Algorithmes pour la comparaison de séquences II

Dimension: px
Commencer à balayer dès la page:

Download "Algorithmes pour la comparaison de séquences II"

Transcription

1 Algorithmes pour la comparaison de séquences II Hélène TOUZET Equipe Bioinfo Master recherche informatique

2 Pourquoi comparer des séquences? Puisque c est la structure qui prime pour la fonction (cf cours de Maude Pupin)

3 Structure des protéines Structure Structure Structure Structure primaire secondaire tertiaire quaternaire Swissprot: séquences TrEMBL: séquences PDB : 243 structures

4 les programmes de séquençage fournissent des séquences qu il faut annoter ADN traduction protéine potentielle (TrEmbl) protéine (Swissprot) les structures 3D sont longues et coûteuses à déterminer cristallographie, résonnance magnétique nucléaire dans PDB, toutes les protéines avec plus de 25 % d identité partagent la même structure PDB: Protein Data Bank - banque de structures de protéines résolues expérimentalement

5 Alignement 2 à 2 : Amélioration du modèle avec le traitement des gaps Gap: succession de délétions ou d insertions Un gap correspond à un seul événement mutationnel. Ouv : pénalité d ouverture de gap Ext : pénalité d extension de gap Anciennes pénalités Nouvelles pénalités T C A G A C G A G T C T C A G A C G A G T C T C G G A _ G C _ T G T C G G A G C T G

6 Pénalités de gaps linéaires toutes les positions sont indépendantes (dépendance d ordre 0) Pénalités de gaps affines le score d une position dépend de la position précédente (dépendance d ordre 1) Ext Insertion Ouv+Ext Ouv+Ext Délétion Ext Ouv+Ext s s Ouv+Ext Substitution s

7 Algorithme Trois tables : a(i, j) score maximal d un alignement entre U(1..i) et V (1..j) qui termine par un match ou un mismatch entre U(i) et V (j) b(i, j) score maximal d un alignement entre U(1..i) et V (1..j) qui termine par l insertion de V (j) c(i, j) score maximal d un alignement entre U(1..i) et V (1..j) qui termine par la délétion de U(i)

8 Formules de récurrence Ouv : pénalité d ouverture de gap Ext : pénalité d extension de gap a(i, j) = Sub(i, j) + max a(i 1, j 1) b(i 1, j 1) c(i 1, j 1) b(i, j) = max Ouv + Ext + a(i, j 1) Ext + b(i, j 1) Ouv + Ext + c(i, j 1) c(i, j) = max Ouv + Ext + a(i 1, j) Ouv + Ext + b(i 1, j) Ext + c(i 1, j)

9 Initialisation a(0, 0) = 0 a(i, 0) = a(0, j) = b(i, 0) = b(0, j) = Ouv + Ext j c(i, 0) = Ouv + Ext i c(0, j) =

10 Exemple : EAGAWGHE et PAWHEAE score des substitutions : A E G H P W A E G H P 10 4 W 15 pénalités d ouverture de gaps : -10 pénalités d extension : -2 alignement global avec gaps affines optimal: E A G A W G H - E P - - A W H E A E

11 a (... substitution) b (... insertion) c (... délétion) E A G A W G H E 0 P A W H E A E E A G A W G H E 0 P A W H E A E E A G A W G H E P A W H E A E

12 BLAST Basic Local Alignment Search Tool Altschul et al

13 Programme pour la recherche de similarités dans de grandes banques de données EMBL, Swissprot,... Utilise un algorithme heuristique linéaire pour l alignement local : Ne s intéresse qu aux séquences avec un fort taux de similarité BLAST ne construit pas un alignement avec toutes les séquences de la banque. Tire parti du caractère biologique des séquences Des séquences similaires ont des segments communs de taille k quasi-identiques. Par défaut : ADN k=11 ou 13, protéines k=3

14 Table de hachage k-mers : mots de longueur k Fonction de hachage (pour l ADN): e : {A, C, G, T } {0, 1, 2, 3} H(i) = k 1 j=0 e(a i+j)4 k j 1 H(i + 1) = 4 H(i) + e(a i+k ) mod 4 k Exemple : 5-mers de AGT ACCGAA A G T A C C G A A

15 Étape 0: Pré-traitement de la banque de données : indexation de tous les k-mers 4 11 = << taille de la banque de données Étape 1: Construction d une table de hachage recensant tous les mots de longueurs k apparaissant dans la séquence requête avec un score > T.

16 Étape 2: Localisation des k-mers dans la banque de données HSP : High Scoring Pairs Étape 3 : Extension de ces points d ancrage de proche en proche, pour avoir un score significatif.

17 Query= Felis catus DRD4 gene fordopamine receptor D4 (276 letters) Database: All GenBank+EMBL+DDBJ+PDB sequences 1,174,453 sequences; 5,001,591,585 total letters Sequences producing significant alignments: Score E (bits) Value gi AB Felis catus DRD4 gene f e-52 gi AB Nyctereutes procyonoide e-36 gi AB Canis lupus DRD4 gene f e-36 gi AB Bos taurus DRD4 gene fo e-31 gi Homo sapiens Dopamine D4 recep e-29

18 ALIGNMENTS >gi dbj AB AB Nyctereutes procyonoides DRD4 gene fordopamine receptor D4. Length = 393 Score = 157 bits (79), Expect = 7e-36 Identities = 94/99 (94%) Strand = Plus / Plus Query 1 ttcttcctaccctgcccgctcatgctgctgctctactgggccacgttcc 48 Sbjct 1 ttcttcctaccctgcccgctcatgctgctgctctactgggccacgttcc 48 Query 49 ggggcctgcggcgctgggaggcggctcgccaggccaagctgcactgccgg 99 Sbjct 49 ggggcctgcggcgctgggaggccgcgcgtcgggccaagctgcacggccgg 99 Score = 107 bits (54), Expect = 5e-21 Identities = 60/62 (96%) Strand = Plus / Plus Query 215 ggaggcgcgccaagatcaccggccgggagcgcaaggccatgagggtcct 252 Sbjct 332 ggagacgcgccaagatcacgggccgggagcgcaaggccatgagggtcct 379 Query 253 tgccggtggtggtc 276 Sbjct 380 tgccggtggtggtc 393

19 >gi AB Hylobates pileatus gene for dopamine receptor D4, partial cds, drd4, 7-repeat allele. Length = 507 Score = 42.1 bits (21), Expect = 0.27 Identities = 45/53 (84%) Strand = Plus / Plus 52 ggcctgcggcgctgggaggcggctcgccaggccaagctgcactgccgggcgcc ggcctgcagcgctgggaggtggcacgtcgcgccaagctgcacggccgcgcgcc 56

