Algorithmes pour la comparaison de séquences II

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimension: px
Commencer à balayer dès la page:

Download "Algorithmes pour la comparaison de séquences II"

Transcription

1 Algorithmes pour la comparaison de séquences II Hélène TOUZET Equipe Bioinfo Master recherche informatique

2 Pourquoi comparer des séquences? Puisque c est la structure qui prime pour la fonction (cf cours de Maude Pupin)

3 Structure des protéines Structure Structure Structure Structure primaire secondaire tertiaire quaternaire Swissprot: séquences TrEMBL: séquences PDB : 243 structures

4 les programmes de séquençage fournissent des séquences qu il faut annoter ADN traduction protéine potentielle (TrEmbl) protéine (Swissprot) les structures 3D sont longues et coûteuses à déterminer cristallographie, résonnance magnétique nucléaire dans PDB, toutes les protéines avec plus de 25 % d identité partagent la même structure PDB: Protein Data Bank - banque de structures de protéines résolues expérimentalement

5 Alignement 2 à 2 : Amélioration du modèle avec le traitement des gaps Gap: succession de délétions ou d insertions Un gap correspond à un seul événement mutationnel. Ouv : pénalité d ouverture de gap Ext : pénalité d extension de gap Anciennes pénalités Nouvelles pénalités T C A G A C G A G T C T C A G A C G A G T C T C G G A _ G C _ T G T C G G A G C T G

6 Pénalités de gaps linéaires toutes les positions sont indépendantes (dépendance d ordre 0) Pénalités de gaps affines le score d une position dépend de la position précédente (dépendance d ordre 1) Ext Insertion Ouv+Ext Ouv+Ext Délétion Ext Ouv+Ext s s Ouv+Ext Substitution s

7 Algorithme Trois tables : a(i, j) score maximal d un alignement entre U(1..i) et V (1..j) qui termine par un match ou un mismatch entre U(i) et V (j) b(i, j) score maximal d un alignement entre U(1..i) et V (1..j) qui termine par l insertion de V (j) c(i, j) score maximal d un alignement entre U(1..i) et V (1..j) qui termine par la délétion de U(i)

8 Formules de récurrence Ouv : pénalité d ouverture de gap Ext : pénalité d extension de gap a(i, j) = Sub(i, j) + max a(i 1, j 1) b(i 1, j 1) c(i 1, j 1) b(i, j) = max Ouv + Ext + a(i, j 1) Ext + b(i, j 1) Ouv + Ext + c(i, j 1) c(i, j) = max Ouv + Ext + a(i 1, j) Ouv + Ext + b(i 1, j) Ext + c(i 1, j)

9 Initialisation a(0, 0) = 0 a(i, 0) = a(0, j) = b(i, 0) = b(0, j) = Ouv + Ext j c(i, 0) = Ouv + Ext i c(0, j) =

10 Exemple : EAGAWGHE et PAWHEAE score des substitutions : A E G H P W A E G H P 10 4 W 15 pénalités d ouverture de gaps : -10 pénalités d extension : -2 alignement global avec gaps affines optimal: E A G A W G H - E P - - A W H E A E

11 a (... substitution) b (... insertion) c (... délétion) E A G A W G H E 0 P A W H E A E E A G A W G H E 0 P A W H E A E E A G A W G H E P A W H E A E

12 BLAST Basic Local Alignment Search Tool Altschul et al

13 Programme pour la recherche de similarités dans de grandes banques de données EMBL, Swissprot,... Utilise un algorithme heuristique linéaire pour l alignement local : Ne s intéresse qu aux séquences avec un fort taux de similarité BLAST ne construit pas un alignement avec toutes les séquences de la banque. Tire parti du caractère biologique des séquences Des séquences similaires ont des segments communs de taille k quasi-identiques. Par défaut : ADN k=11 ou 13, protéines k=3

14 Table de hachage k-mers : mots de longueur k Fonction de hachage (pour l ADN): e : {A, C, G, T } {0, 1, 2, 3} H(i) = k 1 j=0 e(a i+j)4 k j 1 H(i + 1) = 4 H(i) + e(a i+k ) mod 4 k Exemple : 5-mers de AGT ACCGAA A G T A C C G A A

15 Étape 0: Pré-traitement de la banque de données : indexation de tous les k-mers 4 11 = << taille de la banque de données Étape 1: Construction d une table de hachage recensant tous les mots de longueurs k apparaissant dans la séquence requête avec un score > T.

16 Étape 2: Localisation des k-mers dans la banque de données HSP : High Scoring Pairs Étape 3 : Extension de ces points d ancrage de proche en proche, pour avoir un score significatif.

17 Query= Felis catus DRD4 gene fordopamine receptor D4 (276 letters) Database: All GenBank+EMBL+DDBJ+PDB sequences 1,174,453 sequences; 5,001,591,585 total letters Sequences producing significant alignments: Score E (bits) Value gi AB Felis catus DRD4 gene f e-52 gi AB Nyctereutes procyonoide e-36 gi AB Canis lupus DRD4 gene f e-36 gi AB Bos taurus DRD4 gene fo e-31 gi Homo sapiens Dopamine D4 recep e-29

18 ALIGNMENTS >gi dbj AB AB Nyctereutes procyonoides DRD4 gene fordopamine receptor D4. Length = 393 Score = 157 bits (79), Expect = 7e-36 Identities = 94/99 (94%) Strand = Plus / Plus Query 1 ttcttcctaccctgcccgctcatgctgctgctctactgggccacgttcc 48 Sbjct 1 ttcttcctaccctgcccgctcatgctgctgctctactgggccacgttcc 48 Query 49 ggggcctgcggcgctgggaggcggctcgccaggccaagctgcactgccgg 99 Sbjct 49 ggggcctgcggcgctgggaggccgcgcgtcgggccaagctgcacggccgg 99 Score = 107 bits (54), Expect = 5e-21 Identities = 60/62 (96%) Strand = Plus / Plus Query 215 ggaggcgcgccaagatcaccggccgggagcgcaaggccatgagggtcct 252 Sbjct 332 ggagacgcgccaagatcacgggccgggagcgcaaggccatgagggtcct 379 Query 253 tgccggtggtggtc 276 Sbjct 380 tgccggtggtggtc 393

