Le Dépistage Prénatal Non Invasif de la Trisomie 21 : du rêve à la réalité

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimension: px
Commencer à balayer dès la page:

Download "Le Dépistage Prénatal Non Invasif de la Trisomie 21 : du rêve à la réalité"

Transcription

1 PARIS ILE-DE-FRANCE OUEST Le Dépistage Prénatal Non Invasif de la Trisomie 21 : du rêve à la réalité Françoise Muller Hôpital Robert Debré

2 Le contexte

3 Le dépistage prénatal de la trisomie 21 repose sur trois critères :. Age Maternel. Signes échographiques. Marqueurs sériques maternels Jusqu en 2010 ces critères étaient utilisés de façon indépendante. En 2010, ils sont progressivement utilisés de façon combinée.

4 Ce dépistage précède la phase de diagnostic. Le dépistage permet d identifier les patientes à risque accru de trisomie 21 auxquelles on propose le diagnostic. Dépistage : faux-positifs (on inquiète à tort) et fauxnégatifs (on rassure à tort). Le diagnostic repose sur le caryotype fœtal. Un prélèvement fœtal est indispensable, amniocentèse (liquide amniotique) ou biopsie de trophoblaste (placenta) Risque iatrogène 1%

5 2010 : mise en place à l échelon national d une politique de combinaison des risques au 1 er trimestre de la grossesse : âge maternel + marqueurs sériques + clarté nucale Objectif : Diminuer le nb de gestes invasifs

6 Bilan national De moins en moins de gestes invasifs pour déceler autant de cas de Tri Caryo T21 Caryo T21 Age maternel MSM TOTAL VPP 1/70 1/30 1/27

7 Peut-on encore faire mieux?

8 Le DPNI : Diagnostic prénatal non invasif Avis N 120 du CCNE : Questions éthiques associées au développement des tests génétiques fœtaux sur sang maternel. «Le test génétique fœtal de T21 sur sang maternel pourrait être progressivement introduit comme un élément du dépistage combiné actuel, ( ) puisqu il permet de diminuer le nb de prélèvements invasifs». Cet avis favorable a été interprété comme ouvrant la possibilité de réaliser un DPNI de la trisomie 21 à toutes les femmes enceintes dès aujourd hui.

9 Du rêve... à la réalité Aspects techniques Cellules fœtales : technique abandonnée en 2003 ADN fœtal Source : les cellules trophoblastiques Détection 5-6 SA Disparition rapide après accouchement Pas de persistance après grossesse

10 ADN total circulant : - mélange ADN maternel et ADN fœtal - dégradé Fraction fœtale : 5-10% ADN total âge gestationnel body mass index BMI ethnie?

11 ADN fœtal circulant : représentatif des 23 types de chromosomes Ex : Chromosome 21, copies ADN foetal ADN fœtal si TRI maternal copies 10 fetal copies 90 maternal copies 15 fetal copies Chromosome 21 1,35% versus 1,45% de ADN

12 Problème : 1. Le chromosome 21 supplémentaire n est pas muté = identique. 2. Comment mettre en évidence cette petite différence quantitative de 0,10% du chromosome 21? Quantification par «massively parallel sequencing (MPS)» 18 patientes (terme médian : 18 semaines) Tous les cas (9) correctement identifiés 14 patientes (terme médian : 14 semaines) Tous les cas (9) correctement identifiés

13 Dosage chromosomique foetal par MPS : concept 1. ADN (maternel et fœtal) est découpé en petit fragments 2. ADN est séquencé TCCGCCCAGGCCATGAGGGACCTGGAAATGGCTGAT Mapping to the human genome 3. Chaque séquence d ADN est comparée à un génome témoin En conséquence seules les anomalies déséquilibrées sont détectables, donc les triploïdies ne sont pas détectées!

14 4. Dosage statistique Interprétation Z score : = %21 sample mean %21 référence /SD %21 référence Cut-off Z score > 3 (%21 > 99.9 percentile) Résultat: «Positif» vs «Négatif»

15 Etude n = A Gest Paloma ki et al, 2011 Paloma ki et al, ( ) ( ) Echec ou exclusion n = (%) Echantillons euploïdes détectés/tot al (n =) Echantillons aneuploïdes détectés/total (n =) % Sensibi lité % Spécifi cité 13 (0.8%) 1468/ ,+ 21: 209/ (0.9%) 1683/ / / ,+ 18: 59/59 47,+ 13: 11/12 47,+ 21: 210/ Etudes réalisées chez des patientes à risque accru de trisomie 21 : âge maternel, signes échographiques, MSM > 1/250.

16 Etude n = Term e moy en Echec ou exclusio n n (%) Echantillons euploïdes détectés/total (n =) Echantillons aneuploïdes détectés/total (n =) % Sen % Spé Sparks et al, ( ) 0 252/252 47,+ 18: 7/7 47,+ 21: 39/39 Ashoor et al, (0.8%) 297/ /297 47,+ 18: 49/50 47,+ 21: 50/ Norton et al, ( ) 148 (4.6%) 2887/ / ,+ 18: 37/38 47,+ 21: 81/ Nicolaides et al, 2012*** 2049 (10-13) (4.9%) 1937/ / ,+ 18: 2/2 47,+ 21: 8/ *** en population générale

17 Diagnostic non invasif des aneuploïdies par MPS : la question des «no result» Etude n = Age Gest moyen Total «no result» (%) Palomaki et al, Genet Med 2012 Bianchi et al, Obstet Gynecol 2012 Norton et al, Am J Obstet Gynecol 2012 Zimmermann et al, Prenat Diagn ( ) ( ) ( ) ( ) Les échecs pré-analytique/analytique (extraction ADN, séquençage) physiologiques : fraction ADN foetal trop faible (Age gestationnel, BMI )

18 Dosage chromosomique foetal par MPS «ciblée»: concept Capture ou enrichissement ciblé (Digital ANalysis of Selected Regions DANSR: 384 loci) TCCGCCCAGGCCATGAGGGACCTGGAAATGGCTGAT Mapping to the human genome