20 Alignement Felis Catus/ Nyctereute 1 ttcttcctaccctgcccgctcatgctgctgctctactgggccacgttccggggcctgcgg 60 1 ttcttcctaccctgcccgctcatgctgctgctctactgggccacgttccggggcctgcgg cgctgggaggcggctcgccaggccaagctgcactgccgggcgcctcgtcggcccagcggc cgctgggaggccgcgcgtcgggccaagctgcacggccggacaccgcgcagacccagcggc cccggcccaccgccccccga.ggt...c cccggcccgccaccccccgacggtacccccggccccccgccccccgacggcagccccgac ggcgagc ggc.agcccggacggcacccccggcccgccgccccccgacggcacccccgatgacacccc cccccgacgccgtcgcgccccccgacgccgt cgacgccaccccctgccccccgccccccgcccccgacgccgccgcgccccccgccgccga cccagccgagccgccgcggcaggcacccaggaggaggcgcgccaagatcaccggccggga ccctgcggagcccccgtggcagccacgcaagcggagacgcgccaagatcacgggccggga gcgcaaggccatgagggtcctgccggtggtggtc gcgcaaggccatgagggtcctgccggtggtggtc 393

21 AB (horizontal) vs. AB (vertical)

22 Significativité de l alignement : E-valeur E(S,n,m): Nombre moyen d alignements ayant un score supérieur ou égal à S quand on cherche dans une banque de taille m avec une séquence requête de longueur n. décrit le bruit aléatoire qui existe lorsque on aligne des séquences croit de manière proportionnelle en fonction de n et de m décroit de manière exponentielle en fonction du score S plus la E-valeur est proche de 0, plus la similarité est significative

23 Query= actgagcatagctgga (16 letters) Database: All GenBank+EMBL+DDBJ+PDB sequences 1,174,453 sequences; 5,001,591,585 total letters Sequences producing significant alignments: Score E (bits) Value gi AC Mus musculus chromosome gi AC Homo sapiens BAC clone gi AC Canis familiaris clone gi AF Homo sapiens chromosome ALIGNMENTS >gi AC Mus musculus chromosome 10 clone. Length = Query: 1 actgagcatagctgga 16 Sbjct: actgagcatagctgga >gi gb AC Homo sapiens BAC clone Length = Query: 1 actgagcatagctgg 15 Sbjct: actgagcatagctgg 48164

24 Query= actgagcatagctggac (17 letters) Database: All GenBank+EMBL+DDBJ+PDB sequences 1,174,453 sequences; 5,001,591,585 total letters Sequences producing significant alignments: Score E (bits) Value gi AC Mus musculus chromosome gi AL Human DNA sequence fro gi AC Homo sapiens BAC clone ALIGNMENTS >gi AC Mus musculus chromosome 10 clone Query: 1 actgagcatagctggac 17 Sbjct: actgagcatagctggac >gi Human DNA sequence >gi AC Homo sapiens BAC clone Query: 2 ctgagcatagctggac 17 Query: 1 actgagcatagctgg 15 Sbjct: ctgagcatagctggac Sbjct: ctgagcatagctggac 21079

25 Query= actgagcatagctggat (17 letters) Database: All GenBank+EMBL+DDBJ+PDB sequences 1,174,453 sequences; 5,001,591,585 total letters Sequences producing significant alignments: Score E (bits) Value gi AC Mus musculus chromosome 10 c gi AC Homo sapiens BAC clone gi AF Sulfolobus solfataricus ALIGNMENTS >gi AC Mus musculus chromosome 10 clone Query: 1 actgagcatagctgga 16 Sbjct: actgagcatagctgga >gi AC Homo sapiens BAC clone Query: 1 actgagcatagctgg 15 Sbjct: actgagcatagctgg 48164

26 Query= actgagcatag (11 letters) Database: All GenBank+EMBL+DDBJ+PDB sequences 1,174,453 sequences; 5,001,591,585 total letters No significant similarity found.

27 E-value 1000 Query= actgagcatag (11 letters) Database: All GenBank+EMBL+DDBJ+PDB sequences 1,174,453 sequences; 5,001,591,585 total letters Sequences producing significant alignments: Score E (bits) Value gi AC Homo sapiens chromosome 16 clo gi NM_ Danio rerio endothelin recept gi AC Homo sapiens BAC clone gi AC Mus musculus clone rp23-422n gi AP Pyrococcus horikoshii OT gi Drosophila melanogaster ALIGNMENTS >gi AC Homo sapiens chromosome 16 clone Length = Query: 1 actgagcatag 11 Sbjct: actgagcatag 78811

28 Génome de la drosophile Query= actgagcatag (11 letters) Database: D. melanogaster genomic nucleotide sequences 1170 sequences; 122,655,632 total letters Sequences producing significant alignments: Score E (bits) Value gi AE Drosophila melanogaster g gi AE Drosophila melanogaster g gi AE Drosophila melanogaster g gi AE Drosophila melanogaster g gi AE Drosophila melanogaster g ALIGNMENTS >gi gb AE AE Drosophila melanogaster genomic scaffold Query: 1 actgagcatag 11 Sbjct: actgagcatag 17844

29 Les différentes versions de BLAST BLASTN : séquences nucléiques BLASTP : séquences protéiques BLASTX : une séquence nucléique comparée à une base de données protéique. (Traduction suivant les 6 cadres de lecture.) TBLASTX : une séquence protéique comparée à une base de données nucléique TBLASTN : une séquence nucléique comparée à une base de données nucléiques, chacune suivant tous les cadres de lecture. (Cela revient à faire 36 fois BLASTP.)

Recherche par similarité dans les banques/bases de données La suite Blast (Basic Local Alignment Search Tool)

Recherche par similarité dans les banques/bases de données La suite Blast (Basic Local Alignment Search Tool) Recherche par similarité dans les banques/bases de données La suite Blast (Basic Local Alignment Search Tool) A A C T G G T A A C C G A G C T A C G G T C C G Algorithme de Blast (version 1) (Altschul et

Plus en détail

Programmes de comparaison de banques de données

Programmes de comparaison de banques de données Programmes decomparaison debanquesdedonnées FASTA introduction Programmesdecomparaisonde2séquencestroplongs Méthodesheuristiques But:filtrerparétapessuccessiveslesséquences «intéressantes» Etablissementd'unscorepourclasserlesmeilleuressimilitudes

Plus en détail

La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST.

