Génomique Comparative et intégrative

Dimension: px
Commencer à balayer dès la page:

Download "Génomique Comparative et intégrative"

Transcription

1 Génomique Comparative et intégrative Introduction : Le big data : on peut traiter des données massives à présent, l'objectif à présent est d'éviter les transferts de données trop longs. On a tout à portée de main à présent, on a la possibilité de questionné plus les données pour en savoir plus sur le vivant. Un autre changement important en biologie, c'est un passage d'une biologie analytique (on se focaliser sur un gène, adn) à un niveau d'intégration supérieur, systémique (plus isolement mis dans son complexe, ou dans son réseau d interaction), grâce notamment au haut débit. On va vraiment vers l'intégrative. On est passé de 1996 du premier génome complet, à des milliers de génomes en 2013 (dont projet 1000 génomes). On passe à une comparaison à très grande échelle, permettant d'en savoir plus l'évolution. Mais on peut faire des comparaisons plus proche, pour savoir les régions génomiques conservés, et du coup pour trouver des régions importantes du génome. On peut aussi se rapprocher entre espèces très proches (exemple homme primate) pour savoir les éléments génétiques qui sont propre à l'homme. On peut aller plus loin maintenant, on peut avoir plusieurs génomes d'une même espèce, par exemple pour comparer des personnes saines, et malades pour trouver ce qui va favoriser la formation de la maladie. Ainsi on pourra tester nos génomes, pour savoir si on a tel élément génétique qui va former une maladie ou d'adapter le traitement en fonction du génome, vers une génomique personnalisé. On peut même séquencer plusieurs cellules d'une même tumeur, et comparer les génomes à l'intérieur de la tumeur (comparaison du même individu). On peut s'intéresser à la présence d'un gène, mais aussi de micro ARN. On peut aussi voir entre la sourie et l'homme s'il y a des introns en plus, des variations de longueurs, positions. Une autre chose qu'on compare c'est l'organisation des éléments génétiques. Sinon les séquences génomiques, pour regarder les régions conservées entre les organismes, pour essayer voir ce qui est fonctionnel. En faisant ces comparaisons on cherche à savoir l'évolution des génomes, pour comprendre comment évolue les génomes, par exemples dans le génome pathogènes, quelles sont les tendances général, et essayer de comprendre comment ça marche. Et puis il y a des aspects plus applicatifs on va s'appuyer sur le fait qu'on est plein de séquences pour les interpréter, pour comprendre comment les gènes sont réguler, qu'ils fonctionnent : c'est beaucoup plus complexe. La génomique comparative est donc beaucoup utilisée pour ça. Aussi utilisé pour comparer des pathogènes pour savoir s'ils sont sensibles à un antibiotique, pour connaître les gènes impliqués dans cette résistance. Pour finir le coté génomique personnelle. I) L'évolution de l'adn a) Nature, cause, longueur des variations, polymorphismes et devenir des variations Il y a de nombreuses types d'événements : substitutions, réarrangement équilibré et déséquilibrés, modifications des nombres de chromosomes, et par transferts horizontales : Réarrangement équilibré peuvent être une - Inversion de l'adn (un morceau d'adn des deux brins s 'échange), - Translocation il y a déplacement de deux régions qui s'échangent, alors que la transposition un seul fragment se déplace. 1

2 Réarrangement déséquilibrés : - il y a des duplications, avec une seule région qui se retrouve à plusieurs endroit du génome : par exemple en tandem : ADN satélique, minisatelite : on retrouve donc des duplications proches l'une de l'autre. Il y a aussi inversée ou une copie est inversée, mais c'est plutôt rare. Pour finir dispersé, qu'on retrouve plus loin dans l'adn, souvent à cause de transposons à ADN. - Pour terminer les délétions, ou il y a une séquence d'adn qui est perdu. Modifications du nombre de chromosomes : - fusion de 2 chromosomes en 1, mais aussi fission ou 1 chromosome donne 2 chromosomes. - L'aneuploïdie ou un (ou plusieurs chromosomes) sont en nombre anormal, le cas le plus connu étant la trisomie La polyploïdie (duplication du génome complet) : autopolyploïdie : le génome se duplique (une ou plusieurs fois) à l'intérieur d'une même espèce. Allopolyploïdie : le génome est dupliqué suite à l'hybridation entre 2 espèces proches. L'ADN peut aussi varier quand le génome vient d'ailleurs, avec une rencontre avec un autre organisme (transfert horizontale) : - D'abord il y a la transformation : récupération d'un ADN et intégrer à son ADN. - La conjugaison appariement, mise en place d une structure d échange et transfert d ADN à la cellule acceptrice, - La transduction qui est un transfert de gènes par l'intermédiaire d'un bactériophage ou d'un virus (incorporation d ADN de la cellule hôte au moment de l encapsidation). - Le parasitisme, symbiose : à cause de la proximité il se peut que l'hôte puisse récupérer l'adn du parasite, l'inverse est aussi possible. Grâce aux intégrases il est possible d'intégrer de l'adn à des sites spécifiques. Les variations sont causées par des divers facteurs. - Il y a les facteurs exogènes : due à des molécules réactives, ou encore par des radiations. - Puis les facteurs endogènes, comme les accidents lors de la réplication et réparation, action 2

3 d'endonucléase ou de topoisomérases, recombinaisons ectopiques illégitimes => éléments répétés, et action des éléments mobiles (transposons, et rétrotransposons, phages virus, plasmides) Les variations sont de tailles variées : il y a les petites variations : Mutations ponctuelles et dans ce cas une seule base est affectée (insertion, délétion, décalage de cadre de lecture, substitution, mutation faux sens et non-sens ou synonyme dans les régions codantes). - Mutations à petite échelle (<1KB ou 50pb suivant les auteurs) : délétion/insertion, duplication et inversion. Les variants sont répertoriés dans la banque dbsnp (NCBI) Puis il y a ceux de plus de 1KB (ou 50pb) : - Insertion, invertion, transposition d'éléments mobiles, délétions, duplication et translocation. Cela inclus les variations du nombre de copie d une région génomique. Banque dbvar Le polymorphisme : Coexistence naturelle de séquence alternative (allèles) pour un locus donné dans une population. L allèle le moins fréquence représente >1% de la population. Sinon considéré comme une mutation rare. (Exemple : SNP, CNP, VNTR). Un exemple est le cancer du côlon cible chimio thérapeutique : la thymidiate synthase (essentielle à la prolifération cellulaire) Lors d'une mutation, quand il y a aucun effet apparent : on appelle ça le polymorphisme neutre. Puis il y a du polymorphisme qui peut avoir des conséquences fonctionnelles : - Transcription (par exemple une mutation dans un promoteur il y a modification du pattern d'expression) - Stabilité des ARNm (par exemple mutation dans un site de polyadénylation => dégradation de l ARNt) - Traduction (exemple : traduction interrompue prématurément suite à une mutation non-sens ou un indel qui cause un décalage de cadre.), - Stabilité ou localisation de la protéine (exemple : mutation qui altère le repliement de la protéine.) - Fonction de la protéine Le devenir des variations : - Sélection et neutralisme : fitness = valeur adaptative ou sélective = succès reproducteur => nombre de descendants viables et fertiles. Une variation peut être neutre, délétère ou avantageuse. - Sélection positive : Augmentation de la fréquence des allèles - Sélection négative (purifiante) - Dérive génétique (Genetic drift) : Fluctuation aléatoire de la fréquence des allèles. Particulièrement important dans des petites populations, après un goulot d étranglement, effet fondateur. Une mutation délétère peut se propager par dérive génétique. La sélection directionnelle qui peut être positive ou négative : si l'allèle est très mauvais il sera supprimé, et dans le cas contraire il sera multiplié (exemple dans la mutation du gène de lactase permettant à 80% de la population de digéré le lait à l'âge adulte. Dans le cas de la sélection stabilisante on reste dans les valeurs moyennes, les extrêmes sont éliminés. 3