19 Aneuploïdies et ADN fœtal circulant : Dépistage ou Diagnostic? Dépistage Test offert à une population sans risque connu Diagnostic Test offert à une population avec des symptômes ou à risque En dépistage on privilégie la sensibilité (identifier correctement ceux qui ont la maladie) et en diagnostic la spécificité (identifier ceux qui n ont pas la maladie)

20 Diagnostic non invasif des aneuploïdies par MPS : Quels laboratoires? Laboratoire Type de test Age Gest Résultat Chromosomes étudiés Sequenom (USA) Whole genome (MaterniT21 Plus) 12SA POS/NEG X.Y Verinata (USA) Whole genome (Verifi) 12SA POS/NEG X.Y Lifecodexx (Allemagne) Whole genome (Praenatest) 12SA POS/NEG Natera (USA) Targeted (Panorama) 11SA Risque X.Y Arioso (USA) Targeted (Harmony) 12SA Risque X.Y

21 Diagnostic non invasif des aneuploïdies par MPS : la situation en France? AUCUN laboratoire en France ne propose un test en routine à ce jour. Plusieurs projets en cours ou à venir, notamment : PHRC SEQ21 (terminé) : - Hôpital Necker-Enfants Malade + Génoscope - Patientes à risque - Etude non interventionnelle = faisabilité Etude SEHDA (Novembre 2013) : - Etude multicentrique (30 centres) + Laboratoire CERBA - Patientes à risque - Etude non interventionnelle STIC SAFE21 (début prévu Octobre 2013) : - Hôpital Necker-Enfants Malade + Cytogénétique Necker - Patientes à risque (dépistage combiné T1) - Etude prospective randomisée (DPNI vs amniocentèse/bt)

22 En CONCLUSION Aucun laboratoire en France ne propose un test en routine à ce jour. Test fait à l étranger concluant «Trisomie 21» : un caryotype sur amniocentèse est réalisé avant de proposer une IMG. Peu d études en population générale. Prévu en France (et ailleurs) exclusivement chez les patientes à risque accru de trisomie 21. Non réalisé en France si signe d appel échographique. Accepter des faux-positifs et des faux-négatifs. DPNI = en France «Super Dépistage» non invasif. Etape supplémentaire intermédiaire entre MSM et le caryotype. Prise en charge financière? Coût actuel : 1250 euros en Allemagne 1500 euros à AHP (San Diego, USA) Coût futur? Délai de résultat : 2 à 3 semaines ; 5% de non-résultats

23 Le rêve ne s écroule pas, le rêve a ses réalités

Les petis signes de T21 : comment ça marche et à quoi ça sert? Christophe Vayssière (Toulouse) DIU d echographie 2011

Les petis signes de T21 : comment ça marche et à quoi ça sert? Christophe Vayssière (Toulouse) DIU d echographie 2011 Les petis signes de T21 : comment ça marche et à quoi ça sert? Christophe Vayssière (Toulouse) DIU d echographie 2011 2 types de «petits signes»? Il a 2 types de petits signes de T21 : 1/ les signes suite

Plus en détail

OPINION DE COMITÉ DE LA SOGC

OPINION DE COMITÉ DE LA SOGC N 287, février 2013 État actuel du dépistage prénatal non effractif du syndrome de Down, de la trisomie 18 et de la trisomie 13 au moyen d ADN acellulaire se trouvant dans le plasma maternel La présente

Plus en détail

OUTIL D'EVALUATION DU TEMPS ARC / CHEF DE PROJET PROMOTEUR REQUIS POUR UNE RECHERCHE BIOMEDICALE V 2.3 DE L OUTIL NOTICE D UTILISATION

OUTIL D'EVALUATION DU TEMPS ARC / CHEF DE PROJET PROMOTEUR REQUIS POUR UNE RECHERCHE BIOMEDICALE V 2.3 DE L OUTIL NOTICE D UTILISATION OUTIL D'EVALUATION DU TEMPS ARC / CHEF DE PROJET PROMOTEUR REQUIS POUR UNE RECHERCHE BIOMEDICALE V 2.3 DE L OUTIL NOTICE D UTILISATION i) Contexte :... - 2 - ii) But de l outil :... - 2 - iii) Fonctionnement

Plus en détail

I - CLASSIFICATION DU DIABETE SUCRE

I - CLASSIFICATION DU DIABETE SUCRE I - CLASSIFICATION DU DIABETE SUCRE 1- Définition : Le diabète sucré se définit par une élévation anormale et chronique de la glycémie. Cette anomalie est commune à tous les types de diabète sucré, mais

Plus en détail

Césarienne pour toutes

Césarienne pour toutes Césarienne pour toutes Méthodologie Revue de la littérature : - PUBMED de 2003 à nos jours - Mots clefs: urinary incontinence AND cesarean section (210 publications) fecal incontinence AND cesarean section

Plus en détail

Les tests génétiques à des fins médicales

Les tests génétiques à des fins médicales Les tests génétiques à des fins médicales Les tests génétiques à des fins médicales Nous avons tous hérité d une combinaison unique de gènes de la part de nos parents. Cette constitution originale et l

Plus en détail

ELABORATION DU PLAN DE MONITORING ADAPTE POUR UNE RECHERCHE BIOMEDICALE A PROMOTION INSTITUTIONNELLE

ELABORATION DU PLAN DE MONITORING ADAPTE POUR UNE RECHERCHE BIOMEDICALE A PROMOTION INSTITUTIONNELLE Référence HCL : Titre de l étude : ELABORATION DU PLAN DE MONITORING ADAPTE POUR UNE RECHERCHE BIOMEDICALE A PROMOTION INSTITUTIONNELLE Investigateur Coordonnateur : Méthode. Définition du niveau de risque

Plus en détail

Biométrie foetale. Comité éditorial pédagogique de l'uvmaf. Date de création du document 01/071011. - Support de Cours (Version PDF) -

Biométrie foetale. Comité éditorial pédagogique de l'uvmaf. Date de création du document 01/071011. - Support de Cours (Version PDF) - Biométrie foetale Comité éditorial pédagogique de l'uvmaf Date de création du document 01/071011 Table des matières I Techniques de biométrie...3 I.1 Mesure de la longueur cranio-caudale...3 I.2 Mesure

Plus en détail

Qu est-ce qu un test génétique?