La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST. La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST. Gaël Le Mahec - p. 1/12 L algorithme BLAST. Basic Local Alignment Search Tool est un algorithme de recherche

Plus en détail

Module Analyse de Génomes 2011-2012 Master 2 module FMBS 326 Immunoinformatique

Module Analyse de Génomes 2011-2012 Master 2 module FMBS 326 Immunoinformatique Module Analyse de Génomes 2011-2012 Master 2 module FMBS 326 Immunoinformatique Planning du Module : Date Heure Salle 12/12 9h-12h TD info TA1Z bat 25 13h-17h TD info TA1Z bat 25 13/12 9h-12h TD info TA1Z

Plus en détail

GMIN206 TD Banques de données biologiques Interrogation des banques via GQuerry et Formats de fichiers de séquences

GMIN206 TD Banques de données biologiques Interrogation des banques via GQuerry et Formats de fichiers de séquences GMIN206 TD Banques de données biologiques Interrogation des banques via GQuerry et Formats de fichiers de séquences 1. Interrogation des banques via GQuerry 1.1 Rappel De manière concrère, l interrogation

Plus en détail

Prédiction de gènes. La localisation des gènes. Quel est le point de départ? Une idée naïve : les phases ouvertes de lecture

Prédiction de gènes. La localisation des gènes. Quel est le point de départ? Une idée naïve : les phases ouvertes de lecture La localisation des gènes Prédiction de gènes Crs de présentation des tils bio-informatiques pr la localisation puis l'étude des gènes C'est la première étape pr interpréter un génome Distinction entre

Plus en détail

Transformée de Burrows-Wheeler et mapping de données RNA-seq

Transformée de Burrows-Wheeler et mapping de données RNA-seq Transformée de Burrows-Wheeler et mapping de données RNA-seq MAPPI, journée indexation 6 juin 2011 Introduction Indexation But : Recherche rapide d'une information dans de grands volumes de données Indexation

Plus en détail

Annotation in silico de séquences biologiques

Annotation in silico de séquences biologiques Annotation in silico de séquences biologiques Carl Herrmann TAGC Inserm U928 Université de la Méditerranée carl.herrmann@univmed.fr Pourquoi Diana est-elle ce qu'elle est...? génotype = l'information génétique

Plus en détail

La Génomique Biologie, informatique, évolution. Hugues Roest Crollius hrc@ens.fr Dyogen Group L3 Introduction aux sciences du vivant 03.12.

La Génomique Biologie, informatique, évolution. Hugues Roest Crollius hrc@ens.fr Dyogen Group L3 Introduction aux sciences du vivant 03.12. La Génomique Biologie, informatique, évolution Hugues Roest Crollius hrc@ens.fr Dyogen Group L3 Introduction aux sciences du vivant 03.12.2013 La «génomique fonctionnelle» La «génomique évolutive» human

Plus en détail

ALIGNEMENT PLUS RAPIDE

ALIGNEMENT PLUS RAPIDE ALIGNEMENT PLUS RAPIDE 1. méthodes heuristiques : hachage, arbres de suffixe, PD limitée (taille totale de trous bornée) 2. PD éparse (pour sous-séquence commune ou chaînage en alignement global heuristique)

Plus en détail

Initiation à la Bioinformatique Daniel Gautheret ESIL, Université de la Méditerranée

Initiation à la Bioinformatique Daniel Gautheret ESIL, Université de la Méditerranée Initiation à la Bioinformatique Daniel Gautheret ESIL, Université de la Méditerranée V.2004.4 http://www.esil.univ-mrs.fr/~dgaut/cours Bioinformatique Deux définitions possibles Applications de l informatique

Plus en détail

Biologie «in silico» Adapté de Pierre Vincens

Biologie «in silico» Adapté de Pierre Vincens Biologie «in silico» Adapté de Pierre Vincens Bioinformatique Association de la biologie et de l'informatique Objectifs : Analyser, modéliser ou prédire les informations issues de données biologiques expérimentales

Plus en détail

Recherche d homologies

Recherche d homologies Recherche d homologies Soluscience Guillaume Chakroun guillaume chakroun@hotmail.com Copyright c 2004 Guillaume Chakroun TABLE DES MATIÈRES Table des matières 1 Introduction 4 2 Les systèmes de scores

Plus en détail

TD5 : Prédiction de la structure tridimensionnelle d une protéine Modélisation moléculaire

TD5 : Prédiction de la structure tridimensionnelle d une protéine Modélisation moléculaire TD5 : Prédiction de la structure tridimensionnelle d une protéine Modélisation moléculaire Vous aurez besoin des programmes suivant : d un éditeur de séquence d un visualiseur de structure 3D (PyMOL) Avant-propos

Plus en détail

Anne-Aurélie RAYMOND. Journée scientifique «Data Mining of OMICs Data» 5 février 2015

Anne-Aurélie RAYMOND. Journée scientifique «Data Mining of OMICs Data» 5 février 2015 Anne-Aurélie RAYMOND Journée scientifique «Data Mining of OMICs Data» 5 février 2015 Présentation générale Fiches techniques des protéines Analyse automatique d un set de data «omique» Par grandes fonctions

Plus en détail

Corrigé Contrôle terminal : Bioanalyse (EL6BIOFM) 6 mai 2014

Corrigé Contrôle terminal : Bioanalyse (EL6BIOFM) 6 mai 2014 Corrigé Contrôle terminal : Bioanalyse (EL6BIOFM) 6 mai 2014 Exercice 1 (4,5 points) 1. Donner la définition de l acronyme BLAST. (0,5 pt) : Basic Local Alignment Search Tool 2. Expliquer les principes

Plus en détail

Big data et sciences du Vivant L'exemple du séquençage haut débit

Big data et sciences du Vivant L'exemple du séquençage haut débit Big data et sciences du Vivant L'exemple du séquençage haut débit C. Gaspin, C. Hoede, C. Klopp, D. Laborie, J. Mariette, C. Noirot, MS. Trotard bioinfo@genopole.toulouse.inra.fr INRA - MIAT - Plate-forme

Plus en détail

Étude de la biodiversité fongique à l aide de techniques de pyroséquençage

Étude de la biodiversité fongique à l aide de techniques de pyroséquençage Étude de la biodiversité fongique à l aide de techniques de pyroséquençage Biodiversité fongique Biodiversité: diversité spécifique d une communauté écologique, correspondant au nombre d espèces et à leur

Plus en détail

Bioinformatique. Ressources et banques de données internationales

Bioinformatique. Ressources et banques de données internationales Bioinformatique Ressources et banques de données internationales Frédéric Lecerf frederic.lecerf@agrocampus-ouest.fr UMR PEGASE Equipe Génétique & Génomique Bioinformatique Plan du module 1. Présentation

Plus en détail

L ADN. Schématisez un nucléotide et un nucléoside en précisant sur quel carbone du sucre se font les différents assemblages :

