détail

Introduction générale

Introduction générale Introduction générale Touchant près de 600 nouvelles personnes chaque année en France, la leucémie myéloïde chronique est une maladie affectant les cellules du sang et de la moelle osseuse (située au cœur

Plus en détail

L échelle du ph est logarithmique, c està-dire

L échelle du ph est logarithmique, c està-dire Le ph Qu est-ce que le ph? Le ph mesure l acidité d un liquide. Sa valeur s exprime sur une échelle graduée de 0 à 14 où 1 désigne une substance fortement acide, 7, une substance neutre, et 14, une substance

Plus en détail

ATELIER SANTE PREVENTION N 2 : L ALIMENTATION

ATELIER SANTE PREVENTION N 2 : L ALIMENTATION ATELIER SANTE PREVENTION N 2 : L ALIMENTATION Mardi 24 janvier 2012 au Centre de Formation Multimétiers de REIGNAC L objectif de cet atelier sur la santé est de guider chacun vers une alimentation plus

Plus en détail

LISTE V AU PROTOCOLE A MAROC. Description des produits

LISTE V AU PROTOCOLE A MAROC. Description des produits LISTE V AU PROTOCOLE A MAROC 04.03 Babeurre, lait et crème caillés, yoghourt, képhir et autres laits et crèmes fermentés ou acidifiés, même concentrés ou additionnés de sucre ou d'autres édulcorants ou

Plus en détail

Fonctionnement de l organisme et besoin en énergie

Fonctionnement de l organisme et besoin en énergie Partie 2 Fonctionnement de l organisme et besoin en énergie Y Cette partie doit permettre à l élève d appréhender quelques aspects généraux concernant le fonctionnement du corps humain. Il s agit principalement

Plus en détail

L AUTOGREFFE QUELQUES EXPLICATIONS

L AUTOGREFFE QUELQUES EXPLICATIONS L AUTOGREFFE QUELQUES EXPLICATIONS Le traitement de votre maladie nécessite une Chimiothérapie intensive. Cette chimiothérapie qui utilise de fortes doses de médicaments antimitotiques est plus efficace

Plus en détail

Tests paramétriques de comparaison de 2 moyennes Exercices commentés José LABARERE

Tests paramétriques de comparaison de 2 moyennes Exercices commentés José LABARERE Chapitre 5 UE4 : Biostatistiques Tests paramétriques de comparaison de 2 moyennes Exercices commentés José LABARERE Année universitaire 2010/2011 Université Joseph Fourier de Grenoble - Tous droits réservés.

Plus en détail

Séquence 1. Reproduction conforme de la cellule et réplication de l ADN Variabilité génétique et mutation de l ADN

Séquence 1. Reproduction conforme de la cellule et réplication de l ADN Variabilité génétique et mutation de l ADN Séquence 1 Reproduction conforme de la cellule et réplication de l ADN Variabilité génétique et mutation de l ADN Sommaire 1. Reproduction conforme de la cellule et réplication de l ADN 2. Variabilité

Plus en détail

Fluorescent ou phosphorescent?

Fluorescent ou phosphorescent? Fluorescent ou phosphorescent? On entend régulièrement ces deux termes, et on ne se préoccupe pas souvent de la différence entre les deux. Cela nous semble tellement complexe que nous préférons rester

Plus en détail

Les OGM. 5 décembre 2008. Nicole Mounier

Les OGM. 5 décembre 2008. Nicole Mounier Les OGM 5 décembre 2008 Nicole Mounier Université Claude Bernard Lyon 1 CGMC, bâtiment Gregor Mendel 43, boulevard du 11 Novembre 1918 69622 Villeurbanne Cedex OGM Organismes Génétiquement Modifiés Transfert

Plus en détail

LES CIGARETTES LÉGÈRES SONT-ELLES MOINS NOCIVES?

