MISE À PROFIT DU SÉQUENÇAGE DU GÉNOME HUMAIN POUR IDENTIFIER DE NOUVEAUX MINISATELLITES POLYMORPHES, VOIRE HYPERMUTABLES

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimension: px
Commencer à balayer dès la page:

Download "MISE À PROFIT DU SÉQUENÇAGE DU GÉNOME HUMAIN POUR IDENTIFIER DE NOUVEAUX MINISATELLITES POLYMORPHES, VOIRE HYPERMUTABLES"

Transcription

1 MISE À PROFIT DU SÉQUENÇAGE DU GÉNOME HUMAIN POUR IDENTIFIER DE NOUVEAUX MINISATELLITES POLYMORPHES, VOIRE HYPERMUTABLES France DENOEUD Rapport de stage de DEA AGM2 ( ) effectué à l'institut de Génétique et Microbiologie d'orsay, dans le laboratoire Instabilité des Extrémités de Chromosomes Humains, sous la responsabilité de Gilles VERGNAUD

2 Ê ÙÑ Ä Ñ Ò Ø ÐÐ Ø ÓÒØ Ó ÒÓÑ Ö ÙÜ Ô Ø ÒØ Ö ÒØ Ð ÓÐÓ Ù ¹ ÒÓÑ ÙÑ Ò Ø Ð ÕÙ Ð Ö ÙÐ Ø ÓÒ Ò Ð Ø Ö Ð ÖÓÑÓ ÓÑ Ø Ð³ ѹ ÔÖ ÒØ Ô Ö ÒØ Ð º Ä ÓÒÒ Ò ÙÖ Ð ÓÐÓ Ñ Ò Ø ÐÐ Ø ÓÒØ ÙÓÙÔ ÔÖÓ¹ Ö Ü ÖÒ Ö ÒÒ Ö Ð³ ÒØ Ø ÓÒ Ø Ð³ Ò ÐÝ Ñ Ò Ø ÐÐ Ø ÝÔ ÖÑÙØ Ð ÕÙ ÓÒØ ÔÔ ÖÙ ÓÑÑ ÓÑ ÖÕÙ ÙÖ ÔÓØ ÒØ Ð ÔÓÙÖ Ð³ ÜÔÓ Ø ÓÒ ÒØ ÒÓØÓÜ ÕÙ ÓÑÑ Ð Ö Ø ÓÒ ÓÒ ÒØ º Ô Ò ÒØ Ð³ ÓÐ Ñ ÒØ Ñ Ò Ø ÐÐ Ø ³ ÒØ Ö Ø ÔÓÐÝÑÓÖÔ ÓÙ ÝÔ ÖÑÙØ Ð µ Ø Ø Ù ÕÙ³ ÔÖ ÒØ Ð Ñ Ø Ô Ö Ð Ø Ò ÕÙ ÜÔ Ö Ñ ÒØ Ð º Ò ØØ ØÙ ÒÓÙ ÚÓÒ Ñ ÔÖÓ Ø Ð ÓÒÒ ÕÙ Ò Ù ÒÓÑ ÙÑ Ò Ò ³ ØÙ Ö Ð Ö Ô ÖØ Ø ÓÒ Ñ Ò Ø ÐÐ Ø ÓÒØ Ð Ò Ø ÓÒ ÔÙ ØÖ ÔÖ µº ÆÓÙ ÚÓÒ Ð Ñ ÒØ ÔÙ ØÖÓÙÚ Ö ÙÒ ÑÓÝ Ò ÑÔÐ Ø ¹ ³ Ñ Ð ÓÖ Ö Ð Ø Ø ÓÒ Ñ Ò Ø ÐÐ Ø ÔÓÐÝÑÓÖÔ Ô ÖØ Ö Ð ÕÙ Ò Ð ÔÓÙÖÖ ØÖ Ñ Ò ÙÚÖ ÕÙ ÒÓÙ ÔÓ ÖÓÒ ÙÜ ÐÐ Ð Ö ÒØ ³ÙÒ Ñ Ñ ÖÓÑÓ ÓÑ º ØÖ Ø Å Ò Ø ÐÐ Ø Ú Ò ÓÙÒ Ò Ó Ø ÓÒ Û Ø ÑÔÓÖØ ÒØ ØÙÖ Ó ÙÑ Ò ÒÓÑ ÓÐÓ Ý Ù Ò Ö ÙÐ Ø ÓÒ ÖÓÑÓ ÓÑ Ð Ö Ð Ø Ò ÑÔÖ ÒØ Ò º ÇÙÖ ÒÓÛÐ Ó Ñ Ò Ø ÐÐ Ø ÓÐÓ Ý Ö ØÐÝ ÒÖ Ò Ø Ô Ø Ø Ò Ý Ö ÓÛ Ò ØÓ Ø ÒØ ¹ Ø ÓÒ Ò Ö ÙÐ Ò ÐÝ Ó ÙÑ Ò ÝÔ ÖÑÙØ Ð Ñ Ò Ø ÐÐ Ø Û Ú Ò ÔÙØ ÓÖÛ Ö ÔÓØ ÒØ Ð ÓÑ Ö Ö ÓÖ Ø ÑÓÒ ØÓÖ Ò Ó ÒÓØÓÜ ÒØ Ù ÓÒ Þ Ò Ö Ø ÓÒº Æ Ú ÖØ Ð ÒØ Ø ÓÒ Ó ÔÓÐÝÑÓÖÔ ÓÖ ÝÔ ÖÑÙØ Ð Ñ Ò Ø ÐÐ Ø Ò Ð Ñ Ø Ý ÜÔ Ö Ñ ÒØ Ð ÓÒ ØÖ ÒØ º ÁÒ Ø ØÙ Ý Û Ø Ú ÒØ Ó Ø Ö ÒØ Û ÓÐ ÖÓÑÓ ÓÑ ÕÙ Ò Ø Ö Ð ØÓ ÔÖÓÚ Ò ÙÒ Ý Ò Ú Û ÓÒ Ñ Ò Ø ÐÐ Ø Ò Ø ÓÒ Ò ØÖ ÙØ ÓÒ Û Ñ Ý Ð Ø Ø Ø ÒÒÓØ Ø ÓÒ Ó Ø Ò Ñ Ö Ô Ø ¹ ÕÙ Ò µ Ò ØÓ Ò Ò ÒØ Ñ Ø Ó Ó ÒØ Ø ÓÒ Ó ÔÓÐÝÑÓÖÔ Ñ Ò Ø ÐÐ Ø ÓÒ Ø Ö ÕÙ Ò Ø Û ÐÐ ÔÔÐ Ð ÓÓÒ ØÛÓ Ö ÒØ ÐÐ Ð Ó ÙÑ Ò ÖÓÑÓ ÓÑ Û ÐÐ Ö Ð º

3 Ì Ð Ñ Ø Ö ½ ÁÒØÖÓ ÙØ ÓÒ ½ ¾ Å Ø Ö Ð Ø Ñ Ø Ó ¾º½ Ð ÓÖ Ø ÓÒ ³ÙÒ ÓÒÒ Ö Ô Ø Ø ÓÒ Ò Ø Ò Ñ º º º º º º º º ¾º½º½ Ë ÕÙ Ò ØÖ Ø º º º º º º º º º º º º º º º º º º º º º º º º º º º º ¾º½º¾ Ê Ö Ö Ô Ø Ø ÓÒ Ò Ø Ò Ñ Ø ÑÔÓÖØ Ø ÓÒ Ò Ð ÓÒÒ º º º º º º º º º º º º º º º º º º º º º º º º º º º º º º º º º ¾º½º ÁÒØ ÖÖÓ Ø ÓÒ Ð ÓÒÒ Ô Ö Ð Û º º º º º º º º º º º º ¾º¾ ØÙ ÔÓÔÙÐ Ø ÓÒ Ô Ö È Ê º º º º º º º º º º º º º º º º º º º º º º º º Ê ÙÐØ Ø Ø Ù ÓÒ º½ ØÙ Ð Ö Ô ÖØ Ø ÓÒ Ñ Ò Ø ÐÐ Ø ÙÖ Ð ÖÓÑÓ ÓÑ ¾¾ ÙÑ Ò Ø ÓÑÔ Ö ÓÒ Ú ³ ÙØÖ ÒÓÑ º º º º º º º º º º º º º º º º º º º º º º¾ Ì Ø ÔÓÐÝÑÓÖÔ Ñ º º º º º º º º º º º º º º º º º º º º º º º º º º º º ½¼ ÓÒÐÙ ÓÒ Ø Ô Ö Ô Ø Ú ½

4 ½ ÁÒØÖÓ ÙØ ÓÒ Ä Ñ Ò Ø ÐÐ Ø ÓÒØ Ö Ô Ø Ø ÓÒ Ò Ø Ò Ñ ÓÙÖØ ÑÓØ ½¼¼ Ô Ö µ ÔÐÙ ÓÙ ÑÓ Ò Ò ÓÒ ÖÚ ¼± ½¼¼± ³ ÓÑÓÐÓ µ ÙÖ ÕÙ ÐÕÙ ÒØ Ò ÕÙ ÐÕÙ Ñ ÐÐ Ö Ô Ö º ÁÐ ³ Ø ³ ÒØ ÖÑ Ö ÒØÖ Ð Ñ ÖÓ Ø ÐÐ Ø ÑÓØ Ò Ö ÙÖ Ô µ Ø Ð Ø ÐÐ Ø ÐÓÒ Ù ÙÖ ØÓØ Ð ØØ Ò ÒØ ÔÐÙ ÙÖ Å µº Ø ÐÐ ØÖÙØÙÖ Ò ÕÙ³ Ý ÒØ ØÓÙØ ³ ÓÖ Ø ÓÐ Þ Ð³ ÓÑÑ Ü Ø ÒØ Ò ÒÓÑ Ö ÙÜ ÓÖ Ò Ñ Ý ÓÑÔÖ Ð Ø Ö º Ä Ñ Ò Ø ÐÐ Ø ÓÒØ ÔÐÙ ÙÖ ÒØ Ö Ø ÓÐÓ ÕÙ ÖØ Ò ÓÒØ Ô ÖØ Ô ÓÙÚ ÖØ Ð ØÙÖ ÕÙ Ô ÙØ Ò Ò Ö Ö Ù ÔÓÐݹ ÑÓÖÔ Ñ Ò Ð ÔÓÔÙÐ Ø ÓÒ ÙÑ Ò ³ ÙØÖ Ð ÒØ ÔÖÓØ Ò Ú ÓÒ ÕÙ Ò ÓÒØ ÓÒÒ ÐÐ Ú Ö Ð Ö ÙÐ Ø ÓÒ ØÖ Ò Ö ÔØ ÓÒÒ ÐÐ Ô ÑÔÖ ÒØ Ô Ö ÒØ Ð ºººµ ÖØ Ò Ø Ö Ð ÖÓÑÓ ÓÑ ÓÒØ Ñ Ò Ø ÐÐ Ø Ä Ñ Ò Ø ÐÐ Ø ÔÓÐÝÑÓÖÔ ÓÒØ ÖÚ Ñ ÖÕÙ ÙÖ ÔÓÙÖ Ð ÖØÓ Ö Ô Ù ¹ ÒÓÑ ÙÑ Ò Ö Ð ÙÖ ÐÓ Ð Ø ÓÒ ÔÖ Ò Ô Ð Ñ ÒØ Ù ¹Ø ÐÓÑ Ö ÕÙ Ð ÓÒØ ÔÙ ÖÚ Ö ÓÒ ÔÓÙÖ Ø Ø Ö Ñ ÖÓ¹ Ð Ø ÓÒ ÜØÖ Ñ Ø ÖÓÑÓ ÓÑ ÙÑ Ò ÑÔÐ ¹ ÕÙ Ô Ö Ü ÑÔÐ Ò Ð Ö Ø Ö Ñ ÒØ Ð ÁÐ ÓÒØ ÙØ Ð ÔÓÙÖ Ð³ ÒØ Ø ÓÒ ³ Ò Ú Ù ÑÔÖ ÒØ Ò Ø ÕÙ µ Ä Ñ Ò Ø ÐÐ Ø ÝÔ ÖÑÙØ Ð Ò Ñ Ó µ Ô ÖÑ ØØ ÒØ Ð³ ØÙ Ô ÒÓÑ Ò Óѹ ÔÐ Ü Ö ÓÑ Ò ÓÒ ÓÑÑ Ð ÓÒÚ Ö ÓÒ Ò ÕÙ º ÁÐ ÔÓÙÖÖ ÒØ Ð Ñ ÒØ Ö¹ Ú Ö ÓÑ ÖÕÙ ÙÖ ³ ÜÔÓ Ø ÓÒ ÒØ ÒÓØÓÜ ÕÙ Ä Ñ Ò Ø ÐÐ Ø ³ ÒØ Ö Ø ÓÒØ ÓÒ ÔÖ Ò Ô Ð Ñ ÒØ Ð Ñ Ò Ø ÐÐ Ø ÔÓÐÝÑÓÖÔ Ð Ñ ÒØ ÔÔ Ð ÎÆÌÊ Ú Ö Ð ÒÙÑ Ö Ó Ø Ò Ñ Ö Ô Ø µ Ø Ð Ñ Ò Ø ÐÐ Ø Ý¹ Ô ÖÑÙØ Ð ÕÙ ÓÒØ ØÖ Ö Ö Ñ ÔÖ ÒØ ÒØ ÙÒ ÜØÖ Ñ Ò Ø Ð Ø µº Ä Ñ Ò Ø ÐÐ Ø ÝÔ ÖÑÙØ Ð ÓÒØ Ð Ð Ñ ÒØ Ð ÔÐÙ Ò Ø Ð Ù ÒÓÑ Ù¹ Ñ Ò Ô Ö Ü ÑÔÐ ½ ÙÒ Ø ÙÜ ÑÙØ Ø ÓÒ ÔÐÙ ½¾± Ò Ñ Ó Ò Ð Ð Ò ÖÑ Ò Ð Ñ ÙÐ Ò ÚÓ Ö ÒÒ Ü ½ Ö ÔØ ÓÒ ÔÖ Ò Ô ÙÜ Ñ Ò Ø ÐÐ Ø Ý¹ Ô ÖÑÙØ Ð µº ÇÒ ÕÙ Ð ³ ÝÔ ÖÑÙØ Ð Ð Ñ Ò Ø ÐÐ Ø ÔÓÙÖ Ð ÕÙ Ð ÓÒ Ó ÖÚ Ú ÙÒ Ö ÕÙ Ò ÔÐÙ ¼º ± Ò ÒØ Ý ÒØ Ö Ø ³ÙÒ ÐÐ Ð ÐÓÒ Ù ÙÖ Ö ÒØ ÐÐ ÐÐ Ð Ô Ö ÒØ ÙÜ ÐÓÖ Ð³ ØÙ Ô Ö Ö Ò Ñ ÐÐ Ù ÈÀµº ÐÐ Ð ÑÙØ ÒØ ÔÖÓÚ ÒÒ ÒØ Ò Ö Ð Ñ ÒØ ³ Ú Ò Ñ ÒØ ÓÑÔÐ Ü ÒØÖ ¹ ÐÐ Ð ÕÙ ÓÙ ÒØ Ö ÐÐ Ð ÕÙ Ù ØÝÔ ÓÒÚ Ö ÓÒ Ò ÕÙ Ù Ö ½ Â Ö Ý ½ µ ÕÙ ÙÖÚ ÒÒ ÒØ ÐÓÖ Ð Ñ Ó Ø ÙÜ ÑÙØ Ø ÓÒ ÙÓÙÔ ÔÐÙ Ð Ú Ò Ð Ô ÖÑ ÕÙ Ò Ð Ò Ó Ð Ö Ö ÐÐ Ð ÑÙØ ÒØ Ö ÙÐØ ÒØ ³ Ú Ò Ñ ÒØ ÙÓÙÔ ÔÐÙ ÑÔÐ Ø ÒØÖ ¹ ½

5 ÐÐ Ð ÕÙ Â Ö Ý ½ µº ÈÐÙ ÙÖ ÑÓ Ð ÓÒØ Ø ÔÖÓÔÓ ÔÙ ½ ÔÓÙÖ ÜÔÐ ÕÙ Ö Ö ÓÑ Ò ÓÒ Ð Ù Ö ÒØ ÔÓÙÖ Ð ÔÐÙÔ ÖØ Ð Ò Ö Ø ÓÒ ÓÙÔÙÖ ÓÙ Ð Ö Ò Ð Ð³ ÒØ Ö ÙÖ Ö Ô Ø Ø ÓÒ Ò Ø Ò Ñ Ô Ö Ü ÑÔÐ Ó ½ µº Ô Ò ÒØ ÔÐÙ ÙÖ Ó ÖÚ Ø ÓÒ Ð ÒØ ÙÔÔÓ Ö ÙÒ ÖÐ ÑÔÓÖØ ÒØ Ð ÕÙ Ò ÒÕÙ ÒØ º ÌÓÙØ ³ ÓÖ ÔÓÙÖ Ð ÔÐÙÔ ÖØ Ñ Ò Ø ÐÐ Ø ÝÔ ÖÑÙØ Ð ÓÒ Ó ÖÚ ÙÒ ÔÓÐ Ö Ø ÐÓ Ð Ø ÓÒ ÑÙØ Ø ÓÒ Ð Ú Ò Ñ ÒØ ÔÖÓ Ù ÒØ ÔÖ Ö ÒØ ÐÐ ¹ Ñ ÒØ Ú Ö ÙÒ ÜØÖ Ñ Ø Ù Ñ Ò Ø ÐÐ Ø Â Ö Ý ½ µº ³ ÙØÖ Ô ÖØ ÙÒ ØÖ Ò Ú Ö ÓÒ Ò Ò Ð ÒÕÙ ÒØ Ù Ñ Ò Ø ÐÐ Ø ÅË ¾ Ø Ó ÙÒ ÓÖØ Ö ÙØ ÓÒ Ù Ø ÙÜ ÑÙØ Ø ÓÒ ØØ ÙÔÔÖ ÓÒ Ø Ò Ñ Ò³ Ø Ô Ð Ô Ø Ð³ ÐÐ Ð ÓÙ Ö Ð ÖÐ ÓÒÒ ÙÖ ÐÓÖ Ð ÓÒÚ Ö ÓÒ Ò ÕÙ ÅÓÒ ØÓÒ ½ µº Ò Ò ÅË ¾ Ø Ó ÙÒÔÓ ÒØ Ù ÖÓ Ò ÓÚ Ö ÕÙ Ù Ö Õ٠г Ò Ø Ð Ø Ñ Ò ¹ Ø ÐÐ Ø ÝÔ ÖÑÙØ Ð ÔÓÙÖÖ Ø ØÖ ÙÒ ÓÒ ÕÙ Ò Ð ÔÖÓÜ Ñ Ø ÔÓ ÒØ Ù Ö ÓÑ Ò ÓÒ Ñ ÓØ ÕÙ Â Ö Ý ½ µº Ò ½ Ð Ø ÑÓÒØÖ ÕÙ ÓÒ Ò Ö Ø ÙÒ Ñ Ò Ø ÐÐ Ø ÝÔ ÖÑÙØ Ð ÙÑ Ò Ò Ð Ð ÚÙÖ Ë ÖÓÑÝ Ö Ú ÔÖÓÜ Ñ Ø ³ÙÒ ÔÓ ÒØ Ù Ö ÓÑ Ò ÓÒ ÓÒ Ó ÖÚ Ø ÙÒ Ò Ø Ð Ø Ù Ñ Ò Ø ÐÐ Ø Ô Ò ÒØ Ð ØÓÔÓ ÓÑ Ö Ñ ÓØ ÕÙ ÔÓ½½ ÕÙ Ò Ö ÙÖ ÓÙ Ð Ö Ò Ö Ò Ö ÙÛ Ö ½ µº ÆÓÙ ÚÓÒ ÓÒ ÔÖÓÔÓ ÙÒ ÒÓÙÚ Ù ÑÓ Ð ³ Ò Ø Ð Ø Ñ Ò Ø ÐÐ Ø ÝÔ ÖÑÙØ Ð Î Ö Ò Ù ² ÒÓ Ù ¾¼¼¼µ ÚÓ Ö ÒÒ Ü ¾º ÁÐ Ô ÖÑ Ø Ö Ò Ö ÓÑÔØ Ð ÔÐÙÔ ÖØ Ú Ò Ñ ÒØ Ó ÖÚ Þ Ð³ ÓÑÑ Ò Ò Ø ÒØ Ð Ñ Ò Ñ Ô Ö ÙÒ ÙÖ ÓÙ Ð Ö Ò Ö Ò Ò Ð ÒÕÙ ÒØ Ù Ñ Ò Ø ÐÐ Ø º ij ØÙ ÐÐ ÕÙ Ð Ñ Ò Ø ÐÐ Ø ÝÔ ÖÑÙØ Ð Ò ÓÒØ Ô ÒØÖ Ò ÕÙ Ñ ÒØ Ò¹ Ø Ð Ñ Ö ÙÐØ ÒØ Ð Ó Ò Ò ÒØÖ ÙÒ ÔÓ ÒØ Ù Ö ÓÑ Ò ÓÒ Ñ ÓØ ÕÙ Ø ÙÒ Ñ Ò Ø ÐÐ Ø ÒÓÖÑ Ð ÕÙ ÓÒØ Ö ÕÙ ÒØ µ ÔÖÓÑ Ø ³ ÒØ Ö ÒØ Ô Ö Ô Ø Ú Ð Ø Ø ÓÒ Ñ Ò Ø ÐÐ Ø ÝÔ ÖÑÙØ Ð ÔÓÙÖÖ ØÖ Ó Ð Ñ Ò Ú Ò Ø Ð³ Ò ÐÝ ÔÓ ÒØ Ù Ö ÓÑ Ò ÓÒ Ù ÒÓÑ ÙÑ Ò ÕÙ Ö Ø ÒØ ÔÓÙÖ Ð³ Ò ¹ Ø ÒØ ÒÓÖ ØÖ Ô Ù ØÙ º È Ö Ü ÑÔÐ ÙÒ ØÙ Ö Ò ÐÐ Ð ØÖ ÙØ ÓÒ Ñ Ò Ø ÐÐ Ø ÝÔ ÖÑÙØ Ð Ò Ð ÒÓÑ Ô ÖÑ ØØÖ Ø ³ ÔÔÖ Ò Ö Ð ØÖ Ù¹ Ø ÓÒ ÔÓ ÒØ Ù ÙÖ ÓÙ Ð Ö Òº Ä Ø ØÙ ÔÓÙÖ ÙØ Ø Ö Ö Ô ÖØ Ù ÕÙ Ò Ù ÒÓÑ ÙÑ Ò ÔÓÙÖ ÓÐ Ö Ñ Ò Ø ÐÐ Ø ³ ÒØ Ö Ø ÔÓÐÝÑÓÖÔ Ò ÔÖ Ñ Ö Ð Ù ÔÙ Ú ÒØÙ ÐÐ Ñ ÒØ Ý¹ Ô ÖÑÙØ Ð Ð Ñ Ò Ø ÐÐ Ø ÝÔ ÖÑÙØ Ð ÓÒØ Ò Ø ÜØÖ Ñ Ñ ÒØ ÔÓÐÝÑÓÖÔ µº Ä Ñ Ø Ó ÜÔ Ö Ñ ÒØ Ð Ý Ö Ø ÓÒ ÓÒ ÙÖ ËÓÙØ ÖÒ ÐÓØ Î Ö Ò Ù ½ ºººµ Ú ÐÓÔÔ Ù ÕÙ³ ÐÓÖ Ò Ô ÖÑ ØØ ÒØ ³ ÓÐ Ö ÕÙ Ð Ñ Ò Ø ÐÐ Ø ÓÒØ Ð ÐÓÒ¹ Ù ÙÖ ØÓØ Ð Ü Ø ¼¼ Ô ÒÚ ÖÓÒ Ø ÓÒØ Ð ÑÓØ Ö Ô Ø Ø Ø Ô Ù ÓÑÔÐ Ü º ¾