L ADN. Schématisez un nucléotide et un nucléoside en précisant sur quel carbone du sucre se font les différents assemblages : L ADN. I. GENERALITES. A. Les caractéristiques de l ADN. Donnez les 6 caractéristiques de l ADN : B. Les nucléotides/nucléosides : Schématisez un nucléotide et un nucléoside en précisant sur quel carbone

Plus en détail

Perl Orienté Objet BioPerl There is more than one way to do it

Perl Orienté Objet BioPerl There is more than one way to do it Perl Orienté Objet BioPerl There is more than one way to do it Bérénice Batut, berenice.batut@udamail.fr DUT Génie Biologique Option Bioinformatique Année 2014-2015 Perl Orienté Objet - BioPerl Rappels

Plus en détail

Plus courts chemins, programmation dynamique

Plus courts chemins, programmation dynamique 1 Plus courts chemins, programmation dynamique 1. Plus courts chemins à partir d un sommet 2. Plus courts chemins entre tous les sommets 3. Semi-anneau 4. Programmation dynamique 5. Applications à la bio-informatique

Plus en détail

Bioinformatique BTV Alignement de Séquences

Bioinformatique BTV Alignement de Séquences 1 / 60 Bioinformatique BTV Alignement de Séquences Jean-Michel Richer jean-michel.richer@univ-angers.fr http://www.info.univ-angers.fr/pub/richer Juillet 2008 2 / 60 Plan Plan 1 Rappels 2 Alignement multiple

Plus en détail

Sommaire. A) Méthode de contrôle manuel des résultats produits par GLADX

Sommaire. A) Méthode de contrôle manuel des résultats produits par GLADX Sommaire Définitions et abréviations Résumé Introduction I. Matériel II. Méthode A) Méthode de contrôle manuel des résultats produits par GLADX B) Comparaison des résultats de l outil GLADX avec les résultats

Plus en détail

TD Bioinformatique : Sequence Alignment. Pourquoi faire une recherche par similarité?

TD Bioinformatique : Sequence Alignment. Pourquoi faire une recherche par similarité? TD Bioinformatique : Sequence lignment Pourquoi faire une recherche par similarité? - Savoir si ma séquence ressemble à d'autres déjà connues. - Trouver toutes les séquences d'une même famille. - Rechercher

Plus en détail

PRÉSENTATION DE LA BIOINFORMATIQUE

PRÉSENTATION DE LA BIOINFORMATIQUE PRÉSENTATION DE LA BIOINFORMATIQUE O. Collin CNRS IRISA GenOuest 7 octobre 2013 Warming session Poser le décor pour les 3 jours Mise en évidence et mise en relation des éléments clés Réflexions sur quelques

Plus en détail

Analyse des génomes. Module de Bioinformatique Appliquée. A. Les projets Génome : a) Qu est-ce qu un projet génome? Cours Analyse des génomes

Analyse des génomes. Module de Bioinformatique Appliquée. A. Les projets Génome : a) Qu est-ce qu un projet génome? Cours Analyse des génomes Module de Bioinformatique Appliquée GB3-2012 Cours Analyse des génomes 0 Analyse des génomes 1 Les objectifs des projets génomes sont : Assemblagedes cartes physiques et génétiques sur le génome de l organisme

Plus en détail

Séquençage haut débit 5 mars 26 mars (14h) C. Gaspin, C. Klopp, J. Mariette & G. Salin

Séquençage haut débit 5 mars 26 mars (14h) C. Gaspin, C. Klopp, J. Mariette & G. Salin Séquençage haut débit 5 mars 26 mars (14h) C. Gaspin, C. Klopp, J. Mariette & G. Salin Plan de la session Bioinformatique & séquençage haut débit Date Intervenant (s) Libellé 05/03 G. Salin Introduction

Plus en détail

Base de données bibliographiques Pubmed-Medline

Base de données bibliographiques Pubmed-Medline Chapitre 1 ; Domaine 1 ; Documentation ; Champs référentiels 1.1.1, 1.1.2 et 1.1.3 Base de données bibliographiques Pubmed-Medline D r Patrick Deschamps,, 30 mai 2007 PLAN C2i métiers de la santé Introduction

Plus en détail

makeblastdb in genome.fasta dbtype nucl title nom_genome out nom_genome_blastdb

makeblastdb in genome.fasta dbtype nucl title nom_genome out nom_genome_blastdb Note du 19 mai 2011 La version de BLAST utilisée dans ce document de mars 2010 est obsolète. Les nouveaux utilisateurs de BLAST devraient directement apprendre et utiliser les commandes BLAST+. L'intégralité

Plus en détail

Les microarrays: technologie pour interroger le génome

Les microarrays: technologie pour interroger le génome Les microarrays: technologie pour interroger le génome Patrick DESCOMBES patrick.descombes@frontiers-in-genetics.org Plate forme génomique NCCR Frontiers in Genetics Université de Genève http://genomics.frontiers-in-genetics.org

Plus en détail

Recherche dans les banques d ADN par indexation parallèle

Recherche dans les banques d ADN par indexation parallèle Recherche dans les banques d ADN par indexation parallèle Van Hoa Nguyen Institut Francophone d Informatique Hanoi, Vietnam Email: nvhoa@ifi.edu.vn Dominique Lavenier CNRS / IRISA Rennes, France Email:

Plus en détail

AutoGRAPH Un serveur pour automatiser et visualiser la comparaison de génomes: Application à l identification de nouveaux gènes chez le chien.

AutoGRAPH Un serveur pour automatiser et visualiser la comparaison de génomes: Application à l identification de nouveaux gènes chez le chien. AutoGRAPH Un serveur pour automatiser et visualiser la comparaison de génomes: Application à l identification de nouveaux gènes chez le chien. Thomas DERRIEN CNRS-UMR6061 Génétique et Développement Université

Plus en détail

ARN et bioinformatique: PDF processed with CutePDF evaluation edition www.cutepdf.com

ARN et bioinformatique: PDF processed with CutePDF evaluation edition www.cutepdf.com ARN et bioinformatique: Partie 1 PDF processed with CutePDF evaluation edition www.cutepdf.com Sommaire Principes biologiques : Transcription/traduction, types d ARN, formes primaires/secondaires. Zuker

Plus en détail

Méthodes de distances Formation CNRS «Phylogénie moléculaire»

Méthodes de distances Formation CNRS «Phylogénie moléculaire» Méthodes de distances Formation CNRS «Phylogénie moléculaire» Guy Perrière Laboratoire de Biométrie et Biologie Évolutive UMR CNRS n 5558 Université Claude Bernard Lyon 1 2 mars 213 Guy Perrière (BBE)

