Solutions aux exercices

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimension: px
Commencer à balayer dès la page:

Download "Solutions aux exercices"

Transcription

1 Solutions aux exercices Chapitre 18 La génétique moléculaire Page 627 du manuel 1. Un échantillon d ADN contient des nucléotides A et C dans les proportions suivantes : A = 34 % et C = 16 %. Quelles sont les proportions des nucléotides G et T dans cet échantillon? (Suppose que les proportions caractéristiques sont égales.) Détermine la proportion des nucléotides G et T dans l échantillon. La proportion de nucléotides A dans l échantillon est de 34 %. La proportion de nucléotides C dans l échantillon est de 16 %. Étape 1 Utilise la règle de Chargaff pour évaluer la proportion de nucléotides T dans l échantillon. Étape 2 Utilise la règle de Chargaff pour évaluer la proportion de nucléotides G dans l échantillon. Étape 1 Selon la règle de Chargaff, dans tout échantillon d ADN, la quantité d adénine (A) est toujours égale à la quantité de thymine (T). Par conséquent, la proportion de nucléotides de thymine (T) dans l échantillon doit être de 34 %. Étape 2 Selon la règle de Chargaff, dans tout échantillon d ADN, la quantité de cytosine (C) est toujours égale à la quantité de guanine (G). Par conséquent, la proportion de nucléotides de guanine (G) dans l échantillon doit être de 16 %. 34 % + 16 % + 34 % + 16 % = 100 % Reproduction autorisée Chenelière Éducation inc. 1

2 2. À l aide de la règle de Chargaff, remplis le tableau suivant. (Suppose que les proportions caractéristiques sont égales.) La composition des nucléotides de l ADN dans l échantillon X Nucléotide Proportion (%) A 24 C G T Détermine la proportion de nucléotides C, G et T dans l échantillon. La proportion de nucléotides A dans l échantillon est de 24 %. Étape 1 Utilise la règle de Chargaff pour évaluer la proportion de nucléotides T dans l échantillon. Étape 2 Évalue ensuite le pourcentage de nucléotides G et C dans l échantillon. Étape 1 Selon la règle de Chargaff, dans tout échantillon d ADN, la quantité d adénine (A) est toujours égale à la quantité de thymine (T). Par conséquent, la proportion de nucléotides de thymine (T) dans l échantillon doit être de 24 %. Étape 2 Puisque la proportion d adénine (A) est de 24 % et que la proportion de thymine (T) est de 24 %, la proportion totale de nucléotides A et T est 24 % + 24 % = 48 %. Puisque les proportions de nucléotides doivent totaliser 100 %, la proportion totale de guanine (G) et de cytosine (C) dans l échantillon doit être 100 % 48 % = 52 %. La règle de Chargaff mentionne également que dans tout échantillon d ADN, la quantité de cytosine (C) est toujours égale à la quantité de guanine (G). Donc, la quantité de nucléotides C et G dans l échantillon doit être 52 % 2 = 26 % pour chaque nucléotide. 24 % + 26 % + 24 % + 26 % = 100 % Page 637 du manuel 3. À l aide du tableau 18.3, trouve l acide aminé qui correspond à chacun des codons suivants : a) CCA; b) AUG; c) GCA. Reproduction autorisée Chenelière Éducation inc. 2

3 Trouve l acide aminé qui correspond à chacun des codons CCA, AUG et GCA. Les codons CCA, AUG et GCA. À l aide du tableau 18.3, détermine l acide aminé qui correspond à chaque codon. Étape 1 Pour déterminer l acide aminé qui correspond au codon CCA, trouve la première base C dans la colonne gauche du tableau intitulé «Première base». Pour trouver la deuxième base C, lis les lignes de la colonne intitulée «Deuxième base» au haut du tableau. Au croisement de la ligne de la première base et de la colonne de la deuxième base, tu trouveras une liste de quatre acides aminés possibles. Pour établir le bon acide aminé, lis la colonne intitulée «Troisième base» pour trouver la dernière base A du codon, qui indiquera que l acide aminé proline correspond au codon CCA. Étape 2 Pour déterminer l acide aminé qui correspond au codon AUG, recommence l étape 1 en utilisant les bases du codon AUG. L acide aminé méthionine correspond au codon AUG. Étape 3 Pour déterminer l acide aminé qui correspond au codon GCA, recommence les étapes précédentes en utilisant les bases du codon GCA. L acide aminé alanine correspond au codon GCA. 4. Quels sont les trois codons de l ARN qui servent de signaux «d arrêt»? Détermine les trois codons qui servent de signaux d arrêt. Utilise le tableau 18.3 pour déterminer les trois codons qui servent de signaux d arrêt. Étape 1 Pour déterminer les trois codons qui servent de signaux d arrêt, lis les acides aminés énumérés au centre du tableau Les codons UAA, UAG et UGA y sont présentés comme les codons d arrêt. Reproduction autorisée Chenelière Éducation inc. 3

4 5. Nomme trois codons qui correspondent à l acide aminé nommé l «arginine». Détermine trois codons qui correspondent à l acide aminé arginine. Utilise le tableau 18.3 pour déterminer trois codons qui correspondent à l acide aminé arginine. Étape 1 Pour déterminer trois codons qui correspondent à l acide aminé arginine, lis les acides aminés énumérés au centre du tableau Les codons CGU, CGC, CGA, CGG, AGA et AGG représentent tous l acide aminé arginine. Nomme trois de ces codons pour répondre correctement à la question. Si tu refais les étapes, tu obtiens les mêmes résultats. Page 638 du manuel 6. Un brin d ARNm contient la séquence de nucléotides suivante : AUGCCCACUACAUAG. Pour quelle séquence d acides aminés cet ARNm code-t-il? Détermine la séquence d acides aminés pour laquelle code la séquence de nucléotides de l ARNm AUGCCCACUACAUAG. La séquence de nucléotides de l ARNm AUGCCCACUACAUAG. Étape 1 Divise la séquence de nucléotides en codons de trois nucléotides chacun. Étape 2 Utilise le tableau 18.3 pour déterminer l acide aminé qui correspond à chaque codon de la séquence de nucléotides de l ARNm. Reproduction autorisée Chenelière Éducation inc. 4