Qu est-ce qu un test génétique? 8 Vous pouvez rechercher les laboratoires de diagnostic dans votre pays par nom de maladie ou de gène à l'adresse suivante: Qu est-ce qu un test génétique? http://www.orpha.net/consor/cgi-bin/clinicallabs.php?lng=fr

Plus en détail

1 les caractères des êtres humains.

1 les caractères des êtres humains. Quelques rappels des classes précédentes ACTIVITÉ livre pages 8 et 9 : apprendre le bilan de la page 9 Les êtres vivants sont répartis en espèces. Chaque être vivant est formé de cellules. schéma d une

Plus en détail

Fondation PremUp. Mieux naître pour mieux vivre

Fondation PremUp. Mieux naître pour mieux vivre Fondation PremUp Mieux naître pour mieux vivre Une fondation de coopération scientifique initiée par les pouvoirs publics en 2007 6 membres fondateurs : L Assistance Publique des Hôpitaux de Paris, l Inserm,

Plus en détail

À compter de 2010 les codes du chapitre XVI ne doivent plus être employés au-delà de 2 ans. Créé le 1 er Mars 2011

À compter de 2010 les codes du chapitre XVI ne doivent plus être employés au-delà de 2 ans. Créé le 1 er Mars 2011 FASCICULE VI AFFECTIONS DU NOUVEAU-NÉ Emploi des codes du chapitre XVI Le chapitre XVI est celui de Certaines affections dont l origine se situe dans la période périnatale. La définition de la période

Plus en détail

DÉTECTION DES ANEUPLOÏDIES DES CHROMOSOMES 13, 18, 21, X ET Y PAR QF-PCR (RÉFÉRENCE 2013.03.004) Avis d évaluation

DÉTECTION DES ANEUPLOÏDIES DES CHROMOSOMES 13, 18, 21, X ET Y PAR QF-PCR (RÉFÉRENCE 2013.03.004) Avis d évaluation Analyse tirée de l'avis transmis au ministre le 28 février 2014. Pour en savoir plus sur les Processus et critères d'évaluation des analyses de biologie médicale de l INESSS cliquez ici. DÉTECTION DES

Plus en détail

Streptocoque B :apports des tests en fin de grossesse, nouvelles propositions.

Streptocoque B :apports des tests en fin de grossesse, nouvelles propositions. Streptocoque B :apports des tests en fin de grossesse, nouvelles propositions. Exemple d une étude prospective sur la place d un test de détection rapide du SGB. HONORAT Raphaële 1, ASSOULINE Corinne 1,

Plus en détail

ASPECT ECHOGRAPHIQUE NORMAL DE LA CAVITE UTERINE APRES IVG. Dr D. Tasias Département de gynécologie, d'obstétrique et de stérilité

ASPECT ECHOGRAPHIQUE NORMAL DE LA CAVITE UTERINE APRES IVG. Dr D. Tasias Département de gynécologie, d'obstétrique et de stérilité Hôpitaux Universitaires de Genève ASPECT ECHOGRAPHIQUE NORMAL DE LA CAVITE UTERINE APRES IVG Dr D. Tasias Département de gynécologie, d'obstétrique et de stérilité Introduction (1) L IVG chirurgicale est

Plus en détail

Gènes Diffusion - EPIC 2010

Gènes Diffusion - EPIC 2010 Gènes Diffusion - EPIC 2010 1. Contexte. 2. Notion de génétique animale. 3. Profil de l équipe plateforme. 4. Type et gestion des données biologiques. 5. Environnement Matériel et Logiciel. 6. Analyses

Plus en détail

Biomarqueurs en Cancérologie

Biomarqueurs en Cancérologie Biomarqueurs en Cancérologie Définition, détermination, usage Biomarqueurs et Cancer: définition Anomalie(s) quantitative(s) ou qualitative(s) Indicative(s) ou caractéristique(s) d un cancer ou de certaines

Plus en détail

Génétique et génomique Pierre Martin

Génétique et génomique Pierre Martin Génétique et génomique Pierre Martin Principe de la sélections Repérage des animaux intéressants X Accouplements Programmés Sélection des meilleurs mâles pour la diffusion Index diffusés Indexation simultanée

Plus en détail

INFORMATION GÉNÉTIQUE et REPRODUCTION SEXUÉE

INFORMATION GÉNÉTIQUE et REPRODUCTION SEXUÉE Partie 1, Chapitre 4 INFORMATION GÉNÉTIQUE et REPRODUCTION SEXUÉE Constat : à l'exception des jumeaux, chaque individu est unique. Ses caractères héréditaires dependent des info génétiques (allèles) portées

Plus en détail

Apport de la biologie moléculaire au diagnostic des parasitoses

Apport de la biologie moléculaire au diagnostic des parasitoses Apport de la biologie moléculaire au diagnostic des parasitoses M-H H BESSIERES,, S. CASSAING, A. BERRY, R. FABRE, J-F.. MAGNAVAL Service de Parasitologie-Mycologie Diagnostic biologique d une d parasitose

Plus en détail

ECHOGRAPHIE EN GYNECOLOGIE ET EN OBSTETRIQUE

ECHOGRAPHIE EN GYNECOLOGIE ET EN OBSTETRIQUE ECHOGRAPHIE EN GYNECOLOGIE ET EN OBSTETRIQUE (Diplôme Interuniversitaire National d ) 17/02/2015 avec Bordeaux, Brest, Lille, Lyon, Marseille, Nantes, Paris V et XII, Toulouse et Tours Objectifs : Formation

Plus en détail

Nouvelles techniques moléculaires de dépistage prénatal de l aneuploïdie chromosomique

Nouvelles techniques moléculaires de dépistage prénatal de l aneuploïdie chromosomique MISE À JOUR TECHNIQUE DE LA SOGC MISE À JOUR TECHNIQUE DE LA SOGC N 210, juillet 2008 Nouvelles techniques moléculaires de dépistage prénatal de l aneuploïdie chromosomique La présente mise à jour technique

Plus en détail

Indications de la césarienne programmée à terme

Indications de la césarienne programmée à terme Indications de la césarienne programmée à terme Janvier 2012 Quelles sont les indications de la césarienne programmée? Utérus cicatriciel Transmissions mère-enfant d infections maternelles Grossesse gémellaire