19 >gi AB Hylobates pileatus gene for dopamine receptor D4, partial cds, drd4, 7-repeat allele. Length = 507 Score = 42.1 bits (21), Expect = 0.27 Identities = 45/53 (84%) Strand = Plus / Plus 52 ggcctgcggcgctgggaggcggctcgccaggccaagctgcactgccgggcgcc ggcctgcagcgctgggaggtggcacgtcgcgccaagctgcacggccgcgcgcc 56

20 Alignement Felis Catus/ Nyctereute 1 ttcttcctaccctgcccgctcatgctgctgctctactgggccacgttccggggcctgcgg 60 1 ttcttcctaccctgcccgctcatgctgctgctctactgggccacgttccggggcctgcgg cgctgggaggcggctcgccaggccaagctgcactgccgggcgcctcgtcggcccagcggc cgctgggaggccgcgcgtcgggccaagctgcacggccggacaccgcgcagacccagcggc cccggcccaccgccccccga.ggt...c cccggcccgccaccccccgacggtacccccggccccccgccccccgacggcagccccgac ggcgagc ggc.agcccggacggcacccccggcccgccgccccccgacggcacccccgatgacacccc cccccgacgccgtcgcgccccccgacgccgt cgacgccaccccctgccccccgccccccgcccccgacgccgccgcgccccccgccgccga cccagccgagccgccgcggcaggcacccaggaggaggcgcgccaagatcaccggccggga ccctgcggagcccccgtggcagccacgcaagcggagacgcgccaagatcacgggccggga gcgcaaggccatgagggtcctgccggtggtggtc gcgcaaggccatgagggtcctgccggtggtggtc 393

21 AB (horizontal) vs. AB (vertical)

22 Significativité de l alignement : E-valeur E(S,n,m): Nombre moyen d alignements ayant un score supérieur ou égal à S quand on cherche dans une banque de taille m avec une séquence requête de longueur n. décrit le bruit aléatoire qui existe lorsque on aligne des séquences croit de manière proportionnelle en fonction de n et de m décroit de manière exponentielle en fonction du score S plus la E-valeur est proche de 0, plus la similarité est significative

23 Query= actgagcatagctgga (16 letters) Database: All GenBank+EMBL+DDBJ+PDB sequences 1,174,453 sequences; 5,001,591,585 total letters Sequences producing significant alignments: Score E (bits) Value gi AC Mus musculus chromosome gi AC Homo sapiens BAC clone gi AC Canis familiaris clone gi AF Homo sapiens chromosome ALIGNMENTS >gi AC Mus musculus chromosome 10 clone. Length = Query: 1 actgagcatagctgga 16 Sbjct: actgagcatagctgga >gi gb AC Homo sapiens BAC clone Length = Query: 1 actgagcatagctgg 15 Sbjct: actgagcatagctgg 48164

24 Query= actgagcatagctggac (17 letters) Database: All GenBank+EMBL+DDBJ+PDB sequences 1,174,453 sequences; 5,001,591,585 total letters Sequences producing significant alignments: Score E (bits) Value gi AC Mus musculus chromosome gi AL Human DNA sequence fro gi AC Homo sapiens BAC clone ALIGNMENTS >gi AC Mus musculus chromosome 10 clone Query: 1 actgagcatagctggac 17 Sbjct: actgagcatagctggac >gi Human DNA sequence >gi AC Homo sapiens BAC clone Query: 2 ctgagcatagctggac 17 Query: 1 actgagcatagctgg 15 Sbjct: ctgagcatagctggac Sbjct: ctgagcatagctggac 21079

25 Query= actgagcatagctggat (17 letters) Database: All GenBank+EMBL+DDBJ+PDB sequences 1,174,453 sequences; 5,001,591,585 total letters Sequences producing significant alignments: Score E (bits) Value gi AC Mus musculus chromosome 10 c gi AC Homo sapiens BAC clone gi AF Sulfolobus solfataricus ALIGNMENTS >gi AC Mus musculus chromosome 10 clone Query: 1 actgagcatagctgga 16 Sbjct: actgagcatagctgga >gi AC Homo sapiens BAC clone Query: 1 actgagcatagctgg 15 Sbjct: actgagcatagctgg 48164

26 Query= actgagcatag (11 letters) Database: All GenBank+EMBL+DDBJ+PDB sequences 1,174,453 sequences; 5,001,591,585 total letters No significant similarity found.

27 E-value 1000 Query= actgagcatag (11 letters) Database: All GenBank+EMBL+DDBJ+PDB sequences 1,174,453 sequences; 5,001,591,585 total letters Sequences producing significant alignments: Score E (bits) Value gi AC Homo sapiens chromosome 16 clo gi NM_ Danio rerio endothelin recept gi AC Homo sapiens BAC clone gi AC Mus musculus clone rp23-422n gi AP Pyrococcus horikoshii OT gi Drosophila melanogaster ALIGNMENTS >gi AC Homo sapiens chromosome 16 clone Length = Query: 1 actgagcatag 11 Sbjct: actgagcatag 78811

28 Génome de la drosophile Query= actgagcatag (11 letters) Database: D. melanogaster genomic nucleotide sequences 1170 sequences; 122,655,632 total letters Sequences producing significant alignments: Score E (bits) Value gi AE Drosophila melanogaster g gi AE Drosophila melanogaster g gi AE Drosophila melanogaster g gi AE Drosophila melanogaster g gi AE Drosophila melanogaster g ALIGNMENTS >gi gb AE AE Drosophila melanogaster genomic scaffold Query: 1 actgagcatag 11 Sbjct: actgagcatag 17844

29 Les différentes versions de BLAST BLASTN : séquences nucléiques BLASTP : séquences protéiques BLASTX : une séquence nucléique comparée à une base de données protéique. (Traduction suivant les 6 cadres de lecture.) TBLASTX : une séquence protéique comparée à une base de données nucléique TBLASTN : une séquence nucléique comparée à une base de données nucléiques, chacune suivant tous les cadres de lecture. (Cela revient à faire 36 fois BLASTP.)