5 Étape 3 Écris les acides aminés de la séquence qui correspond à la séquence de nucléotides de l ARNm donnée. Étape 1 La division de la séquence de nucléotides en codons de trois nucléotides chacun donne la séquence suivante : AUG-CCC-ACU-ACA-UAG. Étape 2 Pour déterminer l acide aminé qui correspond au codon AUG, trouve la première base A dans la colonne gauche du tableau intitulé «Première base». Pour trouver la deuxième base U, lis les lignes de la colonne intitulée «Deuxième base» au haut du tableau. Au croisement de la ligne de la première base et de la colonne de la deuxième base, tu trouveras une liste de quatre acides aminés possibles. Pour déterminer le bon acide aminé, lis la colonne intitulée «Troisième base» pour trouver la dernière base G du codon, qui indiquera que l acide aminé méthionine correspond au codon AUG. Étape 3 Pour déterminer l acide aminé qui correspond au codon CCC, recommence l étape 2 en utilisant les bases du codon CCC. L acide aminé proline correspond au codon CCC. Étape 4 Recommence les étapes ci-dessus pour les codons ACU et ACA. Chacun de ces codons correspond à l acide aminé thréonine. Étape 5 Pour déterminer l acide aminé qui correspond au codon UAG, recommence les étapes précédentes en utilisant les bases du codon UAG. Tu obtiendras le codon UAG comme le codon d arrêt sans acide aminé correspondant. Étape 6 Pour déterminer la séquence d acides aminés pour laquelle code la séquence de l ARNm, écris les acides aminés que tu as déterminés à l aide du tableau 18.3 dans l ordre correspondant à la séquence d ARNm. La séquence d acides aminés pour laquelle code la séquence d ARNm AUGCCCACUACAUAG est méthionine-proline-thréonine-thréonine. 7. Un brin d ADN contient la séquence de nucléotides suivante : TACTGCCTCCCCATAAGAATT. a) Quelle séquence de nucléotides du brin d ARNm est transcrite à partir de ce modèle d ADN? b) Quelle est la séquence des acides aminés du polypeptide qui est produite à partir de ce brin d ARNm? Trouve la séquence de nucléotides du brin d ARNm qui est transcrite à partir de ce modèle d ADN. Reproduction autorisée Chenelière Éducation inc. 5

6 Trouve la séquence des acides aminés du polypeptide qui est produite à partir de ce brin d ARNm. La séquence de nucléotides de l ADN TACTGCCTCCCCATAAGAATT. Le tableau 18.3 présente les codons d ARNm et leurs acides aminés correspondants. Étape 1 Utilise tes connaissances de l appariement des nucléotides pour déterminer la séquence de nucléotides du brin d ARNm qui est transcrite de ce modèle d ADN. Étape 2 Divise la séquence de nucléotides de l ARNm en codons de trois nucléotides chacun. Étape 3 Utilise le tableau 18.3 pour déterminer l acide aminé qui correspond à chaque codon dans la séquence de nucléotides de l ARNm. Étape 4 Écris les acides aminés de la séquence qui correspond à la séquence de nucléotides de l ARNm donnée. Étape 1 Tu sais que les nucléotides A, T, C et G dans un brin d ADN correspondent respectivement aux nucléotides U, A, G et C dans un brin d ARNm. La séquence de nucléotides du brin d ARNm qui est transcrite de la séquence de nucléotides d ADN TACTGCCTCCCCATAAGAATT est la suivante : AUGACGGAGGGGUAUUCUUAA. Étape 2 La division de la séquence de nucléotides en codons de trois nucléotides chacun donne la séquence suivante : AUG-ACG-GAG-GGG-UAU-UCU-UAA. Étape 3 Pour déterminer l acide aminé qui correspond au codon AUG, trouve la première base A dans la colonne gauche du tableau intitulé «Première base». Pour trouver la deuxième base U, lis les lignes de la colonne intitulée «Deuxième base» au haut du tableau. Au croisement de la ligne de la première base et de la colonne de la deuxième base, tu trouveras une liste de quatre acides aminés possibles. Pour déterminer le bon acide aminé, lis la colonne intitulée «Troisième base» pour trouver la dernière base G du codon, qui indiquera que l acide aminé méthionine correspond au codon AUG. Étape 4 Pour déterminer l acide aminé qui correspond au codon ACG, recommence l étape 3 en utilisant les bases du codon ACG. L acide aminé thréonine correspond au codon ACG. Étape 5 Recommence les étapes ci-dessus pour les codons GAG, GGG, UAU et UCU. Ces codons correspondent respectivement aux acides aminés acide glutamique, glycine, tyrosine et sérine. Étape 6 Pour déterminer l acide aminé qui correspond au codon UAA, recommence les étapes précédentes en utilisant les bases du codon UAA. Cela indiquera le codon UAA comme le codon d arrêt sans acide aminé correspondant. Reproduction autorisée Chenelière Éducation inc. 6

7 Étape 7 Pour déterminer la séquence d acides aminés pour laquelle code la séquence d ARNm, écris les acides aminés que tu as établis en utilisant le tableau 18.3 dans l ordre correspondant à la séquence de l ARNm. La séquence d acides aminés pour laquelle code la séquence de l ARNm AUGACGGAGGGGUAUUCUUAA est méthionine-thréonine-acide glutamiqueglycine-tyrosine-sérine. Reproduction autorisée Chenelière Éducation inc. 7

Cours IFSI Rockefeller 2013 Dr Julie Marzais

Cours IFSI Rockefeller 2013 Dr Julie Marzais Cours IFSI Rockefeller 2013 Dr Julie Marzais Synthèse s Protéines Du co génétique g aux molécules du Vivant Fonction principale l information l génétique g L information est codée e dans l ADN l succession

Plus en détail

DU GÈNE À LA PROTÉINE

DU GÈNE À LA PROTÉINE 1 DU GÈNE À LA PROTÉINE 1. Le génome et la notion de gène: Génome: ensemble du matériel génétique d'un individu. = patrimoine héréditaire Gène: région d'un brin d'adn dont la séquence code l'information

Plus en détail

Prédiction de gènes. Présentation du problème. Open Reading Frame. HMM (Modèles de Markov cachés) Fonctionnement Exemples Limites

Prédiction de gènes. Présentation du problème. Open Reading Frame. HMM (Modèles de Markov cachés) Fonctionnement Exemples Limites Présentation du problème Open Reading Frame Fonctionnement Exemples Limites Procaryotes versus eucaryotes Validation des résultats: 1) comparaison de séquences 2) utilisation de données statistiques HMM

Plus en détail

CORRECTION DES EXERCICES DE GENETIQUE SYNTHESE PROTEIQUE : P 136-137

CORRECTION DES EXERCICES DE GENETIQUE SYNTHESE PROTEIQUE : P 136-137 CORRECTION DES EXERCICES DE GENETIQUE SYNTHESE PROTEIQUE : P 136-137 Exercice 1 p 171 : définir en une phrase les mots suivants Polypeptide : chaine de plusieurs acides aminés. Séquence protéinique : séquence

Plus en détail

Sujets de mini-projets

Sujets de mini-projets Sujets de mini-projets Sujet I: Décodage neuronal Assistant responsable: Samuel.Gmehlin@epfl.ch et Lukas.Rytz@epfl.ch Motivation Certains neurones du cerveau sont corrélés avec des stimuli complexes, par

Plus en détail

JE M ENTRAINE POUR ETRE AU TOP LE JOUR J

JE M ENTRAINE POUR ETRE AU TOP LE JOUR J JE M ENTRAINE POUR ETRE AU TOP LE JOUR J Exercice n 1 : du gène (brin non transcrit) à la protéine L'ocytocine et l'adh sont deux hormones peptidiques libérées par la post-hypophyse. Les séquences peptidiques