Plus en détail

Grossesse et HTA. J Potin. Service de Gynécologie-Obstétrique B Centre Olympe de Gouges CHU de Tours

Grossesse et HTA. J Potin. Service de Gynécologie-Obstétrique B Centre Olympe de Gouges CHU de Tours Grossesse et HTA J Potin Service de Gynécologie-Obstétrique B Centre Olympe de Gouges CHU de Tours HTA et grossesse Pathologie fréquente : 2 à 5 % des grossesses (2 à 3 % des multipares, 4 à 8 % des primipares)

Plus en détail

DROITS A L ASSURANCE MATERNITE

DROITS A L ASSURANCE MATERNITE I. Ouverture des droits DROITS A L ASSURANCE MATERNITE Les conditions d ouverture des droits tant aux prestations en nature qu aux prestations en espèce de l assurance maternité s apprécient soit au début

Plus en détail

Charte de la Banque ADN et de Cellules de Généthon

Charte de la Banque ADN et de Cellules de Généthon Sommaire 1. PREAMBULE... 2 2. DEFINITIONS... 2 3. CADRE LEGAL... 3 4. ORGANISATION DE LA BACG... 4 5. PRESTATIONS DE LA BACG... 5 6. MODALITES DE CONTRIBUTION ET D UTILISATION DES SERVICES... 5 7. REGLES

Plus en détail

Infection VIH et Grossesse Rédigée par : Laurichesse Hélène, C Jacomet

Infection VIH et Grossesse Rédigée par : Laurichesse Hélène, C Jacomet Procédure qualité : «VIH et grossesse» Page 1 sur 6 CHU de Clermont-Ferrand Service de Gynécologie-obstétrique Pôle Gynécologie-Obstétrique biologie de la reproduction Procédure médicale Infection VIH

Plus en détail

Marquage CE et dispositifs médicaux

Marquage CE et dispositifs médicaux Marquage CE et dispositifs médicaux Références officielles Trois principales directives européennes réglementent la mise sur le marché et la mise en service des dispositifs médicaux : la directive 90/385/CEE

Plus en détail

la grossesse de la grossesse Ce qui a précédé Les débuts Les conditions de «mise en route» de la grossesse

la grossesse de la grossesse Ce qui a précédé Les débuts Les conditions de «mise en route» de la grossesse FICHE ACTION N o 1 Ce qui a précédé la grossesse Les débuts de la grossesse Comprendre pour agir Les conditions de «mise en route» de la grossesse D après l enquête nationale périnatale 2003 (1), quand

Plus en détail

Lundis de la Santé - Brest 12 Décembre 2005. Tabac et Grossesse M. COLLET

Lundis de la Santé - Brest 12 Décembre 2005. Tabac et Grossesse M. COLLET Lundis de la Santé - Brest 12 Décembre 2005 Tabac et Grossesse M. COLLET Tabac et grossesse Problème majeur de santé publique 25 à 33 % des femmes fument pendant la grossesse Nombreuses conséquences obstétricales

Plus en détail

Instructions dans la recherche clinique

Instructions dans la recherche clinique Instructions dans la recherche clinique I. CNIL 1. Histoire de sa création 2. Organisation et composition 3. Missions 4. Définition des données à caractère personnel et de l anonymisation II. III. IV.

Plus en détail

Prise en charge des déchirures périnéales obstétricales sévères. Courjon M, Ramanah R, Eckman A, Toubin C, Riethmuller D.

Prise en charge des déchirures périnéales obstétricales sévères. Courjon M, Ramanah R, Eckman A, Toubin C, Riethmuller D. Prise en charge des déchirures périnéales obstétricales sévères Courjon M, Ramanah R, Eckman A, Toubin C, Riethmuller D. Introduction Incidence : 0,5 à 3 % Importance de la reconnaissance et d un traitement

Plus en détail

Montréal, 24 mars 2015. David Levine Président et chef de la direction DL Strategic Consulting. DL Consulting Strategies in Healthcare

Montréal, 24 mars 2015. David Levine Président et chef de la direction DL Strategic Consulting. DL Consulting Strategies in Healthcare Montréal, 24 mars 2015 David Levine Président et chef de la direction DL Strategic Consulting 1 RSSPQ, 2013 2 MÉDECINE INDIVIDUALISÉE Médecine personnalisée Médecine de précision Biomarqueurs Génomique

Plus en détail

Détection et prise en charge de la résistance aux antirétroviraux

Détection et prise en charge de la résistance aux antirétroviraux Détection et prise en charge de la résistance aux antirétroviraux Jean Ruelle, PhD AIDS Reference Laboratory, UCLouvain, Bruxelles Corata 2011, Namur, 10 juin 2011 Laboratoires de référence SIDA (Belgique)

Plus en détail

PRISE EN CHARGE DES PRE ECLAMPSIES. Jérôme KOUTSOULIS. IADE DAR CHU Kremlin-Bicêtre. 94 Gérard CORSIA. PH DAR CHU Pitié-Salpétrière.

PRISE EN CHARGE DES PRE ECLAMPSIES. Jérôme KOUTSOULIS. IADE DAR CHU Kremlin-Bicêtre. 94 Gérard CORSIA. PH DAR CHU Pitié-Salpétrière. PRISE EN CHARGE DES PRE ECLAMPSIES Jérôme KOUTSOULIS. IADE DAR CHU Kremlin-Bicêtre. 94 Gérard CORSIA. PH DAR CHU Pitié-Salpétrière. 75 Pas de conflits d intérêts. Définitions Pré éclampsie Définitions

Plus en détail

Les différentes maladies du coeur

Les différentes maladies du coeur Auteur : Dr Pascal AMEDRO Les différentes maladies du coeur 1. Le cœur normal L oxygène capté dans l air va dans les poumons, où le sang «bleu» est alors oxygéné et devient «rouge». Il est conduit par

Plus en détail

Le syndrome de Noonan

Le syndrome de Noonan Le syndrome Le diagnostic Les aspects génétiques Le traitement, la prise en charge, la prévention Vivre avec En savoir plus Madame, Monsieur, Cette fiche est destinée à vous informer sur le syndrome de