Introduction à l annotation de séquences

Introduction à l annotation de séquences Introduction à l annotation de séquences - Université de Lille 1-2 eme Semestre But de l annotation de séquences Les séquences nucléiques : Détecter la présence de gènes Trouver la structure des gènes

Plus en détail

Recherche par similarité dans les banques/bases de données La suite Blast (Basic Local Alignment Search Tool)

Recherche par similarité dans les banques/bases de données La suite Blast (Basic Local Alignment Search Tool) Recherche par similarité dans les banques/bases de données La suite Blast (Basic Local Alignment Search Tool) A A C T G G T A A C C G A G C T A C G G T C C G Algorithme de Blast (version 1) (Altschul et

Plus en détail

Plan. Comparaison de 2 séquences. Dotplot, alignement optimal Recherche de similarité. Alignement multiple. Phylogénie moléculaire

Plan. Comparaison de 2 séquences. Dotplot, alignement optimal Recherche de similarité. Alignement multiple. Phylogénie moléculaire Plan 1 Banques de données 2 Comparaison de 2 séquences Dotplot, alignement optimal Recherche de similarité 3 Alignement multiple l 4 Phylogénie moléculaire Recherche de similarité 1 séquence (Query) comparée

Plus en détail

Comparaison et alignement. de séquences 2 LV348 -BI. sophie.pasek@upmc.fr. Sophie Pasek

Comparaison et alignement. de séquences 2 LV348 -BI. sophie.pasek@upmc.fr. Sophie Pasek Comparaison et alignement de séquences 2 LV348 -BI Sophie Pasek sophie.pasek@upmc.fr Comment comparer une séquence contre une banque? Comparaison séquence/banque Pourquoi? : Réunir un échantillon taxonomique

Plus en détail

Introduction à la bioinformatique

Introduction à la bioinformatique Faculté des Sciences - Rabat Laboratoire de Microbiologie et Biologie Moléculaire -------------------------------------- Université Mohamed V - Agdal Faculté des Sciences B.P. 1014 - Rabat - MAROC TD Biologie

Plus en détail

Lancer FASTA et BLAST en ligne de commande

Lancer FASTA et BLAST en ligne de commande Lancer FASTA et BLAST en ligne de commande V.2006.1 http://www.esil.univ-mrs.fr/~dgaut/cours Daniel Gautheret ESIL, Université de la Méditerranée Fasta Article original: Lipman and Pearson (1985) Science

Plus en détail

Comparaison et alignement de séquences 2

Comparaison et alignement de séquences 2 Comparaison et alignement de séquences 2 LV348 -BI Sophie Pasek sophie.pasek@upmc.fr Comment comparer une séquence contre une banque? Comparaison séquence/banque Pourquoi? : Réunir un échantillon taxonomique

Plus en détail

Initiation à la Bioinformatique

Initiation à la Bioinformatique Université d Alexandrie Initiation à la Bioinformatique Basic Local Alignment Search Tool BLAST Université d Alexandrie AUF Auteur(s): Mohamed GAD 2009/2010 Auteur(s) : Mohamed GAD Professeur à l institut

Plus en détail

Alignement de séquences (2/2)

Alignement de séquences (2/2) Alignement de séquences (2/2) Observation à l aide de l outil graphique : le dotplot. Simple, visuel, Très informatif : Permet de repérer une similarité globale Permet de repérer des similarités locales

Plus en détail

Prédiction de gènes. Cours de présentation des outils bio-informatiques pour la localisation puis l'étude des gènes. Equipe Bonsai (2014)

Prédiction de gènes. Cours de présentation des outils bio-informatiques pour la localisation puis l'étude des gènes. Equipe Bonsai (2014) Prédiction de gènes Cours de présentation des outils bio-informatiques pour la localisation puis l'étude des gènes Equipe Bonsai (2014) La localisation des gènes C'est la première étape pour interpréter

Plus en détail

Programmes de comparaison de banques de données

Programmes de comparaison de banques de données Programmes decomparaison debanquesdedonnées FASTA introduction Programmesdecomparaisonde2séquencestroplongs Méthodesheuristiques But:filtrerparétapessuccessiveslesséquences «intéressantes» Etablissementd'unscorepourclasserlesmeilleuressimilitudes

Plus en détail

Bioinformatique appliquée. Cours 4 BLAST. idée. lire un résultat de Blast. la famille Blast

Bioinformatique appliquée. Cours 4 BLAST. idée. lire un résultat de Blast. la famille Blast Bioinformatique appliquée Cours 4 BLAST idée lire un résultat de Blast la famille Blast -1- "quelle est la similarité entre ces 2 séquences? et donc: est-ce que ces deux séquences sont homologues?" "existe-t-il

Plus en détail

INTRODUCTION À LA BIO-INFORMATIQUE

INTRODUCTION À LA BIO-INFORMATIQUE Biologie moléculaire-2016 1 INTRODUCTION À LA BIO-INFORMATIQUE Dans cette section, on désire vous donner une introduction sur l utilisation du site web du National Center for Biotechnology Information

Plus en détail

Contenu du cours. Comparaisons locales et matrices de score. Matrice BLOSUM-62 pour les protéines. Exemples pour l ADN

Contenu du cours. Comparaisons locales et matrices de score. Matrice BLOSUM-62 pour les protéines. Exemples pour l ADN Contenu du cours Comparaisons locales et matrices de score Équipe Bonsai http://www.lifl.fr/bonsai Matrices de scores Recherches locales : BLAST et FastA année 2013 Équipe Bonsai Comparaisons locales et

Plus en détail

La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST.

La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST. La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST. Gaël Le Mahec - p. 1/12 L algorithme BLAST. Basic Local Alignment Search Tool est un algorithme de recherche

Plus en détail

Alignement d une séquence avec une banque. Thierry Lecroq Université de Rouen 1

Alignement d une séquence avec une banque. Thierry Lecroq Université de Rouen 1 Alignement d une séquence avec une banque 1 Problématique générale Localiser des alignements significatifs entre une séquence requête x dans une banque de p séquences Y = {y 0,y 1,,y p 1 }. La solution

Plus en détail

De la biologie molécualire à la génomique

De la biologie molécualire à la génomique De la biologie molécualire à la génomique Pierre Neuvial École Nationale de la Statistique et de l Administration Économique Méthodes statistiques pour la biologie Plan du cours 1 Introduction à la biologie

Plus en détail

Les bases de données biologiques. Sigrid Le Clerc Conservatoire Nationale des Arts et Métiers Chaire de Bioinformatique

Les bases de données biologiques. Sigrid Le Clerc Conservatoire Nationale des Arts et Métiers Chaire de Bioinformatique Les bases de données biologiques Sigrid Le Clerc Conservatoire Nationale des Arts et Métiers Chaire de Bioinformatique Sommaire 1. Introduction 2. Le système Entrez 2.1. Description du système Entrez 2.2.