Plus en détail

CHAPITRE 3 LA SYNTHESE DES PROTEINES

CHAPITRE 3 LA SYNTHESE DES PROTEINES CHAITRE 3 LA SYNTHESE DES ROTEINES On sait qu un gène détient dans sa séquence nucléotidique, l information permettant la synthèse d un polypeptide. Ce dernier caractérisé par sa séquence d acides aminés

Plus en détail

Collège Notre Dame de Jamhour. THEME 1A : Expression, stabilité et variation du patrimoine génétique

Collège Notre Dame de Jamhour. THEME 1A : Expression, stabilité et variation du patrimoine génétique Collège Notre Dame de Jamhour Classe : 1 ère S THEME 1A : Expression, stabilité et variation du patrimoine génétique Chapitre 3 : L expression du patrimoine génétique TD- 5 : La protéosynthèse, un processus

Plus en détail

BACCALAUREAT TECHNOLOGIQUE SCIENCES ET TECHNOLOGIES DE LA SANTE ET DU SOCIAL BIOLOGIE ET PHYSIOPATHOLOGIE HUMAINES SESSION 2012

BACCALAUREAT TECHNOLOGIQUE SCIENCES ET TECHNOLOGIES DE LA SANTE ET DU SOCIAL BIOLOGIE ET PHYSIOPATHOLOGIE HUMAINES SESSION 2012 BACCALAUREAT TECHNOLOGIQUE SCIENCES ET TECHNOLOGIES DE LA SANTE ET DU SOCIAL BIOLOGIE ET PHYSIOPATHOLOGIE HUMAINES SESSION 2012 Durée : 3 h 30 Coefficient : 7 Avant de composer, le candidat s assurera

Plus en détail

BACCALAURÉAT GÉNÉRAL

BACCALAURÉAT GÉNÉRAL BACCALAURÉAT GÉNÉRAL SESSION 2016 ÉCOLOGIE AGRONOMIE et TERRITOIRES Épreuve n 6 Série S ÉPREUVE DU MERCREDI 22 JUIN 2016 Durée de l épreuve : 3 heures 30 Coefficient : 5 Aucun appareil électronique n est

Plus en détail

I. Histoire de la biologie moléculaire (Q1 à Q5)

I. Histoire de la biologie moléculaire (Q1 à Q5) I. Histoire de la biologie moléculaire (Q1 à Q5) Q1. Concernant les premières lois sur l hérédité : Elles ont été établies grâce à des expériences menées sur la drosophile (Drosophila melanogaster). Elles

Plus en détail

Biologie Moléculaire et Organismes Modèles

Biologie Moléculaire et Organismes Modèles Biologie Moléculaire et Organismes Modèles Sami Khuri Department of Computer Science San José State University khuri@cs.sjsu.edu Usine de Protéines Les protéines sont responsables de la plupart des fonctions

Plus en détail

Chapitre 11 LA GÉNÉTIQUE

Chapitre 11 LA GÉNÉTIQUE Chapitre 11 LA GÉNÉTIQUE L ADN de la plupart de nos cellules atteint près de 2 m et est constitué d environ 6,4 milliards de nucléotides. Des scientifiques ont réussi à obtenir des souris fluorescentes

Plus en détail

Espèces. Bactérie 0,92 1,03 Levure 1,80 1,00 Ail 1,73 1,01 Blé 1,22 0,98. Taux fort. Aucun Plutonium. Taux. moyen de fumée + plutonium

Espèces. Bactérie 0,92 1,03 Levure 1,80 1,00 Ail 1,73 1,01 Blé 1,22 0,98. Taux fort. Aucun Plutonium. Taux. moyen de fumée + plutonium DS Chapitre 3 : L ADN, support de l information génétique Partie 1 : Restitution des connaissances. 1/ Définir : gène, mutation 2/ Citer le nom de la «brique» de base de la molécule d ADN. Représenter

Plus en détail

BIOLOGIE. 1re année. Santé. VISA pour la 1 re année Santé. 2 e édition. Marie-Claude Descamps. Préparer et réussir son entrée en PACES/L1 Santé 100%

BIOLOGIE. 1re année. Santé. VISA pour la 1 re année Santé. 2 e édition. Marie-Claude Descamps. Préparer et réussir son entrée en PACES/L1 Santé 100% 100% 1re année Santé Médecine Pharmacie Dentaire Sage-Femme Marie-Claude Descamps BILGIE VISA pour la 1 re année Santé Préparer et réussir son entrée en PACES/L1 Santé Toutes les notions du Lycée requises

Plus en détail

Alanine (Ala) Codons: GCT, GCC, GCA, GCG

Alanine (Ala) Codons: GCT, GCC, GCA, GCG A Alanine (Ala) Codons: GCT, GCC, GCA, GCG R Arginine (Arg) Le nourrisson ne peut pas la fabriquer L'arginine est fréquemment retrouvée dans les energy drinks. Depuis 2008, elle a été remplacée par la

Plus en détail

Séquence 4. Génétique et évolution : le brassage génétique et sa contribution à la diversité génétique, et processus de diversification du vivant

Séquence 4. Génétique et évolution : le brassage génétique et sa contribution à la diversité génétique, et processus de diversification du vivant Séquence 4 Génétique et évolution : le brassage génétique et sa contribution à la diversité génétique, et processus de diversification du vivant Sommaire Chapitre 1. Prérequis Chapitre 2. La reproduction

Plus en détail

TRANSCRIPTION TRADUCTION

TRANSCRIPTION TRADUCTION 4 TRANSCRIPTION TRADUCTION Objectifs : définir transcription et traduction et donner leur localisation cellulaire sur un schéma, identifier les acteurs de la transcription (ARNpol, brin transcrit, ARNm)

Plus en détail

Acides Nucléiques. ADN et ARN Unités de base : les nucléotides donc les nucléotides = monomères ADN et ARN = polynucléotides = polymères

Acides Nucléiques. ADN et ARN Unités de base : les nucléotides donc les nucléotides = monomères ADN et ARN = polynucléotides = polymères Acides Nucléiques ADN et ARN Unités de base : les nucléotides donc les nucléotides = monomères ADN et ARN = polynucléotides = polymères Structure d un nucléotide Tous composés d une base azotée, d un sucre

Plus en détail

UE1 Atomes, Biomolécules, Génome PACES 2011-2012

UE1 Atomes, Biomolécules, Génome PACES 2011-2012 UE1 Atomes, Biomolécules, Génome Traduction et régulation (1) PACES 2011-2012 Sandrine Dabernat Code génétique et traduction 1- Les ARN de transfert 2- Les ARN ribosomaux et ribosomes 3- Le code génétique

Plus en détail

Le gène, de l'adn aux protéines

Le gène, de l'adn aux protéines 13/10/2011 - Par Claude Sauter Le gène, de l'adn aux protéines La vie d'un gène, de sa duplication à la fabrication d'une protéine pour laquelle il code, est une succession d'étapes cruciales. Ce dossier

Plus en détail

Génétique. Kit Traduction. Réf : Français p 1. Version : 1106

Génétique. Kit Traduction. Réf : Français p 1. Version : 1106 Français p 1 Version : 1106 1. Instructions Ce kit vous fournit des molécules et des liaisons pour construire un modèle de d ARNm comprenant 15 nucléotides, dont une coiffe de méthyl-guanosine et une queue

Plus en détail

1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16.