Plus en détail

Maternité et activités sportives

Maternité et activités sportives Maternité et activités sportives L obstétricien est de plus en plus souvent interrogé sur les avantages et les risques de maintenir ou de débuter une APS ou de loisir pendant la grossesse. Transformations

Plus en détail

Annales du Contrôle National de Qualité des Analyses de Biologie Médicale

Annales du Contrôle National de Qualité des Analyses de Biologie Médicale Annales du Contrôle National de Qualité des Analyses de Biologie Médicale Plombémie Plombémie 07PLO1 ; 07PLO2 ; 07PLO3 et 07PLO4 2007 Edition : décembre 2008 Afssaps -143/147, Bd Anatole France F-93285

Plus en détail

ENSEIGNEMENTS ET SÉMINAIRES

ENSEIGNEMENTS ET SÉMINAIRES CHAIRE ESSEC-AVENTIS ÉTHIQUE & BIOTECHNOLOGIES Dans un marché comme celui du médicament où les clients sont d abord des patients, les biotechnologies sont appelées à répondre à un double défi, à la fois

Plus en détail

Maladie hémolytique du nouveau né. Dr Emmanuel RIGAL Unité d hématologie transfusionelle GENEVE Présentation du 13 janvier 2012.

Maladie hémolytique du nouveau né. Dr Emmanuel RIGAL Unité d hématologie transfusionelle GENEVE Présentation du 13 janvier 2012. Maladie hémolytique du nouveau né. Dr Emmanuel RIGAL Unité d hématologie transfusionelle GENEVE Présentation du 13 janvier 2012. HISTORIQUE Période de DESCRIPTION : -Ictère, Anasarque 1609 Louyse BOURGEOIS

Plus en détail

Soins palliatifs en salle de naissance. Pierre Bétrémieux CHU de Rennes 9 octobre 2009 Chantilly

Soins palliatifs en salle de naissance. Pierre Bétrémieux CHU de Rennes 9 octobre 2009 Chantilly Soins palliatifs en salle de naissance Pierre Bétrémieux CHU de Rennes 9 octobre 2009 Chantilly La loi du 22 avril 2005 S applique au nouveau-né Rappelle l interdit de l obstination déraisonnable Et l

Plus en détail

Essais cliniques de phase 0 : état de la littérature 2006-2009

Essais cliniques de phase 0 : état de la littérature 2006-2009 17 èmes Journées des Statisticiens des Centres de Lutte contre le Cancer 4 ème Conférence Francophone d Epidémiologie Clinique Essais cliniques de phase 0 : état de la littérature 2006-2009 Q Picat, N

Plus en détail

Échographie obstétricale

Échographie obstétricale - Support de Cours (Version PDF) - Échographie obstétricale Comité éditorial pédagogique de l'uvmaf Date de création du document 01/03/11 Université Médicale Virtuelle Francophone 1/38 - Support de Cours

Plus en détail

F us u ses c ouc u he h s s po p nt n a t né n es J. L J. an sac CHU H T ou

F us u ses c ouc u he h s s po p nt n a t né n es J. L J. an sac CHU H T ou Fausses couches spontanées J Lansac CHU Tours Définition Avortement : expulsion produit de conception avant 22SA ou enfant

Plus en détail

Hépatite C une maladie silencieuse..

Hépatite C une maladie silencieuse.. Hépatite C une maladie silencieuse.. F. Bally Centre de Maladies Infectieuses et Epidémiologie Institut Central des Hôpitaux Valaisans Histoire Années 70 Hépatite non-a-non-b = hépatite post-transfusionelle

Plus en détail

La maladie de Stargardt

La maladie de Stargardt La maladie Le diagnostic Les aspects génétiques Le traitement, la prise en charge, la prévention Vivre avec En savoir plus Madame, Monsieur, Cette fiche est destinée à vous informer sur la maladie de Stargardt.

Plus en détail

Plateforme Transgenèse/Zootechnie/Exploration Fonctionnelle IBiSA. «Anexplo» Service Transgenèse. Catalogue des prestations

Plateforme Transgenèse/Zootechnie/Exploration Fonctionnelle IBiSA. «Anexplo» Service Transgenèse. Catalogue des prestations Plateforme Transgenèse/Zootechnie/Exploration Fonctionnelle IBiSA «Anexplo» Service Transgenèse Catalogue des prestations 04/01/12 - Page 1 sur 8 Présentation du service de Transgenèse Le service de Transgenèse

Plus en détail

Résistance du VIH-1 aux antirétroviraux dans les compartiments anatomiques et cellulaires

Résistance du VIH-1 aux antirétroviraux dans les compartiments anatomiques et cellulaires Résistance du VIH-1 aux antirétroviraux dans les compartiments anatomiques et cellulaires Jade GHOSN Laboratoire de Virologie CHU Necker-Enfants Malades EA MRT 3620 Paris 5 Réservoirs anatomiques du VIH:

Plus en détail

HEPATITES VIRALES 22/09/09. Infectieux. Mme Daumas

HEPATITES VIRALES 22/09/09. Infectieux. Mme Daumas HEPATITES VIRALES 22/09/09 Mme Daumas Infectieux Introduction I. Hépatite aigu II. Hépatite chronique III. Les différents types d hépatites A. Hépatite A 1. Prévention de la transmission 2. Vaccination

Plus en détail

USAGE PRÉCONISÉ RÉSUMÉ ET EXPLICATION DU TEST PRINCIPE DU TEST

USAGE PRÉCONISÉ RÉSUMÉ ET EXPLICATION DU TEST PRINCIPE DU TEST Pour utilisation en diagnostic in vitro uniquement Stocker entre 2 et 25 C. Ne pas congeler. Le test QuikCheck ffn de Hologic est un test qualitatif permettant de détecter la fibronectine fœtale dans les

Plus en détail

Les renseignements suivants sont destinés uniquement aux personnes qui ont reçu un diagnostic de cancer

Les renseignements suivants sont destinés uniquement aux personnes qui ont reçu un diagnostic de cancer Information importante pour les personnes atteintes d un cancer du poumon non à petites cellules de stade avancé Les renseignements suivants sont destinés uniquement aux personnes qui ont reçu un diagnostic

Plus en détail

Sang, plasma, plaquettes...