Plus en détail

Plateforme de Recherche de Mutations

Plateforme de Recherche de Mutations Plateforme de Recherche de Mutations Jean-Marc Aury contact: pfm@genoscope.cns.fr 29 janvier 2009 Introduction Présentation des données produites par le GSFLX : type, qualité, Méthodes de détection de

Plus en détail

c) Calculer MP. 3) Déterminer l'arrondi au degré de la mesure de Dˆ.

c) Calculer MP. 3) Déterminer l'arrondi au degré de la mesure de Dˆ. Exercice :(Amiens 1995) Les questions 2, 3 et 4 sont indépendantes. L'unité est le centimètre. 1) Construire un triangle MAI rectangle en A tel que AM = 8 et IM = 12. Indiquer brièvement les étapes de

Plus en détail

Progenesis LC-MS and Phenyx

Progenesis LC-MS and Phenyx Progenesis LC-MS and Phenyx Une combinaison unique d un logiciel d analyse différentielle en LC-MS et d une plateforme d identification et de caractérisation de protéines et peptides à partir de données

Plus en détail

Méthodologie de mise en oeuvre de workflows scientifiques

Méthodologie de mise en oeuvre de workflows scientifiques Méthodologie de mise en oeuvre de workflows scientifiques Yuan Lin yuan.lin@supagro.inra.fr UMR MISTEA INRA, SupAgro, Montpellier!2 Contexte & Objectif Divers domaines scientifiques Ressources existantes

Plus en détail

VI. Domaines protéiques

VI. Domaines protéiques Chapitre 1 Structure des protéines I. Rappels Définitions II. La Protein Data Bank (PDB) III. Angles dièdres et diagramme de ramachandran IV. Structures secondaires V. Structures supersecondaires VI. Domaines

Plus en détail

DB Main Bien débuter.

DB Main Bien débuter. DB Main Bien débuter. Downloader depuis http://www.info.fundp.ac.be/~dbm/ L élaboration d une base de données se fait en 4 étapes : 1. L analyse conceptionnelle 2. Le MCD modèle conceptuel de données.

Plus en détail

Master research Internship. Rapport bibliographique. Comparaison massive et multiple de métagénomes non assemblés

Master research Internship. Rapport bibliographique. Comparaison massive et multiple de métagénomes non assemblés Master research Internship Rapport bibliographique Comparaison massive et multiple de métagénomes non assemblés Auteur : Guillaume Holley Encadrant : Pierre Peterlongo GenScale Résumé La nature est d une

Plus en détail

Optimisation des performances du programme mpiblast pour la parallélisation sur grille de calcul

Optimisation des performances du programme mpiblast pour la parallélisation sur grille de calcul Optimisation des performances du programme mpiblast pour la parallélisation sur grille de calcul Mohieddine MISSAOUI * Rapport de Recherche LIMOS/RR-06-10 20 novembre 2006 * Contact : missaoui@isima.fr

Plus en détail

Analyse de Séquences M1 BIBS. 2 e partie. http://rna.igmors.u-psud.fr/gautheret/cours/ V. 2012.1

Analyse de Séquences M1 BIBS. 2 e partie. http://rna.igmors.u-psud.fr/gautheret/cours/ V. 2012.1 Analyse de Séquences M1 BIBS 2 e partie http://rna.igmors.u-psud.fr/gautheret/cours/ V. 2012.1 1 Les programmes Génome 2 Les programmes Génome Préhistoire Séquençage de Sanger Avant le séquençage d organismes:

Plus en détail

BIN 1002: INTÉGRATION BIOSCIENCES/INFORMATIQUE

BIN 1002: INTÉGRATION BIOSCIENCES/INFORMATIQUE BIN 1002: INTÉGRATION BIOSCIENCES/INFORMATIQUE Plan de Cours Automne 2015 Professeurs: Sylvie Hamel, Département d Informatique et de Recherche Opérationnelle Guillaume Lettre, Institut de Cardiologie

Plus en détail

Introduction aux bases de données: application en biologie

Introduction aux bases de données: application en biologie Introduction aux bases de données: application en biologie D. Puthier 1 1 ERM206/Technologies Avancées pour le Génome et la Clinique, http://tagc.univ-mrs.fr/staff/puthier, puthier@tagc.univ-mrs.fr ESIL,

Plus en détail

Cours d introduction à la génétique de la souris Notion de Souche

Cours d introduction à la génétique de la souris Notion de Souche Cours d introduction à la génétique de la souris Notion de Souche Introduction: - Réponse d un animal à l expérimentation (diapo 1) Facteurs environnementaux et propres à l animal - Notion d animal standardisé

Plus en détail

Fida KHATER & Abdoulaziz MOUSSA 03 mars 2012 - Journée Portes Ouvertes à l'um2

Fida KHATER & Abdoulaziz MOUSSA 03 mars 2012 - Journée Portes Ouvertes à l'um2 DEVELOPPEMENT D UNE INTERFACE GRAPHIQUE : LOCAL WEB GUI FOR BLAST (LWBG), POUR LES TRAITEMENTS DE DONNEES BIOLOGIQUES Fida KHATER & Abdoulaziz MOUSSA 03 mars 2012 - Journée Portes Ouvertes à l'um2 Plan

Plus en détail

Guide de référence du logiciel MiSeq Reporter pour les tests IVD

Guide de référence du logiciel MiSeq Reporter pour les tests IVD Guide de référence du logiciel MiSeq Reporter pour les tests IVD DESTINÉ AU DIAGNOSTIC IN VITRO UNIQUEMENT EXCLUSIF À ILLUMINA Nº 15038356 Rév. A FRA Mars 2014 Ce document et son contenu sont exclusifs

Plus en détail

Introduc)on à Ensembl/ Biomart : Par)e pra)que

Introduc)on à Ensembl/ Biomart : Par)e pra)que Introduc)on à Ensembl/ Biomart : Par)e pra)que Stéphanie Le Gras Jean Muller NAVIGUER DANS ENSEMBL : PARTIE PRATIQUE 2 Naviga)on dans Ensembl : Pra)que Exercice 1 1.a. Quelle est la version de l assemblage

Plus en détail

Limitations of the Playstation 3 for High Performance Cluster Computing

Limitations of the Playstation 3 for High Performance Cluster Computing Introduction Plan Limitations of the Playstation 3 for High Performance Cluster Computing July 2007 Introduction Plan Introduction Intérêts de la PS3 : rapide et puissante bon marché L utiliser pour faire

Plus en détail

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq Présenté par Xi LIU ATCGCGCTAGCTGGTGTATCGCATCGCGCTAGCTGGTGTATCGCGCTAGCTGGTGTATCGCGCTAGCCTGGTGTATCGCCATCGCGCTAGCTGGCGCTAGCTGAATCGCGCATATG 17 Septembre 2013 Homéoallèles Génome Normalisation Analyse différentielle