1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 1. Indiquer ce qu est un gène. 2. Décrire la structure de la molécule d ADN. 3. Indiquer ce que sont les allèles d un gène. 4. Indiquer ce qu est le génotype. 5. Indiquer ce qu est le phénotype. 6. Citer

Plus en détail

CHAPITRE 3 : L'EXPRESSION DU PATRIMOINE GÉNÉTIQUE

CHAPITRE 3 : L'EXPRESSION DU PATRIMOINE GÉNÉTIQUE CHAPITRE 3 : L'EXPRESSION DU PATRIMOINE GÉNÉTIQUE LES PROTÉINES SONT LE RÉSULTAT DE L'EXPRESSION DES GÈNES On observe de nombreuses différences entre ces deux gènes; 1061 nucléotides pour l'allèle du groupe

Plus en détail

DE L ADN AUX PROTÉINES LES ÉTAPES

DE L ADN AUX PROTÉINES LES ÉTAPES DE L ADN AUX PROTÉINES LES ÉTAPES L ADN (acide désoxyribonucléique) Situé dans le noyau, l ADN constitue le matériel génétique noyau Double hélice d ADN cytoplasme LES NUCLEOTIDES (ADN et ARNs) Une classe

Plus en détail

CHAPITRE III : LE NOYAU INTERPHASIQUE ET LE CYCLE CELLULAIRE

CHAPITRE III : LE NOYAU INTERPHASIQUE ET LE CYCLE CELLULAIRE CHAPITRE III : LE NOYAU INTERPHASIQUE ET LE CYCLE CELLULAIRE III.1 LE NOYAU INTERPHASIQUE III.1. 1 STRUCTURE L organite le plus proéminent de la cellule est le noyau. Il est le centre vital de la cellule.

Plus en détail

NUMEROTATION NATURELLE DES ACIDES AMINES

NUMEROTATION NATURELLE DES ACIDES AMINES Jean-Nicolas Maisonnier Le 22 novembre 2008 jean.nicolas@maisonnier.com NUMEROTATION NATURELLE DES ACIDES AMINES LE POINT SUR LES INVESTIGATIONS DU GROUPE BENA Le code génétique atteste d une numérotation

Plus en détail

LA SYNTHÈSE DES PROTÉINES

LA SYNTHÈSE DES PROTÉINES LA SYNTHÈSE DES PROTÉINES La transcription Information : dans le noyau (sous forme d'adn) Synthèse des protéines : dans le cytoplasme (au niveau des ribosomes du reticulum endoplasmique) L'ADN ne sort

Plus en détail

BACCALAUREAT TECHNOLOGIQUE CHIMIE, BIOCHIMIE, SCIENCES DU VIVANT ET ENSEIGNEMENT SPECIFIQUE A LA SPECIALITE SCIENCES ET TECHNOLOGIES DE LABORATOIRE

BACCALAUREAT TECHNOLOGIQUE CHIMIE, BIOCHIMIE, SCIENCES DU VIVANT ET ENSEIGNEMENT SPECIFIQUE A LA SPECIALITE SCIENCES ET TECHNOLOGIES DE LABORATOIRE BAALAUREAT TEHNLGIQUE ANNALE ZER 2013 Epreuve : HIMIE, BIHIMIE, SIENES DU VIVANT ET ENSEIGNEMENT SPEIFIQUE A LA SPEIALITE Série SIENES ET TEHNLGIES DE LABRATIRE Sous-épreuve de himie, Biochimie, Sciences

Plus en détail

La Bioinformatique fonctionnelle Retrouver les Gènes

La Bioinformatique fonctionnelle Retrouver les Gènes Biologie moléculaire-2016 1 La Bioinformatique fonctionnelle Retrouver les Gènes Le séquençage est devenu chose tellement courante, que dans les dernières années nous avons obtenu les séquences complètes

Plus en détail

Les gènes, unité d information génétique :

Les gènes, unité d information génétique : Les gènes, unité d information génétique : Le gène est une portion de chromosome qui détermine un caractère héréditaire précis. Un même gène est présent sur chaque chromosome d une même paire et y occupe

Plus en détail

III. GENE, CODE GENETIQUE ET SYNTHESE DES PROTEINES

III. GENE, CODE GENETIQUE ET SYNTHESE DES PROTEINES le caryotype. De nouvelles techniques de marquage des chromosomes directement sur coupes tissulaires (FISH) ou in vitro ( C G H ) (Fig. 14) ont été développées ces dernières années et permettent d étudier

Plus en détail

Chapitre 14: La génétique

Chapitre 14: La génétique Chapitre 14: La génétique A) Les gènes et les protéines, ça te gêne? 1) a) Quel est l élément de base des vivants? Les cellules b) Qu a-t-elle en son centre? Un noyau c) Qu y retrouve-t-on sous forme de

Plus en détail

Baccalauréat général Sciences de la vie et de la Terre

Baccalauréat général Sciences de la vie et de la Terre Baccalauréat général Sciences de la vie et de la Terre Épreuve obligatoire série S Partie 1 (5 points) Thème 1-: Expression, stabilité, variation du patrimoine génétique. Sujet : On cherche à montrer,

Plus en détail

Fiche pédagogique : De l ADN aux protéines. Les secrets de l expression de l information génétique.

Fiche pédagogique : De l ADN aux protéines. Les secrets de l expression de l information génétique. Fiche pédagogique : De l ADN aux protéines. Les secrets de l expression de l information génétique. Pourquoi êtes-vous blonds? bruns? chauves? Pourquoi avez-vous les yeux bleus? Pourquoi ressemblez-vous

Plus en détail

Figure 1. Schéma général d une cellule d un organisme vivant terrien. En rouge : l ADN, compacté dans la cellule. La structure simplifiée d un

Figure 1. Schéma général d une cellule d un organisme vivant terrien. En rouge : l ADN, compacté dans la cellule. La structure simplifiée d un Iconographie Figure 1. Schéma général d une cellule d un organisme vivant terrien. En rouge : l ADN, compacté dans la cellule. La structure simplifiée d un fragment d ADN a été obtenue avec le logiciel

Plus en détail

MÉCANISMES MOLÉCULAIRES DE L EXPRESSION DES GÉNES : LA TRADUCTION OU BIOSYNTHÈSE DES PROTÉINES

MÉCANISMES MOLÉCULAIRES DE L EXPRESSION DES GÉNES : LA TRADUCTION OU BIOSYNTHÈSE DES PROTÉINES MÉCANISMES MOLÉCULAIRES DE L EXPRESSION DES GÉNES : LA TRADUCTION OU BIOSYNTHÈSE DES PROTÉINES Le sens de lecture L ARN polymérase lit le brin matrice dans la direction 3 vers 5 de façon à synthétiser