Sang, plasma, plaquettes... Sang, plasma, plaquettes... Le don de sang, un geste incontournable En donnant votre sang, vous aidez par exemple une femme qui a perdu beaucoup de sang lors de son accouchement à reprendre des forces,

Plus en détail

BIOPSIE PAR ASPIRATION Sous stéréotaxie

BIOPSIE PAR ASPIRATION Sous stéréotaxie Vous avez appris qu une anomalie a été détectée lors de votre mammographie. Afin d investiguer cette anomalie, le radiologue a pris la décision d effectuer une biopsie par aspiration sous stéréotaxie.

Plus en détail

«Adaptation de la mise en œuvre des bonnes pratiques cliniques en fonction des caractéristiques de certaines recherches»

«Adaptation de la mise en œuvre des bonnes pratiques cliniques en fonction des caractéristiques de certaines recherches» Synthèse de la table ronde 2- Giens XXI -octobre 2005 «Adaptation de la mise en œuvre des bonnes pratiques cliniques en fonction des caractéristiques de certaines recherches» Pierre-Henri.Bertoye, Soizic.Courcier-Duplantier,

Plus en détail

Dépistage du cancer colorectal :

Dépistage du cancer colorectal : Dépistage du cancer colorectal : Quels enjeux? Robert Benamouzig Gastro-entérologie Hôpital Avicenne Bobigny Le cancer colorectal dans le monde 3ème cause de cancer Augmentation 1975 : 500 000 cas 1990

Plus en détail

Les définitions des saignements ACS/PCI

Les définitions des saignements ACS/PCI Les définitions des saignements ACS/PCI Les définitions classiques et leurs limites Les nouvelles définitions Des éléments pour de futures définitions François SCHIELE, CHU de BESANCON Définition «classique»,

Plus en détail

Conférence de Presse 11/09/2013. «Système de Surveillance de la Santé Périnatale au Luxembourg»

Conférence de Presse 11/09/2013. «Système de Surveillance de la Santé Périnatale au Luxembourg» Conférence de Presse 11/09/2013 «Système de Surveillance de la Santé Périnatale au Luxembourg» La Santé Périnatale au Luxembourg Etat des lieux Présentation de deux rapports : Surveillance de la Santé

Plus en détail

Donneurs vivants Risques à long terme. Cours de transplantation Univ. Montréal et McGill 5 avril 2013

Donneurs vivants Risques à long terme. Cours de transplantation Univ. Montréal et McGill 5 avril 2013 Donneurs vivants Risques à long terme Michel R. Pâquet MD, PhD Unité de Transplantation Le Centre Hospitalier de l Université de Montréal Hôpital Notre-Dame Montréal Hôtel-Dieu Hôpital Notre-Dame Cours

Plus en détail

LA CONTRACEPTION SUR L INFORMATION REÇUE EN

LA CONTRACEPTION SUR L INFORMATION REÇUE EN LA CONTRACEPTION 1 SATISFACTION DES PATENTES SUR L INFORMATION REÇUE EN POST PARTUM INTRODUCTION Contexte : 2 Élargissement des compétences de SF (contraception & gynécologie de prévention) (1) Rôle dans

Plus en détail

Introduction générale

Introduction générale Introduction générale Touchant près de 600 nouvelles personnes chaque année en France, la leucémie myéloïde chronique est une maladie affectant les cellules du sang et de la moelle osseuse (située au cœur

Plus en détail

Devenir des soignants non-répondeurs à la vaccination anti-vhb. Dominique Abiteboul - GERES Jean-François Gehanno Michel Branger

Devenir des soignants non-répondeurs à la vaccination anti-vhb. Dominique Abiteboul - GERES Jean-François Gehanno Michel Branger Devenir des soignants non-répondeurs à la vaccination anti-vhb Dominique Abiteboul - GERES Jean-François Gehanno Michel Branger Contexte Hépatite B = risque professionnel pour les soignants Passé futur

Plus en détail

INFORMATION À DESTINATION DES PROFESSIONNELS DE SANTÉ LE DON DU VIVANT

INFORMATION À DESTINATION DES PROFESSIONNELS DE SANTÉ LE DON DU VIVANT INFORMATION À DESTINATION DES PROFESSIONNELS DE SANTÉ LE DON DU VIVANT QUELS RÉSULTATS POUR LE RECEVEUR? QUELS RISQUES POUR LE DONNEUR? DONNER UN REIN DE SON VIVANT PEUT CONCERNER CHACUN /////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////

Plus en détail

Sang, plasma, plaquettes...

Sang, plasma, plaquettes... Guide des dons Sang, plasma, plaquettes... et vous, que donnerez-vous? Le don de sang, un geste incontournable En donnant votre sang, vous aidez par exemple une femme qui a perdu beaucoup de sang lors

Plus en détail

SECTION II RELATIVE AU PRÉLEVEUR

SECTION II RELATIVE AU PRÉLEVEUR SECTION II RELATIVE AU PRÉLEVEUR II-0 INDEX SECTION II Pages Section relative au préleveur Heures d ouvertures des laboratoires pour clients externes Requête régionale II-2 II-2 II-3 Informations requises

Plus en détail

des banques pour la recherche

des banques pour la recherche ADN, cellules, tissus... des banques pour la recherche FÉVRIER 2009 Les banques d échantillons de matériel biologique (tissus, cellules, ADN ), appelées biobanques, mettent à disposition des chercheurs

Plus en détail

Principes de bonne pratique :

Principes de bonne pratique : Principes de bonne pratique : Recommandations en vue de la création de bases de données génétiques nationales Le présent document a été élaboré par le Groupe d experts d INTERPOL sur le suivi des techniques

Plus en détail

Quantification de l AgHBs Pouquoi? Quand?