Plus en détail

Structures Familles, domaines et sites protéiques Ontologie Cluster de transcrits. O. Lecompte Bioinformatique

Structures Familles, domaines et sites protéiques Ontologie Cluster de transcrits. O. Lecompte Bioinformatique Banques Séquences nucléiques protéiques mixtes Structures Familles, domaines et sites protéiques Ontologie Cluster de transcrits PROSITE banque de motifs et de profils caractéristiques de domaines ou de

Plus en détail

Module Analyse de Génomes 2011-2012 Master 2 module FMBS 326 Immunoinformatique

Module Analyse de Génomes 2011-2012 Master 2 module FMBS 326 Immunoinformatique Module Analyse de Génomes 2011-2012 Master 2 module FMBS 326 Immunoinformatique Planning du Module : Date Heure Salle 12/12 9h-12h TD info TA1Z bat 25 13h-17h TD info TA1Z bat 25 13/12 9h-12h TD info TA1Z

Plus en détail

Les propriétés physicochimiques de l ADN Structure des génomes La chromatine

Les propriétés physicochimiques de l ADN Structure des génomes La chromatine Cours de Biologie Moléculaire L2S3 Structure de l ADN Organisation des génomes 2ème cours (1h30) Les propriétés physicochimiques de l ADN Structure des génomes La chromatine L ADN est chargé négativement

Plus en détail

Prédiction de gènes. La localisation des gènes. Quel est le point de départ? Une idée naïve : les phases ouvertes de lecture

Prédiction de gènes. La localisation des gènes. Quel est le point de départ? Une idée naïve : les phases ouvertes de lecture La localisation des gènes Prédiction de gènes Crs de présentation des tils bio-informatiques pr la localisation puis l'étude des gènes C'est la première étape pr interpréter un génome Distinction entre

Plus en détail

Transformée de Burrows-Wheeler et mapping de données RNA-seq

Transformée de Burrows-Wheeler et mapping de données RNA-seq Transformée de Burrows-Wheeler et mapping de données RNA-seq MAPPI, journée indexation 6 juin 2011 Introduction Indexation But : Recherche rapide d'une information dans de grands volumes de données Indexation

Plus en détail

A BIOINFORMATIQUE FONCTIONNELLE

A BIOINFORMATIQUE FONCTIONNELLE Biologie moléculaire-2017 1 A BIOINFORMATIQUE FONCTIONNELLE PRÉDIRE LA FONCTION D UNE PROTÉINE INCONNUE Supposons que vous avez trouvé la séquence d'acides aminés d'une protéine inconnue et que vous souhaitez

Plus en détail

Annotation in silico de séquences biologiques

Annotation in silico de séquences biologiques Annotation in silico de séquences biologiques Carl Herrmann TAGC Inserm U928 Université de la Méditerranée carl.herrmann@univmed.fr Pourquoi Diana est-elle ce qu'elle est...? génotype = l'information génétique

Plus en détail

GMIN206 TD Banques de données biologiques Interrogation des banques via GQuerry et Formats de fichiers de séquences

GMIN206 TD Banques de données biologiques Interrogation des banques via GQuerry et Formats de fichiers de séquences GMIN206 TD Banques de données biologiques Interrogation des banques via GQuerry et Formats de fichiers de séquences 1. Interrogation des banques via GQuerry 1.1 Rappel De manière concrère, l interrogation

Plus en détail

Outils de la Bioinformatique M1 GENIOMHE/ M1 BS Comparaison de séquences 2 à 2

Outils de la Bioinformatique M1 GENIOMHE/ M1 BS Comparaison de séquences 2 à 2 Outils de la Bioinformatique M1 ENIOMHE/ M1 BS omparaison de séquences 2 à 2 Exercice 1 : omparaison visuelle de séquences avec ot Plot Les séquences suivantes sont à comparer : Séquence_1 Séquence_2 1.1)

Plus en détail

génomes Présentation La biologie à l'heure du séquençage des génomes Séquençage de génomes: Pourquoi? Comment? Annotation des génomes

génomes Présentation La biologie à l'heure du séquençage des génomes Séquençage de génomes: Pourquoi? Comment? Annotation des génomes Présentation Bioinformatique: analyse des génomes Céline Brochier-Armanet (Laurent Duret) Université Claude Bernard, Lyon 1 Laboratoire de Biométrie et Biologie évolutive (UMR 5558) Celine.brochier-armanet@univ-lyon1.fr

Plus en détail

ALIGNEMENT PLUS RAPIDE

ALIGNEMENT PLUS RAPIDE ALIGNEMENT PLUS RAPIDE 1. méthodes heuristiques : hachage, arbres de suffixe, PD limitée (taille totale de trous bornée) 2. PD éparse (pour sous-séquence commune ou chaînage en alignement global heuristique)

Plus en détail

Annotation de protéines

Annotation de protéines JS Varré Université Lille 1 jean-stephane.varre@lifl.fr http://www.lifl.fr/~varre jean-stephane.varre@lifl.fr 1 / Pourquoi faire de l annotation automatique de protéines? Il est difficile de trouver expérimentalement

Plus en détail

BIO6: Bioinformatique appliquée Correction du TD3

BIO6: Bioinformatique appliquée Correction du TD3 BIO6: Bioinformatique appliquée Correction du TD3 Exercice 1 : programmation dynamique voir le site web indiqué dans le TD pour corriger l'exercice Exercice 2 : similarité de séquence et distance évolutive

Plus en détail

BIOINFORMATIQUE APPLIQUÉE - CHMI 3206 F. Professeur : Eric R. Gauthier. Test de mi-session. 31 octobre Votre nom :

BIOINFORMATIQUE APPLIQUÉE - CHMI 3206 F. Professeur : Eric R. Gauthier. Test de mi-session. 31 octobre Votre nom : BIOINFORMATIQUE APPLIQUÉE - CHMI 3206 F Professeur : Eric R. Gauthier Test de mi-session 31 octobre 2006 Votre nom : Consignes : 1) Durée : 85 min 2) 5 questions sur 5 pages, pour 80 points. Compte pour

Plus en détail

Prédiction de la Structure des Protéines. touzet@lifl.fr

Prédiction de la Structure des Protéines. touzet@lifl.fr Prédiction de la Structure des Protéines Hélène TOUZET touzet@lifl.fr Structure Structure Structure Structure primaire secondaire tertiaire quaternaire Exemple : la structure secondaire de la transthyretine

Plus en détail

Objectif : identifier la mutation responsable de la maladie parmi les millions de polymorphisme.