4 Dans le cas de la sélection diversifiante, c'est le contraire on garde les valeurs extrêmes. La sélection balancée : il y a plusieurs sélections, et privilégie le fait d'avoir plusieurs allèles différents qui fonctionnent ensemble. II) Méthodologie de base en génomique comparative : a) Prédiction des relations d orthologie/inparalaogie/outparalogie Orthologues : Les gènes ici d'un être commun par un événement de spéciation. Paralogues : Viennent de la même espèce et il y a un événement de duplication : deux exemplaire d'un gène. Devenir des paralogues après duplication : - Il se peut qu'un des gènes garde sa fonction et l autre dégénère : pseudogène. - Il se peut qu un des gènes garde sa fonction initiale et que l autre évolue rapidement ce qui amène vers une nouvelle fonction. - Dans le cas où le gène ancestral ait plusieurs fonctions, les deux gènes peuvent perdre une partie de leur fonction ce qui formerait une complémentation. - Ou bien maintien de la fonction ancestral mais spéciation Inparalogue : On considère qu'ils sont encore proches. Emerge après la séparation des deux espèces Outparalogue : Ils sont considérés comme divergents. Proviennent d une duplication qui a eu lieu avant la spéciation. 4

5 Exemple : - Chez l'homme on voit que les gènes MTM1, MTMR1 et MTMR2 viennent d'un gène ancestral qu'on voit chez la drosophile : on peut donc dire qu'il y a eu duplication. - On voit la différence entre homo sapiens et musculus et on voit qu'il manque un gène chez la sourie! Il manque donc un gène chez la sourie. Chez l'homme ils sont coortologues à ceux de melanogaster. Et sont inparalogue entre eux. Certains programmes essayent de prédire les orthologues : On fait du blast de chaque protéine d'un génome sur l'autre. Meilleur hit réciproque : on regarde le meilleur hit dans chaque protéine. Puis on le fait dans l'autre sens. On a aussi Orthoinspector : Blast sur une protéine, recherche des inparalogues. On va considérer que toutes les protéines trouvé avant celle d'une autre espèce sont inparalogue par rapport à cet organisme. Et il y a aussi OrthoMCL et Inparanoid. 5

6 Mais on trouve notamment des méthodes basés sur la phylogénie : besoin d'un alignement multiple (difficile si les séquences deviennent divergentes). Mais pas de méthode purement basé sur la phylogénie car besoin d'une base de données. Comparaison de méthodes existantes : Spécificité = mesure la capacité d'un test à donner un résultat négatif lorsque l'hypothèse n'est pas vérifiée (Quand faible : sous-prédiction) Sensibilité = mesure sa capacité à donner un résultat positif lorsqu'une hypothèse est vérifiée (Quand faible : sur-prédiction). b) Comparaison de l organisation chromosomique Synténie (synteny) : Définition classique : co-localisation d éléments génétiques sur un même chromosome Définition récente : conservation de l ordre des gènes Recherche de synténie entre espèces : - 1ère approche: alignement de séquences génomiques - 2ème approche (basée sur les gènes) : o Identification des gènes orthologues entre 2 génomes o Localisation physique sur le ou les chromosomes o Identification de gènes «co-localisés» avec critères plus ou moins stricts o Eventuellement représentation graphique (ex : GenePlot au NCBI pour les procaryotes : best hit réciproque au niveau protéique et localisation des orthologues sur une matrice de points) c) Alignements de séquences génomiques Alignement 2 à 2 (pairwise alignments) : - Blastz Z (et LastZ): Adapté à la comparaison de chromosomes (élimination des éléments répétés, génération des alignements en 2 étapes pour augmenter la longueur, parsing des résultats) - Blat : Blat nucléique : adapté pour recherche rapide de très forte similarité (ex : primates). Translated Blat : recherche rapide de similarité après traduction, utilisable pour espèces plus éloignées 6

7 Chainage et filtrage des alignements 2 à 2 : - Chainage (chained alignments) : Construction d ensembles ordonnés d alignements compatibles réunis par des gaps - Filtrage (net alignments) : Sélection du meilleur alignement chainé pour chaque région génomique Alignement multiple : - MultiZ : Se base sur les alignements BlastZ - PECAN :Construit un alignement global à partir de blocs synténiques. Accepte des séquences de longueur très différentes. Nécessite un arbre phylogénétique - EPO (Enredo, Pecan, Ortheus) Enredo : Recherche de segments colinéaires Pecan : Alignement multiple Ortheus : Reconstruction de la séquence ancestrale Analyse des conversations à partir d alignements : - GERP (Genomic Evolutionary Rate Profiling) : Calcul d un score de conservation à chaque colonne. Identification des éléments conservés (recherche de suite de bases conservées) - PHAST (Phylogenetic analysis with space/time models) o phylop : Estime conservation au niveau de chaque nucléotidique (+ rapide ou + lente qu attendue si évolution neutre) o phastcons : Tient compte de la conservation des nucléotides adjacents (probabilité qu un nucléotide appartienne à un élément conservé) III) Évolution des génomes : a) Plasticité chromosomique Réarrangements fréquents chez les procaryotes : - Ordre des gènes (synténie) moins conservé que gènes eux-mêmes. - Synténie (entre espèces éloignées) ne concerne que de petits clusters de gènes 7

8 Réarrangements fréquents chez les eucaryotes : - Réarrangements fréquents mais plus difficiles à estimés, cf qualité des génomes, variations en taille - Hotspots de réarrangements / courts blocs synténiques : répartition des réarrangements n est pas uniforme. Les éléments répétés (éléments répétés simples, transposons, rétrotransposons, gènes dupliqués ) favorisent les recombinaisons - Le nombre de génération/an influence la fréquence des réarrangements Duplications chez les eucaryotes - Expansion différentielle d éléments répétés suivant les lignées ex : à l intérieur des plantes, vertébrés - Multiplication de certaines familles de gènes : très grandes familles multigéniques chez plantes et vertébrés - Polyploïdisations : très fréquentes chez les plantes : événements ancestraux + nombreux événements indépendants à l événements indépendants à l intérieur des Angiospermes. Plusieurs événements chez les «champignons» (Fungi). 1 duplication à la base des Vertébrés (env 500 millions d années) puis peu au cours de l évolution récente des Vertébrés à l exception des : poissons, certains amphibiens. Plasticité chromosomique : on voit tous les chromosomes d'une espèce (exemple : rat) et on retrouve les chromosomes, et l'ensemble du rat a été aligné avec ceux humain et de la souris. Ce que sa représente : des couleurs qui représentent un chromosome chez l'humain et la souris. Donc on peut voir facilement les réarrangements. Large scale analysis of imparalogy : On cherche les relations de coorthologie entre gènes inparalogue. Plus on est vers le rouge plus il y a de relation 1 à plusieurs entre les génomes. (Donc si c'est rouge on a donc de nombreux gènes pour un gène d'une autre espèce) On a plusieurs gènes de vertébrés pour un gène d'invertébré : expliqué par les duplications de gènes. 8