LES CIGARETTES LÉGÈRES SONT-ELLES MOINS NOCIVES? LS IGATTS LÉGÈS SONT-LLS MOINS NOIVS? Journaliste : M. D. Duterte VM productions, 1999 Durée : 01 min 9 s Ainsi donc, les fumeurs qui se donnaient bonne conscience en fumant des cigarettes légères ont

Plus en détail

ÉMILIE MUDJEREDIAN GRAPHISTE / ILLUSTRATRICE 06 19 98 53 07 http://emiliemudjeredian.com emilie.mudjeredian@gmail.com

ÉMILIE MUDJEREDIAN GRAPHISTE / ILLUSTRATRICE 06 19 98 53 07 http://emiliemudjeredian.com emilie.mudjeredian@gmail.com ÉMILIE MUDJEREDIAN GRAPHISTE / ILLUSTRATRICE 06 19 98 53 07 http://emiliemudjeredian.com emilie.mudjeredian@gmail.com WORLD STOCK MARKET VISUALIZATION - Creation d une bibliothèque de documents financiers

Plus en détail

Détection des duplications en tandem au niveau nucléique à l'aide de la théorie des flots

Détection des duplications en tandem au niveau nucléique à l'aide de la théorie des flots Université Toulouse 3 Paul Sabatier(UT3 Paul Sabatier) Informatique Spécialité Bioinformatique Eric AUDEMARD lundi 28 novembre 2011 Détection des duplications en tandem au niveau nucléique à l'aide de

Plus en détail

La cigarette électronique permet-elle de sortir la société du tabac?

La cigarette électronique permet-elle de sortir la société du tabac? La cigarette électronique permet-elle de sortir la société du tabac? Dubois G, Goullé JP, Costentin J Au nom de la Commission VI (Addictions) Académie Nationale de Médecine Introduction Le tabac tue un

Plus en détail

La Terre mise en scène

La Terre mise en scène Objectif La pièce peut servir d «évaluation des performances» et offrir aux élèves la possibilité de montrer de manière créative ce qu ils ont appris sur la Terre en tant que système. Vue d ensemble La

Plus en détail

A-ESSE s.p.a. FICHE DE SÉCURITÉ

A-ESSE s.p.a. FICHE DE SÉCURITÉ A-ESSE s.p.a. USINE OXYDES de ZINC FICHE DE SÉCURITÉ Oxyde de zinc 1. IDENTIFICATION DU PRODUIT CHIMIQUE ET DE LA SOCIÉTÉ NOM DU PRODUIT: DÉNOMINATION COMMUNE, COMMERCIALE ET SYNONYMES: UTILISATION DE

Plus en détail

PH Moins 1. IDENTIFICATION DE LA SUBSTANCE/DU MÉLANGE ET DE LA SOCIÉTÉ/ENTREPRISE. Postbus 12 5373 ZG Herpen Pays-Bas +31 (0) 486 416 959

PH Moins 1. IDENTIFICATION DE LA SUBSTANCE/DU MÉLANGE ET DE LA SOCIÉTÉ/ENTREPRISE. Postbus 12 5373 ZG Herpen Pays-Bas +31 (0) 486 416 959 1. IDENTIFICATION DE LA SUBSTANCE/DU MÉLANGE ET DE LA SOCIÉTÉ/ENTREPRISE Nom de product Acide phosphorique 59% Article no. Substance/préperation substance L utilisation de la substance ajustement du ph

Plus en détail

GRAMMATICAUX DE MÊME CATÉGORIE AUSSI TÔT / BIENTÔT BIEN TÔT / PLUTÔT PLUS TÔT / SITÔT SI TÔT 1 Homophones grammaticaux de même catégorie

GRAMMATICAUX DE MÊME CATÉGORIE AUSSI TÔT / BIENTÔT BIEN TÔT / PLUTÔT PLUS TÔT / SITÔT SI TÔT 1 Homophones grammaticaux de même catégorie GRAMMATICAUX DE MÊME CATÉGORIE AUSSITÔT HOMOPHONES AUSSI TÔT / BIENTÔT BIEN TÔT / PLUTÔT PLUS TÔT / SITÔT SI TÔT 1 Homophones grammaticaux de même catégorie aussitôt aussi tôt aussitôt : Il signifie au