Plus en détail

TP BIOINFORMATIQUE Bases de Données relationnelles

TP BIOINFORMATIQUE Bases de Données relationnelles TP BIOINFORMATIQUE Bases de Données relationnelles Objectif : Construire et utiliser une base de données relationnelle simple. Déroulement : Ce TP se déroulera sur 2 séances. 1. Modélisation simplifiée

Plus en détail

Guide de configuration TWIN31 SESAM VITALE. Logiciel EI96 v3.31

Guide de configuration TWIN31 SESAM VITALE. Logiciel EI96 v3.31 Guide de configuration TWIN31 SESAM VITALE Logiciel EI96 v3.31 Ingenico 190 192 avenue Charles de Gaulle 92200 Neuilly sur Seine Tél. 33(0)1 46 25 82 00 Fax 33 (0)1 47 72 56 95 ingenico@ingenico.com SOMMAIRE

Plus en détail

revue de littérature - corpus comparables

revue de littérature - corpus comparables revue de littérature - corpus comparables Julie Roy April 23, 2015 Université de Montréal Introduction Matière première MT : corpus parallèles. Intérêt des corpus comparables : corpus parallèles et dictionnaires

Plus en détail

15 septembre 2010. Démo #2 MySQL Séquençage

15 septembre 2010. Démo #2 MySQL Séquençage 15 septembre 2010 Démo #2 MySQL Séquençage SQL et MySQL SQL: structured query language langage pour manipuler des données dans des bases de données relationnelles MySQL: Implantation de SQL Ajout à SQL

Plus en détail

ESSEC. Cours «Management bancaire» Séance 3 Le risque de crédit Le scoring

ESSEC. Cours «Management bancaire» Séance 3 Le risque de crédit Le scoring ESSEC Cours «Management bancaire» Séance 3 Le risque de crédit Le scoring Les méthodes d évaluation du risque de crédit pour les PME et les ménages Caractéristiques Comme les montants des crédits et des

Plus en détail

MABioVis. Bio-informatique et la

MABioVis. Bio-informatique et la MABioVis Modèles et Algorithmes pour la Bio-informatique et la Visualisation Visite ENS Cachan 5 janvier 2011 MABioVis G GUY MELANÇON (PR UFR Maths Info / EPI GRAVITE) (là, maintenant) - MABioVis DAVID

Plus en détail

Exemples de problèmes et d applications. INF6953 Exemples de problèmes 1

Exemples de problèmes et d applications. INF6953 Exemples de problèmes 1 Exemples de problèmes et d applications INF6953 Exemples de problèmes Sommaire Quelques domaines d application Quelques problèmes réels Allocation de fréquences dans les réseaux radio-mobiles Affectation

Plus en détail

CHAPITRE 3 LA SYNTHESE DES PROTEINES

CHAPITRE 3 LA SYNTHESE DES PROTEINES CHAITRE 3 LA SYNTHESE DES ROTEINES On sait qu un gène détient dans sa séquence nucléotidique, l information permettant la synthèse d un polypeptide. Ce dernier caractérisé par sa séquence d acides aminés

Plus en détail

Mise en place du NGS en routine diagnostic - Validation, Organisation, Développements

Mise en place du NGS en routine diagnostic - Validation, Organisation, Développements Mise en place du NGS en routine diagnostic - Validation, Organisation, Développements Atelier sur le Diagnostic Moléculaire de la Mucoviscidose 2014 - Lille Stratégie analytique Préparation library (1,5

Plus en détail

Apprentissage d automates sur les protéines

Apprentissage d automates sur les protéines Apprentissage d automates sur les protéines Approche par fusion de fragments significativement similaires (Jobim 04) François Coste, Goulven Kerbellec, Boris Idmont, Daniel Fredouille Christian Delamarche

Plus en détail

MASTER «IN SILICO DRUG DESIGN» (2015-2016) Semestre 2 - Spécialité MMis - MACROMOLECULES BIOLOGIQUES Université Paris Diderot

MASTER «IN SILICO DRUG DESIGN» (2015-2016) Semestre 2 - Spécialité MMis - MACROMOLECULES BIOLOGIQUES Université Paris Diderot MASTER «IN SILICO DRUG DESIGN» (2015-2016) Semestre 2 - Spécialité MMis - MACROMOLECULES BIOLOGIQUES Université Paris Diderot UE1 PROGRAMMATION EN DRUG DESIGN (7 ECTS) Responsable : O. TABOUREAU EC1 -

Plus en détail

Travaux Pratiques de Métagénomique

Travaux Pratiques de Métagénomique Travaux Pratiques de Métagénomique Comparaison des métagénomes intestinaux de patients en rémission d infection chroniques de l intestin et d individus sains 1 Introduction Bérénice Batut berenice.batut@udamail.fr

Plus en détail

UV Théorie de l Information. Codes à longueur variable

UV Théorie de l Information. Codes à longueur variable Cours n 5 : UV Théorie de l Information Compression de l information : Codage de source sans distorsion Ex 1 : Code de Shannon Fano Ex 2 : Code de Huffman Ex 3 : Codage par plage Ex 4 : Codage de Lempel

Plus en détail

Fiche technique : utilisation d Anagène (logiciel d étude des données moléculaires).

Fiche technique : utilisation d Anagène (logiciel d étude des données moléculaires). Fiche technique : utilisation d Anagène (logiciel d étude des données moléculaires). Objectifs de la fiche : 1. Ouvrir des séquences (ADN ou protéine). 2. Changer de règle de numérotation & faire apparaître

Plus en détail

GENETIQUE. la division cellule. durant la division cellule. Ai Aristote Mendel. Platon. Information génétique. Chromosome

GENETIQUE. la division cellule. durant la division cellule. Ai Aristote Mendel. Platon. Information génétique. Chromosome Molécules ADN Division cellulaire Synthèse des protéines. En Lien: Campbell, Reece,2déd./Biologie./chap.13 1 En Lien: Campbell, Reece,2déd./Biologie./chap.13 2 1 Chromosome Phénotype: l'apparence : structures

Plus en détail

Séquence 6. Mais ces espèces pour autant ne sont pas identiques et parfois d ailleurs ne se ressemblent pas vraiment.