6 ÕÙ Ò ÔÖ ÒØ ÒØ ÙÒ ÓÖØ Ö Ô ÖØ Ø ÓÒ Ú Ö Ð ÜØÖ Ñ Ø Ø ÐÓÑ Ö ÕÙ º ÍÒ ØÙ ÔÐÙ Ý Ø Ñ Ø ÕÙ Ö Ô Ø Ø ÓÒ Ò Ø Ò Ñ Ú ÒØ Ñ ÙÜ Ò Ö Ð Ñ Ò Ø Ð¹ Ð Ø Ò ÔÖ ÓÖ ÙÜ ÓÒØÖ ÒØ ÜÔ Ö Ñ ÒØ Ð Ø Ñ ÒØ Ò ÒØ Ö Ò Ù ÔÓ Ð Ô Ö Ð ÔÖÓ Ö Ù ÕÙ Ò Ù ÒÓÑ ÙÑ Ò ÒÓÙ ÔÓÙÚÓÒ ÓÖ Ò Ú ÒØ ÓÐ Ö ¹ Ö Ø Ñ ÒØ Ð Ö Ô Ø Ø ÓÒ Ò Ø Ò Ñ Ô ÖØ Ö Ð ÕÙ Ò Ø ØÙ Ö Ð ÙÖ ØÖ ÙØ ÓÒ Ð³ ÐÐ ³ÙÒ ÖÓÑÓ ÓÑ ÒØ Ö Ð ÕÙ Ò ÖÓÑÓ ÓÑ ¾½ Ø ¾¾ Ø Ò Ø Ú µº ÔÖ ÚÓ Ö Ô Ö ÓÐ Ð Ñ Ò Ø ÐÐ Ø ÓÒØ ÓÒ ÙÖ ÔÙ ÔÖ Ö Ð Ò Ø ÓÒ ÕÙ Ø ÒÓÖ Ô Ù Ð Ö Ø ÓÒ Ô Ù ÑÔÐÓÝ Ô Ö Ü ÑÔÐ Ò Ð³ ÖØ Ð ØÖ Ø ÒØ Ð ÕÙ Ò Ù ÖÓÑÓ ÓÑ ¾¾ ÙÑ Ò ÙÒ Ñ ½ µ Ð Ñ Ò Ø ÐÐ Ø Ò ÓÒØ Ô ÒÒÓØ ÓÑÑ Ø Ð µ Ð Ù Ö ØÖ Ô Ð Ö Ô Ö Ö Ô ÖÑ ÙÜ Ð Ñ Ò Ø Ð¹ Ð Ø ÔÓÐÝÑÓÖÔ º ÍÒ ØÙ Ñ Ò ÙÖ ÙÒ Ò Ñ Ð Ñ Ò Ø ÐÐ Ø Ù ÖÓÑÓ ÓÑ ¾¾ ÒÓÙ Ô ÖÑ ØØÖ ³ Ø Ñ Ö Ð ÔÓÐÝÑÓÖÔ Ñ ÑÓÝ Ò Ø ³ Ò Ù Ö Ñ Ø Ó Ú ÒØ Ø Ø Ö ÔÖ Ö ÒØ ÐÐ Ñ ÒØ Ð Ñ Ò Ø ÐÐ Ø ÔÓÐÝÑÓÖÔ º ¾ ¾º½ Å Ø Ö Ð Ø Ñ Ø Ó Ð ÓÖ Ø ÓÒ ³ÙÒ ÓÒÒ Ö Ô Ø Ø ÓÒ Ò Ø Ò Ñ Ò Ð Ø Ö Ð³ ÙÜ ÓÒÒ ÓÒ ÖÒ ÒØ Ð Ñ Ò Ø ÐÐ Ø Ù ÖÓÑÓ ÓÑ ¾¾ ÙÑ Ò Ø ÖÓÑÓ ÓÑ ÒØ Ö Ñ ÒØ ÕÙ Ò Ò ³ ÙØÖ Ô µ ³ Ð ÓÖ ÙÒ ÓÒÒ Ö Ô Ø Ø ÓÒ Ò Ø Ò Ñ ÒØ ÖÖÓ Ð Ô Ö Ð Û ÙÖ Ð Ø ØØÔ»»Ñ Ò Ø ÐÐ Ø ºÙ¹Ô Ù º Öº ¾º½º½ Ë ÕÙ Ò ØÖ Ø ÆÓÙ ÚÓÒ Ó ØÖ Ø Ö ÖÓÑÓ ÓÑ ÓÒØ Ð ÕÙ Ò Ø Ø Ú Ò Ò Ô ÚÓ Ö Ö Ñ ØØÖ Ð ÓÒÒ ÓÙÖ Ù ÙÖ Ø Ñ ÙÖ Ð³ Ú Ò Ù ÕÙ Ò ³ Ø ÔÓÙÖÕÙÓ ÒÓÙ Ò ÔÓ ÓÒ ØÙ ÐÐ Ñ ÒØ ÕÙ Ù ÖÓÑÓ ÓÑ ¾¾ ÙÑ Ò ÙÒ Ñ ½ Ð ÖÓÑÓ ÓÑ ¾½ Ø Ò ÓÙÖ ³ ÑÔÓÖØ Ø ÓÒµº Ò ÔÓÙÚÓ Ö ØÙ Ö ÓÑÔ Ö ÓÒ Ú ³ ÙØÖ ÓÖ Ò Ñ ÒÓÙ ÚÓÒ Ð Ñ ÒØ ØÖ Ø ÒØÖ ÙØÖ Ð ÖÓÑÓ ÓÑ ³ Ö ÓÔ Ø Ð Ò Å Ý Ö ½ µ Ø Ð ÖÓÑÓ ÓÑ ½ ÒÓÖ Ø Ð Ò Ð Ò ÕÙ Ò Ò ÓÒ ÓÖØ ÙÑ ½ µº Ä ÓÒØ ØÖ Ø ÔÓÙÖ ØÖÓ ÖÓÑÓ ÓÑ ÓÒØ ÙÜ ÕÙ Ø ÒØ ÔÓÒ Ð Ù ÑÓ ÒÚ Ö ¾¼¼¼ ½¾ ÓÒØ ÔÓÙÖ Ð ÖÓÑÓ ÓÑ ¾¾ ÙÑ Ò ØÓØ Ð ÒØ Å Ð ÙÖ Ð Ø Ø Ð ÙÖ Ð Ø ØØÔ»»ÛÛÛºÒ ºÒÐÑºÒ º ÓÚ» ÒÓÑ» Õ» ÕÙ Ò ÓÒØ ØÖ Ô Ù ÚÓÐÙ ÔÙ Ð ÙÖ ÑÔÓÖØ Ø ÓÒµ ¾ÓÒØ ÔÓÙÖ Ð ÖÓÑÓ ÓÑ ³ Ø Ð Ò ØÓØ Ð ÒØ ½ Å ØØÔ»»ÛÛÛºÑ Ô º Ó ÑºÑÔ º»ÔÖÓ»Ø Ð»µ

7 ½ Ö ÔÓÙÖ Ð ÖÓÑÓ ÓÑ ½ Ð Ò ½¾ Å ØØÔ»»ÛÛÛºÒ ºÒÐÑºÒ º ÓÚ» ¹ Ò» ÒØÖ Þ» Ö Ñ ÒÓÑ ² ¾µ ¾º½º¾ Ê Ö Ö Ô Ø Ø ÓÒ Ò Ø Ò Ñ Ø ÑÔÓÖØ Ø ÓÒ Ò Ð ÓÒÒ Ä ÓÒØ Ö Ô ØÖ ÓÒØ Ø ÓÙÑ Ù ÐÓ Ð Ì Ò Ñ Ê Ô Ø Ò Ö Ò ÓÒ ½ µ Ð ÙÖ Ð Ø ØØÔ»» º ÓÑ Ø ºÑ Ѻ Ù»ØÖ º ØÑÐ ÕÙ ÒØ Ð Ö Ô Ø Ø ÓÒ Ò Ø Ò Ñ Ø ÓÙÖÒ Ø Ö ÒØ Ò ÓÖÑ Ø ÓÒ ÐÓÒ Ù ÙÖ Ù ÑÓØ ÒÓÑ Ö Ö Ô Ø Ø ÓÒ Ð Ò Ú Ö ÙÒ Ö ³ Ð Ò Ñ Òغººµ ÕÙ ÓÒØ Ø ÑÔÓÖØ Ò ÙÒ ÓÒÒ Ö ÓÙ ÔÖ ÙÒ ØÖ Ø Ñ ÒØ ÔÖ Ð Ð Ø Ð ÙÜ ÓÖØ Ô Ö ÙÒ Ñ ÖÓ Ü Ðº Ò Ø Ð Ö ÙÐØ Ø ÔÖÓÔÓ Ô Ö Ð ÌÊ ÔÖ ÒØ ÒØ ÓÙÚ ÒØ ÙÒ Ö ÓÒ¹ Ò ÔÓÙÖ ÙÒ Ñ Ñ ÐÓÙ ÔÐÙ ÙÖ ÓÒ Ò Ù Ô ÙÚ ÒØ ØÖ ÔÖÓÔÓ ¹Ô Ö Ü ÑÔÐ ½ ¾¼Ô Ø ¼ ½¼Ô ¹º ØØ Ö ÓÒ Ò Ø Ð Ñ Ò Ò ÙØ Ð ÒØ Ð Ö Ø Ö Ù Ú ÒØ Ô ÖÑ Ð ÓÒ Ò Ù Ó Ù Ñ ÐÐ ÙÖ Ø ÙÜ ³ ÓÑÓÐÓ ÒØÖ Ð ÑÓØ»¹ ±µ ÙÐ ÐÙ ÓÖÖ ÔÓÒ ÒØ Ù ÔÐÙ Ô Ø Ø ÑÓØ Ö Ô Ø Ø Ð ÔÐÙ Ö Ò ÐÓÒ Ù ÙÖ ØÓØ Ð Ø ÓÒ ÖÚ µº Ä Ö ³ Ð Ò Ñ ÒØ ÓÙÖÒ Ô Ö Ð ÐÓ Ð ÌÊ ØÖ ÚÓÐÙÑ Ò ÙÜ ÓÒ Ò Ü¹ ÔÐÓ Ø Ð Ô Ö Ð Û ÓÒØ Ø Ò Ò ÙØ ÒØ Ö ÕÙ ³ Ð Ò Ñ ÒØ ³ Ø Ö ÙÒ Ö ³ Ð Ò Ñ ÒØ Ô Ö Ö Ô Ø Ø ÓÒ Ò Ø Ò Ñ Ø Ø µ Ö ÙÒ ÔÖÓ Ö ÑÑ Ó Ò È ÖÐ ÓÙÖÒ Ô Ö ÅÓÙÖ Ë ØÓÙ Ô µº ¾º½º ÁÒØ ÖÖÓ Ø ÓÒ Ð ÓÒÒ Ô Ö Ð Û Ä ÓÒÒ Ö Ô Ø Ø ÓÒ Ò Ø Ò Ñ Ò ÖÓÑÓ ÓÑ ÒØ Ö Ñ ÒØ ¹ ÕÙ Ò Ø Ð ÙÖ Ð Ø ØØÔ»»Ñ Ò Ø ÐÐ Ø ºÙ¹Ô Ù º Öº ËÓÒ ÒØ ÖÖÓ Ø ÓÒ ³ ØÙ Ö Ð Ø ÒÓÐÓ ËÈ Ø Ú Ë ÖÚ Ö È µ ÕÙ Ô ÖÑ Ø Ð Ö Ø ÓÒ Ô Ï ÝÒ Ñ ÕÙ Ø ÒØ Ö Ø Ú Ù Ð³ Ü ÙØ ÓÒ Ö ÔØ Ô Ö Ð ÖÚ ÙÖ Ð ÔÖÓ Ö ÑÑ Ø Ó Ò Î Ö Ôصº ij ÒÒ Ü ÔÖ ÒØ Ð Ô ÓÙÑ ÓÒ Ö ÕÙ Ø Ò ÕÙ Ð Ö ÙÐØ Ø Ò Ö ÔÓÙÖ ÙÒ Ö ÕÙ Ø Ö Ô ÖØ Ø ÓÒ Ú Ù Ð Ø ÓÒ Ð Ö Ô ÖØ Ø ÓÒ Ö Ô Ø Ø ÓÒ Ò Ø Ò Ñ Ð ÐÓÒ ³ÙÒ ÖÓÑÓ ÓÑ µ Ø ÙÒ Ö ÕÙ Ø ÓÐ Ñ ÒØ Ó Ø ÒØ ÓÒ ØÓÙØ Ð Ö Ø Ö Ø ÕÙ Ö Ô Ø Ø ÓÒ Ò Ø Ò Ñ ÓÐ µ ØÙ ÙÖ Ð ÖÓÑÓ ÓÑ ¾¾ ÙÑ Òº ¾º¾ ØÙ ÔÓÔÙÐ Ø ÓÒ Ô Ö È Ê Ä Ñ Ò Ø ÐÐ Ø Ô ÙÚ ÒØ ØÖ ÔÓÐÝÑÓÖÔ Ô Ö Ð ÓÑÔÓ Ø ÓÒ ÒØ ÖÒ Ð ÙÖ ÑÓØ ÓÙ Ô Ö Ð ÙÖ ÒÓÑ Ö ³ÙÒ Ø Ö Ô Ø ÒÓÙ Ò ÒÓÙ ÒØ Ö ÓÒ ÕÙ³ Ù ÔÓÐÝÑÓÖÔ Ñ ÒÓÑ Ö Ö Ô Ø Ø ÓÒ º ÈÓÙÖ Ð Ñ ÙÖ Ö ÒÓÙ ÚÓÒ ØÙ Ô Ö È Ê ÔÓÐÝÑ Ö Ò Ö Ø ÓÒµ Ò Ú Ù ÔÓÙÖ Ð ÔÐÙÔ ÖØ ÒÓÒ ÔÔ Ö ÒØ Ô Ö ÒØ Ñ ÐÐ Ù ÈÀ

8 Ø ÕÙ ÐÕÙ Ö Ò ¹Ô Ö ÒØ Ò Ú Ö Ö Ð Ö Ø ÓÒ ÐÐ Ð ÕÙ Ô ÖÑ ØØÖ ³ Ð Ñ Ò Ö Ð Ú ÒØÙ Ð ÖØ Ø º Ä ÑÓÖ ÓÒØ Ø Ó Ô ÖØ Ö ¾¼¼ ÒÙÐ ÓØ ÒÕÙ ÒØ ÔÖÓÔÓ Ô Ö Ð ÐÓ Ð Ì Ò Ñ Ê Ô Ø Ò Ö Ò ÓÒ ½ µº ÆÓÙ ÚÓÒ Ð Ø ÓÒÒ ÓÐ ÓÒÙÐ Ó¹ Ø ³ ÒÚ ÖÓÒ ¼ Ô Ö Ù ÐÓ Ð ÈÖ Ñ Ö ÔÓÒ Ð ÙÖ Ð Ø ØØÔ»»ÛÛÛ¹ ÒÓÑ º Û ºÑ غ Ù» ¹ Ò»ÔÖ Ñ Ö»ÔÖ Ñ Ö ÛÛÛº Ø Ð ÙÖ Ô Ø Ø Ú Ö Ô Ö ÓÒ ÖÓÒ¹ Ø Ø ÓÒ Ð Ø µ Ú Ö ÒØ ÒÕÙ ÕÙ Ò Ò Ò ÒÖ Ø Ö Ô Ö Ô Ø ººº Ø Ø ÓÒØ Ô ÖÑ Ó Ö ÔÓÙÖ ÕÙ ÓÙÔÐ ³ ÑÓÖ Ð Ñ Ò È Ê Ð ÔÐÙ ÅÂÖ Ö ÈÌ ¾¼¼ ÓÙ È Ö Ò ÐÑ Ö ¼¼ Ñ Ò ÓÑÔØ ÒØ ÐÓ µ Ð Ø ÑÔ Ö ØÙÖ ³ ÒÒ Ð Ò Ý Ö Ø ÓÒ ÑÓÖ µ ÓÔØ Ñ Ð Ð Ñ Ò ÈÌ ¾¼¼ Ô ÙØ ÔÖÓ Ù Ö Ö ÒØ Ø ÑÔ Ö ØÙÖ ÕÙ Ú Ø ÑÙÐØ ÔÐ Ö Ð È Ê µ Ð Ì Õ ÔÓÐÝÑ Ö Ð Ñ ÙÜ ÔÔÖÓÔÖ Ì Õ Ó Ö Ò Ö Ó ÈÛÓ Ó Ö Ò Ö ÓÙ Ì Õ ÔÔÐ Ò µ ÕÙ È Ê Ø ØÙ ÔÓÙÖ ØÙ Ò Ú Ù µ ÑÙÐØ Ò Ñ ÒØ Ò ½¾ ÖÖ ØØ ØÙ º Ä ÓÑÔÓ Ø ÓÒ Ù Ñ Ð Ò Ö Ø ÓÒÒ Ð Ò ÕÙ ØÙ ½ ĵ Ø Ð Ù Ú ÒØ Æ ÒÚ ÖÓÒ ¼ Ò ÐÓÒ Ð ÕÙ ÒØ Ø Ò ÕÙ Ô Ö Ð Ô µ ÔÓ Ò ÙÒ ÚÓÐÙÑ Ä Ö ÙÒ ÔÔ Ö Ð ØÖ ÙØ ÓÒ ÙØÓÑ Ø ÕÙ Ù ÐÐ ÊÓ Ò µ ÒÙÐ ÓØ ØÖ ¹Ô Ó Ô Ø ÓÒ ÒØÖ Ø ÓÒ Ò Ð ¾¼¼ Å ÙÒ ÑÓÖ ÓÒ ÒØÖ Ø ÓÒ Ò Ð ¼ Å ÙÒ Ì Õ ÔÔÐ Ò ÓÙ Ó Ö Ò Öµ ¼ Í Ú ÒØÙ ÐÐ Ñ ÒØ ÈÛÓ Ó Ö Ò Ö Ó Ð Ì Õ Ó Ö Ò Öµ ¼ ¼ Í Ì ÑÔÓÒ Ó Ö Ò Ö ÓÙ ÔÔÐ Ò ÐÓÒ Ð Ì Õ ÓÒØ Ò ÒØ ½ ÑÅ Å Ò Ð Ä Ñ Ð Ò Ì Õ Ø ÑÔÓÒ ÆÌÈ ÑÓÖ µ Ø Ö Ô ÖØ Ö ÓÒ ½¼ Ä Ô Ö ØÙ Ò Ð ØÙ ÓÒØ Ò ÒØ Ä ÓÐÙØ ÓÒ ³ ƺ ÔÖ Ð³ ÑÔÐ Ø ÓÒ Ñ Ò Ø ÐÐ Ø Ð ÒØ ÐÐÓÒ ÓÒØ Ø ÓÙÑ ÙÒ Ð ØÖÓ¹ Ô ÓÖ ÙÖ ÙÒ Ð ³ ÖÓ Ñ ½± Ò ÙÒ Ø ÑÔÓÒ Ñ Ö Ø ÓÒ Ì ¼º ÙÒ ÚÓÐØ Î»Ñ Ô Ò ÒØ ½ ÙÖ ¼ ÒÚ ÖÓÒº Ä Ð ÓÒØ Ò Ù Ø Ø ÓÐÓÖ Ù Ì Ø Ú Ù Ð ÓÙ Ð ÍΠг ÒÒ Ü ÔÖ ÒØ ÙÒ Ü ÑÔÐ Ö ÙÐØ Ø Ó Ø ÒÙµº