Objectif : identifier la mutation responsable de la maladie parmi les millions de polymorphisme. Identification de gènes morbides Analyses mutationnelles Maladies monogéniques Objectif : identifier la mutation responsable de la maladie parmi les millions de polymorphisme. Plan : Variations du nombre

Plus en détail

ftp://ftp.ncbi.nih.gov/blast/executables/latest

ftp://ftp.ncbi.nih.gov/blast/executables/latest Jour 4: TP : application à la bibliographie et recherche d'information : recherche systématique d'articles scientifiques liés à des séquences sélectionnées d'une banque de séquence (wget). TP: recherche

Plus en détail

AVL Liban La Bioinformatique. Bioinformatique

AVL Liban La Bioinformatique. Bioinformatique AVL Liban 2011 La Sami Khuri Department of Computer Science San José State University San José, California, USA sami.khuri@sjsu.edu www.cs.sjsu.edu/faculty/khuri Sami Khuri sami.khuri@sjsu.edu Qu est-ce

Plus en détail

Plus courts chemins, programmation dynamique

Plus courts chemins, programmation dynamique 1 Plus courts chemins, programmation dynamique 1. Plus courts chemins à partir d un sommet 2. Plus courts chemins entre tous les sommets 3. Semi-anneau 4. Programmation dynamique 5. Applications à la bio-informatique

Plus en détail

Dr. Christophe Geourjon

Dr. Christophe Geourjon Prédiction de la structure 3D Dr. Christophe Geourjon Pôle de BioInformatique Lyonnais PBIL - Site de Lyon-Gerland IBCP - CNRS UMR 5086 Bioinformatique et RMN structurales 7, passage du Vercors 69367 Lyon

Plus en détail

Examen de bioinformatique Février 2009

Examen de bioinformatique Février 2009 Examen de bioinformatique Février 2009 Durée : 2h (ou 2h30) - Documents interdits Première partie (4 points) 1) La séquence ci-dessous est-elle au format fasta (justifiez votre réponse)? 1 pt Is the sequence

Plus en détail

Modélisation de la structure 3D des protéines

Modélisation de la structure 3D des protéines Modélisation de la structure 3D des protéines We are drowning in data and starving for knowledge -R.D. Roger Unité Mathématique Informatique et Génome Séminaire AGENAE, Seignosse-le-Pénon, 20-21 mai 2003

Plus en détail

La Génomique Biologie, informatique, évolution. Hugues Roest Crollius hrc@ens.fr Dyogen Group L3 Introduction aux sciences du vivant 03.12.

La Génomique Biologie, informatique, évolution. Hugues Roest Crollius hrc@ens.fr Dyogen Group L3 Introduction aux sciences du vivant 03.12. La Génomique Biologie, informatique, évolution Hugues Roest Crollius hrc@ens.fr Dyogen Group L3 Introduction aux sciences du vivant 03.12.2013 La «génomique fonctionnelle» La «génomique évolutive» human

Plus en détail

Étude de la biodiversité fongique à l aide de techniques de pyroséquençage

Étude de la biodiversité fongique à l aide de techniques de pyroséquençage Étude de la biodiversité fongique à l aide de techniques de pyroséquençage Biodiversité fongique Biodiversité: diversité spécifique d une communauté écologique, correspondant au nombre d espèces et à leur

Plus en détail

Bioinformatique dans l IUP

Bioinformatique dans l IUP Bioinformatique dans l IUP Intervenants Equipe Bioinfo (Laboratoire d Informatique Fondamentale de Lille) Cours : Jean-Stéphane Varré (jean-stephane.varre@lifl.fr) TD sur machine : Jean-Stéphane Varré,

Plus en détail

Méthodes et algorithmes pour le séquençage

Méthodes et algorithmes pour le séquençage Méthodes et algorithmes pour le séquençage Jérémie MARY http://www.lri.fr/~mary La comparaison de séquences Distance d'édition Selon ce concept, le bon alignement est celui qui minimise les opérations

Plus en détail

Quelques caractéristiques des microsatellites : définition, densité et structure. P. Jarne CEFE - Montpellier

Quelques caractéristiques des microsatellites : définition, densité et structure. P. Jarne CEFE - Montpellier Quelques caractéristiques des microsatellites : définition, densité et structure P. Jarne CEFE - Montpellier Buts * Définitions * Méthodes d études de la distribution * Qques résultats : distribution dans

Plus en détail

Comparaison et! Alignement! de séquences

Comparaison et! Alignement! de séquences Comparaison et! Alignement! de séquences Frédérique Barloy-Hubler fhubler@univ-rennes1.fr CNRS-IGDR Rennes Responsable PF Amadeus Annotation des gènes et des génomes Biosit -UMS 3480 Un petit jeu pour

Plus en détail

Résistance au VIH (version numérique de l exercice)

Résistance au VIH (version numérique de l exercice) 1 Résistance au VIH (version numérique de l exercice) Au début des années 1990, différentes recherches ont démontré que malgré un contact fréquent avec le virus certaines personnes ne devenaient pas porteuses

Plus en détail

TD Bioinformatique : Sequence Alignment. Pourquoi faire une recherche par similarité?

TD Bioinformatique : Sequence Alignment. Pourquoi faire une recherche par similarité? TD Bioinformatique : Sequence lignment Pourquoi faire une recherche par similarité? - Savoir si ma séquence ressemble à d'autres déjà connues. - Trouver toutes les séquences d'une même famille. - Rechercher

Plus en détail

Quelle place pour la bioinformatique à l IN2P3? V. Breton Journées informatiques Cargèse 07/01

Quelle place pour la bioinformatique à l IN2P3? V. Breton Journées informatiques Cargèse 07/01 Quelle place pour la bioinformatique à l IN2P3? V. Breton Journées informatiques Cargèse 07/01 Définitions Bioinformatique : informatique d acquisition et d analyse des données issues de la génomique et

Plus en détail

L ADN. Schématisez un nucléotide et un nucléoside en précisant sur quel carbone du sucre se font les différents assemblages :

L ADN. Schématisez un nucléotide et un nucléoside en précisant sur quel carbone du sucre se font les différents assemblages : L ADN. I. GENERALITES. A. Les caractéristiques de l ADN. Donnez les 6 caractéristiques de l ADN : B. Les nucléotides/nucléosides : Schématisez un nucléotide et un nucléoside en précisant sur quel carbone