Plus en détail

dans la cellule, où se trouve la substance responsable de l hérédité? Génétique quelle est la substance responsable de l hérédité?

dans la cellule, où se trouve la substance responsable de l hérédité? Génétique quelle est la substance responsable de l hérédité? dans la cellule, où se trouve la substance responsable de l hérédité? Génétique acetabularia sp. Pr. R. Raynal Questions Si l'information était contenue dans le cytoplasme de l'ovule, de quelle couleur

Plus en détail

CPE Lyon ESA ESA Purpan ESCOM ESEO IGAL ISA ISAB - ISARA-Lyon ISEN Brest ISEN Lille ISEN Toulon ISEP LOUIS DE BROGLIE SELECTION FESIC

CPE Lyon ESA ESA Purpan ESCOM ESEO IGAL ISA ISAB - ISARA-Lyon ISEN Brest ISEN Lille ISEN Toulon ISEP LOUIS DE BROGLIE SELECTION FESIC CPE Lyon ESA ESA Purpan ESCOM ESEO IGAL ISA ISAB - ISARA-Lyon ISEN Brest ISEN Lille ISEN Toulon ISEP LOUIS DE BROGLIE SELECTION FESIC ADMISSION en 1ère ANNEE du 1er CYCLE 2006 EPREUVE DE SCIENCES DE LA

Plus en détail

La traduction. Synthèse des protéines: La machinerie. Composition des ribosomes procaryotes Protéines ribosomales ARNs ribosomiques.

La traduction. Synthèse des protéines: La machinerie. Composition des ribosomes procaryotes Protéines ribosomales ARNs ribosomiques. La traduction 1 triplet de nucléotide sur l ARN m (codon) 1 acide aminé Synthèse des protéines: La machinerie Le mécanisme et les éléments : polypeptide ribosome acide aminé Composition des ribosomes procaryotes

Plus en détail

THEME 1 A EXPRESSION, STABILITE ET VARIATION DU PATRIMOINE GENETIQUE

THEME 1 A EXPRESSION, STABILITE ET VARIATION DU PATRIMOINE GENETIQUE THEME 1 A EXPRESSION, STABILITE ET VARIATION DU PATRIMOINE GENETIQUE CHAPITRE 3 L EXPRESSION DU PATRIMOINE GENETIQUE I. LA RELATION GENES-PROTEINES Les protéines interviennent dans le fonctionnement d

Plus en détail

Eléments primordiaux de biologie moléculaire

Eléments primordiaux de biologie moléculaire Eléments primordiaux de biologie moléculaire Pourquoi s intéresser au matériel génétique? Base de l information génétique Tissu Cellule Noyau Organisme entier Lieu où est localisé l ADN Mol d ADN qui est

Plus en détail

Biologie 12 Examen de référence C Cahier d examen

Biologie 12 Examen de référence C Cahier d examen Biologie 12 Examen de référence C Cahier d examen Nombre de pages : 32 pages Durée de l examen : 2 heures 67 questions à choix multiple dans le Cahier d examen Temps supplémentaire permis : 60 minutes

Plus en détail

LIVRET Q.C.M. (QUE VOUS CONSERVEZ).

LIVRET Q.C.M. (QUE VOUS CONSERVEZ). ÉCOLE Samedi 4 avril 2009 SUPÉRIEURE DE MASSEURS CORRIGE KINÉSITHÉRAPEUTES et PÉDICURES Instituts Privés de formation 17, rue de Liège 75009 PARIS ÉPREUVE DE BIOLOGIE 2 durée 0H30 (IL N Y A PAS DE POINTS

Plus en détail

CORRIGÉ DU CONCOURS D ASSAS 2010 (école de Masso-Kinésithérapie)

CORRIGÉ DU CONCOURS D ASSAS 2010 (école de Masso-Kinésithérapie) 1 CORRIGÉ DU CONCOURS D ASSAS 2010 (école de Masso-Kinésithérapie) Biologie : correction réalisée par Mr LAIGNIER Laurent Poly-Prépas Correction proposée et non officielle Toute reproduction interdite

Plus en détail

1) Donner la polarité de ce fragment de gène (brin transcrit) et la séquence d ADN complémentaire.

1) Donner la polarité de ce fragment de gène (brin transcrit) et la séquence d ADN complémentaire. FACULTE DE MEDECINE D'ALGER CBM DERGANA MODULE DE GENETIQUE- SERIE DE TD N 3 Exercice 1 On se propose d étudier la synthèse du facteur IX, un facteur plasmatique de la coagulation. La séquence ci dessous

Plus en détail

EXERCICES : DU GENE A LA PROTEINE : pages 64 65 66 EXERCICE 1 PAGE 64 : PHENOTYPES ASSOCIES A UN ENZYME : G6PD

EXERCICES : DU GENE A LA PROTEINE : pages 64 65 66 EXERCICE 1 PAGE 64 : PHENOTYPES ASSOCIES A UN ENZYME : G6PD EXERCICES : DU GENE A LA PROTEINE : pages 64 65 66 EXERCICE 1 PAGE 64 : PHENOTYPES ASSOCIES A UN ENZYME : G6PD Question 1 : définir le phénotype à plusieurs échelles Enzyme G6PD active : eau oxygénée transformée

Plus en détail

PARTIE 1 La Terre dans l Univers, la vie et l évolution du vivant L Expression, stabilité et variation du patrimoine génétique

PARTIE 1 La Terre dans l Univers, la vie et l évolution du vivant L Expression, stabilité et variation du patrimoine génétique A L PARTIE 1 La Terre dans l Univers, la vie et l évolution du vivant L Expression, stabilité et variation du patrimoine génétique CHA CHAP.3: L EXPRESSION DU PATRIMOINE GENETIQUE Diapo COURS 2011 EXPRESSION

Plus en détail

INSTITUT NATIONAL DE PODOLOGIE, PARIS, SAINTE-ANNE, 2013

INSTITUT NATIONAL DE PODOLOGIE, PARIS, SAINTE-ANNE, 2013 3_Pedicure_podologue_2e ed._concours 170x240 mardi24/06/14 11:57 Page211 4 INSTITUT NATIONAL DE PODOLOGIE, PARIS, SAINTE-ANNE, 2013 Durée de l épreuve : 2 heures. Cette épreuve est notée sur 40 points.

Plus en détail

BACCALAURÉAT PROFESSIONNEL SUJET

BACCALAURÉAT PROFESSIONNEL SUJET SESSION 2011 France métropolitaine BACCALAURÉAT PROFESSIONNEL ÉPREUVE N 5 SCIENCES APPLIQUÉES ET TECHNOLOIE Option : Conduite et gestion de l élevage canin et félin Durée : 2 heures Matériel(s) et document(s)

Plus en détail

L'ordre et la nature des acides aminés (ou séquence) d un polypeptide dépend de la séquence des nucléotides de l ADN du gène qui le code.