9 Duplication et perte différentielles : nombreux événements de pertes et duplications spécifiques à chaque lignée. Par exemple la duplication est plus importantes chez la sourie. Mais il y plus de duplication spécifique. Transfert horizontale : détection des événements - Signature génomique différente (composition en nucléotides, fréquence des oligonucléotides, usage des codons) - «cicatrice» du transfert - arbre phylogénétique atypique exemple : Hydrogénase Ne pas confondre avec héritage vertical + duplication et perte différentielles (difficile à quantifier) Gènes souvent «échangés» : - diffusion de résistance aux antibiotiques, de déterminants de pathogénicité, de détoxification - clusters de gènes photosynthétiques et liés à la symbiose (symbiosis islands) mosaïque de gènes assemblés par de multiples événements de transferts et véhiculés par des cyanophages - capacité à exploiter de nouvelles ressources (transporteurs, enzymes de dégradation ) - Mais peu de transferts pour les gènes «informationnels Acquisitions par HGT chez les Procaryotes - très fréquentes entre organismes proches - nombreux exemples entre organismes très éloignés (entre Bactéries et Archées (cf P. abyssi), acquisitions de gènes eucaryotes dans cas de symbiose ou de parasitisme intracellulaire. Acquisitions par HGT chez les Eucaryotes - Acquisition de gènes procaryotes suite à une acquisition de gènes procaryotes suite à une endosymbiose endosymbiose (ex: gènes mitochondriaux devenus nucléaires) - Beaucoup moins nombreux que chez Procaryotes, en particulier chez les pluricellulaires Evolution réticulée (résultant de l'hybridation interspécifique) : remet en cause la notion d arbre => réseau 9

10 b) Conséquence de cette plasticité Pertes et duplication différentielles, innovations, acquisitions par transfert horizontal => disparité des histoires évolutives Philomes : arbres phylogénétiques de l ensemble des protéines (ou des gènes) d un organisme On peut aussi le voir à l intérieur d une famille, et d un genre. Diversité génétique intraspécifique : Pan-génome : le répertoire global de gènes d une espèce (somme de tous les gènes présents dans ou plusieurs souches d une espèce) - gènes communs essentiels à l espèce (core genes) - gènes accessoires (dispensable genes) - Pan-génome fermé : niche isolé avec des limites accès à l ensemble global des gènes de microorganismes. Pan-génome ouvert : Environnement multiple, multiple voies, et échange de matériel génétique. 10

11 c) Niches écologiques et dynamique des génomes procaryotes Réduction extrême : Candidatus Tremplaya princeps, hôte : cochenille - 2 Symbiotes bactériens (fournissent des acides aminés essentiels) à l hôte. o Candidatus Tremblaya princeps (140 gènes) o Candidatus Moranella endobia (452 gènes) - Moranella vit à l intérieur de Tremblaya! Catégories fonctionnelles : - Nombre de gènes quasi-indépendant de la taille du génome (à l exception des intracellulaires les plus dégradés) : traduction, division cellulaire, métabolisme et transport des nucléotides - Nombre de gènes proportionnel à la taille du génome : enzymes du métaboliques, transporteurs, réplication et réparation de l ADN - Fraction augmente avec la taille du génome : régulateurs de la transcription transduction du signal d) Vitesse d évolution Variation spécifique Variation fonctionnelle 11

12 Variation fonctionnelles et spécifique e) Phylogénomique du vivant Différente représentation : Complexité ancestrale : 12

13 IV) Génomique comparative appliqué a) Prédictions de fonctions et liens fonctionnels Prédictions de liens fonctionnels par profils phylogénétiques : Hypothèse : les gènes impliqués dans même processus cellulaire sont soumis à la même pression (perte ou acquisition de l ensemble des gènes) Méthode : étude de la présence/absence de gènes dans les génomes complets Gènes susceptibles d intervenir dans une même voie métabolique ou un même complexe structural Détermination de la «fonction» de gènes inconnus Inférences fonctionnelles : métabolisme du PI5P Prédictions de 4 complexes : 2 confirmations expérimentales Méthode des profils phylogénétiques, Prédictions d interactions protéine-protéine Complexe phosphatase kinase régulateur : régulation spatiale fine du turn-over des phosphoinositides Méthode du contexte génomique Constat : la synténie est très faible entre génomes éloignés. Observée pour des opérons ou des clusters de gènes reliés fonctionnellement (même voie métabolique, même complexe macromoléculaire...) Méthode : recherche des gènes co-localisés dans les génomes procaryotes pour prédire la fonction de gènes inconnus 13

14 Méthode de la pierre de Rosette Principe: les gènes impliqués dans le même complexe ou dans la même voie peuvent fusionner au cours de l évolution (Détection de liens fonctionnels impliquant un partenaire inconnu) Avantage : applicable aux eucaryotes Inconvénient : les domaines ubiquitaires doivent être éliminés Dans certain organismes 2 gènes fusionnent : donc lien fort (Attention au domaine Ubiquitaire) String Base de données et web ressource d interaction protéine-protéine connu ou prédit. Les intéractions inclus direct (physique) et indirect (fonction) association. Sont dérivé de quatre sources : - Contexte génomique - Expérimentation à haut débit - Coexpression - Connaissance précédentes. b) Localisation d éléments fonctionnels Régions codantes (et UTR) 6% à 15% du génome humain a été estimée être contraint parmi les mammifères placentaires. Beaucoup plus que les 1,2% occupée par les séquences codantes pour la protéine => Importance des éléments non-codantes conservées (CNE) - Gènes des ARN non codants (ncrna) (Gènes qui ne codent pas pour des protéines (trna, rrna, mirna )Meilleure conservation au niveau des structures secondaires - Régions régulatrices Régulation : la vision classique 14

15 Cis-contexte : la séquence Promoteur proximal - 76% des core promoteurs humains manque des éléments TATA-like - 54% mange le consensus INR - 46% des promoteurs humains n ont pas de TATA-like et élément INR - Ilôts CpG (régions génomiques présentant un enrichissement en dinucléotides CpG) - Abondants au sein des promoteurs «larges» (gènes ubiquitaires) Séquence régulatrice 15

16 Transcontexte L épigénétique Epigénétique : influence de l environnement sur l expression des gènes. Epigenome: L état de chromatine a été trouvé parmi le génome, défini par un point donné et type cellulaire. Pour un génome donné il peut y avoir 100 ou 1000 épigénome dépendant de la stabilité de l état de chromatine. Un nucléosome : ~147 bp d ADNet 1 octamère de protéines histones Modification des histones (méthylation, acétylation...) =>compaction/décompaction de la chromatine, répression ou activation de la transcription des gènes voisins Méthylation de l ADN => Méthylation des cytosines qui entraine généralement une répression de la transcription Localisation des régions régulatrices : nécessité d approches intégratives. Il y a les analyses in silico : - Recherche de site de fixations de facteurs de transcription. A partir d un motif consensus, ou à partir d un modèle : méthodes d apprentissage) o Construction d un modèle décrivant le set d apprentissage o Comparaison du modèle à de nouvelles séquences => scores o HMM (ex HMMsearch), profil = PSSM (ex: MatInspector, Match) Nécessité de filtre : Position par rapport aux gènes, conservation. - Recherche de régions conservés non codantes (phylogenetic footprinting et phylogenetic shadowing) Recherche d éléments communs à un grand groupe => Phylogenetic footprinting (Ex pour les mammifères : comparaison homme/souris (séparation : millions d années)) Recherche d éléments plus récents => Phylogenetic shadowing (Ex : trait apparu chez les primates) Problème : forte conservation : - distinction impossible entre conservation fonctionnelle et conservation passive - augmenter la divergence en multipliant le nombre d espèces Localisation des régions régulatrices : les Méthodes expérimentales - Identification des sites de fixation d une protéine sur l ADN par Immunoprecipitation de la chromatine (ChIP) => ChIP on chip, ChIP-seq 16

17 - Identification des sites accessibles de l ADN : Accessibilité à la DNAse (DNAse-seq), Faire-seq. Encyclopédie d éléments ADN (ENCODE) : Consortium international But : catalogue complet des éléments fonctionnels sur le génome humain 1ère phase : 1% du génome humain Sept 2007 : début de la phase production - Echelle du génome complet - Développement de protocoles expérimentaux standardisés - Unification des formats de données - Utilisation de séquençage de nouvelle génération c) Recherche de cibles par corrélation génotype/phénotype Identification de gènes impliqués dans la pathogénicité ou la résistance 17