Plus en détail

Titre alcalimétrique et titre alcalimétrique complet

Titre alcalimétrique et titre alcalimétrique complet Titre alcalimétrique et titre alcalimétrique complet A Introduction : ) Définitions : Titre Alcalimétrique (T.A.) : F m / L T.A. T.A.C. Définition : C'est le volume d'acide (exprimé en ml) à 0,0 mol.l

Plus en détail

L INSUFFISANCE CARDIAQUE

L INSUFFISANCE CARDIAQUE L INSUFFISANCE CARDIAQUE EXISTE-T-IL DES TRAITEMENTS À BASE DE CELLULES SOUCHES POUR L INSUFFISANCE CARDIAQUE? Bien qu aucun traitement à base de cellules souches pour l insuffisance cardiaque n ait encore

Plus en détail

Information génétique

Information génétique chapitre 3 Information génétique et division cellulaire L étude de la division cellulaire est abordée pour découvrir comment est transmise et conservée l information génétique portée par les chromosomes.

Plus en détail

TITRE : On est tous séropositif!

TITRE : On est tous séropositif! PRÉPARER UNE «SITUATION COMPLEXE DISCIPLINAIRE», SITUATION D APPRENTISSAGE ET/OU D ÉVALUATION TITRE : On est tous séropositif! classe : 3 ème durée : 30 min I - Choisir des objectifs dans les textes officiels.

Plus en détail

"La santé des étudiants en 2015"

La santé des étudiants en 2015 Dossier de Presse "La santé des étudiants en 2015" 9 ème Enquête Nationale 1999 2015 Enquête Santé d emevia Depuis plus de 16 ans, à l écoute des étudiants 1 Sommaire EmeVia et les mutuelles étudiantes

Plus en détail

4 : MÉTHODES D ANALYSE UTILISÉES EN ÉCOLOGIE MICROBIENNE

4 : MÉTHODES D ANALYSE UTILISÉES EN ÉCOLOGIE MICROBIENNE 4 : MÉTHODES D ANALYSE UTILISÉES EN ÉCOLOGIE MICROBIENNE L écologie microbienne (ou étude des micro-organismes de l environnement) étudie : les relations entre les différentes populations de micro-organismes

Plus en détail

Chapitre 4 : cohabiter avec les micro-organismes. Contrat-élève 3 ème

Chapitre 4 : cohabiter avec les micro-organismes. Contrat-élève 3 ème Chapitre 4 : cohabiter avec les micro-organismes Mais, que dois-je savoir? Pour rattraper un cours manquant, retrouve-le sur le site du collège dans la rubrique «enseignements» : http://colleges.acrouen.fr/courbet/spipuser/

Plus en détail

Développement d une application pilote

Développement d une application pilote Développement d une application pilote Nutri-TIC Flora Massanella Principes Cette seconde phase vise à mettre en pratique les conclusions obtenues lors de la phase A. L application web Nutri- TIC a donc

Plus en détail

Mesure de la surface spécifique

Mesure de la surface spécifique Mesure de la surface spécifique Introducing the Acorn Area TM Acorn Area est un instrument révolutionnaire conçu pour mesurer la surface spécifique des nanoparticules en suspension dans un liquide. Utilisant

Plus en détail

La prise en charge de votre insuffisance cardiaque

La prise en charge de votre insuffisance cardiaque G U I D E - A F F E C T I O N D E L O N G U E D U R É E La prise en charge de votre insuffisance cardiaque Vivre avec une insuffisance cardiaque Décembre 2007 Pourquoi ce guide? Votre médecin traitant

Plus en détail

L'œsophage L'œsophage est un tube musculaire qui traverse de la bouche à l'estomac. Causes