L'ordre et la nature des acides aminés (ou séquence) d un polypeptide dépend de la séquence des nucléotides de l ADN du gène qui le code. L'ordre et la nature des acides aminés (ou séquence) d un polypeptide dépend de la séquence des nucléotides de l ADN du gène qui le code. Une mutation, peut entraîner une modification de la séquence des

Plus en détail

Généticien (nne) : 2) Quels sont les types des protéines qui correspondent aux énoncés du tableau suivant?

Généticien (nne) : 2) Quels sont les types des protéines qui correspondent aux énoncés du tableau suivant? Généticien (nne) : Groupe : EXERCICES GÉNÉTIQUE LES PROTÉINES ET L ADN 1) Les gènes portent de l information. De quelle sorte d information s agit-il? Cette information représente la séquence des acides

Plus en détail

L annotation in silico des séquences génomiques Claudine Médigue, Stéphanie Bocs, Laurent Labarre, Catherine Mathé, David Vallenet

L annotation in silico des séquences génomiques Claudine Médigue, Stéphanie Bocs, Laurent Labarre, Catherine Mathé, David Vallenet MEDECINE/SCIENCES 2002 ; 18 : 237-250 > Depuis 1995, nous avons accès à l information génétique complète d un nombre croissant d organismes vivants très divers. Cette explosion d informations impose des

Plus en détail

Pipetez, chargez et observez!

Pipetez, chargez et observez! Ce document propose une activité préparatoire et une activité de prolongement à l activité Pipetez, chargez et observez! proposée aux élèves du 3 e, 4 e et 5 e secondaire en complément de la visite de

Plus en détail

TD 3 : LA GÉNÉTIQUE. L Homme possède 46 chromosomes, soit 23 paires de chromosomes.

TD 3 : LA GÉNÉTIQUE. L Homme possède 46 chromosomes, soit 23 paires de chromosomes. TD 3 : LA GÉNÉTIQUE ADN : acide désoxyribonucléique. ARN : acide ribonucléique.! L ADN possède deux brins, l ARN un seul. Ils sont composés de nucléotides eux-même composés d une base azoté, d un sucre,

Plus en détail

I- Unités monomériques: Nucléotides

I- Unités monomériques: Nucléotides B- Les Acide nucléiques 1 acide nucléique = polymères de nucléotides Capacité: autoduplication transport et transmission de l information > Programme des protéines produites par chaque cellule base >reproduction

Plus en détail

Macromolécules et la Cellule

Macromolécules et la Cellule Macromolécules et la Cellule Macromolécules Campbell chapitre 5 Macromolécules Définition: Molécule géante formée par l assemblage de plusieurs petites molécules organiques Macromolécules Définition:

Plus en détail

A T C G A T C G CORRECTION TD Ecole Manip RADIO (Montpellier) Base. Sucre 3. Base Purine Base Pyrimidine. G= Guanine C= Cytosine

A T C G A T C G CORRECTION TD Ecole Manip RADIO (Montpellier) Base. Sucre 3. Base Purine Base Pyrimidine. G= Guanine C= Cytosine CORRECTION TD 2 2011-2012 Question N1. Concernant la structure de l'adn (double brin) qu'elles sont la ou les réponses exactes? A) Dans un ADN, le rapport : nombre de A /nombre de G est égal à 1. B) Plus

Plus en détail

BASES DE GENETIQUE. Y.LAMBREY- genetique-ifsi-2006 1

BASES DE GENETIQUE. Y.LAMBREY- genetique-ifsi-2006 1 BASES DE GENETIQUE Y.LAMBREY- genetique-ifsi-2006 1 ADN ET PROTEINES Y.LAMBREY- genetique-ifsi-2006 2 2 éléments fondamentaux pour la vie, les protéines et l ADN - PROTEINES, présentes partout, exercent

Plus en détail

Chapitre 2. La synthèse protéique : la relation entre le génotype et le phénotype.

Chapitre 2. La synthèse protéique : la relation entre le génotype et le phénotype. Chapitre 2. La synthèse protéique : la relation entre le génotype et le phénotype. Les maladies génétiques comme la drépanocytose ou l'albinisme sont liées à des modifications du génotype des individus

Plus en détail

a. Participent à la transcription nucléotides b. Participent à la traduction b. Sont le support de l information

a. Participent à la transcription nucléotides b. Participent à la traduction b. Sont le support de l information Nom Prénom : EVALUATION Première S 4 février 2015 /29 Restituer et mobiliser des connaissances exigibles Raisonner, argumenter, Informations : une évaluation doit être rédigée sur une copie correctement

Plus en détail

Séquence 3. Comment les informations génétiques se transmettent-elles de cellules en cellules? Nos cellules, filles de la cellule-œuf

Séquence 3. Comment les informations génétiques se transmettent-elles de cellules en cellules? Nos cellules, filles de la cellule-œuf Sommaire Nous sommes en train d étudier le support des informations génétiques 1 au sein de nos cellules. Rapidement après sa formation, la cellule-œuf commence à se multiplier (vu en classe de 4 e ).

Plus en détail

Expression, stabilité et variation du patrimoine génétique Expression du patrimoine génétique

Expression, stabilité et variation du patrimoine génétique Expression du patrimoine génétique Thème I A Chapitre 3 Expression, stabilité et variation du patrimoine génétique Expression du patrimoine génétique Introduction : - gène = portion d ADN = information détermination des caractères [phénotype]

Plus en détail

Brin transcrit : chaine de l ADN qui, par complémentarité des nucléotides, sert de modèle pour la synthèse de l ARN messager

Brin transcrit : chaine de l ADN qui, par complémentarité des nucléotides, sert de modèle pour la synthèse de l ARN messager Fin du cours chap 5 La transcription : de l ADN à l ARN : Par définition, le brin transcrit est le brin d ADN complémentaire de l ARN : c est le brin qui sert à la synthèse de l ARN, donc ici le brin2.

Plus en détail

Du gène à la protéine Campbell, 4 ème édition, chapitre 17. Automne 2013, 101-NYA-05

Du gène à la protéine Campbell, 4 ème édition, chapitre 17. Automne 2013, 101-NYA-05 Du gène à la protéine Campbell, 4 ème édition, chapitre 17 Automne 2013, 101-NYA-05 1 Objectif général à l issue de ce cours Schématiser les principales étapes de la synthèse des protéines en identifiant

Plus en détail

PC Brizeux AD N 2 Altmayer- Henzien 2015-2016. Approche documentaire N 2 Synthèse peptidique

PC Brizeux AD N 2 Altmayer- Henzien 2015-2016. Approche documentaire N 2 Synthèse peptidique P Brizeux AD N 2 Altmayer- Henzien 2015-2016 Approche documentaire N 2 Synthèse peptidique bjectif : Le but de cette approche documentaire est d analyser les stratégies de synthèse in vitro et in vivo

Plus en détail

Spécialité Sciences Physiques et Chimiques en Laboratoire

Spécialité Sciences Physiques et Chimiques en Laboratoire BACCALAURÉAT TECHNOLOGIQUE Série : STL Spécialité Sciences Physiques et Chimiques en Laboratoire SESSION 2014 CBSV : sous épreuve coefficient 4 Sciences physiques et chimiques en laboratoire : sous épreuve