9 Ê ÙÐØ Ø Ø Ù ÓÒ º½ ØÙ Ð Ö Ô ÖØ Ø ÓÒ Ñ Ò Ø ÐÐ Ø ÙÖ Ð ÖÓÑÓ ÓÑ ¾¾ ÙÑ Ò Ø ÓÑÔ Ö ÓÒ Ú ³ ÙØÖ ÒÓÑ ÚÓ Ö Î Ö Ò Ù ² ÒÓ Ù ¾¼¼¼ Ô Ö Ö Ô Ì Ò Ú ÒØ Ó Ø ÐÓ Ð Ú Û ÔÖÓÚ Ý Ð Ö Ð ÕÙ Ò Ò µ Ä Ñ Ò Ø ÐÐ Ø ÓÐ Ù ÕÙ³ ÔÖ ÒØ Ò Ò Ö Ð Ö Ð ÙÖ ÔÖÓÔÖ Ø ÖÓ ¹ Ý Ö Ø ÓÒ Ú ³ ÙØÖ Ö Ô Ø Ø ÓÒ Ò Ø Ò Ñ Î Ö Ò Ù ½ µ Ô Ö Ð³ ÒØ ÖÑ Ö ËÓÙØ ÖÒ ÐÓØ Ú ÒØ Ò Ö Ñ ÒØ ÙÒ ÐÓÒ Ù ÙÖ ÓÑÔ Ø Ð Ú ØØ Ø Ò ÕÙ Ó Ø ÔÐÙ ¼¼ Ô ÒÚ ÖÓÒº Ø Ð Ñ Ò Ø ÐÐ Ø ÓÒØ ÙÒ Ö ÕÙ Ò Ñ Ð Ö Ò ÒÕ ÒÓÑ Ñ ÑÑ Ö ÜÔÐÓÖ Ñ Ð ÙÖ ØÖ ÙØ ÓÒ Ö ÙÓÙÔ ³ÙÒ ÒÓÑ Ð³ ÙØÖ Þ Ð³ ÓÑÑ ÓÒ Ó ÖÚ ÙÒ ÓÖØ Ö Ô ÖØ Ø ÓÒ Ú Ö Ð ÜØÖ Ñ Ø ÖÓÑÓ ÓÑ ÑÓ Ò ÒØÙ Þ Ð ÔÓÖ Ø Ò Ü Ø ÒØ Þ Ð ÓÙÖ Ø Ð Ö Øº Ò Ø Ð Ö Ð Ø ÓÒ ÝÒØ Ò ÒØÖ Ô Ù Ö ÒØ ÕÙ Þ Ð³ Ò ØÖ ÓÑÑÙÒ Ð Ñ Ò Ø ÐÐ Ø Ú ÒØ ÙÒ ÐÓ Ð Ø ÓÒ Ø ÐÓÑ Ö ÕÙ Ñ Ö Ö ½ µº Ä Ö Ô Ø Ø ÓÒ Ò Ø Ò Ñ ÕÙ Ô ÙÚ ÒØ ØÖ Ò ÐÝ Ô Ö ËÓÙØ ÖÒ ÐÓØ ¼¼ Ô µ ÓÒØ ÓÒ Ñ ÓÖ Ø Ö Ñ ÒØ Ó ÙÜ ÜØÖ ¹ Ñ Ø ÖÓÑÓ ÓÑ Ø Ð Ö ÓÒ ÒØ Ö Ø Ø ÐÐ ÕÙ Ò ÓÒØ Ö ÓÒØ ÔÖÓ Ð Ñ ÒØ Ð Ö ÙÐØ Ø Ö ÖÖ Ò Ñ ÒØ ÓÒ Ö ÓÑÑ Ð Ù ÓÒ Ø ÐÓÑ Ö º Ô Ò ÒØ ØÝÔ Ñ Ò Ø ÐÐ Ø Ò Ö ÔÖ ÒØ ÕÙ³ÙÒ Ð ÔÖÓÔÓÖØ ÓÒ Ö Ô Ø Ø ÓÒ Ò Ø Ò Ñ ÓÒØ Ð ÔÐÙÔ ÖØ ÓÒØ ÙÒ ÐÓÒ Ù ÙÖ ØÓØ Ð Ò Ö ÙÖ Ð Ð Ñ Ø Ö ØÖ Ö ÓÔØ Ù ÕÙ³ ÔÖ ÒØ ¼¼ Ô Ò ÔÔ ÖØ Ò Ö ÔÓÙÖ ÙØ ÒØ Ð Ð Ñ ÖÓ Ø ÐÐ Ø º Ä Ò Ø ÓÒ ÓÑÑ ÕÙÓ Ð Ñ Ò Ø ÐÐ Ø Ó Ú ÒØ Ü Ö ¼¼ Ô Ø ØÖÓÔ Ö ØÖ Ø Ú ÔÓÙÖ Ù ÑÓ Ò ÙÜ Ö ÓÒ Ö Ô Ø Ø ÓÒ Ò Ø Ò Ñ ÕÙ ÓÒØ Ð Ö Ñ ÒØ ÕÙ Ð Ñ Ò Ø ÐÐ Ø ÓÒØ ÓÙÚ ÒØ ÐÐ Ð ÑÓ Ò ¼¼ Ô Ò Ð ÔÓÔÙÐ Ø ÓÒ ÐÓÖ Ð³ Ñ Ð ÓÒÒ ÕÙ Ò Ð Ú Ö Ø Ð ÐÓÒ Ù ÙÖ Ñ Ò Ø ÐÐ Ø Ò³ Ø Ô ØÓÙ ÓÙÖ ÓÒÚ Ò Ð Ñ ÒØ Ø ÖÑ Ò ÙÖØÓÙØ ÕÙ Ò Ð ÑÓØ Ö Ô Ø ÓÒØ ÓÖØ Ñ ÒØ ÓÒ ÖÚ ½ Ð Ñ Ò Ø ÐÐ Ø Ð ÔÐÙ ÝÔ ÖÑÙØ Ð Ö Ø Ö Ù ÕÙ³ ÐÓÖ Î Ö Ò Ù ½ ½µ ÐÐÙ ØÖ ÙÜ Ð ÙÒ Ð Ò Ø ÓÒ ØÙ ÐÐ º ÓÖ Ò Ú ÒØ Ð Ö Ô Ø Ø ÓÒ Ò Ø Ò Ñ Ô ÙÚ ÒØ ØÖ ÓÐ Ö Ø Ñ ÒØ Ô ÖØ Ö ÓÒÒ Ù ÕÙ Ò Ø Ð ÙÖ Ö Ô ÖØ Ø ÓÒ Ô ÙØ ØÖ Ø٠г ÐÐ ÖÓÑÓ ÓÑ ÒØ Ö º ÆÓÙ ÚÓÒ ÓÒ Ö ÙÒ ÓÒÒ Ö Ô Ø Ø ÓÒ Ò Ø Ò Ñ ÔÐÙ ÙÖ ÖÓÑÓ ÓÑ ÒØ Ö Ñ ÒØ ÕÙ Ò ÚÓ Ö Ñ Ø Ö Ð Ø Ñ Ø Ó Ô Ö Ö Ô ¾º½µº Ä ÙÖ ½ ÔÖ ÒØ ÙÒ ØÙ Ð Ö Ô ÖØ Ø ÓÒ Ö Ô Ø Ø ÓÒ Ò Ø Ò Ñ Ù ÖÓÑÓ¹ ÓÑ ¾¾ ÙÑ Òº Ð Ù Ú Ö Ð ÖÓ Ø ÓÒØ Ö ÔÖ ÒØ Ð ÔÓ Ø ÓÒ Ù ÒØÖÓÑ Ö

10 º ½ Ê Ô ÖØ Ø ÓÒ Ö Ô Ø Ø ÓÒ Ò Ø Ò Ñ Ò Ð Ö¾¾ Ð ÖÓÑÓ ÓÑ ¾¾ Ø ÖÓ ÒØÖ ÕÙ µ Ð ÔÓ Ø ÓÒ ½ ÙÖ µ Ñ ÖÕÙ ÙÖ ¹ Ò Ø ÓÒ ÒØ Ô Ö Ð ÐÓ Ð ÌÊ Ð Ö ÓÒ Ö ÖÓ µ Ø Ô ÙÚÖ Ú Öص Ò Ð Ö ÓÒ Ö ÓÑ Ò ÓÒ ÖÙ Ú ÓРص Ø Ð Ö ÓÒ ÝÒØ Ò Ú Ð ÓÙÖ ÓÖÖ ÔÓÒ ÒØ ÙÜ Ò Ø ÓÒ ÙÒ Ñ Ø Ðº ½ º Ä ØÓ Ö ÑÑ ÔÖ ÒØ ÒØ Ð Ö Ô ÖØ Ø ÓÒ Ó Ø ÒÙ ÔÓÙÖ Ö ÒØ Ö ÕÙ Ø Í Æ Í ½ Æ Ä ½¼¼ Í ½ Æ ± ± ¼º ±Å ± Ú Í ÐÓÒ Ù ÙÖ Ù ÑÓØ Æ ÒÓÑ Ö Ö Ô Ø Ø ÓÒ Ä ÐÓÒ Ù ÙÖ ØÓØ Ð» ± ± µ ± ± ±Å ÔÓÙÖ ÒØ ³ ÓÑÓÐÓ ± ÔÓÙÖ ÒØ Ò µº Ä ÖÓÑÓ ÓÑ ¾¾ Ø Ö Ñ ÒØ Ò ¾¼ Ñ ÒØ ÐÓÒ Ù ÙÖ Ð º Ä ÔÓÙÖ ÒØ Ö ÔÔÓÖØ ÓÙ Ð ¹ ØÓ Ö ÑÑ ÓÖÖ ÔÓÒ ÒØ Ð ÔÖÓÔÓÖØ ÓÒ ³Ó Ø Ò Ð ÙÜ ÖÒ Ö Ñ ÒØ ÕÙ ÓÑÔÖ ÒÒ ÒØ º Å Ó Ø ½¼± Ð ÐÓÒ Ù ÙÖ ØÓØ Ð º Ä Ú Ð ÙÖ ¾ ÓÒØ Ø ÐÙÐ Ò ÓÑÔ Ö ÒØ Ð ÒÓÑ Ö Ö Ô Ø Ø ÓÒ Ò Ø Ò Ñ Ò Ð ½¼± Ø ÖÑ Ò ÙÜ Ù ÖÓÑÓ ÓÑ Ø Ð ÒÓÑ Ö ÑÓÝ Ò Ö Ô Ø Ø ÓÒ Ò Ø Ò Ñ Ò ½¼± Ù ÖÓÑÓ ÓÑ º Ä Ù Ð Ò ¹ Ø Ú Ø Ø º ½ Ú È ¼ ± Ð Ú Ð ÙÖ ÓÒØ Ò ÖÓÙ Ö ÐÐ Ü ÒØ Ù Ðµº ÇÒ ÓÒ Ø Ø ÕÙ³ÙÒ Ø Ö ½ ¼¼¼ Ö Ô Ø Ø ÓÒ Ò Ø Ò Ñ Ù ÖÓÑÓ ÓÑ ¾¾ Ø Ø Ð Ò Ø ÓÒ Ð ÔÐÙ Ð Ö ³ÙÒ Ñ Ò Ø ÐÐ Ø ÑÓØ ³ Ù ÑÓ Ò Ô Ö Ô Ø Ù ÑÓ Ò Ó µ ÙÖ ½ º Ö Ô Ø Ø ÓÒ ÔÖ ÒØ ÒØ ÙÒ Ò Ø Ö Ô ÖØ Ø ÓÒ Ú Ö Ð Ø ÐÓÑ Ö º È ÖÑ ÐÐ Ð Ñ Ò Ø ÐÐ Ø Ý ÒØ ÙÒ Ø Ö Ô Ø ÔÐÙ ½ Ô Ø ÙÒ ÐÓÒ Ù ÙÖ ØÓØ Ð ÙÔ Ö ÙÖ ½¼¼ Ô ÑÓÒØÖ ÒØ ÙÒ ØÖ ÙØ ÓÒ ÔÐÙ ÓÖØ Ñ ÒØ Ú Ö Ð Ø ÐÓÑ Ö ½ Ð Ö Ô Ø Ø ÓÒ Ò Ø Ò Ñ ÑÓØ ÑÓ Ò ½ Ô Ø ÐÓÒ Ù ÙÖ ØÓØ Ð Ò Ö ÙÖ ½¼¼ Ô ÑÓÒØÖ ÒØ ÕÙ ÒØ ÐÐ ÙÒ Ö Ô ÖØ Ø ÓÒ ÓÑÓ Ò ÓÒÒ

11 ÒÓÒ ÑÓÒØÖ µº Ä ÓÑÔ Ö ÓÒ ÙÒ Ø Ö Ô Ø Ò Ð Ñ Ò Ø ÐÐ Ø Ð ÕÙ ÓÒ Ù Ø Ð ÒÓØ ÓÒ ÓÖ ÕÙ Ò ÑÓÒØÖ ÒØ Ñ Ð ØÙ Ú Ð ÕÙ Ò Ù Ô Ì Ì µº Ó ÖÚ Ø ÓÒ Ô ÙÚ ÒØ ØÖ Ö ÙÑ ÓÑÑ Ù Ø Ð ÔÐÙÔ ÖØ Ñ Ò Ø ÐÐ Ø Ð ÕÙ ÓÒØ Ö Ò Ú ÙÒ ÓÖØ ÝÑ ØÖ» ÒØÖ Ð Ö Ò º Ä ÙÖ ½ ÑÓÒØÖ Ð Ö ÙÐØ Ø ³ÙÒ Ö ÕÙ Ø Ñ Ñ ÒØ Ö Ø Ö Ø ÕÙ Ö ÕÙ Ø ÓÒØ ÒÙ Ö Ò ÓÖØ» Ø ÓÖØ ÓÑÓ Ò Ø ÒØ ÖÒ µº Ä ÑÓ Ø ¾ Ñ Ò Ø ÐÐ Ø ÓÖÖ ÔÓÒ ÒØ Ö Ø Ö ÓÒØ ÐÓ Ð Ò Ð ½¼± Ø ÖÑ Ò ÙÜ Ù ÖÓÑÓ ÓÑ ¾¾º Ö ÕÙ Ø ÑÔÐ ÑÓÒØÖ ÒØ ÕÙ³ÙÒ Ö Ø ÓÒ Ö Ô Ø Ø ÓÒ Ò Ø Ò Ñ ÓÑÔÖ ¹ Ò ÒØ ÒØ Ò ÐÓÙ ÙÖ Ð ÖÓÑÓ ÓÑ ¾¾ ÓÑÔÓÖØ ÓÑÑ Ð Ñ Ò Ø ÐÐ Ø Ð ÕÙ ÔÖ ÒØ Ñ ÓÖ Ø Ö Ñ ÒØ Ò Ð Ò Ê Ø ÖÑ Ò Ð ÖÓÑÓ ÓÑ ÙÑ Ò Ñ Ö Ö ½ µº È Ö ÓÒØÖ ÓÒ Ò ØÖÓÙÚ Ô ÓÖÖ Ð Ø ÓÒ ÔÔ Ö ÒØ ÒØÖ Ð ØÖ Ù¹ Ø ÓÒ Ñ Ò Ø ÐÐ Ø Ø Ð ÖÓÒØ Ö ÝÒØ Ò Ú Ð ÓÙÖ Ð Ö Ò ÓÙÐ Ö ÓÒ Ö ÓÑ Ò ÓÒ ÖÙ º º ¾ ÓÑÔ Ö ÓÒ Ð Ö Ô ÖØ Ø ÓÒ Ö Ô Ø Ø ÓÒ Ò Ø Ò Ñ Ò ØÖÓ ÓÖ Ò Ñ Ä ÙÖ ¾ ÔÖ ÒØ ÙÒ ØÙ ÓÑÔ Ö Ø Ú ÒØÖ Ð ÖÓÑÓ ÓÑ ¾¾ ÙÑ Ò º Å ÖÓ ÒØÖ ÕÙ µ Ð ÖÓÑÓ ÓÑ ³ Ø Ð Ò ½ º Å ÖÓ ÒØÖ ÕÙ µ Ø Ð ÖÓÑÓ ÓÑ

12 ½ Ð Ò ½¾º Å µº Ä ÑÓÒØÖ ÒØ Ð ÔÓ Ø ÓÒ Ù ÒØÖÓÑ Ö ÒÓÒÒÙ ÔÓÙÖ Ð ÖÓÑÓ ÓÑ ½ Ð Ò µº Ä Ö ÕÙ Ø Ø Ð Ù Ú ÒØ Í ½¼ Æ Ä ½¼¼ ¼ ¼º ±Å ¼±º Ä ÖÓÑÓ ÓÑ ÓÒØ Ø Ö Ñ ÒØ Ò Ñ ÒØ ÐÓÒ Ù ÙÖ ÓÑÔ Ö Ð ½º Å ¾¼µ ÔÓÙÖ Ð ÖÓÑÓ ÓÑ ¾¾ ÙÑ Ò ½º Å ½¼µ ÔÓÙÖ Ð ÖÓÑÓ ÓÑ ³ Ø Ð Ò Ø ½º ¾ Å µ ÔÓÙÖ Ð ÖÓÑÓ ÓÑ ½ Ð Ò Ö Ô Ø Ú Ñ Òغ Ä Ø ÐÐ Ö Ð Ø Ú ÖÓÑÓ ÓÑ ÓÒØ Ö Ô Ø Ò Ð ÙÖ º Ä Ú Ð ÙÖ ¾ ÓÒØ Ò ÖÓÙ ÕÙ Ò ÓÒ ÙÒ Ü ³Ó Ø Ò Ø Ú Ö Ð Ø ÐÓÑ Ö Ò Ú ÓÐ Ø ÕÙ Ò ÓÒ ÙÒ ÙØ ³Ó Ø Ò Ø Ú Ö Ð Ø ÐÓÑ Ö Ø Ò Ú ÖØ ÕÙ Ò Ð Ò³Ý Ô Ö Ò Ò Ø Ú ÒØÖ Ð Ø ÐÓÑ Ö Ø Ð Ö Ø Ù ÖÓÑÓ ÓÑ º Ä ÒÓÑ Ö ØÓØ Ð Ö Ô Ø Ø ÓÒ Ò Ø Ò Ñ ÒØ Ô Ö Ð ÐÓ Ð ÌÊ È Ö ÕÙ ¹ Ø µ Ò³ Ø Ô ÔÖÓÔÓÖØ ÓÒÒ Ð Ð ÐÓÒ Ù ÙÖ Ù ÖÓÑÓ ÓÑ Ð Ø Ò ØØ Ñ ÒØ ÔÐÙ Ð Ú Þ Ð Ò Ñ ØӻŠµ ÕÙ Þ Ð³ ÓÑÑ ½»Å µ ÓÙ Ð ÔÐ ÒػŠµº Ä ÙÖ ¾ Ð Ò Ù ÑÓÒØÖ Ð Ö ÙÐØ Ø ³ÙÒ Ö ÕÙ Ø Ö ÔÖ ÒØ Ø Ú º Ä ÒÓÑ Ö Ñ Ò Ø ÐÐ Ø ÓÐ Ø Ñ Ð Ö Ò Ð ØÖÓ Ô ÓÒ ÔÖ Ò Ò ÓÑÔØ Ð ÐÓÒ Ù ÙÖ Ö Ð Ø Ú ÖÓÑÓ ÓÑ º ÍÒ ÓÖØ Ø ÐÓÑ Ö ÕÙ Ø Ó ÖÚ ÔÓÙÖÐ ÖÓÑÓ ÓÑ ½ Ð Ò ÓÑÑ ÔÓÙÖ Ð ÖÓÑÓ ÓÑ ¾¾ ÙÑ Òº È Ö ÓÒØÖ Ð Ö Ô ÖØ Ø ÓÒ Ñ Ò Ø ÐÐ Ø Þ Ø Ð Ò Ø ØÖ Ö ÒØ ÐÐ ÙÜ ÙØÖ ÒÓÑ Ð Ö Ô Ø Ø ÓÒ Ò Ø Ò Ñ ÓÒØ Ö Ô ÖØ ÔÖ Ò Ô Ð Ñ ÒØ ÙØÓÙÖ Ù ÒØÖÓÑ Ö º ØØ Ö Ò Ô ÙØ ³ ÜÔÐ ÕÙ Ö Ô Ö Ð Ø ÕÙ Þ Ð³ ÓÑÑ Ð ÜØÖ Ñ Ø ÖÓÑÓ ÓÑ ÓÒØ ÙÒ ÙØ Ò ÒÓ ÙÐ Ö ÓÑ Ò ÓÒ Ô Ö Ö ÔÔÓÖØ Ð ÙÖ ÓÖØ Ø ÙÜ Ö ÓÑ Ò ÓÒ Ø Ò ÕÙ Þ Ð ÔÐ ÒØ Ð ØÖ ÙØ ÓÒ ÒÓ ÙÐ Ö ÓÑ Ò ÓÒ Ø ÓÖÖ Ð Ð Ö ÕÙ Ò Ö ÓÑ Ò ÓÒ Ð ÐÓÒ ÖÓÑÓ ÓÑ Ð Ý ½ µº Ä Ñ Ò Ø ÐÐ Ø Ø ÐÓÑ Ö ÕÙ ÓÒØ Ò Ø ÔÓÙÖ Ü¹ ÔÐ ÕÙ Ö Ð Ô Ö ÓÜ Ó ÖÚ Þ Ð³ ÓÑÑ Ñ Ò Ñ Ô ÕÙ Ö ÒØ Ø Ú Ò Ñ Ó ÑÐ Ø Ð Ñ Ò Ø ÐÐ Ø Ö ÒØ ÑÔÐ ÕÙ Ò Ð³ ÔÔ Ö Ñ ÒØ ÖÓÑÓ ÓÑ Ó Ø Ö Ø Ñ ÒØ Ó Ø Ô Ö Ð³ ÒØ ÖÑ Ö ÔÖÓØ Ò ³ ÔÔ Ö Ñ ÒØ ËÝ Ò ½ µº Ä ÓÑÔ Ö ÓÒ Ö ÒØ ÒÓÑ ÓÒ Ô ÖÑ ÓÒ ÖÑ Ö Ð Ô ÖØ ÙÐ Ö Ø ÔÐ ÒØ Ô Ö Ö ÔÔÓÖØ Ð³ ÓÑÑ Ø Ù Ò Ñ ØÓ µ ÕÙ ÔÓÙÖÖ Ø ÓÖÖ ÔÓÒ Ö ÙÒ ÖÐ Ö ÒØ Ñ Ò Ø ÐÐ Ø Ò Ð Ñ Ò Ñ Ö ÓÑ Ò ÓÒ Ò ÖÐ Þ Ð ÔÐ ÒØ ºººµº ÆÓÙ ÚÓÒ Ù ØÙ Ò Ø Ð Ð Ú Ö Ø ÓÒ Ù Ö Ô ÖØ Ø ÓÒ Ø ÐÓÑ Ö ÕÙ Ö Ô¹ ÔÓÖØ ÒØÖ Ð ÒÓÑ Ö Ö Ô Ø Ø ÓÒ Ò Ø Ò Ñ Ø ÐÓÑ Ö ÕÙ Ø ÒÓÒ Ø ÐÓÑ Ö ÕÙ µ Ò ÓÒØ ÓÒ Ð ÐÓÒ Ù ÙÖ Ù ÑÓØ Ö Ô Ø Ø Ð ÐÓÒ Ù ÙÖ ØÓØ Ð ÔÓÙÖ Ð ØÖÓ Ô ÚÓ Ö ÙÖ º Ò ÓÖ ÓÒÒ Ø ½¼± Ø ÖÑ Ò ÙÜ Ì ¼¼ µ Ø ÙØÖ Ö ÓÒ Ö Ñ Ò ½¼± ¼¼ ÙØÖ µ ¹ ¹ ÓÖ º Ò ÔÐ ÐÓÒ Ù ÙÖ ³ÙÒ Ø Ö Ô Ø ÓÙ ÐÓÒ Ù ÙÖ ØÓØ Ð µº