L'œsophage L'œsophage est un tube musculaire qui traverse de la bouche à l'estomac. Causes L'œsophage est un tube musculaire qui traverse de la bouche à l'estomac. Chez l'adulte moyen, il fait 25 cm à 30 cm (10 po à 14 po) de long et environ 2 cm (moins d'un pouce) de large. L'œsophage est constitué

Plus en détail

Maladie de Hodgkin ou lymphome de Hodgkin

Maladie de Hodgkin ou lymphome de Hodgkin Maladie de Hodgkin ou lymphome de Hodgkin Ce que vous devez savoir Le cancer : une lutte à finir 1 888 939-3333 www.cancer.ca MALADIE DE HODGKIN Ce que vous devez savoir Même si vous entendez parler du

Plus en détail

galités s sociales de cancer chez les travailleurs

galités s sociales de cancer chez les travailleurs Inégalit galités s sociales de cancer chez les travailleurs Annie Thébaud baud-mony INSERM/GISCOP93, Université Paris13 Rencontres francophones internationales sur les inégalit galités s sociales et de

Plus en détail

Ver de la grappe: cochylis

Ver de la grappe: cochylis Fiche: 050 Ver de la grappe: cochylis (Eupoecilia ambiguella Hb.) Auteurs: P.-J. Charmillot, D. Pasquier, U. Remund et E. Boller Aire de répartition La cochylis de la vigne est une tordeuse dont l'aire

Plus en détail

Un environnement sans fumée pour vos enfants. Comment y parvenir?

Un environnement sans fumée pour vos enfants. Comment y parvenir? Un environnement sans fumée pour vos enfants. Comment y parvenir? Renseignements sur la fumée secondaire et tertiaire Qu est-ce que la fumée secondaire? La fumée secondaire est une combinaison de fumée

Plus en détail

Première partie: Restitution + Compréhension (08 points)

Première partie: Restitution + Compréhension (08 points) Lycée M hamdia Année scolaire : 2011/2012 Prof : Saïd Mounir Date : 17/05/2012 Première partie: Restitution + Compréhension (08 points) EXERCIE N O 1: (4 points) : 1 : a-b 2 : b 3 : a-b 4 : d 5 : d 6 :

Plus en détail

I - CLASSIFICATION DU DIABETE SUCRE

I - CLASSIFICATION DU DIABETE SUCRE I - CLASSIFICATION DU DIABETE SUCRE 1- Définition : Le diabète sucré se définit par une élévation anormale et chronique de la glycémie. Cette anomalie est commune à tous les types de diabète sucré, mais

Plus en détail

Chapitre 10 : Radioactivité et réactions nucléaires (chapitre 11 du livre)

Chapitre 10 : Radioactivité et réactions nucléaires (chapitre 11 du livre) Chapitre 10 : Radioactivité et réactions nucléaires (chapitre 11 du livre) 1. A la découverte de la radioactivité. Un noyau père radioactif est un noyau INSTABLE. Il se transforme en un noyau fils STABLE

Plus en détail

Compléments ments alimentaires Les règles du jeu - SCL / Strasbourg-Illkirch 14 octobre 2011

Compléments ments alimentaires Les règles du jeu - SCL / Strasbourg-Illkirch 14 octobre 2011 Compléments ments alimentaires Les règles du jeu - SCL / Strasbourg-Illkirch 14 octobre 2011 Bureau 4A : Nutrition & Information sur les denrées alimentaires Novel Food, Adjonction V&M, SBNP Compléments

Plus en détail

Le Don de Moelle Ça fait pas d mal!