Plus en détail

La synthèse des protéines

La synthèse des protéines La synthèse des protéines exemple vers théorie Rappel : le phénotype correspond à l'ensemble des caractéristiques d'un individu. Ces caractéristiques peuvent s'observer à différentes échelles. Un caractère

Plus en détail

STRUCTURE ET FONCTION DES GÈNES ET DES CHROMOSOMES

STRUCTURE ET FONCTION DES GÈNES ET DES CHROMOSOMES Faculté de Médecine de Sousse Tunisie Année Universitaire 209-2010 Deuxième Année Médecine Support pédagogique illustré relatif au cours: STRUCTURE ET FONCTION DES GÈNES ET DES CHROMOSOMES Pr. Ag. ELGHEZAL

Plus en détail

La division cellulaire Chapitre 5 Anatomie

La division cellulaire Chapitre 5 Anatomie La division cellulaire Chapitre 5 Anatomie La division cellulaire est le mode de multiplication de toute cellule. Elle lui permet de se diviser en plusieurs cellules-filles (deux le plus souvent). C'est

Plus en détail

groupement carboxyle (-COOH) liés ensemble par un atome de carbone (C) auquel

groupement carboxyle (-COOH) liés ensemble par un atome de carbone (C) auquel UV. /. Les gènes et les protéines Manuel, p. 390 à 39. Dites à quoi correspondent les définitions suivantes. a) Les unités de base de l ADN. Les nucléotides. b) Les «barreaux» dans la structure en double

Plus en détail

Quelques termes-clef de biologie moléculaire et leur définition

Quelques termes-clef de biologie moléculaire et leur définition Acide aminé (AA) Quelques termes-clef de biologie moléculaire et leur définition Isabelle Quinkal INRIA Rhône-Alpes Septembre 2003 Petite molécule dont l enchaînement compose les protéines - on dit qu

Plus en détail

Chapitre 3 : La cellule bactérienne, génétique et synthèse protéique

Chapitre 3 : La cellule bactérienne, génétique et synthèse protéique Chapitre 3 : La cellule bactérienne, génétique et synthèse protéique Attention, ce cours suppose la connaissance de notions de base en génétique, notamment les notions de transcription, traduction ainsi

Plus en détail

Enquête. Un médecin a reçu des morceaux d ADN provenant de 2 patients différents. Il a mélangé les tubes et a donc besoin de votre aide pour savoir:

Enquête. Un médecin a reçu des morceaux d ADN provenant de 2 patients différents. Il a mélangé les tubes et a donc besoin de votre aide pour savoir: Enquête Un médecin a reçu des morceaux d ADN provenant de 2 patients différents. Il a mélangé les tubes et a donc besoin de votre aide pour savoir: Quel patient a le plus de chance d être d origine japonaise?

Plus en détail

Nom: Groupe: Date: Caractère Caryotype Chromatine Chromosome Gène Génome

Nom: Groupe: Date: Caractère Caryotype Chromatine Chromosome Gène Génome Nom: Groupe: Date: C11 hapitrela génétique L ADN et les gènes PAGES 350 À 354 En théorie 1. Que suis-je? Toutes les questions de ce chapitre sont liées à des concepts prescrits du programme STE. Caractère

Plus en détail

GENETIQUE. La génétique est l étude de la transmission des caractères héréditaires et de ses anomalies.

GENETIQUE. La génétique est l étude de la transmission des caractères héréditaires et de ses anomalies. GENETIQUE La génétique est l étude de la transmission des caractères héréditaires et de ses anomalies. I- BASES BIOCHIMIQUES DE LA GENETIQUE L ADN est le support de l information génétique, c est à dire

Plus en détail

Le Génome Humain: Principes fondamentaux

Le Génome Humain: Principes fondamentaux CURRICULUM Forum Med Suisse N o 23 6 juin 2001 599 Le Génome Humain: Principes fondamentaux sur l ADN E. G. Berger, T. Hennet Institut de Physiologie de l Université de Zurich *www.gdb.org/hugo www.nhgri.nih.gov

Plus en détail

Contrôle de l expression génétique chez les eucaryotes

Contrôle de l expression génétique chez les eucaryotes Contrôle de l expression génétique chez les eucaryotes 3 ème partie : synthèse, maturation & dégradation des protéines - Chapitre I : La synthèse des protéines Cours de Mr Le Dréan I Rappels en guise d

Plus en détail

Partie 3 : La biodiversité et sa dynamique. Chapitre III : La diversification des génomes

Partie 3 : La biodiversité et sa dynamique. Chapitre III : La diversification des génomes Partie 3 : La biodiversité et sa dynamique Chapitre III : La diversification des génomes La résistance aux antibiotiques chez les eubactéries Un exemple d antibiogramme http://geniebio.ac-aixmarseille.fr/zimages/spip.php?article172&id_do

Plus en détail

Toutes les caractéristiques d'un organisme vivant sont déterminées par le type de protéines que fabrique cet être vivant. Ce qui différencie un être

Toutes les caractéristiques d'un organisme vivant sont déterminées par le type de protéines que fabrique cet être vivant. Ce qui différencie un être 2 L ADN ET LES PROTÉINES : GÉNÉRALITÉS Toutes les caractéristiques d'un organisme vivant sont déterminées par le type de protéines que fabrique cet être vivant. Ce qui différencie un être vivant d'un autre,

Plus en détail

Structure du gène Eucaryote, du gène Procaryote la Transcription, le Code génétique et la Traduction

Structure du gène Eucaryote, du gène Procaryote la Transcription, le Code génétique et la Traduction UNIVERSITE D ALGER Faculté de Médecine et de Médecine Dentaire ZIANIA (Château Neuf) Structure du gène Eucaryote, du gène Procaryote la Transcription, le Code génétique et la Traduction COURS DE GENETIQUE

Plus en détail

Biologie Moléculaire et Organismes Modèles

Biologie Moléculaire et Organismes Modèles Biologie Moléculaire et Organismes Modèles Sami Khuri Department of Computer Science San José State University khuri@cs.sjsu.edu Plan du Cours Biologie Moléculaire et Organismes Modèles Qu est-ce que la

Plus en détail

C'est la conversion d'arnm en protéine, selon le code génétique. Seule la séquence ORF ( Open Reading Frame ) de l'arn est traduite.