Plus en détail

TD5 : Prédiction de la structure tridimensionnelle d une protéine Modélisation moléculaire

TD5 : Prédiction de la structure tridimensionnelle d une protéine Modélisation moléculaire TD5 : Prédiction de la structure tridimensionnelle d une protéine Modélisation moléculaire Vous aurez besoin des programmes suivant : d un éditeur de séquence d un visualiseur de structure 3D (PyMOL) Avant-propos

Plus en détail

Le décryptage des génomes

Le décryptage des génomes Biologie et société Le décryptage des génomes Jacques van Helden Jacques.van-Helden@univ-amu.fr Université d Aix-Marseille, France http://jacques.van-helden.perso.luminy.univ-amu.fr/ Adresse précédente

Plus en détail

AutoGRAPH Un serveur pour automatiser et visualiser la comparaison de génomes: Application à l identification de nouveaux gènes chez le chien.

AutoGRAPH Un serveur pour automatiser et visualiser la comparaison de génomes: Application à l identification de nouveaux gènes chez le chien. AutoGRAPH Un serveur pour automatiser et visualiser la comparaison de génomes: Application à l identification de nouveaux gènes chez le chien. Thomas DERRIEN CNRS-UMR6061 Génétique et Développement Université

Plus en détail

HMSN206 - Partie Alignement

HMSN206 - Partie Alignement M1 Bioinformatique, Connaissances et Données Master Sciences et Numérique pour la Santé Année 2016-2017 HMSN206 - Partie Alignement Partie I-2 : Matrices de scores, BLAST, FASTA Anne-Muriel Arigon Chifolleau

Plus en détail

Bioinformatique Appliquée Recherche de similitudes

Bioinformatique Appliquée Recherche de similitudes Besoin d'accélérer la recherche de similitude dans une banque Bioinformatique Appliquée Recherche de similitudes La recherche de similitude permet de comparer une séquence appelée requête (query) à une

Plus en détail

TD5 : Prédiction de la structure tridimensionnelle d une protéine Modélisation moléculaire

TD5 : Prédiction de la structure tridimensionnelle d une protéine Modélisation moléculaire TD5 : Prédiction de la structure tridimensionnelle d une protéine Modélisation moléculaire Avant de commencer le TD, installer (ou vérifier qu ils le sont) sur la partition K: du poste de travail, les

Plus en détail

Algorithmes sur les séquences en bioinformatique

Algorithmes sur les séquences en bioinformatique M2 - STL Algorithmes sur les séquences en bioinformatique L ARN est un polymère constitué par 4 unités nucléotidiques A,C, G, U (adénine, cytosine, guanine et uracile) Le U remplace le T dans l ADN. Cours

Plus en détail

Qualité des séquences produites par 454 : exemple de traitement

Qualité des séquences produites par 454 : exemple de traitement Qualité des séquences produites par 454 : exemple de traitement Eric PEYRETAILLADE Equipe d accueil CIDAM Faculté de Pharmacie, Université d Auvergne 1 La Technologie 454 (Roche) Etape 1 : Préparation

Plus en détail

Annotation de séquences génomiques Exemple d une région du chromosome 1 de riz autour du gène qsh1 (Os_1:36429001..36558000)

Annotation de séquences génomiques Exemple d une région du chromosome 1 de riz autour du gène qsh1 (Os_1:36429001..36558000) Annotation de séquences génomiques Exemple d une région du chromosome 1 de riz autour du gène qsh1 (Os_1:36429001..36558000) II) Annotation de gènes codant des protéines 1) Objectif du TD L objectif du

Plus en détail

Initiation à la Bioinformatique Daniel Gautheret ESIL, Université de la Méditerranée

Initiation à la Bioinformatique Daniel Gautheret ESIL, Université de la Méditerranée Initiation à la Bioinformatique Daniel Gautheret ESIL, Université de la Méditerranée V.2004.4 http://www.esil.univ-mrs.fr/~dgaut/cours Bioinformatique Deux définitions possibles Applications de l informatique

Plus en détail

TD2 : Histoire évolutive de la famille GH15 des glucosides hydrolases

TD2 : Histoire évolutive de la famille GH15 des glucosides hydrolases Master 1 :: module BBSG1.2.1 "Bioinformatique" :: année 2006/2007 TD2 : Histoire évolutive de la famille GH15 des glucosides hydrolases Encadrants: Emmanuel Talla (talla@ibsm.cnrs-mrs.fr) & Céline Brochier-Armanet

Plus en détail

Méthodes d Optimisation

Méthodes d Optimisation Méthodes d Optimisation Licence Professionnelle Logistique Université du Littoral - Côte d Opale, Pôle Lamartine Laurent SMOCH (smoch@lmpa.univ-littoral.fr) Septembre 2011 Laboratoire de Mathématiques

Plus en détail

Séquençage haut débit 5 mars 26 mars (14h) C. Gaspin, C. Klopp, J. Mariette & G. Salin

Séquençage haut débit 5 mars 26 mars (14h) C. Gaspin, C. Klopp, J. Mariette & G. Salin Séquençage haut débit 5 mars 26 mars (14h) C. Gaspin, C. Klopp, J. Mariette & G. Salin Plan de la session Bioinformatique & séquençage haut débit Date Intervenant (s) Libellé 05/03 G. Salin Introduction

Plus en détail

Bioinformatique: alignement de séquences

Bioinformatique: alignement de séquences Bioinformatique: alignement de séquences Céline Brochier-Armanet Université Claude Bernard, Lyon 1 Laboratoire de Biométrie et Biologie évolutive (UMR 5558) Celine.brochier-armanet@univ-lyon1.fr Problème

Plus en détail

Bases de données multimédia VIII indexation vidéo & audio

Bases de données multimédia VIII indexation vidéo & audio Bases de données multimédia VIII indexation vidéo & audio ENSIMAG 2014-2015 Matthijs Douze & Karteek Alahari Plan Spécificité du problème Filtrage temporel Détecteur spatio-temporels Aggrégation temporelle

Plus en détail

Biologie «in silico» Adapté de Pierre Vincens

Biologie «in silico» Adapté de Pierre Vincens Biologie «in silico» Adapté de Pierre Vincens Bioinformatique Association de la biologie et de l'informatique Objectifs : Analyser, modéliser ou prédire les informations issues de données biologiques expérimentales