13 º Å ÙÖ Ù ÐÓÒ Ð ÐÓÒ Ù ÙÖ Ù ÑÓØ ÓÙ Ð ÐÓÒ Ù ÙÖ ØÓØ Ð Ð Ò ÑÓÒØÖ ÙÒ Ø ÐÓÑ Ö ÕÙ ÔÓÙÖ ØÓÙØ Ð ÐÓÒ Ù ÙÖ ³ÙÒ Ø Ö Ô Ø Ñ Ñ ÓÙÖØ Ò Ô ÖØ ÙÐ Ö Ø ½¾ Ô ÕÙ Ø Ð ÔÖ Ò ÒÓÑ Ö Ù Ö Ô Ø ¹ Ø ÓÒ Ò Ø Ò Ñ ØÝÔ Ø ÐÓÑ Ö ÕÙ ÌÌ µò Ì Ð Ò Ë ÕÙ Ò Ò ÓÒ ÓÖØ ÙÑ ½ µº Ò Ö Ú Ò Ð Ø ÐÓÑ Ö ÕÙ Ò³ ÔÔ Ö Ø Þ Ð³ ÓÑÑ ÕÙ ÔÓÙÖ ÙÒ Ø Ö ¹ Ô Ø ÐÓÒ Ù ÙÖ ÙÔ Ö ÙÖ ÓÙ Ð ½ Ô º ÓÒ ÒØ Ö ÒØ ½ Ô Ø Ù Ø Ñ ÒØ Ð Ð Ñ Ø Ù Ð Ð ÕÙ ÐÐ Ð Ñ Ò Ñ Ö Ô Ö Ø ÓÒ Ñ ÔÔ Ö Ñ ÒØ Ò Ô ÙÚ ÒØ ÔÐÙ Ö Ô Ö Ö Ð ÓÙÐ ³ Æ Þ Ð Ð ÚÙÖ Ë ½ µº ÓÒØÖ Ö Ñ ÒØ Ð Ò Ð Ø ÐÓÑ Ö ÕÙ Ò³ ÔÔ Ö Ø ÔÓÙÖ Ð ÖÓÑÓ ÓÑ ¾¾ ÙÑ Ò ÕÙ ÔÓÙÖ ÐÓÒ Ù ÙÖ ØÓØ Ð ÙÔ Ö ÙÖ ½¾¼¹½ ¼ Ô ÙÖ Ð Ö Ô ÕÙ ÓÒ Ö Ñ ÖÕÙ ÕÙ ØØ ØÖ Ò Ø ÓÒ ØÙ ÒØÖ ½¼¼ Ø ¾¼¼ Ô ÔÖ Ñ Ö ÔÓ ÒØ ¼ ½¼¼ Ô ÙÜ Ñ ÔÓ ÒØ ½¼¼ ¾¼¼ Ô µ Ñ ÙÒ ØÙ ÔÐÙ Ò Ô ÖÑ Ð Ø ÖÑ Ò Ö Ú ÔÖ ÓÒ ÓÒÒ ÒÓÒ ÑÓÒØÖ µº Ù Ð ÚÓÕ٠г Ò Ø Ð Ø ØÖ ÔÐ Ø Ó ÖÚ Ù Ð ¼¹ ¼ Ö Ô Ø Ø ÓÒ Ò ÒÓÑ Ö Ù Ñ Ð Ò ÙÖÓ Ò Ö Ø Ú º ÈÓÙÖ Ð ÖÓÑÓ ÓÑ ³ Ö ÓÔ Ø Ð Ò Ö ÑÑ ÓÒ ÖÑ ÒØ Ò ÙÒ ¹ ÙØ Ö Ô Ø Ø ÓÒ Ò Ø Ò Ñ Ò Ð Ö ÓÒ Ø ÐÓÑ Ö ÕÙ º º¾ Ì Ø ÔÓÐÝÑÓÖÔ Ñ Ò ³ ÚÓ Ö ÙÒ Ù ÒÓÑ Ö Ñ Ò Ø ÐÐ Ø ÔÓÐÝÑÓÖÔ Ô ÖÑ Ð³ Ò Ñ Ð Ñ Ò Ø ÐÐ Ø ÒÓÙ ÚÓÒ ØÝÔ Ô Ö È Ê ÚÓ Ö Ô Ö Ö Ô ¾º¾µ ÙÒ ÖØ Ò ÒÓÑ Ö Ñ Ò Ø ÐÐ Ø Ù ÖÓÑÓ ÓÑ ¾¾ Ó ÔÐÙ ÓÙ ÑÓ Ò Ö ØÖ Ö Ñ ÒØ ÖØ Ò ÓÖÖ ¹ ÔÓÒ ÒØ Ö ÕÙ Ø Ñ Ñ ÒØ Ð Ö Ô ÖØ Ø ÓÒ Ñ Ò Ø ÐÐ Ø ØÖ Ø ÓÒÒ ÐÐ Ñ ÒØ ØÙ Ø ³ ÙØÖ ÒÓÙ ÓÒØ Ø Ù Ö Ô Ö ÖÝ Ò ÓÒ ÙØ ÙÖ Ù ÐÓ Ð Ì Ò Ñ Ê Ô Ø Ò Öµ Ú ÕÙ ÒÓÙ ÓÐÐ ÓÖÓÒ Ò Ø Ø Ö ÓÒ ÝÔÓØ ÙÖ Ð ÔÖ Ø ÓÒ Ù ÔÓÐÝÑÓÖÔ Ñ º ½¼

14 È ÖÑ Ð Ñ Ò Ø ÐÐ Ø Ù Ö Ô Ö ÖÝ Ò ÓÒ ÖØ Ò Ò³ Ø ÒØ Ô ÙÒ ÕÙ ÔÐÙ¹ ÙÖ Ñ Ò Ø ÐÐ Ø Ô ÖØ ÒØ ÕÙ Ò ÒÕÙ ÒØ Ø ÙÒ ÑÓØ Ö Ô Ø Ñ Ð Ö Ñ Ð ÒÓÑ Ö ÓÔ ÑÓØ Ö Øº ÁÐ ³ Ø Ú Ö Õ٠гÙÒ Ñ ÐÐ ÔÔ ÖØ Ò Ø ÙÒ Ö ØÖÓÔÓ ÓÒ ËÎ µ ÓÒØ Ò ÒØ ÙÒÒÓÑ Ö Ú Ö Ð ÓÔ ³ÙÒ Ö Ô Ø ¹ Ø ÓÒ Ò Ø Ò Ñ ¼ Ô Ð ÑÓÖ È Ê ÓÒØ Ø Ó Ð³ ÜØ Ö ÙÖ Ð ÕÙ Ò Ù Ö ØÖÓÔÓ ÓÒº ÍÒ ÙØÖ ÓÖÖ ÔÓÒ Ø ÔÖÓ Ð Ñ ÒØ ÙÒ Ö ÓÒ Ä Ê ÐÓÛ ÓÔÝ Ö ¹ Ô Ø µ Ù ÖÓÑÓ ÓÑ ¾¾ Ð Ø ÑÔÓ Ð Ó Ö ÑÓÖ Ô ÕÙ ÔÓÙÖ Ñ Ò Ø ÐÐ Ø º ÇÒ Ô ÙØ Ö ÕÙ³ Ð Ü Ø Ñ ÐÐ Ñ Ò Ø ÐÐ Ø ÓÒ ÓÒ Ö ÑÔÐ Ñ ÒØ ÕÙ ØÝÔ ÕÙ Ò ÙØ ÒØ Ò ³ ØÖ ÙÔÐ ÕÙ Ø Ö Ñ Ò Ù Ò Ù ÒÓÑ ÕÙ Ð ÙØÖ º Ô Ò ÒØ Ø ÖÑ ÓÙÚ ÒØ Ø Ñ Ð ÙØ Ð Ù ÔÖ Ñ Ö ÑÓÝ Ò ³ ÓÐ Ñ ÒØ Ñ Ò Ø ÐÐ Ø ÓÒ ÓÒ Ø ØÙ Ö Ô Ø Ø ÓÒ Ò Ø Ò Ñ ³ÙÒ ÕÙ Ò¹ Þ Ò Ô Ö Ô ÖÑ ØØ ÒØ Ø Ø Ö ÒÓÑ Ö ÙÜ Ñ Ò Ø ÐÐ Ø Î Ö Ò Ù ½ µ ÕÙ³ÓÒ Ú Ø ÕÙ Ð ÓÑÑ ÔÔ ÖØ Ò ÒØ Ñ ÐÐ º Ò Ø Ð Ò³ Ú ÒØ Ô Ú Ö Ø Ð ÓÑÓÐÓ ÕÙ Ò Ñ ÙÐ Ñ ÒØ ÕÙ ÐÕÙ Ö Ø Ö Ø ÕÙ ÓÑÑÙÒ Ö Ò ºººµº ÁÐ Ò³ Ü Ø Ô ÓÙÖ Ñ ÐÐ Ñ Ò Ø ÐÐ Ø ÓÑÔØ ÒØ Ù¹ ÓÙÔ Ñ Ñ Ö Ñ Ð³ ØÙ Ý Ø Ñ Ø ÕÙ Ù ÒÓÑ ÙÑ Ò Ö Ò Ù ÔÓ Ð Ô Ö Ð ÕÙ Ò ÔÓÙÖÖ Ø Ô ÖÑ ØØÖ ³ Ò ÓÙÚÖ Öº Ä Ö ÙÐØ Ø ØÝÔ Ô Ö È Ê ÓÒØ Ö Ô ØÙÐ Ò Ð Ø Ð Ù ½º Ä È Ê ÓÒØ ØÓÙØ ³ ÓÖ Ô ÖÑ Ú Ö Ö ÕÙ Ð Ø ÐÐ ÐÐ Ð ØØ Ò Ù ³ ÔÖ Ð ÕÙ Ò Ù ÖÓÑÓ ÓÑ ¾¾ ÓÖÖ ÔÓÒ ÒØ Ò Ð Ö Ò Ñ ÓÖ Ø ½» µ ÐРгÙÒ ÐÐ Ð ÑÔÐ Ô Ö È Ê Ð ÐÐ Ð ÓÖÖ ÔÓÒ ÒØ ÓÒØ Ñ ÖÕÙ ³ÙÒ Ò Ð Ø Ð Ù ½µº ÇÒ Ô ÙØ Ò ÓÒÐÙÖ ÕÙ Ð ÕÙ Ò Ø Ò ØØ ÑÑ Ø ÐÐ ÕÙ Ò³ Ø Ø Ô Ö Ø ÒØ ÓÒÒ ÕÙ³ÙÒ ØÖÓÔ ÓÖØ ÓÑÓÐÓ ÒØÖ Ð ÑÓØ Ô ÙØ Ò Ö Ö ÔÖÓ Ð Ñ ³ Ñ Ð ³ Ø Ö Ð Ô ÖØ ÖØ Ò ÑÓØ µº Ò Ð³ÙÒ ³ ÒÓ Ö Ò ÒØÖ Ð³ ÐÐ Ð ÑÔÐ Ô Ö È Ê Ø Ð ÕÙ Ò Ù ÖÓ¹ ÑÓ ÓÑ ¾¾ г ÜÔÐ Ø ÓÒ Ð ÔÐÙ ÔÖÓ Ð Ø ÕÙ ÒÓÙ ÚÓÒ ÑÔÐ ÙÒ ÙØÖ ÕÙ Ò ÕÙ ÐÐ Ù ÖÓÑÓ ÓÑ ¾¾º Ò Ø Ô Ö ÙÒ Ð Ø Ò Ð Ø ÒÓÙ ÚÓÒ Ò¹ Ø Ò Ð ÖÓÑÓ ÓÑ ½ ÙÒ ÕÙ Ò ÓÑÓÐÓ Ù Ù Ñ Ò Ø ÐÐ Ø Ù ÖÓÑÓ ÓÑ ¾¾ ÕÙ ÓÑÔÓÖØ ¾ Ö Ô Ø Ø ÓÒ ³ÙÒ ÑÓØ ¾ Ô µ Ñ Ò ÓÑÔØ ÒØ ÕÙ³ÙÒ Ü ÑÔÐ Ö Ð³ÙÒ Ø Ö Ô Ø Ù Ú ÔÖ Ñ Ö ÒÙÐ ÓØ Ð³ÙÒ Ø ³ Ø Ö ÙÒ Ö ÓÒ ÙÒ ÕÙ Ô ÒÕÙ ³ÙÒ Ö Ô Ø Ø ÓÒ Ö Ø Ô ÚÓ Ö ÒÒ Ü µº ØØ ÕÙ Ò ÓÖÖ ÔÓÒ Ð Ø ÐÐ Ø Ú Ñ ÒØ ÑÔÐ Ô Ö È Êº Ä Ö ÓÒ ÓÑÓÐÓ Ù Ù ÖÓÑÓ ÓÑ ½ Ø Ù ÖÓÑÓ ÓÑ ¾¾ Ö ÙÐØ ÒØ ÖØ Ò Ñ ÒØ ³ÙÒ ÙÔÐ Ø ÓÒ Ò ØÖ Ð Ñ ÓÒ Ô ÙØ Ñ Ò Ö ÐÐ Ù ÖÓÑÓ ÓÑ ½ ÔÖÓÚ ÒØ ³ÙÒ Ð Ø ÓÒ ÑÓØ Ö Ô Ø ÓÙ ÐÐ ½½

15 Ì º ½ Ê ÙÐØ Ø Ó Ø ÒÙ ÔÓÙÖ ¼ Ñ Ò Ø ÐÐ Ø ØÝÔ ÆÓÑ Ö ÆÓÑ Ö Ø Ð ÈÖÓ ¾ ÐÐ Ð ³ ÐÐ Ð Ñ Ò Ø ÐÐ Ø Ö ÒØ» Ø ÐÐ ÓÖÖ ÔÓÒ ÒØ Ð ÕÙ Ò Ù Ö¾¾ ½ ¾» Ø ÐÐ Ò ÓÖÖ ÔÓÒ ÒØ Ô Ð ÕÙ Ò Ù Ö¾¾ ¼ Ö ÕÙ Ò ÐÐ Ð ÕÙ ± ± ¼º½ º ± º ± ¼º½¼ ± ± ¼º ¼± ¼± ¼º ± ¾ ± ¼º ± ± ½± ¼º¼ ± ½¼± ½± ¼º½ ¾ ½ ½½± ± ± ¼º¾ º ± ± ¼º ± ¼º¼ º ± ¼º ± ± ¼º ½ ± ± ¾½± ½± ¼º ½ ½ ± ± ½± ± ¼º ½ ± º ± ± ¼º ± ¼º ¾ ½ º ± ½ ± º ± ½¼± ± ¼º ½ ± ¼± ¼º ± ± ¼º ± ¼º ± ¼º ¼º ± º ± ± ½¼± ½º ± ¼º ± ½¼± ½º ± ¼º ½ ¾¼ ¾ Ö ÕÙ Ò ÐÐ Ð ÕÙ ÒØÖ ¼º ± Ø ½ ± ¼º ¹ ¾» ÔÖ Ñ Ö ÒÓÒ Ô ÕÙ ³ ÑÔÐ Ø ÓÒ» Ô ³ ÑÔÐ Ø ÓÒ ÔÖÓ Ð Ñ Ñ Ù ÔÓ ÒØ µ Ù ÖÓÑÓ ÓÑ ¾¾ ÔÖÓÚ ÒØ ³ÙÒ ÑÔÐ Ø ÓÒ Ù ÑÓØ Ò Ø Ð Ñ Ð Ð ÔÐÙ ÚÖ Ñ Ð Ð Ö ÙÒ ÝÔÓØ ÙÖ Ð³ÓÖ Ò Ñ Ò Ø ÐÐ Ø Ø ÕÙ ÓÙÖØ Ù ¹ ÕÙ³ ½¼ Ô µ Ö Ô Ø Ø ÓÒ Ö Ø ÔÔ ÖÙ Ô Ö Ö Ú Ò Ñ ÒØ Ò ÔÐÙ ÔÖÓ Ð Õ٠г ÔÔ Ö Ø ÓÒ ³ÙÒ Ö Ô Ø Ø ÓÒ Ò Ø Ò Ñ ÔÐÙ ÙÖ Þ Ò Ô Ö µ Ö ÒØ Ð³ÓÖ Ò Ð ÙÔÐ Ø ÓÒ Ð Ö ÓÒ ÕÙ³ ÐÐ ÒØÓÙÖ ÒØ Ô Ö Ð Ñ ÒØ Ö ÔÐ Ø ÓÒ ÓÙ Ò ÒÓÒ Ö ÔÖÓÕÙ º Ò Ù Ø Ð³ ÜÔ Ò ÓÒ Ù Ñ Ò Ø ÐÐ Ø ÔÓÙÖÖ Ø ÔÖÓ Ù Ö Ô Ö ÓÒÚ Ö ÓÒ Ò ÕÙ ÖÓ Ò ÓÚ Ö ÒÓÒ Ö ÔÖÓÕÙ ÓÙ Ð Ñ ÒØ Ö ÔÐ Ø ÓÒ À Ö ½ µ ÚÓ Ö ÒÒ Ü º ÑÓ Ð Ò Ø ØÓÙØ Ó ÕÙ³ ÔÖ Ð³ ÑÔÐ Ø ÓÒ Ð Ñ Ò Ø Ð¹ Ð Ø Ò Ö Ó Ø ØÓÙ ÓÙÖ ÒÕÙ Ð Ö Ô Ø Ø ÓÒ Ö Ø ÕÙ ÐÕÙ Ô ÕÙ Ò³ Ø Ô Ð ÙÖ Ð ÖÓÑÓ ÓÑ ¾¾ ÒÓÙ ÚÓÒ ¾ ÑÓØ ØÖ Ø º ÍÒ ØÙ ÔÐÙ ÔÔÖÓ ÓÒ Ó Ø ÒÓÖ ØÖ Ñ Ò ÔÓÙÖ ÜÔÐ ÕÙ Ö Ó ÖÚ Ø ÓÒ ÒÓÙ ÐÐÓÒ Ø ÒØ Ö Ö ÓÒ ØÖÙ Ö Ð³ ØÓ Ö Ù Ñ Ò Ø ÐÐ Ø Ù ÖÓÑÓ ÓÑ ¾¾ Ò ÓÒ ² ÓÒ ½ µ Ò Ú Ö Ö Ð³ ÝÔÓØ ³ÙÒ ÑÔÐ Ø ÓÒ Ô ÖØ Ö Ð ÕÙ Ò ÓÑÓÐÓ Ù Ù ÖÓÑÓ ÓÑ ½ Ø ÔØ Ð º ÈÓÙÖ Ð ÙÜ Ñ Ñ Ò Ø ÐÐ Ø ÓÒØ Ð³ ÐÐ Ð ÑÔÐ Ò ÓÖÖ ÔÓÒ Ø Ô Ð ÕÙ Ò Ù ÖÓÑÓ ÓÑ ¾¾ ÙÙÒ ÕÙ Ò ÓÑÓÐÓ Ù Ò³ Ø Ñ Ò Ú Ò Ô Ö Ð Ø Ò Ð Ø Ó Ø Ð Ü Ø ÙÒ Ö ÓÒ ÓÑÓÐÓ Ù ÕÙ Ò³ Ø Ô ÒÓÖ ÕÙ Ò Ó Ø Ð ½¾