Séquence 6. Mais ces espèces pour autant ne sont pas identiques et parfois d ailleurs ne se ressemblent pas vraiment. Sommaire Séquence 6 Nous avons vu dans les séances précédentes qu au cours des temps géologiques des espèces différentes se sont succédé, leur apparition et leur disparition étant le résultat de modifications

Plus en détail

Identification de nouveaux membres dans des familles d'interleukines

Identification de nouveaux membres dans des familles d'interleukines Identification de nouveaux membres dans des familles d'interleukines Nicolas Beaume Jérôme Mickolajczak Gérard Ramstein Yannick Jacques 1ère partie : Définition de la problématique Les familles de gènes

Plus en détail

Modélisation coalescente pour la détection précoce d un cancer

Modélisation coalescente pour la détection précoce d un cancer Modélisation coalescente pour la détection précoce d un cancer Mathieu Emily 27 Novembre 2007 Bioinformatics Research Center - Université d Aarhus Danemark Mathieu Emily Coalescence et cancer 1 Introduction

Plus en détail

PARTIE 1 : ACTIVITÉS NUMÉRIQUES (12 points)

PARTIE 1 : ACTIVITÉS NUMÉRIQUES (12 points) COLLÈGE LA PRÉSENTATION BREVET BLANC Février 2011 ÉPREUVE DE MATHÉMATIQUES Classe de 3 e Durée : 2 heures Présentation et orthographe : 4 points Les calculatrices sont autorisées, ainsi que les instruments

Plus en détail

Génie de la biocatalyse et génie des procédés. «Production d enzymes industrielles»

Génie de la biocatalyse et génie des procédés. «Production d enzymes industrielles» Ministère de l Enseignement Supérieur et de la Recherche Scientifique Université Virtuelle de Tunis Génie de la biocatalyse et génie des procédés «Production d enzymes industrielles» Concepteur du cours:

Plus en détail

Quantification Vectorielle

Quantification Vectorielle Quantification Vectorielle Marco Cagnazzo Département Traitement du Signal et des Images TELECOM ParisTech 14 Décembre 2012 M. Cagnazzo Quantification Vectorielle 1/65 Plan Introduction 1 Introduction

Plus en détail

Polymorphismes de l ADN

Polymorphismes de l ADN Introduction Polymorphismes de l ADN Présentation et mise en évidence Recherche de gènes responsables de maladies génétiques : Analyse de pedigrees où la maladie est présente Sur quel chromosome? À quel

Plus en détail

PROTOCOLE DE DESSIN DES OLIGONUCLEOTIDES LONGS POUR PUCES A ADN. Sommaire

PROTOCOLE DE DESSIN DES OLIGONUCLEOTIDES LONGS POUR PUCES A ADN. Sommaire Sommaire 1. PRINCIPE DE FONCTIONNEMENT:... 2 2. PRE-REQUIS AVANT LE DESSIN DES OLIGONUCLEOTIDES:... 3 2.1 Installation du logiciel OligoArray sur PC:... 3 2.2 Installation du logiciel OligoArray sur Mac:...

Plus en détail

Différentes applications de l oracle des facteurs

Différentes applications de l oracle des facteurs Différentes applications de l oracle des facteurs Thierry Lecroq LITIS Thierry.Lecroq@univ-rouen.fr http://www-igm.univ-mlv.fr/~lecroq en collaboration avec : Joël l Alexandre, Hélène H Dauchel,, Arnaud

Plus en détail

Eléments primordiaux de biologie moléculaire

Eléments primordiaux de biologie moléculaire Eléments primordiaux de biologie moléculaire Pourquoi s intéresser au matériel génétique? Base de l information génétique Tissu Cellule Noyau Organisme entier Lieu où est localisé l ADN Mol d ADN qui est

Plus en détail

Formavie 2010. 2 Différentes versions du format PDB...3. 3 Les champs dans les fichiers PDB...4. 4 Le champ «ATOM»...5. 6 Limites du format PDB...

Formavie 2010. 2 Différentes versions du format PDB...3. 3 Les champs dans les fichiers PDB...4. 4 Le champ «ATOM»...5. 6 Limites du format PDB... Formavie 2010 Les fichiers PDB Les fichiers PDB contiennent les informations qui vont permettre à des logiciels de visualisation moléculaire (ex : RasTop ou Jmol) d afficher les molécules. Un fichier au

Plus en détail

Les technologies de séquençage à haut débit. Patrick Wincker, Genoscope, Institut de Génomique du CEA

Les technologies de séquençage à haut débit. Patrick Wincker, Genoscope, Institut de Génomique du CEA Les technologies de séquençage à haut débit Patrick Wincker, Genoscope, Institut de Génomique du CEA CNG, 12.05.2009 Séquençage Sanger (méthode des dididéoxy terminateurs) : a permis les progrès de la

Plus en détail

Objectifs. Clustering. Principe. Applications. Applications. Cartes de crédits. Remarques. Biologie, Génomique

Objectifs. Clustering. Principe. Applications. Applications. Cartes de crédits. Remarques. Biologie, Génomique Objectifs Clustering On ne sait pas ce qu on veut trouver : on laisse l algorithme nous proposer un modèle. On pense qu il existe des similarités entre les exemples. Qui se ressemble s assemble p. /55

Plus en détail

DEVOIR MAISON 4 : LES VECTEURS

DEVOIR MAISON 4 : LES VECTEURS DEVOIR MAISON 4 : LES VECTEURS Ce devoir maison de révisions, de préparation au DS4 comporte deux pages. Vous traiterez au choix au moins la première ou la deuxième page. Exercice 1. Le plan est muni d

Plus en détail

POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA

POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA Amplification spécifique Détection spécifique Clonage dans des vecteurs Amplification in vitro PCR Hybridation moléculaire - hôte cellulaire

Plus en détail

Utilisation des diagrammes de Voronoï et des algorithmes génétiques pour l'étude des complexes protéine-protéine.

Utilisation des diagrammes de Voronoï et des algorithmes génétiques pour l'étude des complexes protéine-protéine. Utilisation des diagrammes de Voronoï et des algorithmes génétiques pour l'étude des complexes protéine-protéine. Anne Poupon Biologie et Bioinformatique des Systèmes de Signalisation INRA - Nouzilly France

Plus en détail

L'analyse protéomique et les sciences -omiques: des données massives à interpréter et sauvegarder

L'analyse protéomique et les sciences -omiques: des données massives à interpréter et sauvegarder L'analyse protéomique et les sciences -omiques: des données massives à interpréter et sauvegarder Christine CARAPITO, Alexandre BUREL, Patrick GUTERL, Alexandre WALTER, Jérôme PANSANEL, Fabrice VARRIER,

Plus en détail

Chapitre 1 La révolution des sciences de la vie par la génétique

Chapitre 1 La révolution des sciences de la vie par la génétique Chapitre 1 La révolution des sciences de la vie par la génétique Variation génétique de la couleur des grains de maïs. Chaque grain représente un individu de constitution génétique distincte. La sélection