Plus en détail

Plasma, un nouvel algorithme progressif pour l alignement multiple de séquences

Plasma, un nouvel algorithme progressif pour l alignement multiple de séquences Plasma, un nouvel algorithme progressif pour l alignement multiple de séquences Vincent Derrien 1 Jean-Michel Richer 1 et Jin-Kao Hao 1 LERIA - Université d Angers, 2 Bd Lavoisier, 49045 Angers, France

Plus en détail

Introduction à la bioinformatique

Introduction à la bioinformatique Introduction à la bioinformatique Céline Brochier-Armanet Université Claude Bernard, Lyon 1 Laboratoire de Biométrie et Biologie Evolutive (UMR 5558) celine.brochier-armanet@univ-lyon1.fr Lectures recommandées

Plus en détail

Master 1 IUP Génomique et Protéomique Examen de GP4 - Bioinformatique

Master 1 IUP Génomique et Protéomique Examen de GP4 - Bioinformatique Master 1 IUP Génomique et Protéomique Examen de GP4 - Bioinformatique Exercice 1 : banques de données. Durée de l épreuve : 2h Documents autorisés Q1) Le schéma ci-dessous représente le nombre d articles

Plus en détail

a) Considérons le cas où N est un multiple de n : N = Mn

a) Considérons le cas où N est un multiple de n : N = Mn 5.2 TIRAGE SYSTEMATIQUE a) Considérons le cas où N est un multiple de n : N = Mn où M N 0 Prélever un échantillon systématique consiste à tirer de manière équiprobable un individu i 1 parmi {1,..., M},

Plus en détail

Recherche d homologies

Recherche d homologies Recherche d homologies Soluscience Guillaume Chakroun guillaume chakroun@hotmail.com Copyright c 2004 Guillaume Chakroun TABLE DES MATIÈRES Table des matières 1 Introduction 4 2 Les systèmes de scores

Plus en détail

Big data et sciences du Vivant L'exemple du séquençage haut débit

Big data et sciences du Vivant L'exemple du séquençage haut débit Big data et sciences du Vivant L'exemple du séquençage haut débit C. Gaspin, C. Hoede, C. Klopp, D. Laborie, J. Mariette, C. Noirot, MS. Trotard bioinfo@genopole.toulouse.inra.fr INRA - MIAT - Plate-forme

Plus en détail

Notions de bioinformatique

Notions de bioinformatique Notions de bioinformatique Souvent les avancées des biotechnologies ont été possibles du fait d avancées technologiques relevant d autres domaines que la biologie. - En juillet 1995 le séquençage d Haemophilus

Plus en détail

Plateforme de Recherche de Mutations

Plateforme de Recherche de Mutations Plateforme de Recherche de Mutations Jean-Marc Aury contact: pfm@genoscope.cns.fr 29 janvier 2009 Introduction Présentation des données produites par le GSFLX : type, qualité, Méthodes de détection de

Plus en détail

Prof.É.D.Taillard. Classification automatique @Prof. E. Taillard 1 EIVD, Informatique logiciel, 4 e semestre

Prof.É.D.Taillard. Classification automatique @Prof. E. Taillard 1 EIVD, Informatique logiciel, 4 e semestre INFORMATIQUE ORIENTATION LOGICIELS CLASSIFICATION AUTOMATIQUE Prof.É.D.Taillard Classification automatique @Prof. E. Taillard EIVD, Informatique logiciel, 4 e semestre CLASSIFICATION AUTOMATIQUE But :

Plus en détail

Les principales bases de données en bioinformatique

Les principales bases de données en bioinformatique Bases de données en bioinformatique Les principales bases de données en bioinformatique Nombreuses bases de données en bioinformatique Données issues d'expériences, de publications, d'analyses faites à

Plus en détail

Théorème de Thalès Corrigés d exercices / Version de décembre 2012

Théorème de Thalès Corrigés d exercices / Version de décembre 2012 Corrigés d exercices / Version de décembre 0 Les exercices du livre corrigés dans ce document sont les suivants : Page 06 : N, 4, 7, 8 Page 07 : N 0, 4 Page : N 5 Page : N 53 N page 06 Le segment [ AB

Plus en détail

Anne-Aurélie RAYMOND. Journée scientifique «Data Mining of OMICs Data» 5 février 2015

Anne-Aurélie RAYMOND. Journée scientifique «Data Mining of OMICs Data» 5 février 2015 Anne-Aurélie RAYMOND Journée scientifique «Data Mining of OMICs Data» 5 février 2015 Présentation générale Fiches techniques des protéines Analyse automatique d un set de data «omique» Par grandes fonctions

Plus en détail

BREVET BLANC DES 5 et 6 février 2004 Corrigé MATHEMATIQUES

BREVET BLANC DES 5 et 6 février 2004 Corrigé MATHEMATIQUES Collège LANGEVIN WALLON BREVET BLANC DES et 6 février 004 Corrigé MATHEMATIQUES PARTIE I : ACTIVITES NUMERIQUES (1 points) Exercice I :1 1. En faisant apparaître les différentes étapes de calcul, écrire

Plus en détail

Algorithmes de recherche locale

Algorithmes de recherche locale Algorithmes de recherche locale Recherche Opérationnelle et Optimisation Master 1 Sébastien Verel verel@lisic.univ-littoral.fr http://www-lisic.univ-littoral.fr/~verel Université du Littoral Côte d Opale

Plus en détail

Introduction à l Algorithmique et la Programmation feuille de Projet Alignement de Séquences

Introduction à l Algorithmique et la Programmation feuille de Projet Alignement de Séquences Introduction à l Algorithmique et la Programmation feuille de Projet Alignement de Séquences Le thème de ce projet est l alignement de séquences. Il permet d illustrer comment les principes algorithmiques

Plus en détail

Alignements de deux séquences

Alignements de deux séquences Alignements de deux séquences Informatique Génomique - Master 1 Guillaume Blin IGM-LabInfo UMR 8049, Bureau 4B066 Université de Marne La Vallée gblin@univ-mlv.fr http://igm.univ-mlv.fr/ gblin 2007-08 Plan

Plus en détail

L'apport de l'étude des génomes : les innovations génétiques.