16 ÕÙ Ò Ø ÑÔ Ö Ø Ø ÓÒ Ù Ø Ð Ô ÖØ ÖØ Ò ÙÒ Ø Ö Ô Ø Ð³ ÐÐ Ð ¹ Ù Ø Ð ÕÙ Ò Ù ÖÓÑÓ ÓÑ ¾¾ Ø ¼¼ Ô ÑÓ Ò Õ٠г ÐÐ Ð ÑÔÐ Ô Ö È Êµº ÒÚ ÖÓÒ ¾¼±» µ Ñ Ò Ø ÐÐ Ø Ø Ø ÓÒØ Ö Ø Ð³ ÑÔÐ Ø ÓÒ Ô Ö È Ê Ó Ø Ô Ö ÕÙ Ð ÔÖ Ñ Ö ÓÒØ Ø Ñ Ð Ó ÒÓÒ Ô ÕÙ Ý Ö Ø ÓÒ ÖÓ ºººµ Ó Ø Ô Ö ÕÙ Ð ÓÒ Ø ÓÒ ÓÔØ Ñ Ð È Ê Ò³ÓÒØ Ô Ø ØÖÓÙÚ º ± ½»¾ µ Ñ Ò Ø ÐÐ Ø ÑÔÐ ÓÒØ ÔÐÙ ³ÙÒ ÐÐ Ð ØÓÙ Ú Ö ÒØ Ð³ ÕÙ Ð Ö À Ö Ý Ï Ò Ö Ð Ö ÕÙ Ò ÐÐ Ð ÕÙ ÙÜ ÐÐ Ð ÓÒØ Ô Ø Õ Ð Ö ÕÙ Ò ÓÑÓÞÝ ÓØ ÖÓÒØ Ô ¾ Ø Õ ¾ Ø Ð Ö ÕÙ Ò ³ Ø ÖÓÞÝ ÓØ Ö ¾ÔÕµº È ÖÑ Ð Ñ Ò Ø ÐÐ Ø ÑÔÐ ± ¾»¾ µ ÓÒØ ØÖ ÔÓÐÝÑÓÖÔ Ø Ò Ø ÔÓÙÖ ØÖ ÝÔ ÖÑÙØ Ð º Ä Ö Ò Ñ ÒØ ÐÓ Ð Ò³ Ø ÕÙ ± ¾» µ Ð Ó Ò Ø Ø Ö Ñ Ò Ø ÐÐ Ø Ð³ Ò ÐÝ ÕÙ Ò Ò ØÙ Ö Ð È Ê ÒÙØ Ð Ø ÓÒ Ù Ø º Ä Ó Ø Ð Ö ÛÛÛº Ð Ö ºÓѵ ÕÙ Ñ Ò ÙÒ ÔÖÓ Ø ÕÙ Ò Ù ÒÓÑ ÙÑ Ò ÚÖ Ø ÓÙÖÒ Ö ³ ÕÙ ÐÕÙ ÑÓ ÙÒ ÒÓÙÚ ÐÐ ÕÙ Ò Ù ÖÓÑÓ ÓÑ ¾¾ ÕÙ Ô ÖÑ ØØÖ ³ Ñ Ð ÓÖ Ö Ò ØØ Ñ ÒØ Ð Ö Ð ÔÓÙÖ Ð Ö Ö Ñ Ò Ø ÐÐ Ø ØÖ ÔÓÐÝÑÓÖÔ º Ò Ð Ø Ð Ù ½ ÙÖ ÒØ Ð ÔÖÓ Ð Ø ³Ó Ø Ò Ö ÙÜ ÐÐ Ð Ö ÒØ Ø Ö Ö ÕÙ Ò ÐÐ Ð ÕÙ ÙÒ ¾ Ñ Ò Ø ÐÐ Ø ÑÔÐ º Ë ÒÓÙ Ú ÓÒ ÔÓ ÙÜ ÕÙ Ò Ù ÖÓÑÓ ÓÑ ¾¾ Ø ÙØ Ð ÙÒ Ö Ð ØÖ ÑÔÐ Ú ÒØ Ò Ø Ø Ö Ô Ö È Ê ÕÙ Ð Ñ Ò Ø ÐÐ Ø ÓÒØ Ð ÐÓÒ Ù ÙÖ ØÓØ Ð Ø ÒØ Ö ÒØ ÒØÖ ÙÜ ÕÙ Ò ÒÓÙ ÙÖ ÓÒ Ù ± Ò Ø Ø Ö ÕÙ Ñ Ò Ø ÐÐ Ø ØÖ ÔÓÐÝÑÓÖÔ º È ÖÑ Ð ¾ Ñ Ò Ø ÐÐ Ø ÑÔÐ ÒÓÙ Ò ÙÖ ÓÒ ØÝÔ ÓÑÑ ÔÖÓ ³Ó Ø Ò Ö ÙÜ ÐÐ Ð Ö ÒØ µ Ò ÑÓÝ ÒÒ ÓÒØ ¾ ¼º ØÖ ÔÓÐÝÑÓÖÔ ¾ ±µº ÁÐ Ñ Ð ÓÒ ÕÙ ØØ Ñ Ø Ó Ó Ø Ù ÔØ Ð ³ Ñ Ð ÓÖ Ö Ò Ð Ñ ÒØ Ð Ö Ò¹ Ñ ÒØ ³Ó Ø ÒØ ÓÒ Ñ Ò Ø ÐÐ Ø ÓÖØ Ñ ÒØ ÔÓÐÝÑÓÖÔ ³ Ø Ö ÔÓØ ÒØ ÐÐ Ñ ÒØ ÝÔ ÖÑÙØ Ð º ÌÓÙØ Ó ³ ÙØÖ Ñ Ø Ó ÓÒØ ÒÚ Ð ÔÓÙÖ ÒØ Ö Ð Ñ Ò Ø ÐÐ Ø ÔÓÐݹ ÑÓÖÔ ÓÑÑ Ð³ÙØ Ð Ø ÓÒ Ù ÔÓÙÚÓ Ö ÔÖ Ø ³ÙÒ ÙÐ ÐÐ Ð ÙÖ Ð ÔÓÐÝÑÓÖÔ Ñ ÁÐ ³ Ö Ø ³ ØÙ Ö Ð Ù ÓÒ Ú Ö ÒØ ÔÓ Ø ÓÒ Ú Ö ÒØ µ ÒØÖ Ð ÑÓØ Ö ¹ Ô Ø º Ò Ø Ð Ñ Ò Ø ÐÐ Ø Ð ÔÐÙ Ò Ø Ð Ò ÓÒØ Ô ÓÖ Ñ ÒØ Ö Ø Ö Ô Ö ÙÒ ÓÑÓ Ò Ø ÕÙ Ò ÒØÖ Ð ÙÖ ÑÓØ ÕÙ Ð Ö Ò Ñ ÖÓ Ø ÐÐ Ø ÕÙ Ô ÙÚ ÒØ ÑÙØ Ö Ô Ö Ð Ñ ÒØ Ö Ñ ÒØ ³Ç ÐÓÖ Ð Ö ÔÐ Ø ÓÒµº ¹ Ô Ò ÒØ Ð ÓÒØ ÔÖÓ Ð Ñ ÒØ Ö Ø Ö Ø ÕÙ ÓÑÑÙÒ Ô Ö Ü ÑÔÐ ÓÒ ÚÖ Ø ØÖÓÙÚ Ö ÑÓ Ò ØÝÔ Ö ÒØ ³ÙÒ Ø Ö Ô Ø Ù Ò ³ÙÒ Ñ Ò Ø ÐÐ Ø ÝÔ ÖÑÙ¹ Ø Ð ÓÙÑ Ö Ñ Ò Ñ ÒØ ÓÒ Ø ÒØ ÕÙ³ Ù Ò ³ÙÒ Ñ Ò Ø ÐÐ Ø Ò Ø ÓÒØ ØÓÙ Ð ÑÓØ ÙÖÓÒØ ÔÙ Ú Ö Ö Ò Ô Ò ÑÑ ÒØ Ô Ø Ö Ø ÒØ ÜÔÐÓ Ø Ö Ø ÓÒØ Ð³Ó Ø ³ÙÒ ÓÐÐ ÓÖ Ø ÓÒ Ú ÖÝ Ò ÓÒº ½

17 ÓÒÐÙ ÓÒ Ø Ô Ö Ô Ø Ú ÈÖ ÑÑ ÒØ Ð ÒÓÑ Ö Ñ Ò Ø ÐÐ Ø ÔÓÐÝÑÓÖÔ Ð ÕÙ Ø Ø Ø Ñ ÕÙ ÐÕÙ Ñ ÐÐ Ö Ò ØÓÙØ Ð ÒÓÑ ÙÑ Ò Ó Ø ÕÙ ÐÕÙ Þ Ò ÔÓÙÖ Ð ÖÓÑÓ ÓÑ ¾¾º Ó Ø Ö Ö Ò Ñ Ð ÒØ Ô ÔÓÙÚÓ Ö ÓÙ Ö ÙÒ ÖÐ Ò Ð Ñ Ø ÓÐ Ñ Ù ÒÓÑ º ij Ò ÐÝ ÕÙ Ò ÖÓÑÓ ÓÑ ÒØ Ö Ö Ú Ð ÙÒ ÒÓÑ Ö Ò ÔÐÙ ÑÔÓÖØ ÒØ Ñ Ò Ø ÐÐ Ø Ú ÙÒ Ø Ö Ô Ø Ø ÙÒ Ö Ô ÖØ Ø ÓÒ Ú Ö Ð ÜØÖ Ñ Ø Ø ÐÓ¹ Ñ Ö ÕÙ ÓÑÑ ÔÓÙÖ Ð Ñ Ò Ø ÐÐ Ø Ð ÕÙ Ñ Ú ÐÓÒ Ù ÙÖ ØÓØ Ð Ô Ö Ó Ò ÔÐÙ ÓÙÖØ ÕÙ ÐÐ ÕÙ Ø ÒØ ÑÔÓ Ô Ö Ð ÓÒØÖ ÒØ ÜÔ Ö Ñ ÒØ Ð º Ó ÖÚ Ø ÓÒ ÓÒÒ ÒØ Ò ÔÐÙ Ö Ð Ø ÙÜ Ñ Ò Ø ÐÐ Ø º ÁÐ Ö ÒØ Ö ÒØ ÓÑÔ Ö Ö Ð ÔÖ Ñ Ö ÓÒÒ Ö Ô ÖØ Ø ÓÒ Ú ÐÐ ÖÓÑÓ ÓÑ ÙÑ Ò ÔÐÙ Ö Ò ÕÙ Ò Ð ÕÙ Ò Ö Ú º ÈÓÙÖ ÒØ Ö Ñ ÒØ Ñ Ò Ø ÐÐ Ø ÓÖØ Ñ ÒØ ÔÓÐÝÑÓÖÔ ³ Ø Ö ÔÓ¹ Ø ÒØ ÐÐ Ñ ÒØ ÝÔ ÖÑÙØ Ð µ Ô ÖÑ Ð Ú Ø Ò Ñ Ð Ñ Ò Ø ÐÐ Ø Ù ÒÓÑ ÙÑ Ò Ñ Ø Ó ÓÐÓ ÓÒØ Ñ ØØÖ Ò ÙÚÖ º ÆÓÙ ÚÓÒ ÔÙ ÑÓÒØÖ Ö ÕÙ Ð Ø ÔÓ Ö ³ÙÒ ÙÜ Ñ ÐÐ Ð Ù ÖÓÑÓ ÓÑ ¾¾ Ø Ò ÓÒ Ö Ö ÕÙ Ð Ñ Ò Ø ÐÐ Ø ÐÓÒ¹ Ù ÙÖ Ö ÒØ Ò ÙÜ ÕÙ Ò ³ Ú Ö Ö Ø ØÖ Ñ Ð Ö ÙÒ ÔÖÓ Ð Ø ÒÓÒ Ò Ð Ð Ñ ÒÕÙ Ö Ñ Ò Ø ÐÐ Ø ³ ÒØ Ö Øµº ÁÐ Ö Ø Ù ÜÔÐÓ Ø Ö Ð Ô Ø ÓÒ Ø ÒØ ÓÑÔ Ö Ö Ð ØÖ ÙØ ÓÒ ÔÓ Ø ÓÒ Ú Ö ÒØ Ù Ò ÑÓØ ÕÙ Ñ Ñ ÐÐ Ò³ Ñ Ð ÓÖ Ø Ô ØÖ ÓÖØ Ñ ÒØ Ð Ø Ø ÓÒ Ñ Ò Ø ÐÐ Ø ÔÓÐÝÑÓÖÔ ÔÓÙÖÖ Ø ØÖ Ò ÓÖÑ Ø Ú ÙÖ Ð³ÓÖ Ò Ø Ð³ ÚÓÐÙØ ÓÒ Ñ Ò Ø ÐÐ Ø Ò ÕÙ Ð ÙÖ Ñ Ò Ñ ³ Ò Ø Ð Ø º Ä ÒÓØÓÜ Ø Ø ÙÒ ÓÑ Ò Ö Ö ÔÖÓÑ ØØ ÙÖ Ð ÙÜ Ñ Ò Ø ÐÐ Ø º Ò Ø ÒÓÑ Ö Ù ØÙ ÑÓÒØÖ ÒØ ÕÙ Ð Ñ Ò Ø ÐÐ Ø ÝÔ ÖÑÙØ Ð ÔÓÙÖÖ ÒØ Ö¹ Ú Ö ÓÑ ÖÕÙ ÙÖ ÔÓÙÖ Ð³ ÜÔÓ Ø ÓÒ ÒØ ÒÓØÓÜ ÕÙ ÓÑÑ Ð Ö Ø ÓÒ ÓÒ ÒØ º Þ Ð ÓÙÖ ÓÒ ÑÓÒØÖ ÙÒ Ò Ð Ø Ñ Ò Ø ÐÐ Ø Ö Ø ÓÒ Ù ÖÓÚ ½ µ Ò ÕÙ Þ Ð³ ÓÑÑ Ö ÙÒ ØÙ Ñ Ò ÙÖ Ð Ø ÒØ Ö ÓÒ ÓÒØ Ñ Ò Ô Ö Ð³ ÒØ ÖÒÓ ÝÐ Ù ÖÓÚ ½ µº ÔÖÓ Ù Ø Ñ ÕÙ ÔÓÐÐÙØ ÓÒºººµ ÓÒØ Ù Ù Ô Ø ³ Ù Ñ ÒØ Ö Ð Ø ÙÜ ÑÙØ Ø ÓÒ Ò Ñ Ó µ Ñ Ò ¹ Ø ÐÐ Ø ÝÔ ÖÑÙØ Ð º ÑÓ Ð ÓÒØ Ø Ö ÑÑ ÒØ Ú ÐÓÔÔ Þ Ð Ð ÚÙÖ Ò ÖØ ÓÒ Ñ Ò Ø ÐÐ Ø ÝÔ ÖÑÙØ Ð ÙÑ Ò Ò Ö ÒØ ÓÒ Ò Ø ÕÙ µ Ø ÔÓÙÖÖ ÒØ Ô ÖÑ ØØÖ Ð³Ó¹ ÓÒ ³ÙÒ Ø ºººµ Ú ÐÓÔÔ Ö Ø Ø ÒÓØÓÜ Ø ÒØ ÒØ Ô ÕÙ Ñ ÒØ Ø Ú Ø Ö ÓÑ ÒÓ Ò º Ø ÐÐ ØÙ ÔÓÙÖÖ ÒØ Ð Ñ ÒØ Ö ÓÑÔÖ Ò Ö ÕÙ ÐÐ Ø Ð Ð Ð³ ÒØ ÒÓØÓÜ ÕÙ Ð Ö Ô Ø Ø ÓÒ Ò Ø Ò Ñ ÐÐ ¹Ñ Ñ Ð ÔÓ ÒØ ½

18 Ù Ö ÓÑ Ò ÓÒ ÒÕÙ ÒØ ÓÙ Ð Ñ Ò Ö Ö ÔÐ Ø ÓÒººº Ò Ð ÙÜ Ñ ÝÔÓØ Ð Ñ Ò Ø ÐÐ Ø Ö ÒØ ÓÑÑ Ñ ÖÕÙ ÙÖ Ð³ Ø Ú Ø Ù ÔÓ ÒØ Ù Ö ÓÑ Ò ÓÒ Ó Ø Ò ÕÙ Ò Ð ÔÖ Ñ Ö Ø Ô Ùع ØÖ Ù Ð ØÖÓ Ñ µ Ò³ ÑÔÓÖØ ÕÙ Ð Ñ Ò Ø ÐÐ Ø Ñ Ñ ÒÓÒ ÝÔ ÖÑÙØ Ð µ ÔÓÙÖÖ Ø ÖÚ Ö ÓÑ ÖÕÙ ÙÖ ÔÓÙÖ Ð³ ÒØ ÒÓØÓÜ ÕÙ º ½

19 Ð Ó Ö Ô Ñ Ö Ö Îº º Ù Ù Ö Åº ÖÐ º Ô Ó٠Ⱥ È ØÓÒ º Ö Ù Ù Ëº ÅÓÒ ÓÙ ÐÐÓÙÜ Åº Ä Ø ÖÓÔ ÙØÖ ÐÐ ÙÜ Âº Ù Ö Ò º Î Ö Ò Ù º ½ º Ò ÐÝ Ó Ø ÙÑ Ò Ô Ò Ö Ø ÒÓÑ ÙÔÔÓÖØ ÙÒ Ú Ö Ð Ø ÐÓÑ Ö ÓÖ Ò Ó Ñ Ò Ø ÐÐ Ø ÕÙ Ò º ÒÓÑ ¾ ¾¹ ½º Ð Ý Ìº ½ º Å ÑÑ Ð Ò Ñ ÓØ Ö ÓÑ Ò Ø ÓÒ Ö Ü Ñ Ò Ø ÓÒº ÀÙÑ Ò Ø ¹ º Ò ÓÒ º Ò Äº ÓÒ º ½ º Ê ÓÒ ØÖÙØ Ò Ø ÙÔÐ Ø ÓÒ ØÓÖÝ Ó Ø Ò Ñ Ö Ô Øº Á Ñ Ò ÓÒ º ½ º Ì Ò Ñ Ö Ô Ø Ò Ö ÔÖÓ Ö Ñ ØÓ Ò ÐÝÞ Æ ÕÙ Ò º ÆÙÐ Ê ¾ ¹ ¼º Ó Èº Ò º º Â Ö Ý º ½ º Å Ò Ø ÐÐ Ø Ò Ø Ð ØÝ Ò ÖÑÐ Ò ÑÙØ Ø ÓÒº ÐÐ ÅÓÐ Ä Ë ½ ¹ º Ù Ö Âº Ò º Î Ö Ò Ù º ½ º ÓÑÔÐ Ü Ö ÓÑ Ò Ø ÓÒ Ú ÒØ Ø Ø ÝÔ ÖÑÙØ Ð Ñ Ò ¹ Ø ÐÐ Ø ½ ¾Ë ¼µº Å Ç Âº ½ ¾¼ ¹ ¾½¼º Ö ÙÛ Ö Àº º Ù Ö Âº Ì Ö º Ù ÖØ º Î Ö Ò Ù Ò º Æ ÓÐ º ½ º Å ÓØ Ò Ø Ð ØÝ Ó ÙÑ Ò Ñ Ò Ø ÐÐ Ø ½ Ò Ý Ø Ö ÕÙ Ö Æ ÓÙ Ð ¹ ØÖ Ò Ö º Æ Ø Ò Ø ¾ ¹ ½º Ù ÖÓÚ º º κ ƺ Æ Ø ÖÓÚ Æº º ÃÖÓÙ Ò Ý Îº º Ç Ø Ô Ò Ó º Î Ö Ò Ù º ¹ Ö Ù Ù Âº Ù Ö Ò º º Â Ö Ý º ½ º ÙÖØ Ö Ú Ò ÓÖ Ð Ú Ø ÙÑ Ò Ñ Ò Ø ÐÐ Ø ÑÙØ Ø ÓÒ Ö Ø Ò Ð ÖÙ Ø Ý Ö Ø Ö Ø ÖÒÓ ÝÐ Òغ ÅÙغ Ê º ½ ¾ ¹¾ º Ù ÖÓÚ º º ź ÈÐÙÑ Âº ÖÓÛÒ Âº ÒÒ ÐÐÝ Èº Ó º ÓÓ Ò º º Â Ö Ý º ½ º ËØ Ô ØÝ Ó Ö ÔÓÒ Ò ÓÙ Ð Ò Ó ÓÖ ÑÓÙ Ñ Ò Ø ÐÐ Ø ÖÑ¹Ð Ò ÑÙ¹ Ø Ø ÓÒ Ò Ù Ý ÙØ Ö Ø ÓÒº ÈÖÓ Æ ØÐ Ë Í Ë ¾ ½¹ º ÙÒ Ñ Áº ƺ Ë Ñ ÞÙ º º ÊÓ Ëº Ó º ʺ ÀÙÒØ Âº º ÓÐÐ Ò Êº ÖÙ Û º ź Ö Åº Ð ÑÔ Äº º ËÑ Ò Êº Ò Ó٠º Ⱥ ÐÑ º º ÙÐ Ý Âº Ð Ý Ãº ÖÐÓÛ Ãº ƺ Ø Çº Ð Ý º Ⱥ Ö Ëº Ð Ý º ź Ö Ñ Ò º ٠º ÙÖ Ïº º ÙÖÖ ÐРú Ⱥ dz Ö Ò Ø Ðº ½ º Ì Æ ÕÙ Ò Ó ÙÑ Ò ÖÓÑÓ ÓÑ ¾¾º Æ ØÙÖ ¼¾ ¹ º À Ö Âº º Ò º º ÄÓÙ º ½ º Å Ò Ø ÐÐ Ø ÓÖ Ò Ò Ý Ø Ò ÙÑ Ò º ÒÓÑ ½ ¾¹ º Â Ö Ý º º ÅÙÖÖ Ý Âº Ò Æ ÙÑ ÒÒ Êº ½ º À Ö ÓÐÙØ ÓÒ Ñ ÔÔ Ò Ó ÖÓ ÓÚ Ö Ò ÙÑ Ò Ô ÖÑ Ò Ñ Ò Ø ÐÐ Ø ¹ Ó Ø Ö ÓÑ Ò Ø ÓÒ ÓØ ÔÓغ ÅÓÐ ÙÐ Ö Ðк ¾ ¾ ¹ º Â Ö Ý º º Ò Êº Æ ÙÑ ÒÒº ½ º ËÓÑ Ø ÑÙØ Ø ÓÒ ÔÖÓ Ø ÙÑ Ò Ñ Ò Ø ÐÐ Ø º