Quantification de l AgHBs Pouquoi? Quand? Quantification de l AgHBs Pouquoi? Quand? Michelle Martinot-Peignoux Service d Hépatologie Hôpital Beaujon Université Paris-Diderot INSERM U-773/CRB3 Clichy-France Plan Introduction Applications Cliniques

Plus en détail

ACADÉMIE NATIONALE DE MÉDECINE 16, RUE BONAPARTE 75272 PARIS CEDEX 06 TÉL : 01 42 34 57 70 FAX : 01 40 46 87 55

ACADÉMIE NATIONALE DE MÉDECINE 16, RUE BONAPARTE 75272 PARIS CEDEX 06 TÉL : 01 42 34 57 70 FAX : 01 40 46 87 55 ACADÉMIE NATIONALE DE MÉDECINE 16, RUE BONAPARTE 75272 PARIS CEDEX 06 TÉL : 01 42 34 57 70 FAX : 01 40 46 87 55 RAPPORT au nom de la Commission I (Biologie Immunologie Génétique) Les banques de sang de

Plus en détail

Pour l'instant, les connaissances actuelles ne permettent pas d'empêcher un cancer du sein de survenir.

Pour l'instant, les connaissances actuelles ne permettent pas d'empêcher un cancer du sein de survenir. Dépistage Pour l'instant, les connaissances actuelles ne permettent pas d'empêcher un cancer du sein de survenir. Par contre, nous pouvons tenter de le dépister plus tôt afin d'avoir plus de chances de

Plus en détail

Eléments d'information. sur le Téléthon

Eléments d'information. sur le Téléthon Eléments d'information sur le Téléthon 2 Sommaire P. 3 Avant-propos La recherche sur l embryon P. 4 - L AFM-Téléthon soutient la recherche sur les cellules souches embryonnaires. P. 5 - C est quoi les

Plus en détail

2011-2014. Plan national maladies rares. Axes, Mesures, Actions. Qualité de la prise en charge, Recherche, Europe : une ambition renouvelée

2011-2014. Plan national maladies rares. Axes, Mesures, Actions. Qualité de la prise en charge, Recherche, Europe : une ambition renouvelée 2011-2014 Plan national maladies rares Qualité de la prise en charge, Recherche, Europe : une ambition renouvelée Axes, Mesures, Actions 1 Axe A : Améliorer la qualité de la prise en charge du patient

Plus en détail

Dr E. CHEVRET UE2.1 2013-2014. Aperçu général sur l architecture et les fonctions cellulaires

Dr E. CHEVRET UE2.1 2013-2014. Aperçu général sur l architecture et les fonctions cellulaires Aperçu général sur l architecture et les fonctions cellulaires I. Introduction II. Les microscopes 1. Le microscope optique 2. Le microscope à fluorescence 3. Le microscope confocal 4. Le microscope électronique

Plus en détail

Diagnostic des Hépatites virales B et C. P. Trimoulet Laboratoire de Virologie, CHU de Bordeaux

Diagnostic des Hépatites virales B et C. P. Trimoulet Laboratoire de Virologie, CHU de Bordeaux Diagnostic des Hépatites virales B et C P. Trimoulet Laboratoire de Virologie, CHU de Bordeaux Diagnostic VHC Dépistage: pourquoi? Maladie fréquente (Ac anti VHC chez 0,84% de la population soit 367 055

Plus en détail

Incontinence urinaire. DR.L.PEYRAT C.H.U. Tenon, Paris

Incontinence urinaire. DR.L.PEYRAT C.H.U. Tenon, Paris Incontinence urinaire DR.L.PEYRAT C.H.U. Tenon, Paris INCONTINENCE URINAIRE : DEFINITION 2002 ICS (Internationnal Contience Society) : perte involontaire d urine, on distingue Symptôme : élément décrit

Plus en détail

Projet de grossesse : informations, messages de prévention, examens à proposer

Projet de grossesse : informations, messages de prévention, examens à proposer DOCUMENT D INFORMATION POUR LES PROFESSIONNELS Projet de grossesse : informations, messages de prévention, examens à proposer Septembre 2009 DÉFINITION ET OBJECTIF Dès lors qu ils expriment un projet de

Plus en détail

Université Victor Segalen Bordeaux 2, 2008

Université Victor Segalen Bordeaux 2, 2008 Université Victor Segalen Bordeaux 2, 2008 Contenu du dossier Énoncé. Article à analyser. Corrigé. Article avec texte surligné. Énoncé Université Victor Segalen Bordeaux 2 UFR des Sciences Médicales 1

Plus en détail

Tests paramétriques de comparaison de 2 moyennes Exercices commentés José LABARERE

Tests paramétriques de comparaison de 2 moyennes Exercices commentés José LABARERE Chapitre 5 UE4 : Biostatistiques Tests paramétriques de comparaison de 2 moyennes Exercices commentés José LABARERE Année universitaire 2010/2011 Université Joseph Fourier de Grenoble - Tous droits réservés.

Plus en détail

Le programme complémentaire santé le plus complet: Meuhedet See

Le programme complémentaire santé le plus complet: Meuhedet See Le programme complémentaire santé le plus complet: Meuhedet See Chers adhérents, Le programme de la complémentaire santé Meuhedet See est à la fois complet et révolutionnaire, il a pour but de procurer

Plus en détail

Évolution des pratiques vaccinales : 3. vaccination après la grossesse

Évolution des pratiques vaccinales : 3. vaccination après la grossesse Évolution des pratiques vaccinales : 3. vaccination après la grossesse Professeur Emmanuel Grimprel Service de Pédiatrie Générale, Hôpital Trousseau, Paris Université Pierre et Marie Curie, Paris Déclaration

Plus en détail

PRISE EN CHARGE DES LESIONS SPINCTERIENNES ANALES DU POST-PARTUM : DU CURATIF AU PREVENTIF

PRISE EN CHARGE DES LESIONS SPINCTERIENNES ANALES DU POST-PARTUM : DU CURATIF AU PREVENTIF PRISE EN CHARGE DES LESIONS SPINCTERIENNES ANALES DU POST-PARTUM : DU CURATIF AU PREVENTIF Laurent ABRAMOWITZ Unité de proctologie médico-chirurgicale Hôpital Bichat Claude Bernard 95, Rue de Passy 75016

Plus en détail

QUELLES SONT LES OPTIONS DU TRAITEMENT DE LA LMC?