Le Don de Moelle Ça fait pas d mal! Le Don de Moelle Ça fait pas d mal! J ai de 18 à 50 ans Le Don de Moelle Osseuse Ça m intéresse -1 je demande des infos, je réfléchis. -2 je contacte le centre EFS le plus proche de chez moi. 3- je suis

Plus en détail

ROTARY INTERNATIONAL District 1780 Rhône-Alpes Mont-Blanc Don volontaire de cellules souches

ROTARY INTERNATIONAL District 1780 Rhône-Alpes Mont-Blanc Don volontaire de cellules souches ROTARY INTERNATIONAL District 1780 Rhône-Alpes Mont-Blanc Don volontaire de cellules souches Le don de cellules souches Jean VIVIN 04/2013 1-Nature du problème : 2- Technique Les leucémies représentent

Plus en détail

MYRIAD. l ADN isolé n est à présent plus brevetable!

MYRIAD. l ADN isolé n est à présent plus brevetable! MYRIAD La Cour Suprême des Etats-Unis revient sur plus de 30 ans de pratique : l ADN isolé n est à présent plus brevetable! Mauvaise passe pour les inventions en biotechnologies sur le territoire américain.

Plus en détail

Grandes cultures Engrais liquides ou granulaires?

Grandes cultures Engrais liquides ou granulaires? Grandes cultures Engrais liquides ou granulaires? Louis Robert, agronome, M. Sc. Conseiller régional en grandes cultures Même s ils ne sont pas nouveaux sur le marché, les engrais de démarrage liquides

Plus en détail

L APS ET LE DIABETE. Le diabète se caractérise par un taux de glucose ( sucre ) trop élevé dans le sang : c est l hyperglycémie.

L APS ET LE DIABETE. Le diabète se caractérise par un taux de glucose ( sucre ) trop élevé dans le sang : c est l hyperglycémie. 1. Qu est-ce que le diabète? L APS ET LE DIABETE Le diabète se caractérise par un taux de glucose ( sucre ) trop élevé dans le sang : c est l hyperglycémie. Cette hyperglycémie est avérée si à 2 reprises

Plus en détail

TRAIT FALCIFORME. Clinique spécialisée d hématologie pédiatrique

TRAIT FALCIFORME. Clinique spécialisée d hématologie pédiatrique TRAIT FALCIFORME Clinique spécialisée d hématologie pédiatrique Une analyse sanguine a été effectuée chez votre enfant, soit à la naissance, soit à la demande de votre médecin. Cette analyse a démontré

Plus en détail

Chapitre n 6 MASSE ET ÉNERGIE DES NOYAUX

Chapitre n 6 MASSE ET ÉNERGIE DES NOYAUX Chapitre n 6 MASSE ET ÉNERGIE DES NOYAUX T ale S Introduction : Une réaction nucléaire est Une réaction nucléaire provoquée est L'unité de masse atomique est une unité permettant de manipuler aisément

Plus en détail

Qualités nutritives des salades. DOSSIER SPéCIAL BIO F R C magazine FéVRIER 2010 N O 25. Quand la météo s en mêle

Qualités nutritives des salades. DOSSIER SPéCIAL BIO F R C magazine FéVRIER 2010 N O 25. Quand la météo s en mêle DOSSIER SPéCIAL BIO F R C magazine FéVRIER 2010 N O 25 Laitues d hiver Moins de pe Les laitues pommées bio se révèlent exemptes de pesticides. Plus «Bonne nouvelle: toutes les salades sont conformes et

Plus en détail

Soit la fonction affine qui, pour représentant le nombre de mois écoulés, renvoie la somme économisée.

Soit la fonction affine qui, pour représentant le nombre de mois écoulés, renvoie la somme économisée. ANALYSE 5 points Exercice 1 : Léonie souhaite acheter un lecteur MP3. Le prix affiché (49 ) dépasse largement la somme dont elle dispose. Elle décide donc d économiser régulièrement. Elle a relevé qu elle

Plus en détail

Lymphome non hodgkinien

Lymphome non hodgkinien Lymphome non hodgkinien Ce que vous devez savoir Le cancer : une lutte à finir 1 888 939-3333 www.cancer.ca LYMPHOME NON HODGKINIEN Ce que vous devez savoir Même si vous entendez parler du cancer presque

Plus en détail

Cellules procaryotes Service histologie Pr.k.mebarek

Cellules procaryotes Service histologie Pr.k.mebarek Cellules procaryotes Service histologie Pr.k.mebarek I) Les cellules procaryotes II) Les cellules eucaryotes o 1) Caractéristiques générales des cellules eucaryotes o 2) Organisation des cellules eucaryotes

Plus en détail

Une vision d avenir. Il était deux petits navires. Mise en contexte. Rapport Perrault. Forum des générations (2004) En bref...