18 Analyse soustractive Exemple : recherche de cibles thérapeutiques Comparaison d espèces pathogènes proches : Gènes impliqués dans la spécificité de l adaptation à l hôte, Facteurs de virulence. Cils/flagelles impliqués dans de nombreux aspects du développement chez les Vertébrés (migration cellulaire, polarisation ) Anomalie : maladie des reins, dégénérescence de la rétine, syndrome de Bardet-Biedl associant obésité, retard mental, hexadactylie, rétinite pigmentaire, malformation rénale et génitale Génomique comparative : Identification des protéines eucaryotiques impliquées dans la biogénèse et la fonction des cils/flagelles. Présence de cil/flagelle et de corpuscule basal chez : animaux, algues 18

19 Limites de l approche : - seuil de détection par BlastP - gènes à rôle multiple (tubulin, kinesin ) conservation chez tous les Eucaryotes - gènes apparus plus tardivement (ex : spécifiques des mammifères) - V) Génomique personnelle Génomique personnelle : analyse du génome d un individu Objectifs : Connaître le terrain génétique d un individu - Probabilité d apparition d un trait phénotypique (risque de développer une maladie) - réponse aux médicaments => adaptation des traitements - identifier les facteurs génétiques responsables ou impliqués dans les maladies Génomique des populations : - Spécificité des populations - Evolution, spéciation - Histoire des populations (ex: migrations des populations humaines) - Le génome humain de référence 2001 : 1er draft «du» génome humain 2004 : assemblage de haute qualité (99% de la séquence euchromatique) Génome humain de référence : séquence consensus dérivée d une mosaïque d individus et haploïde Les génomes individuels : Accès aux variations génétiques à l échelle du génome complet Génomes diploïdes => connaissance des paires d allèles Exome : ensemble des exons Les exons codants représentent ~1,2% du génome humain (environ 30 millions de bases) - Gain de temps, d argent - Gestion et analyse des données facilitées - Focalisation sur les régions les plus riches en mutations délétères. o exome=> 85% des mutations référencées dans desmaladies Séquençage : - l ensemble des exons (régions codantes et UTR) / uniquement régions codantes 19

20 - Peut inclure les sites d épissage (bordure d introns) => nécessite une phase d enrichissement d exons Ex : enrichissement par capture d hybrides en solution ou sur support solide (puces) Capture des exons par hybridation en solution Puces à ADN ciblées pour détecter des SNP Fragmentation de l ADN, dénaturation, marquage Hybridation sur une puce, détection de la fluorescence : soit SNP connus soit détection de nouveaux SNP (4 bases testées) Les grands projets d étude des variations génétiques humaines - Human Genome Project - SNP consortium - International HapMap Project (Phases I, II, III) (=> haplotype map) o The International HapMap 3 Consortium. Nature 2010 Méthodes : puces => SNP, CNV (Copy Number variation) séquençage de régions génomiques Données : 1184 individus provenant de 11 populations - Le projet 1000 génomes Le projet 1000 génomes : Le but est de trouver le plus possible de variant génétique qui ont des fréquences supérieur à 1% de la population étudié. Caractérisation du spectre humain de variation génétique géographique et fonctionnel Une fondation pour examiner la relation entre génotype et phénotype Une ressource pour aider la compréhension de la contribution génétique des maladies Pilote phase, Objectif : Développer et comparer différentes approches et plateformes 20

21 Polymorphisme : Fréquence de l allèle minoritaire >1% Mutations - Allèle commun : >5% - Allèle peu fréquent : entre 0,5 et 5% - Allèle rare : <0,5% - Allèle privé : présent dans quelques individus Maladies - Rares : affectent moins de 500 personnes sur 1 million - Ultra-rares : affectent moins de 20 personnes sur 1 million Phase 1 : Stratégie - Combinaison de : o séquençage de génomes complets (low-coverage 2-6X), => Accès au non-codant et à l haplotype - Séquençage d exomes (50-100X sur plus de gènes) => fournit des variants rares et privés - puces de SNP individus de 14 populations Résultats : => une carte d haplotypes avec - 38 million de SNPs, 21

22 - 1,4 million d indels grandes délétions => détection estimée de : o 99,7% des SNP avec fréquence 5% o 98 % des SNP avec fréquence 1% - 50% des SNP avec fréquence 0.1% Données incomplètes pour : - régions de faibles complexités, satellites, grands repeats - Beaucoup de variants structuraux (CNV, grandes duplications, et inversions) dbsnp Une archive des variations génétiques au sein et entre les différentes espéces developpé et hévergé par NCBI. Contient une plage de variation moléculaire : SNP, pholymorphismes de courte délétions et insertions, microsatélite ou STRs, MNPs, séquences hétérozygotes et variants. Recherche de variant associés à une maladie Rare disease : complete Congenital Stationary Night Blindness (ccsnb) Whole-Exome Sequencing à partir: Séquençage exome à partir de: - Une famille de ccsnb autosomique récessive consanguins - Un patient ccsnb mâle sporadiques 22

23 Filtrage des variantes: - Comparaison de dbsnp => élimination du polymorphisme "neutre" - Conserver uniquement variantes présentes dans un état homozygote chez les enfants atteints et dans unétat hétérozygote chez les parents de la famille consanguine => Réduire le nombre de variantes de 5,901 indels à 1 et à partir de SNPs à 7 - Elimination des variantes dans les régions non conservées Identification d'un nouveau gène impliqué dans ccnsb - Un gène affecté dans les deux familles (confirmé par un écran de 40 patients): GPR179 (orphelin G récepteurs couplés aux protéines 179) - Validation expérimentale (expression et études immunhistological) => Gpr179 fortement concentrée dans les cellules de la rétine Genome-wide association studies (GWAS) Génotypage par des puces de SNP - Des centaines de milliers de sites sont testés - Imputation des sites à proximité - Capture d environ 90% des variants communs - Comparaison groupe d individus sains/individus affectés par une maladie - Détection des allèles surreprésentés dans un groupe par rapport à l autre - Une association significative signifie qu un variant à risque est à proximité du SNP testé - Adaptée à l étude des variants communs, à faible pénétrance impliqués dans des maladies communes complexes - Ne permet pas de détecter les variants rares - Met en évidence des loci et non des gènes (tests expérimentaux sur gène àproximité) Conclusion NGS => révolution sans précédent en biologie Essor de la génomique comparative à tous les niveaux - Bouleversement de notre vision du Vivant o plasticité des génomes o arbre du Vivant profondément remodelé o modification de «notre position» - Nouvelles possibilités immenses avec la génomique personnelle o Identification de variants impliqués dans les maladies génétiques o Progrès dans la compréhension des cancers o Et beaucoup de questions éthiques 23

Différences entre Homme et singes?