20 ÀÙѺ ÅÓк Ò Øº ½¾ ¹½ º Â Ö Ý º º ú Ì Ñ º Å Ä Ó º º ÅÓÒ ØÓÒ º ĺ Æ Ð Ò Âº º ĺ ÖÑÓÙÖº ½ º ÓÑÔÐ Ü Ò ÓÒÚ Ö ÓÒ Ú ÒØ Ò ÖÑÐ Ò ÑÙØ Ø ÓÒ Ø ÙÑ Ò Ñ Ò Ø ÐÐ Ø º Æ Øº Ò Øº ½ ¹½ º Å Ý Ö Ãº º Ë ÙÐÐ Ö Êº Ï Ñ ÙØØ º ÅÙÖÔ Ý º ÎÓÐ ÖØ Ìº ÈÓ Ð º Ù Ø Ö Ó Ø Ïº ËØ Ñ Ãº º ÒØ Ò Æº Ì ÖÖÝÒ º À ÖÖ Ïº Ò ÓÖ È Ö Ò Ø Äº Ö Ú ÐРź Ê Ö Åº Ï Ð ÖØÒ Ö Îº Ë ÑÓÒ º Ç ÖÑ Ö Êº Šź ÅÙÐÐ Ö Åº ÃÖ Åº Ð ÒÝ Èº ÈÙ ÓÑ Ò Åº Ï Ø ÓÒ Ïº ʺ Å ÓÑ Ø Ðº ½ º Ë ÕÙ Ò Ò Ò ÐÝ Ó ÖÓÑÓ ÓÑ Ó Ø ÔÐ ÒØ Ö ÓÔ Ø Ð Ò º Æ ØÙÖ ¼¾ ¹ º ÅÓÒ ØÓÒ º º ʺ Æ ÙÑ ÒÒ Ìº ÙÖ Ñ Æº Ö ØÛ ÐРú Ì Ñ º Å Ä Ó Ò º º Â Ö Ý º ½ º Å Ò Ø ÐÐ Ø ÑÙØ Ø ÓÒ Ö Ø Ú Ö Ø ÓÒ Ó Ø Û Ø Ò Ò Æ ÕÙ Ò ÔÓÐÝÑÓÖÔ Ñº Æ Ø Ò Ø ½ ¾¹½ ¼º Ë º º ʺ º ÃÓ Ó Åº ÓÑ Ò Èº Ö ÒÛ ÐÐ Ò Ìº º È Ø º ½ º Å ÖÓ Ø ÐÐ Ø Ò Ø Ð ØÝ Ò Ý Ø Ô Ò Ò ÓÒ Ö Ô Ø ÙÒ Ø Þ Ò Æ Ñ Ñ Ø Ö Ô Ö Ò º ÅÓÐ ÐÐ ÓÐ ½ ¾ ½¹ º ËÝ Ò Âº ½ º Ï Ø Ñ ÓÑÓÐÓ ÓÙ ÖÓÑÓ ÓÑ Ò ÓØ Ö Ò Ñ Ó Ö Ú Û Ò Ò ÝÔÓØ º ÖÓÑÓ ÓÑ ½¼ ¾¼ ¹½ º Ì º Ð Ò Ë ÕÙ Ò Ò ÓÒ ÓÖØ ÙѺ ½ º ÒÓÑ ÕÙ Ò Ó Ø Ò Ñ ØÓ º Ð Ò ÔÐ Ø ÓÖÑ ÓÖ ÒÚ Ø Ø Ò ÓÐÓ Ýº Ë Ò ¾ ¾ ¾¼½¾¹ º Î Ö Ò Ù º Ò º Ò Ù º ¾¼¼¼º Å Ò Ø ÐÐ Ø ÅÙØ Ð ØÝ Ò ÒÓÑ Ö Ø ØÙÖ º ÒÓÑ Ê Ö ÙÐÝ ¾¼¼¼º Î Ö Ò Ù º ½ º ÈÓÐÝÑ Ö Ó Ö Ò ÓÑ ÓÖØ ÓÐ ÓÒÙÐ ÓØ Ø Ø ÔÓÐÝÑÓÖÔ ÐÓ Ò Ø ÙÑ Ò ÒÓÑ º ÆÙÐ Ê º ½ ¾ ¹ ¼º Î Ö Ò Ù º º Å Ö Ø º Ô ÓÙ º ÙÖ Åº Ä Ø ÖÓÔ Ò Îº Ä ÙØ Öº ½ ½º Ì Ù Ó ÝÒØ Ø Ø Ò Ñ Ö Ô Ø ØÓ ÓÐ Ø Ò Û ÎÆÌÊ ÐÓ ÐÓÒÓÒ Ó ÙÑ Ò ÝÔ ÖÑÙØ Ð ÕÙ Ò º ÒÓÑ ½½ ½ ¹½ º

21 ANNEXE 1: MINISATELLITES HYPERMUTABLES HUMAINS CONNUS Nom du minisatellite Locus (ou D- number) Localisation Accession. number Séquence du motif consensus Longueur du consensus Nb de positions variantes Homlogie entre motifs (%) Insertions -délétions (%) %GC (biais) %Pur (biais) CEB1 D2S90 2q37.3 (T) AF GAGGGGGGAGGGAGGGTGGCCTGCAG AGGTCCCTGGGCT (0.53) (0.38) CEB15 D1S172 1p36.33 (T) AL ACGGAGCAGAGACACGGG (0.56) CEB25 D10S180 10q26.3 (T) AL TGGGTGTGAGTGTAAGTGTGGAGGTA 52 > GATGTAAGGGTGGGTGTAAGTGTGGG (0.73) (0.36) CEB36 D10S473 10q26.3 (T) AL TGTCTGGTGGGATTAGGAGGGAGGTG CCCGTGGTGGGCAGGT (0.65) (0.32) CEB42 D8S358 8q24.3 (T) AL CCTCTGTGTCCCAGGCGGCGGGTAGG ACCCACAGAAGTGTC (0.11) (0.08) CEB72 D17S888 17q25 (T) AL GCGAAGGGAGTGGGCACAGGG (0.60) (0.62) MS1 D1S7 1p33-35 (I) X14856 ATAGGGTGG (0.93) (0.60) MS32 D1S8 1q42 (I) AF GAGCAGGTGGCCAGGGGTGACTCAGA ATG (0.37) (0.35) B6.7 20q13.3 (T) AF TGAGGGTGGACAGTGAGGGGGTCTCT ACAGGCCA (0.5) (0.37) CSTB EPM1 21q22.3 (T) U46692 CGCGGGGCGGGG (0.5) 100 (0.5) proportion instabilité d'événements paternels 6.7% 97% 1.5% 100% 2.5% 65% 1.8% 50% 0.5% 100% 1.8% 65% 5% 50% 0.4% 50% 5.5% 64% 47%* 76% Les valeurs d'instabilité sont des valeurs moyennes sauf pour CSTB (*) où l'instabilité mesurée correspond à celle d'allèles étendus, pathogènes. Le pourcentage d'homologie entre les motifs correspond à l'homologie moyenne entre les motifs et le consensus. Le biais GC est la valeur absolue de (%G-%C)/( %G+%C), le biais purine est la valeur absolue de (%pur-%pyr).

22 ANNEXE 2: Modèle d instabilité méiotique des minisatellites (Vergnaud & Denoeud, 2000)

23 ANNEXE 3-1: page d interrogation de la base de données (http://minisatellites.u-psud.fr)

24 ANNEXE 3-2: Résultat d une requête «répartition»

25 ANNEXE 3-3: résultat d une requête «isolement»

26 Individus du CEPH GP P GM GP M GM GP P GM GP M GM P M P M P M P M P M P M P M P M P M P M ANNEXE 4: Photo d un gel après migration des produits de PCR Ce minisatellite compte 4 allèles de 1200, 1000, 650, et 550 pb environ, qui ségrègent convenablement au sein des familles. Marqueurs de taille (pb)

27 ANNEXE 5 Minisatellite chr 22 (28 x 62pb) Homologue chr18 Modèle proposé par Haber (1997) pour l origine des minisatellites Duplication initiale Expansion pour former un minisatellite?

ÇÄ Ë ÅÁÆ Ë È ÊÁË ÓÐÐ ÓØÓÖ Ð ÌÀ Ë ÔÓÙÖ Ó Ø Ò Ö Ð Ö ÓØ ÙÖ Ð³ ÓÐ Å Ò È Ö ËÔ Ð Ø ÅÓÖÔ ÓÐÓ Å Ø Ñ Ø ÕÙ ÔÖ ÒØ Ø ÓÙØ ÒÙ ÔÙ Ð ÕÙ Ñ ÒØ Ô Ö Î Ð ÖÝ Ê ÓÒ Ð ½ Ñ Ö ¾¼¼½ ÔÔÐ Ø ÓÒ Ð ÅÓÖÔ ÓÐÓ Å Ø Ñ Ø Õ٠г Ò ÐÝ ÓÒ Ø ÓÒ

Plus en détail

Æ Ó ³ÓÖ Ö ºÍº ½ ¼ ËÈÁ ¾ ÍÒ Ú Ö Ø Ð È Ð ¹ Ð ÖÑÓÒØ ÁÁ ÓÐ ÓØÓÖ Ð Ë Ò ÔÓÙÖ Ð³ÁÒ Ò ÙÖ Ð ÖÑÓÒع ÖÖ Ò ÌÀ Ë ÈÖ ÒØ Ô Ö Ê Ñ ÇÊÆ Ì ÁÒ Ò ÙÖ Ð³ ÆËÈË Ñ ÖÓ Ð ØÖÓÒ ÕÙ Ø ³ ÒØÖÙÑ ÒØ Ø ÓÒ ÍÒ Ú Ö Ø ÄÓÙ È ËÌ ÍÊ ÈÓÙÖ Ó Ø Ò

Plus en détail

Î Ð Ø ÓÒ ³ÙÒ ÑÓ Ð Ó Ø Ð Ô Ö ÔØ ÓÒ Ð ÕÙ Ð Ø ÓÙ Ø ÕÙ Ò ÙÒ Ò Ñ Ð ÐÐ ÓÒ ÖØ Ø ³ÓÔ Ö Ö Ã ÀÄ Ñ Ð Ð Ö Ñº Ö Ì ÓØÓÖ Ø Ö Ø ÙÖ Ø Å Ð ÊÍÆ Í Ä ÓÖ ØÓ Ö ³ Ù Ð ÁÊ Å È Ö Ä ÓÖ ØÓ Ö ³ ÓÙ Ø Õ٠гÍÒ Ú Ö Ø ÙÅ Ò Ä Å Ò Ì ÔÖ ÒØ

Plus en détail

ÍÆÁÎ ÊËÁÌ ÌÀÇÄÁÉÍ ÄÇÍÎ ÁÆ ÍÄÌ ³ÁÆ ÆÁ ÊÁ ÁÇÄÇ ÁÉÍ ÊÇÆÇÅÁÉÍ Ì ÆÎÁÊÇÆÆ Å ÆÌ Ä ÔÔÖÓ Ý Ø Ñ ÔÓÙÖ ÙÒ ÑÙÐ Ø ÓÒ ÔÖÓ Ô Ø Ú Ø ÖÖ ØÓ Ö ÔÔÐ ÕÙ Ð Ø ÓÒ Ð ÖØ Ð Ø ÓÐ Ò Ð Ö ÓÒ Ù Ö Æ Öµ ÈÖÓÑÓØ ÙÖ ÈÖº Ⱥ ÓÙÖÒÝ Öº º Ö Ö ÌÖ

Plus en détail

Å Ø Ö Ê Ö ÁÒØ ÐÐ Ò ÖØ ÐÐ Ê ÓÒÒ Ñ ÒØ ÓÓÔ Ö Ø ÓÒ Ä Ò ØÙ Ô Ö ÑÙÐ Ø ÓÒ Ð ÝÒ Ñ ÕÙ ÓÖ Ò Ø ÓÒÒ ÐÐ ³ÙÒ Ý Ø Ñ ÑÙÐØ ¹ ÒØ ÔØ Ø Ò ÙÒ Ö Ù ³ Ò ÓÖÑ Ø ÓÒº Ê ÔÔÓÖØ ËØ Å Ø Ö Ê Ö ÁÒØ ÐÐ Ò ÖØ ÐÐ Ê ÓÒÒ Ñ ÒØ ÓÓÔ Ö Ø ÓÒ Ä Ò

Plus en détail

ÈÖÓ Ø Ò ³ ØÙ ÇÆ ÈÌÁÇÆ ³ÍÆ ÈÄ ÆÁ Á Ì ÍÊ ÌÊ Â ÌÇÁÊ Ë ÈÇÍÊ ÍÆ ÊÇ ÇÌ ÅÇ ÁÄ Å ØØ Ù Å ÓÒÒ Ù ÚÖ Ö ¾¼¼ ÈÖÓ ÙÖ Ö ÔÓÒ Ð Ù È ÆË Å Åº Ö ØÓÔ ÁÊ Í ¹ Í ÁÆ Åº  ҹÄÙ Í À Ì ËÍÈ Ä Åº ËØ Ô Ò ÎÁ ÄÄ ¾ È Å ØØ Ù Å ÓÒÒ Ù Ê Ñ

Plus en détail

ÅÆ ÁÆÄ ÀÅ ½½¼ ÈÖÒÔ Ñ ÈÖÓ ÙÖ ÐÒ ËعÑÒØ Ø Ù Ð ÑÖ ¾¼¼½ ØÑÔ ¼ ¼ ¹ ½¾ ¼ ÍÍÆ ÅÌÊÁÄ ËÍÈÈÄÅÆÌÁÊ ÈÊÅÁË Æ³ÁÅÈÇÊÌ ÉÍÄÄ ÄÍÄÌÊÁ ÈÊÅÁË ÁÆËÌÊÍÌÁÇÆË ÚÖ Þ ÕÙ ÚÓÙ ÚÞ ØÓÙØ Ð ¾ Ô Ð³ÜÑÒ ÖÔÓÒÞ ØÓÙØ Ð ÕÙ ØÓÒ ÚÓÙ Ò ÚÞ ÓÒ ÚÓÙ

Plus en détail

Ì ÈÖ ÒØ ÔÓÙÖ Ð³Ó Ø ÒØ ÓÒ Ù Ø ØÖ ÓØ ÙÖ Ð³ÍÒ Ú Ö Ø È Ö ËÔ Ð Ø ÁÒ ÓÖÑ Ø ÕÙ ÅÓ Ð Ø ÓÒ ÝÒ Ñ ÕÙ ÐÙÜ Ô Ö ÒØ º ÔÔÐ Ø ÓÒ ÙÜ ÔÖÓ Ù ÖÙ ÐÐ Ñ ÒØ Ò ÐØÖ Ø ÓÒ Ø ÖÓ ÓÒº Ô Ö Ú Ë ÊÎ Ì ËÓÙØ ÒÙ Ð ¾ ÒÓÚ Ñ Ö ¾¼¼¼ Ú ÒØ Ð ÙÖÝÓÑÔÓ

Plus en détail

ÆÙÑ ÖÓ ³ÓÖ Ö Í ½½ Ë ¾ È Ì ¼ ÍÆÁÎ ÊËÁÌ Ä ÁË È Ë Ä Íº ºÊº Ê Ö Ë ÒØ ÕÙ Ø Ì Ò ÕÙ µ ÇÄ Ç ÌÇÊ Ä Ë Ë Á Æ Ë ÇÆ Å ÆÌ Ä Ë ÌÀ Ë ÔÖ ÒØ ÔÓÙÖ Ó Ø Ò Ö Ð Ö Ç Ì ÍÊ ³ÍÆÁÎ ÊËÁÌ ËÈ Á ÄÁÌ ÈÀ ËÁÉÍ Ë È ÊÌÁ ÍÄ Ëµ Ô Ö ÙÝ À ÄÄ

Plus en détail

ÍÒ Ú Ö Ø È Ö ¹ËÙ ÆÌÊ ³ÇÊË Ê ÔÔÓÖØ ÒØ ÕÙ ÔÖ ÒØ ÔÓÙÖ Ð³Ó Ø ÒØ ÓÒ ³ÙÒ À Ð Ø Ø ÓÒ Ö Ö Ê Ö Â Ò¹ Ö ÒÓ ÅÇÆÁÆ Ö Ò Ì Ð ÓÑ Ê² ÓÒØÖ ÙØ ÓÒ ÙÜ Ñ Ø Ó ÓÖÑ ÐÐ ÔÓÙÖ Ð ÐÓ Ð ËÓÙØ ÒÙ Ð Ù ÚÖ Ð ¾¼¼¾ Ú ÒØ ÙÒ ÙÖÝ ÓÒ Ø ØÙ Ô Ö

Plus en détail

Ò ÑÑÓÖ ÖÒÓ ÊÑÖÑÒØ ØÖÚÐ Ø «ØÙ Ò Ð ÖÓÙÔ ÅË Ð³ÁÒ ØØÙØ ÈÝ ÕÙ ÆÙÐÖ ÄÝÓÒº ÖÒÖ ÁÐÐ Ø ÑÓÒ ÖØÙÖ Ø ÔÒÒØ ØÖÓ Ò ÐÙ Ù ÖÓÒÒ ÒØ ÔÓÙÖ Ð ÓÒ Ò ÕٳРØÓÙÓÙÖ Ù ØÑÓÒÖ Ò ÑÓÒ ØÖÚÐ Ø ÔÓÙÖ Ð ÐÖØ ÕٳРѳ ÓÖ ØÓÙØ Ù ÐÓÒ Ñ Ø º ÂÕÙ

Plus en détail

!" # $%% %%% ÚÐÙØÓÒ Ê ÕÙ ÓÒØÖÓÚÖ ÔÖ Ð ÌÓÖ ÇÔØÓÒ ÊÐÐ ÊÓÖØ Ã Ø Ý ÒÖ ÄÔ Þ ËÓÔ ÈÖÓ Ü Ø ÑÐ ÈÖÓØÓÔÓÔ Ù ß ÊÉŹÁÈ ¾ ÖÙ Ð ÖØ ½ ¼¼¾ ÅÖ ÐÐ Ê ÙÑ ÈÙÐ ÓÒ ÑÒ ÖÕÙÖ ØØ ÝÒÑ Ò ÓÒØÖÓÚÖ ÓÙÒØ ÓÖ ÚÐÙÒ Ö º Ì ÒÐÙ ÒÚÖÓÒÑÒØÐ Ö ÓÒÓÑ