Une vision d avenir. Il était deux petits navires. Mise en contexte. Rapport Perrault. Forum des générations (2004) En bref... Une vision d avenir Il était deux petits navires Alain Poirier, directeur national de santé publique et sous-ministre adjoint février 200 En bref... Mise en contexte Une mise en contexte Quelques données

Plus en détail

Les conséquences sanitaires de l accident de Fukushima Dai-ichi : point de situation en février 2012

Les conséquences sanitaires de l accident de Fukushima Dai-ichi : point de situation en février 2012 Les conséquences sanitaires de l accident de Fukushima Dai-ichi : point de situation en février 2012 Faire avancer la sûreté nucléaire Jean-René Jourdain Paris, 28 février 2012 Comment évaluer les conséquences

Plus en détail

des banques pour la recherche

des banques pour la recherche ADN, cellules, tissus... des banques pour la recherche FÉVRIER 2009 Les banques d échantillons de matériel biologique (tissus, cellules, ADN ), appelées biobanques, mettent à disposition des chercheurs

Plus en détail

Le test de dépistage qui a été pratiqué à la

Le test de dépistage qui a été pratiqué à la élever CommenT UN enfant ayant une drépanocytose Q Le test de dépistage qui a été pratiqué à la maternité vient de révéler que votre bébé est atteint de drépanocytose. Aujourd hui, votre enfant va bien,

Plus en détail

TP N 3 La composition chimique du vivant

TP N 3 La composition chimique du vivant Thème 1 : La Terre dans l'univers, la vie et l'évolution du vivant : une planète habitée Chapitre II : La nature du vivant TP N 3 La composition chimique du vivant Les conditions qui règnent sur terre

Plus en détail

LIGNES DIRECTRICES CLINIQUES TOUT AU LONG DU CONTINUUM DE SOINS : Objectif de ce chapitre. 6.1 Introduction 86

LIGNES DIRECTRICES CLINIQUES TOUT AU LONG DU CONTINUUM DE SOINS : Objectif de ce chapitre. 6.1 Introduction 86 LIGNES DIRECTRICES CLINIQUES TOUT AU LONG DU CONTINUUM DE SOINS : ÉTABLISSEMENT DE LIENS ENTRE LES PERSONNES CHEZ QUI UN DIAGNOSTIC D INFECTION À VIH A ÉTÉ POSÉ ET LES SERVICES DE SOINS ET DE TRAITEMENT

Plus en détail

AMAMI Anaïs 3 C LORDEL Maryne. Les dons de cellules & de tissus.

AMAMI Anaïs 3 C LORDEL Maryne. Les dons de cellules & de tissus. AMAMI Anaïs 3 C LORDEL Maryne Les dons de cellules & de tissus. Introduction : Une greffe (don) de cellules consiste à administrer à un patient dont un organe vital ne fonctionne plus correctement, une

Plus en détail

Charte de la Banque ADN et de Cellules de Généthon

Charte de la Banque ADN et de Cellules de Généthon Sommaire 1. PREAMBULE... 2 2. DEFINITIONS... 2 3. CADRE LEGAL... 3 4. ORGANISATION DE LA BACG... 4 5. PRESTATIONS DE LA BACG... 5 6. MODALITES DE CONTRIBUTION ET D UTILISATION DES SERVICES... 5 7. REGLES

Plus en détail

TD de Biochimie 4 : Coloration.