Différences entre Homme et singes? Différences entre Homme et singes? Différences entre Homme et singes? Apparition de l œil? Apparition du vol? Apparition des hémoglobines? Molécule d hémoglobine HEME Chaîne polypeptidique de type 2 Chaîne

Plus en détail

Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013

Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013 Sélectionner les propositions exactes Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013 QCM 1 La plupart des techniques de biologie moléculaire repose sur le principe de complémentarité

Plus en détail

Atelier 5/11/2013. Structure de la chromatine et marques épigénétiques

Atelier 5/11/2013. Structure de la chromatine et marques épigénétiques Atelier 5/11/2013 Structure de la chromatine et marques épigénétiques La chromatine ADN ADN + Histones = Nucleosome ADN + Protéines + ARNs = Chromatine Niveau extrême de condensation = Chromosome métaphasique

Plus en détail

Les microarrays: technologie pour interroger le génome

Les microarrays: technologie pour interroger le génome Les microarrays: technologie pour interroger le génome Patrick DESCOMBES patrick.descombes@frontiers-in-genetics.org Plate forme génomique NCCR Frontiers in Genetics Université de Genève http://genomics.frontiers-in-genetics.org

Plus en détail

CHAPITRE 3 LA SYNTHESE DES PROTEINES

CHAPITRE 3 LA SYNTHESE DES PROTEINES CHAITRE 3 LA SYNTHESE DES ROTEINES On sait qu un gène détient dans sa séquence nucléotidique, l information permettant la synthèse d un polypeptide. Ce dernier caractérisé par sa séquence d acides aminés

Plus en détail

Sommaire. Première partie Les concepts de base

Sommaire. Première partie Les concepts de base Sommaire Préface à la troisième édition... Préface à la deuxième édition... Avant-propos à la troisième édition... Avant-propos à la deuxième édition... Avant-propos à la première édition... XV XVII XIX

Plus en détail

AutoGRAPH Un serveur pour automatiser et visualiser la comparaison de génomes: Application à l identification de nouveaux gènes chez le chien.

AutoGRAPH Un serveur pour automatiser et visualiser la comparaison de génomes: Application à l identification de nouveaux gènes chez le chien. AutoGRAPH Un serveur pour automatiser et visualiser la comparaison de génomes: Application à l identification de nouveaux gènes chez le chien. Thomas DERRIEN CNRS-UMR6061 Génétique et Développement Université

Plus en détail

Cours d introduction à la génétique de la souris Notion de Souche

Cours d introduction à la génétique de la souris Notion de Souche Cours d introduction à la génétique de la souris Notion de Souche Introduction: - Réponse d un animal à l expérimentation (diapo 1) Facteurs environnementaux et propres à l animal - Notion d animal standardisé

Plus en détail

POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA

POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA Amplification spécifique Détection spécifique Clonage dans des vecteurs Amplification in vitro PCR Hybridation moléculaire - hôte cellulaire

Plus en détail

Chapitre 7 : diversification des êtres vivants et évolution de la biodiversité

Chapitre 7 : diversification des êtres vivants et évolution de la biodiversité Chapitre 7 : diversification des êtres vivants et évolution de la biodiversité Au sein d une espèce, la diversité entre les individus a pour origine les mutations, sources de création de nouveaux allèles,

Plus en détail

Marc DELPECH. CORATA La Rochelle le 21 mai 2008

Marc DELPECH. CORATA La Rochelle le 21 mai 2008 Marc DELPECH CORATA La Rochelle le 21 mai 2008 En 24 ans les progrès ont été considérables Premières utilisation des techniques de génétique moléculaire en diagnostic : 1984 Une palette de techniques très

Plus en détail

Recherche de parenté entre les vertébrés

Recherche de parenté entre les vertébrés 1 CHAPITRE A Recherche de parenté entre les vertébrés 2 Chapitre A : Recherche de parentés entre les êtres vivants Tous les êtres vivants présentent des structures cellulaires et un fonctionnement commun

Plus en détail

Cahier de texte de la classe 1 ère 4 - SVT

Cahier de texte de la classe 1 ère 4 - SVT Cahier de texte de la classe 1 ère 4 - SVT DATE SEQUENCE lundi 12 : revoir la fiche méthodologique «utiliser le microscope optique» (disponible sur le site du lycée) Lundi 12 1 er contact avec les élèves.

Plus en détail

Chapitre 5 : La transcription. Professeur Joël LUNARDI

Chapitre 5 : La transcription. Professeur Joël LUNARDI Chapitre 5 : La transcription UE1 : Biochimie Biologie moléculaire Professeur Joël LUNARDI Année universitaire 2011/2012 Université Joseph Fourier de Grenoble - Tous droits réservés. Chapitre 5. La transcription

Plus en détail

DAEU- cours de Sciences de la Nature et de la Vie- Marie Claire Garnier

DAEU- cours de Sciences de la Nature et de la Vie- Marie Claire Garnier Partie 3 : génétique Chapitre 1 : la transmission d un caractère au cours de la reproduction sexuée Rappel : la reproduction sexuée comprend 2 phénomènes fondamentaux successifs : La méiose lors de la

Plus en détail

Analyse des génomes. Module de Bioinformatique Appliquée. A. Les projets Génome : a) Qu est-ce qu un projet génome? Cours Analyse des génomes

Analyse des génomes. Module de Bioinformatique Appliquée. A. Les projets Génome : a) Qu est-ce qu un projet génome? Cours Analyse des génomes Module de Bioinformatique Appliquée GB3-2012 Cours Analyse des génomes 0 Analyse des génomes 1 Les objectifs des projets génomes sont : Assemblagedes cartes physiques et génétiques sur le génome de l organisme

Plus en détail

GENETIQUE MEDICALE - Principe des études moléculaires en Génétique Médicale, Méthodes d analyse des microlésions du Génome

GENETIQUE MEDICALE - Principe des études moléculaires en Génétique Médicale, Méthodes d analyse des microlésions du Génome 29/10/2014 Crévits Léna L2 Génétique médicale Dr Martin Krahn 14 pages Principe des études moléculaires en Génétique Médicale - Méthodes d analyse des microlésions du Génome Plan A. Rappels et généralités

Plus en détail

Détermination de gènes candidats par séquençage d exome dans une famille présentant des calcifications idiopathiques des noyaux gris centraux

Détermination de gènes candidats par séquençage d exome dans une famille présentant des calcifications idiopathiques des noyaux gris centraux Service de Neurologie U614 Génétique médicale et fonctionnelle des cancers et des maladies neuropsychiatriques Pr Frébourg Dr Campion Pr Hannequin Détermination de gènes candidats par séquençage d exome

Plus en détail

Bionformatique. D. Puthier Inserm U1090 Polytech Biotech III, 2014

Bionformatique. D. Puthier Inserm U1090 Polytech Biotech III, 2014 Bionformatique D. Puthier Inserm U1090 Polytech Biotech III, 2014 L informatique est omniprésente dans notre sociéte. La biologie ne fait pas exception Bioinformatique? Utiliser l information numérisée

Plus en détail

Les principes du sequençage haut-débit

Les principes du sequençage haut-débit Les principes du sequençage haut-débit Mardi 23 avril 2013 Dr H. EL HOUSNI Organisation Génomique Podhala'et'al.'Trends'in'genetics'2012' Costa V et al. J BioMed BioTech 2010 32 ans Costa V et al. J BioMed

Plus en détail

Présentation ADN Fishbase. Jolien Bamps

Présentation ADN Fishbase. Jolien Bamps Présentation ADN Fishbase Jolien Bamps Les lois de Mendel et la transmission de l hérédité Gregor Mendel Moine et botaniste hongrois (1822-1884), en charge de maintenir le potager de son monastère Considéré

Plus en détail

Régulation GAL4 chez S. cerevisiae. Annie Sainsard-Chanet

Régulation GAL4 chez S. cerevisiae. Annie Sainsard-Chanet Régulation GAL4 chez S. cerevisiae Annie Sainsard-Chanet Contrôle de l expression génique Mécanismes qui régulent, augmentent ou diminuent l expression d un gène donné suivant le milieu, le tissu, le stade

Plus en détail

Médecine 4P Prédictive, Préventive, Personnalisée, Participative Les enjeux

Médecine 4P Prédictive, Préventive, Personnalisée, Participative Les enjeux Médecine 4P Prédictive, Préventive, Personnalisée, Participative Les enjeux Unité Inserm UMR 1087-CNRS UMR 6291 Hervé Le Marec Evolution de la médecine et de la recherche biomédicale développement de traitements

Plus en détail

BIOLOGIE MOLECULAIRE

BIOLOGIE MOLECULAIRE BIOLOGIE MOLECULAIRE I. Eléments importants de la structure des génomes eucaryotes 1. Chromosomes et chromatines a) Caractéristiques générales d'un chromosome Les chromosomes des eucaryotes sont des grosses

Plus en détail

1. L ADN et l information génétique. l ADN l information génétique est contenue dans l ADN. traduction. comment fait-on une protéine?