Plus en détail

Architectures parallèles pour la comparaison de séquences biologiques

Architectures parallèles pour la comparaison de séquences biologiques Architectures parallèles pour la comparaison de séquences biologiques D. Lavenier IRISA / NRS ampus de Beaulieu Rennes cedex lavenier@irisa.fr Résumé et article présente plusieurs machines parallèles spécialisées

Plus en détail

I. TOUITOU (Mise ligne 15/10/08 LIPCOM-RM) Faculté de Médecine Montpellier-Nîmes

I. TOUITOU (Mise ligne 15/10/08 LIPCOM-RM) Faculté de Médecine Montpellier-Nîmes er cycle PCEM MI5 Génétique moléculaire et clinique Année Universitaire 008-009 Comment apprécier la composante héréditaire des maladies?. Excès de cas familiaux - Les études familiales - - La plupart

Plus en détail

Baccalauréat Professionnel SYSTÈMES ÉLECTRONIQUES NUMÉRIQUES. Champ professionnel : Alarme Sécurité Incendie SOUS - EPREUVE E12

Baccalauréat Professionnel SYSTÈMES ÉLECTRONIQUES NUMÉRIQUES. Champ professionnel : Alarme Sécurité Incendie SOUS - EPREUVE E12 Baccalauréat Professionnel SYSTÈMES ÉLECTRONIQUES NUMÉRIQUES Champ professionnel : Alarme Sécurité Incendie SOUS - EPREUVE E12 TRAVAUX PRATIQUES SCIENTIFIQUES SUR SYSTÈME Durée 3 heures coefficient 2 Note

Plus en détail

Statistiques Multivariées pour la Bioinformatique. Susan Holmes, Stanford, susan@stat.stanford.edu

Statistiques Multivariées pour la Bioinformatique. Susan Holmes, Stanford, susan@stat.stanford.edu BMM 1 Presentation Statistiques Multivariées pour la Bioinformatique Susan Holmes, Stanford, susan@stat.stanford.edu Specificités de cette classe Les données genetiques sont discretes: comptage. En general

Plus en détail

GMIN206 Info. Biologique et Outils bioinformatiques. Elodie Cassan

GMIN206 Info. Biologique et Outils bioinformatiques. Elodie Cassan M Bioinformatique, Connaissances et Données Année 24-25 GMIN206 Info. Biologique et Outils bioinformatiques Banques de données biologiques (3h de Cours +,5h de TD + 4h de TP) Elodie Cassan Anne-Muriel

Plus en détail

Influence du nombre de réplicats dans une analyse différentielle de données RNAseq

Influence du nombre de réplicats dans une analyse différentielle de données RNAseq Influence du nombre de réplicats dans une analyse différentielle de données RNAseq Statisticiens: Sophie Lamarre Steve Van Ginkel Sébastien Déjean - Magali San Cristobal Matthieu Vignes Biologistes: Stéphane

Plus en détail

THÈME 3 : DU GÉNOTYPE AU PHÉNOTYPE. CHAPITRE 1 : la relation entre ADN et protéines

THÈME 3 : DU GÉNOTYPE AU PHÉNOTYPE. CHAPITRE 1 : la relation entre ADN et protéines THÈME 3 : DU GÉNOTYPE AU PHÉNOTYPE CHAPITRE 1 : la relation entre ADN et protéines Les caractères d un individu dépendent de plusieurs facteurs : certains dépendent des caractères présents dans la famille

Plus en détail

Présentation et accès aux bases de données OMIM, GDB, EMBL/GenBank, SWISS PROT, PDB et au système d'information IMGT

Présentation et accès aux bases de données OMIM, GDB, EMBL/GenBank, SWISS PROT, PDB et au système d'information IMGT Présentation et accès aux bases de données OMIM, GDB, EMBL/GenBank, SWISS PROT, PDB et au système d'information IMGT Véronique Giudicelli LIGM, IGH, UPR CNRS 1142 141 rue de la Cardonille 34296 Montpellier

Plus en détail

RAPPORT D ETUDE BIBLIOGRAPHIQUE. Stage de Master Recherche en Informatique

RAPPORT D ETUDE BIBLIOGRAPHIQUE. Stage de Master Recherche en Informatique RAPPORT D ETUDE BIBLIOGRAPHIQUE Stage de Master Recherche en Informatique Université de Rennes 1 Sujet : Analyse des génomes sur GPU Ricardo ASENCIO Février 2007 Encadrant : Dominique LAVENIER 1 Table

Plus en détail

Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure

Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure Marie Verbanck Laboratoire de Mathématiques Appliquées, Agrocampus OUEST Soutenance de thèse - 4 septembre

Plus en détail

A- Exploiter des animations pour repérer une mutation et étudier son mécanisme de réparation.

A- Exploiter des animations pour repérer une mutation et étudier son mécanisme de réparation. THEME 1A : Expression, stabilité et variation du patrimoine génétique Chapitre 2 : Variabilité Génétique et Mutation de l ADN TP-3-: Réparation de l ADN, mutations et polyallélisme Les mutations de l ADN

Plus en détail

Master ISI 2010-2011. Data Mining Recherche des sous-ensembles fréquents

Master ISI 2010-2011. Data Mining Recherche des sous-ensembles fréquents Master ISI 2010-2011 Data Mining Recherche des sous-ensembles fréquents Yves Lechevallier INRIA-Rocquencourt E_mail : Yves.Lechevallier@inria.fr 1 Processus Data Mining Phase A : Entrepôt de données Entrepôt

Plus en détail

Corrigé du TP Carte SIM

Corrigé du TP Carte SIM Corrigé du TP Carte SIM Outil GScriptor Il faut d abord télécharger GScriptor : http://www.springcard.com/download/find.php?file=gscriptor et l installer sous Windows. Depuis Windows 7, il n est pas nécessaire

Plus en détail

Méthodes diagnostiques en génétique moléculaire

Méthodes diagnostiques en génétique moléculaire Méthodes diagnostiques en génétique moléculaire P. Latour Praticien Hospitalier Responsable UF 3427 Neurogénétique Moléculaire Laboratoire de Neurochimie Pr Renaud HCL Centre de Biologie Est DES Neurologie

Plus en détail

Bioinformatique: Annotation des génomes (eucaryotes)

Bioinformatique: Annotation des génomes (eucaryotes) Bioinformatique: Annotation des génomes (eucaryotes) INSA 2011 Laurent Duret BBE UMR CNRS n 5558 Université Claude Bernard - Lyon 1 Présentation Equipe Bioinformatique et Génomique Evolutive Labo. de Biométrie

Plus en détail