Plus en détail

ÇÙ ÑÒ ÐÐÝ ØÓÒ ÔÔÖÓÚ ÓÒÒÑÒØ Ò ÓÒØÜØ ØÓÒ ÔÖÓØ ÒÐÝ ÙÜ Ñ ÙÖ ÒÚÙ ÖÚ ÅÑÓÖ ÑØÖ ÔÖ ÒØ Ð ÖØÓÒ ØÙ ÝÐ ËÙÔÖÙÖ Ð³ÍÒÚÖ Ø ÙÉÙ ÔÓÙÖ Ð³ÓØÒØÓÒ Ù Ö ÅØÖ Ò ÅºËºµ ÈÖÓÖÑÑ ÅØÖ Ò ØÓÒ ÔÖÓØ ÔÖØÑÒØ Ò ÑÒ ØÖØÚ ÍÒÚÖ Ø Ù ÉÙ ÀÙÐÐ Å ¾¼¼¾

Plus en détail

Ì Ð Ñ Ø Ö ½ ÁÒØÖÓ ÙØ ÓÒ Ò Ö Ð ½º½ Ä ÝÐ ØÑÓ Ô Ö ÕÙ ÔÓÙ Ö Ñ Ò Ö Ð º º º º º º º º º º º º º º º º º º ½º½º½ Å Ò Ú Ò Ô Ø ØÓÖ ÕÙ º º º º º º º º º º º º º º º º º º º º º ½º½º¾ Å Ò Ú Ò Ð Ø Ò ÕÙ ØÙ ÐÐ º º º

Plus en détail

Evaluation des compétences en mathématiques en fin de 2e année primaire : Résultats de la première phase de l'enquête Mathéval

Evaluation des compétences en mathématiques en fin de 2e année primaire : Résultats de la première phase de l'enquête Mathéval 03.2 MAI 2003 Evaluation des compétences en mathématiques en fin de 2e année primaire : Résultats de la première phase de l'enquête Mathéval Ouvrage coordonné par Jean-Philippe Antonietti Ú ÐÙ Ø ÓÒ ÓÑÔ

Plus en détail

ÍÒ Ú Ö Ø Ê ÁÅË ÑÔ Ò ¹ Ö ÒÒ Í Ê Ë Ò Ü Ø Ø Æ ØÙÖ ÐÐ Ò Ö Ø ÓÒ ÕÙ Ò Ø Ø ÙØÓÑ Ø Ø ÑÔÓÖ Ëº ÊÍËÇÆ» ĺ ÈÁ ÊÊ» º Ê Ì Ê ÔÓÒ Ð À Ò ÓÙ Ð º ºËºËº ʺ˺Áº ¾¼¼»¾¼¼ Ê ÙÑ Ö ÒØ ÔÖÓØÓÓÐ Ø Ý Ø Ñ Ò Ø ÑÔ Ö Ð Ô ÙÚ ÒØ ØÖ ÑÓ Ð

Plus en détail

ÊÔÔÓÖØ Ø ÖÒÓ ÇÐÚÖ Å ÔØÑÖ ¾¼¼¾ Ê ÙÑ Ä ÓÖÑÐ Ñ Ö ÙÜ Ý Ò Ø ÙÒ ÐØÖÒØÚ Ð ØÓÒ ÓÒÒ Ò Ö Ð ÓÒØ Ð Ö ÙÐØØ ³ÙÒ ÓÒÚÖÒ ÒØÖ Ð ÑØÓ ØØ ØÕÙ ÕÙ ÔÖÑØØÒØ ÐÔ Ð³Ó ÖÚØÓÒ Ð ÐÓ Ø ØÒÓÐÓ Ð³ÒØÐÐÒ ÖØÐÐ ÕÙ ÔÖÑØØÒØ ÙÜ ÓÖÒØÙÖ ØÖØÖ Ð ÓÒÒ

Plus en détail

NOTES D ÉTUDES ET DE RECHERCHE

NOTES D ÉTUDES ET DE RECHERCHE NOTES D ÉTUDES ET DE RECHERCHE UNE MESURE DE LA PERSISTANCE DANS LES INDICES BOURSIERS Sanvi Avouyi-Dovi, Dominique Guégan et Sophie Ladoucette Décembre 2002 NER # 94 DIRECTION GÉNÉRALE DES ÉTUDES ET DES

Plus en détail

Geoffroy Guibert. To cite this version: HAL Id: tel-00007082 https://tel.archives-ouvertes.fr/tel-00007082

Geoffroy Guibert. To cite this version: HAL Id: tel-00007082 https://tel.archives-ouvertes.fr/tel-00007082 Etude par des méthodes nucléaires et physico-chimiques de la contamination des tissus situés autour de biomatériaux métalliques implantés. Mesure de la contribution à la toxicité par la radioactivité résiduelle

Plus en détail

Planification de tâches de manipulation en robotique par des approches probabilistes

Planification de tâches de manipulation en robotique par des approches probabilistes Thèse préparée au Laboratoire d Analyse et d Architecture des Systèmes du CNRS en vue de l obtention du Doctorat de l Université Paul Sabatier de Toulouse Spécialité : Robotique - Informatique par Anis

Plus en détail

Simulation tridimensionnelle du remplissage de corps minces par injection

Simulation tridimensionnelle du remplissage de corps minces par injection Simulation tridimensionnelle du remplissage de corps minces par injection Erwan Bigot To cite this version: Erwan Bigot. Simulation tridimensionnelle du remplissage de corps minces par injection. Mécanique

Plus en détail

Imagerie Cardiaque Multimodalités 2D et 3D : THÈSE

Imagerie Cardiaque Multimodalités 2D et 3D : THÈSE Institut National Polytechnique de Lorraine DFD en Automatique et Production Automatisée École doctorale IAEM Lorraine Imagerie Cardiaque Multimodalités 2D et 3D : application à la Coronarographie/Tomoscintigraphie/TEP-CT

Plus en détail

Potentiel de réserves d un bassin pétrolier : modélisation et estimation

Potentiel de réserves d un bassin pétrolier : modélisation et estimation Potentiel de réserves d un bassin pétrolier : modélisation et estimation Vincent Lepez To cite this version: Vincent Lepez. Potentiel de réserves d un bassin pétrolier : modélisation et estimation. Mathematics.

Plus en détail

X Y. 1,, A n } ØY {B 1,, B m. A 1 A n B 1 B m Ô {,

X Y. 1,, A n } ØY {B 1,, B m. A 1 A n B 1 B m Ô {, ÓÒ ÚÓ Ö ØÖ Ò Ö Ñ Ä Ø Ô Ð ÓÒ ÔØ ÓÒ ³ÙÒ Ñ Ö Ð Ø ÓÒÒ Ð ½º Ò ÐÝ Ó Ò Ò ÓÖÑ ÐÐ µ º½ ÒØ Ø Ó Ø ÓÒµ Ó٠ʵº ¾ºÍØ Ð Ø ÓÒ ³ÙÒÓÙØ Ð Ö Ô ÕÙ ÔÓÙÖÙÒ ÔÖ Ñ Ö ÑÓ Ð Ø ÓÒ Ñ Ø Ó Ô Ò Ò ÓÒØ ÓÒÒ ÐÐ º ÙÒ Ð ÓÒØÖ ÒØ ÙÖÐ ÓÒÒ µµ ºÈ

Plus en détail

Analyse d architectures, modélisation et commmande de générateurs pour réseaux autonomes

Analyse d architectures, modélisation et commmande de générateurs pour réseaux autonomes Analyse d architectures, modélisation et commmande de générateurs pour réseaux autonomes Nicolas Patin To cite this version: Nicolas Patin. Analyse d architectures, modélisation et commmande de générateurs

Plus en détail

½º º Ì Ð ÙÜÔÓÙÖÄÌÄ Ø ÙØÓÑ Ø ½º Ò º Ä ÙØÓÑ Ø Ò Ñ Ò ÙÒÒÓÑ Ö Ò ³ Ø Ø ºÁÐ Ð ÒØ ÑÓØ Ä ω¹ ÙØÓÑ Ø ÙØÓÑ Ø Ú ÙÒÒÓÑ Ö Ò ³ Ø Ø Ñ Ô Ð F Ø Ø Ð Ð Ð Ò ÔØ Ô ÖA FÒ³ ØÔ Ú º ÑÓØÖ Ù Ö ÔØ ÓÒ ³ÙÒ ÒØ ÖÔÖ Ø Ø ÓÒÓ F Ø Ù º ½º Ò

Plus en détail

Extraction d informations à partir de documents juridiques : application à la contrefaçon de marques

Extraction d informations à partir de documents juridiques : application à la contrefaçon de marques Extraction d informations à partir de documents juridiques : application à la contrefaçon de marques Pierre Renaux To cite this version: Pierre Renaux. Extraction d informations à partir de documents juridiques

Plus en détail

Correction du TP2 - Base Location

Correction du TP2 - Base Location Faculté des Sciences Jean Perrin Correction du TP2 - Base Location Remarques : 1. Le répertoire ÚÖ»Ñ est accessible en lecture. Il contiendra les corrections des tps, etc... 2. À la fin de la séance, il

Plus en détail

ÐÁÑÁÑÔÇÌÁ É ÐÅÑÉËÇØÇ ÔÙÍ ÁÑÁÊÔÇÑÉÓÔÉÊÙÍ ÔÏÕ ÐÑÏÚÏÍÔÏÓ

ÐÁÑÁÑÔÇÌÁ É ÐÅÑÉËÇØÇ ÔÙÍ ÁÑÁÊÔÇÑÉÓÔÉÊÙÍ ÔÏÕ ÐÑÏÚÏÍÔÏÓ ÐÁÑÁÑÔÇÌÁ É ÐÅÑÉËÇØÇ ÔÙÍ ÁÑÁÊÔÇÑÉÓÔÉÊÙÍ ÔÏÕ ÐÑÏÚÏÍÔÏÓ 1. ÏÍÏÌÁÓÉÁ ÖÁÑÌÁÊÅÕÔÉÊÏÕ ÐÑÏÚÏÍÔÏÓ VISTIDE. 2. ÐÏÉÏÔÉÊÇ ÊÁÉ ÐÏÓÏÔÉÊÇ ÓÕÍÈÅÓÇ ÊÜèå öéáëßäéï ðåñéý åé cidofovir éóïäýíáìï ìå 375 mg/5 m (75 mg/ml) Üíõäñï

Plus en détail

Ensembles inévitables et classes de conjugaison

Ensembles inévitables et classes de conjugaison Ensembles inévitables et classes de conjugaison Jean-Marc CHAMPARNAUD Georges HANSEL Abstract Un ensemble de mots sur un alphabet est dit inévitable si tout mot infini sur admet au moins un facteur dans.

Plus en détail

aro b=abp= qrabp bq=bjmilv^_fifq äéë íìçéë ÇÉ äûéãéäçá Å~ÇêÉ J gìáå OMMV cfifðobp=`lroqbpi=cfifðobp=ilkdrbp nrbiibp=fkpboqflkp=bq=nrbip=m^o`lrop=\ PM=Çáéä ã ë=éí=nm=aoe=í ãçáöåéåí aìê É=ÇÉë= íìçéë=éí=éãéäçó~äáäáí

Plus en détail

A Theoretical Comparison Between Integrated and Realized Volatilies

A Theoretical Comparison Between Integrated and Realized Volatilies Cahier 2001-26 A Theoretical Comparison Between Integrated and Realized Volatilies MEDDAHI, Nour Département de sciences économiques Université de Montréal Faculté des arts et des sciences C.P. 6128, succursale

Plus en détail

CARACTERES SPECIAUX. Caractères spéciaux : Comment ça marche?

CARACTERES SPECIAUX. Caractères spéciaux : Comment ça marche? CARACTERES SPECIAUX Caractères spéciaux : Comment ça marche? Vous trouverez ci-dessous une liste complète des caractères spéciaux, classés par catégories. Pour utiliser le code clavier, vous devez maintenir

Plus en détail

Ouverture aux 1&2 caractères en.fr. Les règles d enregistrement

Ouverture aux 1&2 caractères en.fr. Les règles d enregistrement Ouverture aux 1&2 caractères en.fr Les règles d enregistrement OUVERTURE AUX 1&2 CARACTERES EN.FR LES REGLES D ENREGISTREMENT 2 Sommaire I. Introduction... 3 II. Les dispositions générales... 4 1. Les

Plus en détail

Codes ASCII ISO HTML

Codes ASCII ISO HTML s ASCII Voici une liste des caractères. Il suffit d'insérer le pour l'obtenir dans votre page. Ou de copier/coller le Symbole. Avec cette manipulation, vous garantissez que les caractères spéciaux seront

Plus en détail

Planning T.A.P. 3/6ans. 7/10 ans. avril. avril. Lundi Mardi Jeudi Vendredi. et culture - La guirlande de fleurs. et culture

Planning T.A.P. 3/6ans. 7/10 ans. avril. avril. Lundi Mardi Jeudi Vendredi. et culture - La guirlande de fleurs. et culture L 2 2 A A J A avril avril et culture - Fabrication d'objets en pâte à sel 1/4 - La balle aux prisonniers et culture - La guirlande de fleurs - La course aux couleurs traditionnels et sportifs - Hockey

Plus en détail

MISE EN FONCTIONNEMENT DE LA POMPE UTILISATION DE LA POMPE

MISE EN FONCTIONNEMENT DE LA POMPE UTILISATION DE LA POMPE MISE EN FONCTIONNEMENT DE LA POMPE UTILISATION DE LA POMPE L utilisation normale de cette pompe passe par un réservoir d eau d une capacité minimum de 120 litres, dans lequel il faut plonger les deux tuyaux

Plus en détail

Visualisation électronique des crédits avec image (VEC-I) pour la clientèle commerciale

Visualisation électronique des crédits avec image (VEC-I) pour la clientèle commerciale Manuel Visualisation électronique des crédits avec image (VEC-I) pour la clientèle commerciale Visualisation électronique des crédits saisis entièrement avec image (VEC-Eplus) pour la clientèle commerciale

Plus en détail

Transition vers le marché du travail au Canada : Portrait de la situation actuelle et perspective historique

Transition vers le marché du travail au Canada : Portrait de la situation actuelle et perspective historique 99s-39 Transition vers le marché du travail au Canada : Portrait de la situation actuelle et perspective historique Daniel Parent Série Scientifique Scientific Series Montréal Novembre 1999 CIRANO Le CIRANO

Plus en détail

Université de Toulon Faculté de Sciences Economiques et de Gestion Année universitaire 2014-2015

Université de Toulon Faculté de Sciences Economiques et de Gestion Année universitaire 2014-2015 Université de Toulon Faculté de Sciences Economiques et de Gestion Année universitaire 2014-2015 Licence 3 de Sciences Economiques Janvier 2015 Dynamique macroéconomique (M. Catin) Tous documents autorisés

Plus en détail

CHAPITRE 4 REPRÉSENTATION DE L INFORMATION. 4.1 Les bases de numération. 4.2 Le rang ou le poids

CHAPITRE 4 REPRÉSENTATION DE L INFORMATION. 4.1 Les bases de numération. 4.2 Le rang ou le poids CHAPITRE 4 REPRÉSENTATION DE L INFORMATION La plupart des systèmes, autant mécaniques qu'électroniques, ne peuvent prendre que deux états stables, que l on note 0 et 1; ainsi, les circuits électroniques

Plus en détail

Devoir 9 - Le 1er décembre - 4 heures

Devoir 9 - Le 1er décembre - 4 heures Devoir 9 - Le 1er décembre - 4 heures Le barème est sur 70 points dont 2 points pour la présentation Les questions Q13, Q14, Q17, Q33 et Q34 peuvent être laissées de coté dans un premier temps. Calculatrice

Plus en détail

Rapport pour la commission permanente du conseil régional

Rapport pour la commission permanente du conseil régional Rapport pour la commission permanente du conseil régional AVRIL 2014 Présenté par Jean-Paul Huchon Président du conseil régional d'ile-de-france PROJETS D INFORMATION ET D ORIENTATION DES JEUNES

Plus en détail

N4DS V01X06 20110502 2

N4DS V01X06 20110502 2 Norme pour les Déclarations Dématérialisées De Données Sociales NORME 4 D S Cahier technique V01X06 UVersion(s) : Version Date Commentaires V01X06 02/05/2011 Toutes Dadsu et DN-AC URédaction : Caisse nationale

Plus en détail

1 BILAN SIMPLIFIÉ DGFiP N 2033-A 2011

1 BILAN SIMPLIFIÉ DGFiP N 2033-A 2011 AGREMENT DGFIP C5.004 Formulaire obligatoire (article 302 septies A bis du Code général des Impôts) BILAN SIMPLIFIÉ DGFiP N 2033-A 20 EXEMPLAIRE A CONSERVER PAR LE DÉCLARANT ACTIF CIRCULANT ACTIF IMMOBILISÉ

Plus en détail

Initiation à l'informatique : APPLICATIONS 1 Traitements de texte WordPad

Initiation à l'informatique : APPLICATIONS 1 Traitements de texte WordPad L'Association Culture Loisirs Entente Sport Club Informatique Initiation à l'informatique : APPLICATIONS 1 Traitements de texte WordPad Le premier logiciel utile et aisément accessible à celle ou celui

Plus en détail

«π π» ( IZIL KALASE) SAVRA HASAR π. ƒ ƒ π π ƒ µ ª π ª π

«π π» ( IZIL KALASE) SAVRA HASAR π. ƒ ƒ π π ƒ µ ª π ª π «π π» ( IZIL KALASE) SAVRA HASAR π. ƒ ƒ π π ƒ µ ª π ª π ETAIPEIA MAKE ONIKøN OY øn IOIKHTIKO YMBOY IO Úfi ÚÔ : NÈÎfiÏ Ô M ÚÙ Ô AÓÙÈappleÚfi ÚÔ : X Ú Ï ÌappleÔ apple ÛÙ ıë ÂÓ. Ú ÌÌ Ù : TÂÚ ÂÓÙ ÔappleÔ

Plus en détail

Génération de code à partir d une spécification B : Application aux bases de données

Génération de code à partir d une spécification B : Application aux bases de données Génération de code à partir d une spécification B : Application aux bases de données Amel Mammar * Régine Laleau ** Université du Luxembourg, LACL, Université Paris 12 SE2C, 6 rue Richard Courdenhove-Kalergi

Plus en détail

(2k 1) = n 2. P n : ... k=1...

(2k 1) = n 2. P n : ... k=1... S ÓÙÖ ËÙ Ø ÒÙÑ Ö ÕÙ T ½ÈÓÙÖÕÙ Ð ÒØ Ö Ð ÔÖÓÔÖ Ø Ù Ú ÒØ Ø¹ ÐÐ ÚÖ ÑÓÒ ØÖ Ø ÓÒÔ ÖÖ ÙÖÖ Ò ÈÖÓÔÖ Ø ½ ÁÒ Ø Ð Ø ÓÒ ÈÖ Ò Ô Ö ÙÖÖ Ò 0Ð À Ö Ø 1µº ÇÒÚ ÙØÑÓÒØÖ ÖÕÙ³ÙÒ ÔÖÓÔÖ Ø P ØÚÖ ÔÓÙÖØÓÙØ ÒØ Ö 0 Ú ÔÖ Ñ Ö ÒØ ÖÓ Ð

Plus en détail

SHAW1N1GAN FALLS, 21 AVRIL 1927. 4 k 1 x^ ~YX t o /4 NT JOURNAL HEBDOMADAIRE. J f SgN L HONORABLE L. A. TASCHEREAU.

SHAW1N1GAN FALLS, 21 AVRIL 1927. 4 k 1 x^ ~YX t o /4 NT JOURNAL HEBDOMADAIRE. J f SgN L HONORABLE L. A. TASCHEREAU. 2 HG F 2 2 6 6 6 ~Y k P - P HDD - H - P G D 2 3 D - K 8 G G è ê - - è - G ç D G - â - G H H G P- â Q â -èg è ê ç D G è è 3 ê ê 3 2 è ê è û - 500 F H P - ê P 23 è ê -ê è è ô 5000 G ç 25000 D 5000000 P ô

Plus en détail

Mesure de la difficulté des jeux vidéo

Mesure de la difficulté des jeux vidéo Mesure de la difficulté des jeux vidéo Guillaume Levieux To cite this version: Guillaume Levieux. Mesure de la difficulté des jeux vidéo. Computer Science. Conservatoire national des arts et metiers -

Plus en détail

Passons à deux outils nécessaires, GhostScript et GhostView. Rendez-vous tout d abord à l adresse

Passons à deux outils nécessaires, GhostScript et GhostView. Rendez-vous tout d abord à l adresse ÁÒ Ø ÐÐ Ø ÓÒ ØÔÖ ÒÑ Ò Ä Ì Formation L TEX Urfist de Bordeaux 20 mars 2014 celine.chevalier@ens.fr ½ ÁÒ Ø ÐÐ Ø ÓÒ ÓÙ Ï Ò ÓÛ ØÖ ÙØ ÓÒÅ ÃÌ ½º½Ä ØÖ ÙØ ÓÒÅ Ì Sous Windows, nous vous proposons d installer et

Plus en détail

écoles L histoire des à Lathus-Saint-Rémy En 2014, le groupe scolaire Abel Thévenet fêtait ses soixante ans!

écoles L histoire des à Lathus-Saint-Rémy En 2014, le groupe scolaire Abel Thévenet fêtait ses soixante ans! --? 204 ê! À - ç F. j. -- :. 904 954 204 : j 205. U ç 900. J - z J J G G ë k k F V H F H j G. j ê U 953-954 ç. j -- -. : V ( 2 47 / -2 2 47 / 3 2 47 / 4-5 2 294 / 4 60 W 372 60 W 796 3 4 3 7 3 3 34). :

Plus en détail

GUIDE D INSTALLATION DES HUISSERIES METALLIQUES type G

GUIDE D INSTALLATION DES HUISSERIES METALLIQUES type G GUIDE D INSTALLATION DES HUISSERIES METALLIQUES type G type G6 assemblé en onglet Type G1-G-G3-G4-G5 Assemblé en angle droit avec des vis et attaches. Type G6-G7 Assemblé en onglet avec des vis et attaches.