1. L ADN et l information génétique. l ADN l information génétique est contenue dans l ADN. traduction. comment fait-on une protéine? 1. L ADN et l information génétique l ADN l information génétique est contenue dans l ADN (ADN) (ARN) 1 2 A G T C U comment fait-on une protéine? traduction l information génétique est organisée par triplets

Plus en détail

Statistique en grande dimension pour les données génomiques

Statistique en grande dimension pour les données génomiques Statistique en grande dimension pour les données génomiques Franck Picard UMR CNRS-5558, Laboratoire de Biométrie et Biologie Evolutive franck.picard@univ-lyon1.fr January 10, 2014 F. Picard, 1/90 Outline

Plus en détail

Cours 5. Transmission et remaniement de l information génétique. http://rna.igmors.u-psud.fr/gautheret/cours/

Cours 5. Transmission et remaniement de l information génétique. http://rna.igmors.u-psud.fr/gautheret/cours/ Cours 5 Transmission et remaniement de l information génétique http://rna.igmors.u-psud.fr/gautheret/cours/ 1 Plan Rappels sur la réplication de l ADN Le cycle cellulaire et ses contrôles La mitose Recombinaisons

Plus en détail

Christelle REYNES EA 2415 Epidémiologie, Biostatistique et Santé Publique Université Montpellier 1. 8 Juin 2012

Christelle REYNES EA 2415 Epidémiologie, Biostatistique et Santé Publique Université Montpellier 1. 8 Juin 2012 Extraction et analyse des mesures haut-débit pour l identification de biomarqueurs : problèmes méthodologiques liés à la dimension et solutions envisagées EA 2415 Epidémiologie, Biostatistique et Santé

Plus en détail

Présentée et soutenue publiquement par. Guénola DRILLON. le 25 février 2013. Pour obtenir le grade de DOCTEUR de l UNIVERSITÉ PIERRE ET MARIE CURIE

Présentée et soutenue publiquement par. Guénola DRILLON. le 25 février 2013. Pour obtenir le grade de DOCTEUR de l UNIVERSITÉ PIERRE ET MARIE CURIE THÈSE DE DOCTORAT DE l UNIVERSITÉ PIERRE ET MARIE CURIE Spécialité : Informatique École Doctorale Informatique, Télécommunications et Électronique (Paris) Présentée et soutenue publiquement par Guénola

Plus en détail

Bases de données des mutations

Bases de données des mutations Bases de données des mutations CFMDB CFTR2 CFTR-France / Registre Corinne THEZE, Corinne BAREIL Laboratoire de génétique moléculaire Montpellier Atelier Muco, Lille, 25-27 septembre 2014 Accès libre http://www.genet.sickkids.on.ca/app

Plus en détail

Titre: Domaine scientifique : Mots clés : Directeurs de thèse : Institution des directeurs de thèse : Adresse email des directeurs de thèse :

Titre: Domaine scientifique : Mots clés : Directeurs de thèse : Institution des directeurs de thèse : Adresse email des directeurs de thèse : Titre: Détermination de l ensemble des ARNs non codants chez Ostreococcus, un modèle d algue unicellulaire marine infectée par des virus à ADN double brin Domaine scientifique : Génomique Mots clés : ARN

Plus en détail

1A 01 Brassage génétique et sa contribution à la diversité génétique Ex 2.1 SUJET 1

1A 01 Brassage génétique et sa contribution à la diversité génétique Ex 2.1 SUJET 1 SUJET 1 On réalise deux croisements expérimentaux chez la drosophile afin d étudier le devenir de deux caractères : la couleur du corps et l aspect des ailes au cours de la reproduction sexuée La longueur

Plus en détail

Cahier de texte de la classe 1 ère 3 - SVT

Cahier de texte de la classe 1 ère 3 - SVT Cahier de texte de la classe 1 ère 3 - SVT DATE SEQUENCE jeudi 8 : revoir la fiche méthodologique «utiliser le microscope optique» (disponible sur le site du lycée) Jeudi 8 1 er contact avec les élèves.

Plus en détail

RNAseq et NGS. Adriana Alberti Karine Labadie

RNAseq et NGS. Adriana Alberti Karine Labadie RNAseq et NGS Séquençage et Diversité LES ORGANISMES EUCARYOTES animaux plantes champignons protistes BACTERIES ARCHEES VIRUS METAGENOMES LES SOURCES ADN GENOMIQUE ARN / cdna AMPLICONS BACs ET FOSMIDES

Plus en détail

CERTIFICAT DE COMPÉTENCES EN BIO-INFORMATIQUE

CERTIFICAT DE COMPÉTENCES EN BIO-INFORMATIQUE CERTIFICAT DE COMPÉTENCES EN BIO-INFORMATIQUE Organisé par l équipe pédagogique : Statistique bioinformatique du département IMATH Responsable de la formation : Pr. Jean-François Zagury Coordinateur des

Plus en détail

3. L'ARN: Structure, Diffférents Types Et Propriétés tructure assification des ARN ARN ribosoinaux (ARNr) synthétisés dans le noyau

3. L'ARN: Structure, Diffférents Types Et Propriétés tructure assification des ARN ARN ribosoinaux (ARNr) synthétisés dans le noyau 3. L'ARN: Structure, Diffférents Types Et Propriétés Structure Les ARN sont des polymères de RiboNucléotides liés par des liaisons phosophodiester 5'-3'. Les bases azotées sont A-U, C-G. Le sucre est le

Plus en détail

Cycle de réplication. Webinaire présenté par : Michael Bailey, directeur, Réalisation des programmes Date : 6 février 2014, de 13 h à 14 h (HNE)

Cycle de réplication. Webinaire présenté par : Michael Bailey, directeur, Réalisation des programmes Date : 6 février 2014, de 13 h à 14 h (HNE) Cycle de réplication virale du VIH Webinaire présenté par : Michael Bailey, directeur, Réalisation des programmes Date : 6 février 2014, de 13 h à 14 h (HNE) Pourquoi est-ce important de comprendre le

Plus en détail

Vers l individualisation des prescriptions en oncologie : rôle du génome constitutionnel

Vers l individualisation des prescriptions en oncologie : rôle du génome constitutionnel Vers l individualisation des prescriptions en oncologie : rôle du génome constitutionnel Jacques Robert I NSERM U916 I nstitut Bergonié Université de Bordeaux Le génome constitutionnel 3 milliards de paires

Plus en détail

D. Locker Professeur émérite Université d Orléans

D. Locker Professeur émérite Université d Orléans Le séquençage du génome Humain : Comment a-t-il été séquencé? Que nous apprend la séquence? Et après? D. Locker Professeur émérite Université d Orléans Résumé L ADN contenu dans nos 23 paires de chromosomes

Plus en détail

Gènes Diffusion - EPIC 2010

Gènes Diffusion - EPIC 2010 Gènes Diffusion - EPIC 2010 1. Contexte. 2. Notion de génétique animale. 3. Profil de l équipe plateforme. 4. Type et gestion des données biologiques. 5. Environnement Matériel et Logiciel. 6. Analyses

Plus en détail

Génétique et génomique Pierre Martin

Génétique et génomique Pierre Martin Génétique et génomique Pierre Martin Principe de la sélections Repérage des animaux intéressants X Accouplements Programmés Sélection des meilleurs mâles pour la diffusion Index diffusés Indexation simultanée