L'apport de l'étude des génomes : les innovations génétiques. Introduction : L'apport de l'étude des génomes : les innovations génétiques. Au sein du vivant, les espèces se différencient les unes des autres par l existence de gènes différents. Au sein d une espèce,

Plus en détail

Alignement de séquences

Alignement de séquences Bioinformatique appliquée ours lignement de séquences principes un algorithme d'alignement: programmation dynamique alignement global, alignement local -- Les comparaisons de séquences DOPLO j'ai séquences,

Plus en détail

Introduction à l Analyse des séquences biologiques.

Introduction à l Analyse des séquences biologiques. Introduction à l Analyse des séquences biologiques Christian.Fondrat@dsi.univ-paris5.fr Les outils d analyse de séquences C est QUOI? DES BASES DE DONNEES DES PROGRAMMES Utilitaires (consultation, acquisition

Plus en détail

Phylogénomique : introduction

Phylogénomique : introduction Phylogénomique : introduction Les limites des phylogénies basées sur un seul gène Résolution limitée (erreur stochastique) La phylogénie du gène peut être différente de la phylogénie des espèces à cause

Plus en détail

Le problème des multiplications matricielles enchaînées peut être énoncé comme suit : étant

Le problème des multiplications matricielles enchaînées peut être énoncé comme suit : étant Licence informatique - L Année 0/0 Conception d algorithmes et applications (LI) COURS Résumé. Dans cette cinquième séance, nous continuons l exploration des algorithmes de type Programmation Dynamique.

Plus en détail

La bioinformatique en entreprise

La bioinformatique en entreprise Charlène FLEURY Christian JACQUES EI3 Info Projet de veille technologique La bioinformatique en entreprise Introduction Le développement de programmes informatiques dédiés à l analyse des données biologiques

Plus en détail

RdF Reconnaissance des Formes Semaine 11 : RDF sur les chaînes

RdF Reconnaissance des Formes Semaine 11 : RDF sur les chaînes RdF Reconnaissance des Formes Semaine 11 : RDF sur les chaînes Master ASE : http://master-ase.univ-lille1.fr/ Master Informatique : http://www.fil.univ-lille1.fr/ Spécialité IVI : http://master-ivi.univ-lille1.fr/

Plus en détail

METHODE DES BIELLES ET TIRNTS SELON L EUROCODE 2 PPLICTION U CLCUL D UN CHEVETRE DE PONT 3.1 PRESENTTION DE L EXEMPLE Viaduc des Usses sur l 41 (nnecy Genève) 3.1 PRESENTTION DE L EXEMPLE Viaduc des Usses

Plus en détail

Chapitre 3 Tableaux à plusieurs dimensions

Chapitre 3 Tableaux à plusieurs dimensions Chapitre 3 Tableaux à plusieurs dimensions Pascal Lando Faculté de mathématiques et d informatique Amiens http://www.laria.u-picardie.fr/~lando pascal.lando@u-picardie.fr 19 février 2007 Plan du cours

Plus en détail

Corrigé Contrôle terminal : Bioanalyse (EL6BIOFM) 6 mai 2014

Corrigé Contrôle terminal : Bioanalyse (EL6BIOFM) 6 mai 2014 Corrigé Contrôle terminal : Bioanalyse (EL6BIOFM) 6 mai 2014 Exercice 1 (4,5 points) 1. Donner la définition de l acronyme BLAST. (0,5 pt) : Basic Local Alignment Search Tool 2. Expliquer les principes

Plus en détail

c) Calculer MP. 3) Déterminer l'arrondi au degré de la mesure de Dˆ.

c) Calculer MP. 3) Déterminer l'arrondi au degré de la mesure de Dˆ. Exercice :(Amiens 1995) Les questions 2, 3 et 4 sont indépendantes. L'unité est le centimètre. 1) Construire un triangle MAI rectangle en A tel que AM = 8 et IM = 12. Indiquer brièvement les étapes de

Plus en détail

Chapitre 7 Organisation et évolution des génomes

Chapitre 7 Organisation et évolution des génomes Chapitre 7 Organisation et évolution des génomes Enseignant : Benoit Nabholz benoit.nabholz@univ-montp2.fr Année 2014-15 I. Architecture des génomes I.1 Le génomes des métazoaires I.2 Le génomes des Eubactéries

Plus en détail

Arithmétique Algorithmique. http://www.math.univ-lyon1.fr/~roblot/ens.html

Arithmétique Algorithmique. http://www.math.univ-lyon1.fr/~roblot/ens.html Arithmétique Algorithmique http://www.math.univ-lyon1.fr/~roblot/ens.html Partie III Algorithmes classiques 1 Coût de la multiplication et de la division 2 Exponentiation rapide 3 Algorithme d Euclide

Plus en détail

VECTEURS EXERCICES CORRIGES

VECTEURS EXERCICES CORRIGES Exercice n 1. VECTEURS EXERCICES CORRIGES On considère un hexagone régulier ABCDEF de centre O, et I et J les milieux respectifs des segments [AB] et [ED]. En utilisant les lettres de la figure citer :

Plus en détail

Dessin de Graphes. Romain Bourqui. Maître de Conférences romain.bourqui@labri.fr

Dessin de Graphes. Romain Bourqui. Maître de Conférences romain.bourqui@labri.fr Dessin de Graphes Romain Bourqui Maître de Conférences romain.bourqui@labri.fr Dessin de Graphes Plan Introduction Dessin de graphes planaires Dessin hiérarchique Dessin par analogie physique Dessin de

Plus en détail

M2 Informatique/Réseaux Université Pierre et Marie Curie UE APMM

M2 Informatique/Réseaux Université Pierre et Marie Curie UE APMM TD TECHNIQUES DE CODAGE ET DE COMPRESSION. LANGAGE / CODAGE / VALENCE.. Rappels Toute fraction intelligible d un message est constituée de symboles. Le langage est l ensemble de ces symboles. Un codage

Plus en détail

Introduction aux Systèmes Dynamiques

Introduction aux Systèmes Dynamiques Introduction aux Systèmes Dynamiques Introduction Deux grands chapitres : Les équations différentielles ordinaires dans IR Les systèmes d équations différentielles dans IR² Applications : Dynamique des

Plus en détail

Bioinformatique BTV Alignement de Séquences

Bioinformatique BTV Alignement de Séquences 1 / 60 Bioinformatique BTV Alignement de Séquences Jean-Michel Richer jean-michel.richer@univ-angers.fr http://www.info.univ-angers.fr/pub/richer Juillet 2008 2 / 60 Plan Plan 1 Rappels 2 Alignement multiple

Plus en détail