Plus en détail

ç~ G 2007 h G ƒféc 28- ƒà ùdg O~ dg IqôoM má«dél pπlcg øe qôom läƒ U GRAND OPTICAL PROPRIÉTAIRE: CLAUDE EL-KHOURY Opticienne D ordonnances

ç~ G 2007 h G ƒféc 28- ƒà ùdg O~ dg IqôoM má«dél pπlcg øe qôom läƒ U GRAND OPTICAL PROPRIÉTAIRE: CLAUDE EL-KHOURY Opticienne D ordonnances Journal Al Hadath Vous souhaite Une Bonne et Heureuse année 2008 Y iông Iƒb G øe «dg Üôb G ÖFÉàµdG ÜõM «dg º æj ~b òdg HõMh ÚeCÉàdh á ZÉ dg áªé dg òg Lh VQ G Y ±ƒbƒ d ámé ùdg ôjô G ÉãeG RhQ~dGh áæ ùdg

Plus en détail

Manuel VEC-I Visualisation électronique des crédits avec image

Manuel VEC-I Visualisation électronique des crédits avec image Manuel VEC-I Visualisation électronique des crédits avec image 499.34.1 fr (pf.ch/dok.pf) 06.2013 PF Manuel VEC-I Version juin 2013 1/21 Service à la clientèle VEC-I Demandes d adhésion VEC-I/transfert

Plus en détail

V a c a t i o n d u 3 D é c e m b r e 2 0 0 8 à 1 3 H 3 0

V a c a t i o n d u 3 D é c e m b r e 2 0 0 8 à 1 3 H 3 0 V a c a t i o n d u 3 D é c e m b r e 2 0 0 8 à 1 3 H 3 0 L O T S N O M B R E E T N A T U R E D E S M A R C H A N D I S E S P O I D S E S T I M A T I O N S 1 1 b r i l l a n t e x t r a + F a u c u n e

Plus en détail

EMC SourceOne Version 7.0

EMC SourceOne Version 7.0 EMC SourceOne Version 7.0 Guide d utilisation Search 300-015-190 RÉV. 01 EMC Computer Systems France River Ouest, 80 Quai Voltaire CS 21002 95876 Bezons Cedex Tél. : +33 1 39 96 90 00 Fax : +33 1 39 96

Plus en détail

Quelque contribution à l optimisation de constellations de satellites

Quelque contribution à l optimisation de constellations de satellites Quelque contribution à l optimisation de constellations de satellites Enguerran Grandchamp To cite this version: Enguerran Grandchamp. Quelque contribution à l optimisation de constellations de satellites.

Plus en détail

1 jour. 20 heures 24 heures

1 jour. 20 heures 24 heures *!"#$% &' (!"#') 4 jours du 29 Février au 22 Mars 2016 * ('++$%%",$+"#$% &'+ (!"#') + 2 jours * "#$-)'+./ $#'+ '# 0 ",'+ 12" #'%"$ ' &) 3456 758 5,5 jours du 17 mars au 23 Juin 2016 3!!)%$-)' "9'/ '(($/"/$#:

Plus en détail

ÓÒÒ R = 8,32 J.mol 1.K 1 T 1 = 300 K P 1 = 1,0 10 5 Pa S = 1,0 10 2 m 2 n = 0,20 mol γ = 1,40º

ÓÒÒ R = 8,32 J.mol 1.K 1 T 1 = 300 K P 1 = 1,0 10 5 Pa S = 1,0 10 2 m 2 n = 0,20 mol γ = 1,40º Ì ÖÑÓ ÝÒ Ñ ÕÙ ¾ ÈÖ Ñ Ö ÔÖ Ò Ô Ü Ö ÌÖ Ò ÓÖÑ Ø ÓÒ ÕÙ Ø Ø ÕÙ Þ Ô Ö Ø ½ ÓÑÔÖ ÓÒ ÓØ ÖÑ ³ÙÒ Þ Ô Ö Ø ¾ Ù Ó Ö ³ÙÒ Þ Ô Ö Ø Ø ÒØ Ø ÕÙ Ö Ú Ö Ð ³ÙÒ Þ Ô Ö Ø Ö ÒØ ÑÓ ÓÑÔÖ ÓÒ ³ÙÒ Þ Ô Ö Ø ÁÒ Ù Ò Ù Ñ Ò ØÖ Ò ÓÖÑ Ø ÓÒ Ù

Plus en détail

Mesures de sécurité. Éviter de longues expositions à la lumière directe ou de chauffer l appareil.

Mesures de sécurité. Éviter de longues expositions à la lumière directe ou de chauffer l appareil. CL800BT MANUEL Mesures de sécurité Éviter de longues expositions à la lumière directe ou de chauffer l appareil. Des erreurs peuvent se produire s il est exposé à des températures extrêmes. Ne pas laisser

Plus en détail

Modélisation éléments finis de poutres sandwich adaptatives en dynamique non-linéaire pour l atténuation de vibrations

Modélisation éléments finis de poutres sandwich adaptatives en dynamique non-linéaire pour l atténuation de vibrations Modélisation éléments finis de poutres sandwich adaptatives en dynamique non-linéaire pour l atténuation de vibrations Ana Cristina Galucio Jean-François Deü Roger Ohayon Laboratoire de Mécanique des Structures

Plus en détail

Déclaration pour l'impôt sur le revenu de l'année 2011

Déclaration pour l'impôt sur le revenu de l'année 2011 ß¼³ ² ±² ¼» ½±² ¾«±² ¼»½» www.impotsdirects.public.lu Bureau d'imposition: Déclaration pour l'impôt sur le revenu de l'année 2011 signalétique Ù«½» Ì 7± ͳ Ð ½ ï ç é ë ð ï î î ç ç ç ï ç é ê ð ê ï ð ç ç

Plus en détail

Manuel d'utilisation. Série SX402 Afficheurs alphanumériques à interface série BAL SX402 SER FR 1.0

Manuel d'utilisation. Série SX402 Afficheurs alphanumériques à interface série BAL SX402 SER FR 1.0 Manuel d'utilisation Série SX402 Afficheurs alphanumériques à interface série BAL SX402 SER FR 1.0 ALLEMAGNE FRANCE Siebert Industrieelektronik GmbH Siebert France Sarl Siebertstrasse, D-66571 Eppelborn

Plus en détail

tel-00491452, version 1-11 Jun 2010 Thèse de doctorat présentée par en vue de l obtention du grade 26 octobre 2007 au LMA devant un jury composé de

tel-00491452, version 1-11 Jun 2010 Thèse de doctorat présentée par en vue de l obtention du grade 26 octobre 2007 au LMA devant un jury composé de Université de la Méditérrannée Aix-Marseille II Ecole doctorale "Mécanique, physique et modélisation" CNRS- Laboratoire de Mécanique et d Acoustique (LMA) PSA Peugeot Citroën tel-00491452, version 1-11

Plus en détail

LE TRAITEMENT DE TEXTE

LE TRAITEMENT DE TEXTE LE TRAITEMENT DE TEXTE Modifier un paragraphe ou des caractères. Page 2 Les alignements de paragraphe Page 3 Les polices de caractères Page 4 Sélectionner Page 5 Quelques raccourcis clavier Page 6 Les

Plus en détail

Rapport pour la commission permanente du conseil régional

Rapport pour la commission permanente du conseil régional Rapport pour la commission permanente du conseil régional JUILLET 2013 Présenté par Jean-Paul Huchon Président du conseil régional d'ile-de-france ATTRIBUTIONS DE SUBVENTIONS DANS LE CADRE DE

Plus en détail

Coin des Experts - Réponse : HTML et caractères spéciaux

Coin des Experts - Réponse : HTML et caractères spéciaux Page 1 sur 7 Les entités du Introduction Les 3 lettres réservées Lettres avec accents ou cédilles Ligatures Ponctuation Modificateurs Symboles de calcul élémentaire Mathématiques spécialisées Caractères

Plus en détail

Théorie algébrique des nombres

Théorie algébrique des nombres Cours de aîtrise de athéatiques : Théorie algébrique des nobres Bas Edixhoven, Université de Rennes 1 janvier 2002 Ce texte est une version (légèreent) corrigée et agrandie (d une section sur le théorèe

Plus en détail

lever lion lit livre loin long loup lui lundi lune lunettes g garçon gâteau gauche gentil glace grand grand-mère grand-père gris gros guitare

lever lion lit livre loin long loup lui lundi lune lunettes g garçon gâteau gauche gentil glace grand grand-mère grand-père gris gros guitare L CP( ) CE1! é k è è- z ' éé ê ' é x z é œ ôé éà è x é x z é é é éè - é ê é ê ê è ç â -è -è ô y ' () é yx ç î à é é è...... z œ! z é è -ê ( ) é è z - z éé z x œ x y ê éé à z è é x à y yx () z zé L CE2

Plus en détail

4.1 Étude de la solubilité du chlorure d hydrogène dans l eau

4.1 Étude de la solubilité du chlorure d hydrogène dans l eau Corrigés des problèmes du chapitre 4 4.1 Étude de la solubilité du chlorure d hydrogène dans l eau 1. Variables de composition 1.1 Par définition de la fraction molaire du constituant, nous avons : Ü Ò

Plus en détail

Le Langage HTML. Hyper Texte Markup Language

Le Langage HTML. Hyper Texte Markup Language Institut Universitaire de technologie d Amiens Université de Picardie Jules Verne Support de cours Réseaux & Télécommunications Le Langage HTML Hyper Texte Markup Language Eric BRASSART, MCF IUT informatique

Plus en détail

Etude d optimisation énergétique

Etude d optimisation énergétique 1 IZUBA énergie BP 147, 22 bd Foch, 34140 Mèze (France) Tél : 04 67 18 31 10 Fax : 04 67 74 18 67 e-mail : contact@izuba.fr - Site web : http:/ / www.izuba.fr Marais du Vigueirat Life Promesse Etude d

Plus en détail

Utilisation de votre Palm Treo 700wx

Utilisation de votre Palm Treo 700wx Utilisation de votre Palm Treo 700wx Propriété intellectuelle 2005-2006 Palm, Inc. Tous droits réservés. Palm, Treo, les logos Palm Treo et Palm Powered sont des marques commerciales ou déposées dont Palm,

Plus en détail

Rapport annuel de gestion 2014-2015. Hôpital chinois de Montréal du CIUSSS du Centre-Est-de-l Île-de-Montréal

Rapport annuel de gestion 2014-2015. Hôpital chinois de Montréal du CIUSSS du Centre-Est-de-l Île-de-Montréal Rapport annuel de gestion 2014-2015 Hôpital chinois de Montréal du CIUSSS du Centre-Est-de-l Île-de-Montréal Déposé au ministère de la Santé et des Services sociaux Le 30 juin 2015 SOMMAIRE Message des

Plus en détail

Vecteurs. I- Généralités. Théorème (Unicité et existence du «translaté») :

Vecteurs. I- Généralités. Théorème (Unicité et existence du «translaté») : 9 8 4 6 / + I Généraliés Vecers «Définiion» Le es n obje maémaiqe qi réni les rois informaions n «éplacemen» irecion Désinaion xpression sens isance L informaion «isance» s appelle la Le éplacemen en qesion

Plus en détail

C r é a t i o n d e l E s c a le artistique à la Villa E l i s a b e th C a p C o r se

C r é a t i o n d e l E s c a le artistique à la Villa E l i s a b e th C a p C o r se C r é a t i o n d e l E s c a le artistique à la Villa E l i s a b e th C a p C o r se P r o j e t c u l t u r e l d a r t c o n t e m p o r a i n L e p r o j e t c o n s i s t e à c r é e r u n e s é

Plus en détail

MANUEL INTEGRATION. Gestion Automatisée des Encaissements VERSION DU 01/03/2015

MANUEL INTEGRATION. Gestion Automatisée des Encaissements VERSION DU 01/03/2015 E-transactions MANUEL INTEGRATION Gestion Automatisée des Encaissements VERSION DU 01/03/2015 Crédit Agricole S.A, société anonyme au capital de 7 729 097 322. Siège social : 12 place des Etats-Unis 92127

Plus en détail

Chapitre 29 : Polices

Chapitre 29 : Polices Polices 29-1 29 : Polices Polices La plupart des éléments que vous voyez dans Finale sont créés avec des caractères de police. En plus des éléments créés avec du texte, les symboles musicaux (comme les

Plus en détail

DENTAL BUZZ. 29,90 /u. 17,90 /u. Usage unique à petits prix. 35,90 /u. 14,90 /u. 12,90 /u. 13,90 /u. 21,90 /u. 18,90 /u. 69,90 /u.

DENTAL BUZZ. 29,90 /u. 17,90 /u. Usage unique à petits prix. 35,90 /u. 14,90 /u. 12,90 /u. 13,90 /u. 21,90 /u. 18,90 /u. 69,90 /u. NTL UZZ 44 Maqe: Poclc Caactétqe: ote de achet ef 993 cm ef 994 9 cm ef 993 cm ef 993 9 3 cm ef 9933 4 cm ef 994 33 44 cm 9,9,9 4,9,9,9,9,9 89,9 4,9 8,9,9,9 Maqe: etdet Caactétqe: ote de achet ef 994 cm

Plus en détail

Délimitation grossière des zones à effets de site sismiques dans le Sud-Isère. Synthèse des études

Délimitation grossière des zones à effets de site sismiques dans le Sud-Isère. Synthèse des études Délimitation grossière des zones à effets de site sismiques dans le Sud-Isère. Synthèse des études Pierre-Yves BARD, Héloïse CADET, Philippe GUEGUEN, Cécile CORNOU - 1 - 1 INTRODUCTION : RAPPEL DES OBJECTIFS

Plus en détail

CONSTRUCTION r H a H u a te t Q u Q a u lité lit d U s U ag a e g

CONSTRUCTION r H a H u a te t Q u Q a u lité lit d U s U ag a e g CONSTRUCTION r Haute Qualité d Usage Ú ±² 7ª± ²± ¾ «¼» Aujourd'hui, le regard porté sur l'accessibilité est en constante évolution, et fait partie des enjeux et des préoccupations des politiques urbaines.

Plus en détail

EM2 : Étude des conducteurs dans l ARQS

EM2 : Étude des conducteurs dans l ARQS EM2 : Étude des conducteurs dans l ARQS 1 L Approximation des régimes quasi-stationnaires 1.1 Condition et conséquences de l ARQS ¼ ½ È Ø Ö 1.1.1 Condition d application de l ARQS Ö Ø ¼ È Øµ ½ Ö soitö

Plus en détail

1 Les différents transferts thermiques

1 Les différents transferts thermiques TR1 : Conduction thermique L étude thermodynamique des systèmes nous a instruit sur deux choses Le transfert thermiqueévers un système aura pour conséquence une variation d énergie pour ce système, cela

Plus en détail

Modélisation des codes de calcul dans. le cadre des processus gaussiens

Modélisation des codes de calcul dans. le cadre des processus gaussiens Modélisation des codes de calcul dans le cadre des processus gaussiens Amandine Marrel Laboratoire de Modélisation des Transferts dans l Environnement CEA Cadarache Introduction (1) Fiabilité et calcul

Plus en détail

La Méthode des Classes d États pour l Analyse des Réseaux Temporels

La Méthode des Classes d États pour l Analyse des Réseaux Temporels La Méthode des Classes d États pour l Analyse des Réseaux Temporels Mise en Œuvre, Extension à la multi-sensibilisation ernard erthomieu LAAS-CNRS 7, avenue du Colonel Roche 31077 Toulouse Cedex ernard.erthomieu@laas.fr

Plus en détail

Comparaison de stratégies de discrimination de masses de véhicules automobiles

Comparaison de stratégies de discrimination de masses de véhicules automobiles Comparaison de stratégies de discrimination de masses de véhicules automobiles Alain Rakotomamonjy * Rodolphe Le Riche ** David Gualandris *** Stéphane Canu * * PSI, INSA Rouen, 7681 St. Etienne du R ay

Plus en détail

Guide utilisateur français EDI-TDFC 2015 Date de mise à jour 03/2015

Guide utilisateur français EDI-TDFC 2015 Date de mise à jour 03/2015 Guide utilisateur français pour la transmission des informations de l entreprise 2015 EDI-TDFC Volume IV Guide technique des transferts entre les Partenaires EDI et la DGFiP Ce document est édité sous

Plus en détail

Table des matières. 1. Tests de Granger 1. 2. Test de Haugh-Pierce 1. 3. Méthode de Sims 2. 4. Notes bibliographiques 3

Table des matières. 1. Tests de Granger 1. 2. Test de Haugh-Pierce 1. 3. Méthode de Sims 2. 4. Notes bibliographiques 3 Tests de causalité Jean-Marie Dufour Ý Université de Montréal Première version: Octobre 2000 Révisions: Avril 2002 Cette version: 15 avril 2002 Compilé: 15 avril 2002, 10:16am Cette recherche a bénéficié

Plus en détail

Un pitchtracker monophonique

Un pitchtracker monophonique Un pitchtracker monophonique Damien Cirotteau Dominique Fober Stephane Letz Yann Orlarey Grame - Département Recherche 9,rue du Garet BP 1185 69002 LYON CEDEX 01 Tel +33 (0)4 720 737 00 Fax +33 (0)4 720

Plus en détail

SYSTEME DE CAISSE ENREGISTREUSE DANS LE SECTEUR HORECA,

SYSTEME DE CAISSE ENREGISTREUSE DANS LE SECTEUR HORECA, CIRCULAIRE n E.T. 124.747 (AGFisc N 43/2013) dd. 23.10.2013 Administration générale de la FISCALITE Services centraux Service Procédure de taxation et Obligations Système de caisse enregistreuse SCE Horeca

Plus en détail

Wikipédia:Comment modifier une page

Wikipédia:Comment modifier une page Wikipédia:Comment modifier une page Si vous voulez simplement créer une nouvelle page, allez voir Wikipédia:Comment démarrer une page. Si vous voulez rechercher un article déjà écrit, tapez les mots clés

Plus en détail

Une exposition : «L'alternance, mode d'emploi»

Une exposition : «L'alternance, mode d'emploi» : «L' '» ' 3 (45 ) L' ' : L' : ' ' ( ' ) L' ô ' : ' - ' 82 222 572 : @ 'FLV L V L L L V LV L : - L y - L : è L y L ' ô 9 V L 2 5 2 L : V L H F É L : G ÂG VÉ È É ç L y è ) Q ( L y y â â ( ) 5 ô 3 î - :

Plus en détail

Un père de la cryptographie Jean Trithème 1462 1516 par Daniel TANT

Un père de la cryptographie Jean Trithème 1462 1516 par Daniel TANT A Ré C Séé I U è J Tè 1462 1516 D TANT J H é 1 é 1462 à T M ù T, T Tè ç. I é à, O, œ 1482, é é 1483. E 1499 é è é éé. M è. I é 1506 é à S-J W ù é : è é, é. S, é «P, I T P, S, M C» î 1518. L 384, à. D «A

Plus en détail

Cours n 1 : Affectation, fonctions, booléens, branchements conditionnels

Cours n 1 : Affectation, fonctions, booléens, branchements conditionnels Lycée Jules Ferry 2015-2016 PTSI 1&2 Informatique Cours n 1 : Affectation, fonctions, booléens, branchements conditionnels Instructions introduites dans ce cours : ¹» ÔÖÒØ Ð ÖØÙÖÒ Ò ÓÖ ÒÓØ Ð Ðº 1 Introduction

Plus en détail

Gigaset A400/A400A Présentation combiné Touches écran du combiné : Affi- Signification chage Menu INT 1 11.12. 11:56 Menu enfoncé Autres symboles

Gigaset A400/A400A Présentation combiné Touches écran du combiné : Affi- Signification chage Menu INT 1 11.12. 11:56 Menu enfoncé Autres symboles Gigaset A400/A400A Présentation combiné 1 Niveau de charge des batteries ( p. 6) 2 Icône du répondeur (A400A uniquement) 3 Intensité de la réception ( p. 6) 4 Numéro interne du combiné 5 Touches écran

Plus en détail

Combiné Gigaset AL14H

Combiné Gigaset AL14H Combiné Gigaset AL14H 1 Remarque : les nouveaux messages dans le journal des appels ou du répondeur/de la messagerie externe (p. 5) sont signalés par un clignotement à l'écran. 1 Niveau de charge 1 du

Plus en détail

Systèmes de communications Ascotel IntelliGate

Systèmes de communications Ascotel IntelliGate Systèmes de communications Ascotel IntelliGate A150 A300 2025 2045 2065 Aastra 5380 / Aastra 5380ip Mode d'emploi Eléments d'exploitation et d'affichage Eléments d'exploitation et d'affichage Eléments

Plus en détail

Programme de reprise et de recyclage de Palm. Propriété intellectuelle. Clause de non-responsabilité

Programme de reprise et de recyclage de Palm. Propriété intellectuelle. Clause de non-responsabilité Guide d'utilisation Propriété intellectuelle. 2009 Palm, Inc. Tous droits réservés. Les marques, les copyrights, les brevets et les autres types de propriété intellectuelle sont définis dans les informations

Plus en détail