C'est la conversion d'arnm en protéine, selon le code génétique. Seule la séquence ORF ( Open Reading Frame ) de l'arn est traduite. I_ Le langage génétique La traduction A. Structure des ARm C'est la conversion d'arm en protéine, selon le code génétique. Seule la séquence ORF ( Open Reading Frame ) de l'ar est traduite. L'AR sera traduit

Plus en détail

Du génotype au phénotype, relation avec l environnement

Du génotype au phénotype, relation avec l environnement Du génotype au phénotype, relation avec l environnement Pré-requis (troisième et seconde) : Chaque individu présente les caractères de l'espèce avec des variations qui lui sont propres. C'est le résultat

Plus en détail

Chapitre 3 Génétique moléculaire : expression de l information génétique

Chapitre 3 Génétique moléculaire : expression de l information génétique Chapitre 3 Génétique moléculaire : expression de l information génétique III 1 Rappel : Les protides III 1.1 Classification III 1.2 Mise en évidence III 2 Mécanismes de l expression génétique III 2.1 Résultats

Plus en détail

CHAPITRE III : Synthèse Protéique. ADN ARN Protéines

CHAPITRE III : Synthèse Protéique. ADN ARN Protéines CHAPITRE III : Synthèse Protéique Introduction : L information contenue dans l ADN, c'est-à-dire le matériel génétique, se présente sous forme de séquences nucléotidiques précises, alignées sur les brins

Plus en détail

Dans un milieu de culture dépourvu de tryptophane, on cultive des bactéries [Try -] en présence de la partie P1.

Dans un milieu de culture dépourvu de tryptophane, on cultive des bactéries [Try -] en présence de la partie P1. Série de génétique n 1 3 ème Sciences Expérimentales Exercice n 1 On considère deux souches de bactérie, le bacille subtil, (bactéries) de phénotype respectivement [Try +] et [Try -]. (Try est un acide

Plus en détail

Algorithmique en seconde avec Xcas

Algorithmique en seconde avec Xcas Algorithmique en seconde avec Xcas Jean-Pierre Branchard Renée De Graeve Bernard Parisse Octobre 2009 Table des matières 1 Introduction 2 1.1 Installation de Xcas........................ 2 1.2 Algorithme

Plus en détail

2013/2014. Les Mutations. Cours de Génétique Semestre 3, Filière Sciences de la Vie Professeur Rkha S.

2013/2014. Les Mutations. Cours de Génétique Semestre 3, Filière Sciences de la Vie Professeur Rkha S. 2013/2014 Les Mutations Cours de Génétique Semestre 3, Filière Sciences de la Vie Professeur Rkha S. INTRODUCTION - Définition - Différences entre mutations germinales et mutations somatiques Définition

Plus en détail

5-1. Introduction 5-2. L appareil de traduction et son fonctionnement - Les ribosomes - Les ARNt - Les ARNt Synthétases

5-1. Introduction 5-2. L appareil de traduction et son fonctionnement - Les ribosomes - Les ARNt - Les ARNt Synthétases 5 - la traduction 5-1. Introduction 5-2. L appareil de traduction et son fonctionnement - Les ribosomes - Les ARNt - Les ARNt Synthétases 5-3. Les étapes de la synthèse protéiques -Initiation - Élongation

Plus en détail

PHYSIOLOGIE CELLULAIRE

PHYSIOLOGIE CELLULAIRE PHYSIOLOGIE CELLULAIRE Licence STAPS 1ère année Stéphane TANGUY Département STAPS Université d Avignon et des pays de Vaucluse PHYSIOLOGIE CELLULAIRE CELLULE molécules atomes CHIMIE TISSU ORGANISME ORGANE

Plus en détail

TD3: support du cours/td

TD3: support du cours/td TD3: support du cours/td Auteur: P RAG D BRUANT Livres de complément: -Maillet (Biologie cellulaire) Masson -Alberts (la cellule) Médecine-science Flammarion -Koolman (Atlas de poche de biochimie) Médecinescience

Plus en détail

FONCTIONS DES GENES, TRANSCRIPTION ET TRADUCTION

FONCTIONS DES GENES, TRANSCRIPTION ET TRADUCTION FONCTIONS DES GENES, TRANSCRIPTION ET TRADUCTION I. Transcription et propriétés de l ARN La transcription est la synthèse d un ARN à partir d un ADN double brin. La transcription est catalysée par une

Plus en détail

La synthèse des protéines transcription code génétique traduction

La synthèse des protéines transcription code génétique traduction CEC André-Chavanne BIO 3 OS La synthèse des protéines transcription code génétique traduction I. La «Transcription» : de l ADN à l ARNm. L'adresse suivante permet d accéder à une ANIMATION sur la TRANSCRIPTION.

Plus en détail

Biologie cellulaire. Cours 8 : Synthèse des protéines

Biologie cellulaire. Cours 8 : Synthèse des protéines Département des Troncs Communs Sciences de la Nature Faculté des Sciences de la Nature et de la Vie Université Abderrahmane Mira de Bejaia Biologie cellulaire Cours 8 : Synthèse des protéines Année universitaire

Plus en détail

Chapitre C. (ancien programme) (Nouveau programme) POLY-PREPAS AMIENS M.LAIGNIER ll.polyprepas@orange.fr

Chapitre C. (ancien programme) (Nouveau programme) POLY-PREPAS AMIENS M.LAIGNIER ll.polyprepas@orange.fr 1 Chapitre C LA SYNTHÈSE PROTÉIQUE (ancien programme) L expression du matériel génétique (Nouveau programme) Le phénotype macroscopique des individus est sous la dépendance des protéines. Le phénotype

Plus en détail

3. E n t r e r d e s d o n n é e s d a n s u n e f e u i l l e

3. E n t r e r d e s d o n n é e s d a n s u n e f e u i l l e 3. E n t r e r d e s d o n n é e s d a n s u n e f e u i l l e Ce document est disponible sur Internet à l adresse : http://perso.fundp.ac.be/~jmlamber Informations complémentaires : Jean-Marie.Lambert@fundp.ac.be

Plus en détail

KIT PRINCIPE DE LA PCR A RECEPTION DU COLIS : COMPOSITION (pour 5 gels de 8 puits soit 40 dépôts d ADN) MATERIEL NECESSAIRE

KIT PRINCIPE DE LA PCR A RECEPTION DU COLIS : COMPOSITION (pour 5 gels de 8 puits soit 40 dépôts d ADN) MATERIEL NECESSAIRE : 0033 (0)169922672 : 0033 (0)169922674 : @ :sordalab@wanadoo.fr KIT PRINCIPE DE LA PCR Ref: PCR A RECEPTION DU COLIS : Vérifier la composition du colis indiquée ci-dessous en page 1 Stocker les articles

Plus en détail

TRADUCTION DE: MICROBIOLOGY 101 INTERNET TEXT CHAPITRES VIII: ÉLÉMENTS DE GÉNÉTIQUE

TRADUCTION DE: MICROBIOLOGY 101 INTERNET TEXT CHAPITRES VIII: ÉLÉMENTS DE GÉNÉTIQUE TRADUCTION DE: MICROBIOLOGY 101 INTERNET TEXT CHAPITRES VIII: ÉLÉMENTS DE GÉNÉTIQUE Version originale: 11-03-97, traduite le 14-03-97 TABLE DES MATIÈRES Les débuts de la génétique moléculaire Qu'est-ce

Plus en détail

Séance TUTORAT 3 24/11/2016

Séance TUTORAT 3 24/11/2016 Séance TUTORAT 3 24/11/2016 Programme M. Heydel Transcription Traduction Techniques exploration ADN M. Masson. TRANSCRIPTION en 5 et 3, régions UTR untraslated region = régions transcrites mais non traduites

Plus en détail