Plus en détail

Vendredi 6 décembre 2013 Rouen

Vendredi 6 décembre 2013 Rouen Séminaire danimation d Animation de l Axe laxe 1 Vendredi 6 décembre 2013 Rouen «Le Séquençage de Nouvelle Génération dans le Cancéropôle Nord Ouest: Evolution, Résultats, projets» Diagnostic 0,5 2 Gb

Plus en détail

Big data et sciences du Vivant L'exemple du séquençage haut débit

Big data et sciences du Vivant L'exemple du séquençage haut débit Big data et sciences du Vivant L'exemple du séquençage haut débit C. Gaspin, C. Hoede, C. Klopp, D. Laborie, J. Mariette, C. Noirot, MS. Trotard bioinfo@genopole.toulouse.inra.fr INRA - MIAT - Plate-forme

Plus en détail

Séquençage massif en parallèle Défis technologiques et informatiques

Séquençage massif en parallèle Défis technologiques et informatiques Séquençage massif en parallèle Défis technologiques et informatiques Jean-Baptiste Rivière, PhD jean-baptiste.riviere@u-bourgogne.fr 10/09/2014 Séquençage massif en parallèle Défis technologiques de Sanger

Plus en détail

L épissage alternatif : un gène, combien de protéines?

L épissage alternatif : un gène, combien de protéines? L épissage alternatif : un gène, combien de protéines? Avant la publication de la séquence complète de l ADN du génome humain, au début des années 2000, on estimait le nombre de gènes à environ 300.000.

Plus en détail

Dr E. CHEVRET UE2.1 2013-2014. Aperçu général sur l architecture et les fonctions cellulaires

Dr E. CHEVRET UE2.1 2013-2014. Aperçu général sur l architecture et les fonctions cellulaires Aperçu général sur l architecture et les fonctions cellulaires I. Introduction II. Les microscopes 1. Le microscope optique 2. Le microscope à fluorescence 3. Le microscope confocal 4. Le microscope électronique

Plus en détail

Filière BCPST BIOLOGIE. Epreuve commune aux ENS de Paris, Lyon et Cachan. Durée : 6 heures

Filière BCPST BIOLOGIE. Epreuve commune aux ENS de Paris, Lyon et Cachan. Durée : 6 heures 74.01B SESSION 2007 Filière BCPST BIOLOGIE Epreuve commune aux ENS de Paris, Lyon et Cachan Durée : 6 heures L usage de calculatrices électroniques de poche à alimentation autonome, non imprimantes et

Plus en détail

Travaux dirigés de Microbiologie Master I Sciences des Génomes et des Organismes Janvier 2015

Travaux dirigés de Microbiologie Master I Sciences des Génomes et des Organismes Janvier 2015 Andrew Tolonen atolonen@genoscope.cns.fr Travaux dirigés de Microbiologie Master I Sciences des Génomes et des Organismes Janvier 2015 A- Généralités I- La vie sur terre telle que nous la connaissons ne

Plus en détail

CATALOGUE DES PRESTATIONS DE LA

CATALOGUE DES PRESTATIONS DE LA 1/23 La plate-forme Biopuces et Séquençage de Strasbourg est équipée des technologies Affymetrix et Agilent pour l étude du transcriptome et du génome sur puces à ADN. SOMMAIRE ANALYSE TRANSCRIPTIONNELLE...

Plus en détail

Obtention de données génétiques à grande échelle

Obtention de données génétiques à grande échelle Obtention de données génétiques à grande échelle Stéphanie FERREIRA Ph.D. Campus de l Institut Pasteur de Lille 1, rue du Professeur Calmette 59000 LILLE Tel : 03 20 87 71 53 Fax : 03 20 87 72 64 contact@genoscreen.fr

Plus en détail

A la rencontre du séquençage haut-débit nouvelle génération. Infosys Building, Kuwait

A la rencontre du séquençage haut-débit nouvelle génération. Infosys Building, Kuwait A la rencontre du séquençage haut-débit nouvelle génération Infosys Building, Kuwait 2001 : Aboutissement du projet Génome Humain Ancêtres & Renouveau 2010 Hélicos, Ion torrent, Pacbio, Oxford Nanopore

Plus en détail

Biomarqueurs en Cancérologie

Biomarqueurs en Cancérologie Biomarqueurs en Cancérologie Définition, détermination, usage Biomarqueurs et Cancer: définition Anomalie(s) quantitative(s) ou qualitative(s) Indicative(s) ou caractéristique(s) d un cancer ou de certaines

Plus en détail

Le séquençage à haut débit Mars 2011

Le séquençage à haut débit Mars 2011 Atelier Epigénétique Université Pierre et Marie Curie Le séquençage à haut débit Mars 2011 Stéphane Le Crom (lecrom@biologie.ens.fr) Institut de Biologie de l École normale supérieure (IBENS) de la Montagne

Plus en détail

leucémie lymphoïde chronique

leucémie lymphoïde chronique la leucémie lymphoïde chronique S.Taoussi, M.T. Abad Service hématologie, EHS ELCC Blida Ce travail a été réalisé au laboratoire hématologie du CAC Blida avec le soutien du CMNG et du laboratoire de recherche

Plus en détail

It was generally thought that genes were almost always present in two copies in a genome.

It was generally thought that genes were almost always present in two copies in a genome. COPY NUMBER VARIATION (CNV) It was generally thought that genes were almost always present in two copies in a genome. However, recent discoveries have revealed that large segments of DNA, ranging in size

Plus en détail

Recherche et analyse de polymorphismes SNP

Recherche et analyse de polymorphismes SNP Recherche et analyse de polymorphismes SNP 1- Tablet : Détection visuelle de SNP avec Tablet Tablet est un outil graphique de visualisation d assemblage et d alignement de séquences issues de NGS (Next

Plus en détail

TYPAGE HLA CROSSMATCH ANTICORPS ANTI-HLA

TYPAGE HLA CROSSMATCH ANTICORPS ANTI-HLA 16/11/12 TYPAGE HLA CROSSMATCH ANTICORPS ANTI-HLA Chantal GAUTREAU LABORATOIRE HLA S E R V I C E D I M M U N O L O G I E E T D H I S T O C O M PAT I B I L I T É, A P - H P, HÔPITAL SAINT LOUIS, PARIS,

Plus en détail

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq Présenté par Xi LIU ATCGCGCTAGCTGGTGTATCGCATCGCGCTAGCTGGTGTATCGCGCTAGCTGGTGTATCGCGCTAGCCTGGTGTATCGCCATCGCGCTAGCTGGCGCTAGCTGAATCGCGCATATG 17 Septembre 2013 Homéoallèles Génome Normalisation Analyse différentielle

Plus en détail

La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST.