TD de Biochimie 4 : Coloration. TD de Biochimie 4 : Coloration. Synthèse de l expérience 2 Les questions posées durant l expérience 2 Exposé sur les méthodes de coloration des molécules : Générique Spécifique Autres Questions Pourquoi

Plus en détail

Correction TP 7 : L organisation de la plante et ses relations avec le milieu

Correction TP 7 : L organisation de la plante et ses relations avec le milieu Correction TP 7 : L organisation de la plante et ses relations avec le milieu (TP multiposte : groupes de 4 élèves qui se répartissent sur les 4 postes une fois chaque poste travaillé, un bilan sera établi

Plus en détail

Allégations relatives à la teneur nutritive

Allégations relatives à la teneur nutritive Allégations relatives à la teneur nutritive Mots utilisés dans les allégations relatives à la teneur nutritive Ce que le mot signifie Exemples Sans Faible Réduit Source de Léger Une quantité insignifiante

Plus en détail

Table des matières Introduction Chapitre*1*:*De*la*matière*sérieuse Chapitre*2*:*Clair*comme*de*l eau*de*roche

Table des matières Introduction Chapitre*1*:*De*la*matière*sérieuse Chapitre*2*:*Clair*comme*de*l eau*de*roche Table des matières Introduction! *! Chapitre*1*:*De*la*matière*sérieuse! 1.1!Les!matériaux! 1.2!Solides,!liquides!et!gaz 1.3!Gaspiller!de!l énergie! 1.4!Le!carburant!du!corps! Chapitre*2*:*Clair*comme*de*l

Plus en détail

Tout ce qu il faut savoir sur le don de moelle osseuse

Tout ce qu il faut savoir sur le don de moelle osseuse Tout ce qu il faut savoir sur le don de moelle osseuse 1. La moelle osseuse : un rôle vital pour le corps humain Page 2/23 1.1. Qu est ce que la moelle osseuse? La moelle osseuse est indispensable à la

Plus en détail

QU EST-CE QUE LA CHLORATION?

QU EST-CE QUE LA CHLORATION? QU EST-CE QUE LA CHLORATION? Qu est-ce que la chloration? Des micro-organismes peuvent être trouvés dans des rivières, lacs et eau souterraine. Même si ce ne sont pas tous les micro-organismes qui peuvent

Plus en détail

Cahier des bonnes pratiques pour un nettoyage écologique des locaux du Conseil Général de la Gironde

Cahier des bonnes pratiques pour un nettoyage écologique des locaux du Conseil Général de la Gironde Le Conseil Général ménage votre santé! Cahier des bonnes pratiques pour un nettoyage écologique des locaux du Conseil Général de la Gironde Sommaire 1. Pourquoi créer ce cahier pratique du nettoyage écologique?

Plus en détail

étiquetage des produits chimiques

étiquetage des produits chimiques Le nouveau règlementr GHS / CLP pour l él étiquetage des produits chimiques Carlo Erba RéactifsR actifs-sds Brigitte Coulange Les systèmes de classification existants au niveau mondial LE TOLUENE Au Canada,

Plus en détail

K W = [H 3 O + ] [OH - ] = 10-14 = K a K b à 25 C. [H 3 O + ] = [OH - ] = 10-7 M Solution neutre. [H 3 O + ] > [OH - ] Solution acide

K W = [H 3 O + ] [OH - ] = 10-14 = K a K b à 25 C. [H 3 O + ] = [OH - ] = 10-7 M Solution neutre. [H 3 O + ] > [OH - ] Solution acide La constante d autoprotolyse de l eau, K W, est égale au produit de K a par K b pour un couple acide/base donné : En passant en échelle logarithmique, on voit donc que la somme du pk a et du pk b d un

Plus en détail

Séquence : La circulation sanguine

Séquence : La circulation sanguine Séquence : La circulation sanguine Objectifs généraux : Amener l élève à Comprendre le rôle du cœur dans la circulation sanguine. Connaître le rôle du sang et ses composants. Connaître l anatomie du cœur.

Plus en détail