QUELLES SONT LES OPTIONS DU TRAITEMENT DE LA LMC? QUELLES SONT LES OPTIONS DU TRAITEMENT DE LA LMC? On vous a diagnostiqué une leucémie myéloïde chronique (LMC) et il se peut que vous ayez déjà débuté un traitement. Le traitement de la LMC dépend largement

Plus en détail

Le test de dépistage qui a été pratiqué à la

Le test de dépistage qui a été pratiqué à la élever CommenT UN enfant ayant une drépanocytose Q Le test de dépistage qui a été pratiqué à la maternité vient de révéler que votre bébé est atteint de drépanocytose. Aujourd hui, votre enfant va bien,

Plus en détail

Césarienne et extraction fœtale difficile. Journée chirurgie - 4 Décembre 2010 Dr AS Coutin

Césarienne et extraction fœtale difficile. Journée chirurgie - 4 Décembre 2010 Dr AS Coutin Césarienne et extraction fœtale difficile Journée chirurgie - 4 Décembre 2010 Dr AS Coutin 1 Extraction fœtale : le cœur de l intervention césarienne Temps délicat Illusoire de croire que la césarienne

Plus en détail

Incontinence anale du post-partum

Incontinence anale du post-partum Incontinence anale du post-partum Laurent Abramowitz Unité de proctologie médico-chirurgicale de l hôpital Bichat, Paris Et cabinet libéral Prévalence Inc anale France (1) : 11% > 45 ans Damon et al (2):Pop

Plus en détail

NAVA pourquoi pas. Stéphane Delisle RRT, PhD, FCCM Mohamed Ait Si M Hamed, inh. BSc.

NAVA pourquoi pas. Stéphane Delisle RRT, PhD, FCCM Mohamed Ait Si M Hamed, inh. BSc. NAVA pourquoi pas Stéphane Delisle RRT, PhD, FCCM Mohamed Ait Si M Hamed, inh. BSc. 7e Symposium en thérapie respiratoire HSCM 1 décembre 2012 Le mode NAVA o Neurally Adjusted Ventilatory Assist Neuro-Asservissement

Plus en détail

E x t rait des Mises à jour en Gynécologie et Obstétri q u e

E x t rait des Mises à jour en Gynécologie et Obstétri q u e CNGOF_MAJ_TITRES.qxp 17/12/09 17:26 Page 1 (1,1) COL L ÈGE N ATIONAL DES GYNÉ COLOGUES E T OBS TÉ TRICIENS FR A NÇ A IS Président : Professeur J. L a n s a c E x t rait des Mises à jour en Gynécologie

Plus en détail

Nous avons augmenté de manière significative notre productivité avec le même effectif

Nous avons augmenté de manière significative notre productivité avec le même effectif Nous avons augmenté de manière significative notre productivité avec le même effectif SMART Automation, optimiser la productivité SMART Automation, optimiser la productivité Introduction Depuis plus de

Plus en détail

Excel Avancé. Plan. Outils de résolution. Interactivité dans les feuilles. Outils de simulation. La valeur cible Le solveur

Excel Avancé. Plan. Outils de résolution. Interactivité dans les feuilles. Outils de simulation. La valeur cible Le solveur Excel Avancé Plan Outils de résolution La valeur cible Le solveur Interactivité dans les feuilles Fonctions de recherche (ex: RechercheV) Utilisation de la barre d outils «Formulaires» Outils de simulation

Plus en détail

Big data et sciences du Vivant L'exemple du séquençage haut débit

Big data et sciences du Vivant L'exemple du séquençage haut débit Big data et sciences du Vivant L'exemple du séquençage haut débit C. Gaspin, C. Hoede, C. Klopp, D. Laborie, J. Mariette, C. Noirot, MS. Trotard bioinfo@genopole.toulouse.inra.fr INRA - MIAT - Plate-forme

Plus en détail

CONTROVERSE : IDR OU QUANTIFERON LORS D'UN CONTAGE EN EHPAD?

CONTROVERSE : IDR OU QUANTIFERON LORS D'UN CONTAGE EN EHPAD? CONTROVERSE : IDR OU QUANTIFERON LORS D'UN CONTAGE EN EHPAD? Hélène MANGEARD François MALADRY Tuberculose : infection mycobactérienne Infection mycobactérienne chronique (M. Tuberculosis ++ ou bacille

Plus en détail

Les plateformes de génétique

Les plateformes de génétique Thérapies ciblées : de l anatomopathologie th l à la biothérapie i Les plateformes de génétique moléculaire PO Schischmanoff UF Génétique moléculaire et oncogénétique CHU Avicenne ACP FHF 29 mars 2012

Plus en détail

Manuel Bioéthique. des Jeunes NOUVELLE ÉDITION ACTUALISÉE ET AUGMENTÉE

Manuel Bioéthique. des Jeunes NOUVELLE ÉDITION ACTUALISÉE ET AUGMENTÉE Manuel Bioéthique des Jeunes NOUVELLE ÉDITION ACTUALISÉE ET AUGMENTÉE Manuel Bioéthique des Jeunes Quoi de plus intime à la vie que la vie elle-même, l'histoire de nos premiers et de nos derniers instants?

Plus en détail

Fécondation in vitro avec don d ovocytes

Fécondation in vitro avec don d ovocytes Fécondation in vitro avec don d ovocytes Ref. 155 / abril 2009 Service de Médecine de la Reproduction Gran Vía Carlos III 71-75 08028 Barcelona Tel. (+34) 93 227 47 00 Fax. (+34) 93 491 24 94 international@dexeus.com

Plus en détail

La surveillance biologique des salariés Surveiller pour prévenir

La surveillance biologique des salariés Surveiller pour prévenir Evaluer et prévenir le risque radiologique professionnel dans les opérations de radiographie industrielle La surveillance biologique des salariés Surveiller pour prévenir Dr Irène Sari-Minodier Service

Plus en détail

1. Code de la sécurité sociale

1. Code de la sécurité sociale Points-clés de la loi du 17 décembre 2010 portant réforme du système de soins de santé et modifiant : 1. le Code de la sécurité sociale ; 2. la loi modifiée du 28 août 1998 sur les établissements hospitaliers.

Plus en détail

Initiation à la recherche documentaire

Initiation à la recherche documentaire Initiation à la recherche documentaire Sages-femmes 2015 1 ère séance http://sicd1.ujf-grenoble.fr Lundi 16 mars 2015 Recherche documentaire Sages-femmes / BUM 1 Une formation en 4 parties - Présentation

Plus en détail