La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST. La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST. Gaël Le Mahec - p. 1/12 L algorithme BLAST. Basic Local Alignment Search Tool est un algorithme de recherche

Plus en détail

MABioVis. Bio-informatique et la

MABioVis. Bio-informatique et la MABioVis Modèles et Algorithmes pour la Bio-informatique et la Visualisation Visite ENS Cachan 5 janvier 2011 MABioVis G GUY MELANÇON (PR UFR Maths Info / EPI GRAVITE) (là, maintenant) - MABioVis DAVID

Plus en détail

ENSEIGNEMENT DE BIOLOGIE CELLULAIRE : BIOLOGIE MOLÉCULAIRE

ENSEIGNEMENT DE BIOLOGIE CELLULAIRE : BIOLOGIE MOLÉCULAIRE ENSEIGNEMENT DE BIOLOGIE CELLULAIRE : BIOLOGIE MOLÉCULAIRE UNIVERSITÉ DES ANTILLES-GUYANE PREMIÈRE ANNÉE COMMUNE DES ETUDES DE SANTÉ DR MARYSE ETIENNE-JULAN-OTTO Gènes VI B. LEWIN DeBoeck Université BIBLIOGRAPHIE

Plus en détail

Bioinformatique en génomique évolutive

Bioinformatique en génomique évolutive Bioinformatique en génomique évolutive Elsa Petit Parcours 1997-2000: Ecole d Ingénieurs des Travaux Agricoles, Bordeaux Option pathologie végétale Eté 1999: Iowa State University, Prévision de l anthracnose

Plus en détail

TRANSCRIPTION TRADUCTION

TRANSCRIPTION TRADUCTION 4 TRANSCRIPTION TRADUCTION Objectifs : définir transcription et traduction et donner leur localisation cellulaire sur un schéma, identifier les acteurs de la transcription (ARNpol, brin transcrit, ARNm)

Plus en détail

Deux plateformes IBiSA et 3 plateaux techniques regroupés depuis 2010. Responsable scientifique Denis Milan. Coordination des nouveaux investissements

Deux plateformes IBiSA et 3 plateaux techniques regroupés depuis 2010. Responsable scientifique Denis Milan. Coordination des nouveaux investissements RNA-seq Olivier Bouchez Nathalie Marsaud Mercredi 28 mars 2012 Plateforme GeT : Génome et Transcriptome Deux plateformes IBiSA et 3 plateaux techniques regroupés depuis 2010 Responsable scientifique Denis

Plus en détail

G.E. Wild, P. Papalia, M.J. Ropeleski, J. Faria et A.B.R. Thomson

G.E. Wild, P. Papalia, M.J. Ropeleski, J. Faria et A.B.R. Thomson 15 Applications des techniques de génie génétique à la gastro-entérologie et à l hépatologie : Paradigmes fondamentaux de la biologie moléculaire de la cellule G.E. Wild, P. Papalia, M.J. Ropeleski, J.

Plus en détail

Les thérapies ciblées du cancer. Dictionnaire anglais-français autorisé. Calculatrice autorisée.

Les thérapies ciblées du cancer. Dictionnaire anglais-français autorisé. Calculatrice autorisée. Les thérapies ciblées du cancer Dictionnaire anglais-français autorisé. Calculatrice autorisée. Une thérapie ciblée est un traitement qui agit par un mécanisme spécifique sur des altérations biologiques

Plus en détail

Influence du nombre de réplicats dans une analyse différentielle de données RNAseq

Influence du nombre de réplicats dans une analyse différentielle de données RNAseq Influence du nombre de réplicats dans une analyse différentielle de données RNAseq Statisticiens: Sophie Lamarre Steve Van Ginkel Sébastien Déjean - Magali San Cristobal Matthieu Vignes Biologistes: Stéphane

Plus en détail

Les OGM. 5 décembre 2008. Nicole Mounier

Les OGM. 5 décembre 2008. Nicole Mounier Les OGM 5 décembre 2008 Nicole Mounier Université Claude Bernard Lyon 1 CGMC, bâtiment Gregor Mendel 43, boulevard du 11 Novembre 1918 69622 Villeurbanne Cedex OGM Organismes Génétiquement Modifiés Transfert

Plus en détail

Mariane ALLEAUME-BENHARIRA Sylvie ODDOU-MURATORIO François LEFEVRE. Ecologie des forêts méditerranéennes INRA AVIGNON - FRANCE

Mariane ALLEAUME-BENHARIRA Sylvie ODDOU-MURATORIO François LEFEVRE. Ecologie des forêts méditerranéennes INRA AVIGNON - FRANCE MODELISER L IMPACT DES CHANGEMENTS DEMOGRAPHIQUES ET ENVIRONNEMENTAUX SUR L EVOLUTION DES ARBRES Le module Luberon Version 2010 Mariane ALLEAUME-BENHARIRA Sylvie ODDOU-MURATORIO François LEFEVRE Ecologie

Plus en détail

Le séquençage haut-débit

Le séquençage haut-débit Nouveaux outils en biologie Le séquençage haut-débit DES d hématologie 16 janvier 2015 Paris Alice Marceau-Renaut Laboratoire d hématologie CHRU Lille NGS = Next-Generation Sequencing Whole-genome Whole-exome

Plus en détail

Chapitre 7 : Structure de la cellule Le noyau cellulaire

Chapitre 7 : Structure de la cellule Le noyau cellulaire UE2 : Structure générale de la cellule Chapitre 7 : Structure de la cellule Le noyau cellulaire Professeur Michel SEVE Année universitaire 2010/2011 Université Joseph Fourier de Grenoble - Tous droits

Plus en détail

PARCOURS : BIOLOGIE, GENETIQUE, IMMUNOLOGIE, MICROBIOLOGIE ENSEIGNEMENT (SEMESTRE 1)

PARCOURS : BIOLOGIE, GENETIQUE, IMMUNOLOGIE, MICROBIOLOGIE ENSEIGNEMENT (SEMESTRE 1) PARCOURS : BIOLOGIE, GENETIQUE, IMMUNOLOGIE, MICROBIOLOGIE ENSEIGNEMENT (SEMESTRE 1) Apport de la Biologie Cellulaire et Moléculaire aux innovations médicales (bases et prérequis de biologie cellulaire

Plus en détail

Le séquençage à haut débit Juin 2012

Le séquençage à haut débit Juin 2012 Atelier Epigénétique Université Pierre et Marie Curie Le séquençage à haut débit Juin 2012 Stéphane Le Crom (stephane.le_crom@upmc.fr) Laboratoire de Biologie du Développement (UPMC) de la Montagne Sainte

Plus en détail

Hémochromatose génétique non liée à HFE-1 : quand et comment la rechercher? Cécilia Landman 11 décembre 2010

Hémochromatose génétique non liée à HFE-1 : quand et comment la rechercher? Cécilia Landman 11 décembre 2010 Hémochromatose génétique non liée à HFE-1 : quand et comment la rechercher? Cécilia Landman 11 décembre 2010 Métabolisme du fer : hepcidine Fer absorbé par les entérocytes des villosités duodénales : transporteur

Plus en détail

Bases moléculaires des mutations Marc Jeanpierre

Bases moléculaires des mutations Marc Jeanpierre Bases moléculaires des mutations Marc Jeanpierre Chaque enfant qui naît hérite de 10 à 30 nouvelles mutations ponctuelles. L essentiel des ces mutations sont heureusement des variations neutres de séquence

Plus en détail

Les acides nucléiques et génomes

Les acides nucléiques et génomes Chapitre 2 : UE1 : Biochimie Biologie moléculaire Les acides nucléiques et génomes Professeur Joël LUNARDI Année universitaire 2011/2012 Université Joseph Fourier de Grenoble - Tous droits réservés. Chapitre

Plus en détail

3: Clonage d un gène dans un plasmide

3: Clonage d un gène dans un plasmide 3: Clonage d un gène dans un plasmide Le clonage moléculaire est une des bases du génie génétique. Il consiste à insérer un fragment d'adn (dénommé insert) dans un vecteur approprié comme un plasmide par

Plus en détail

Conception assistée par ordinateur de molécules thérapeutiques

Conception assistée par ordinateur de molécules thérapeutiques Conception assistée par ordinateur de molécules thérapeutiques D. Gilis Bioinformatique génomique et structurale Faculté des sciences appliquées Université Libre de Bruxelles Objectif: illustrer en quoi

Plus en détail

Etude de la lysine acetyl transferase PCAF dans le développement du diabète et de l'obésité.

Etude de la lysine acetyl transferase PCAF dans le développement du diabète et de l'obésité. Etude de la lysine acetyl transferase PCAF dans le développement du diabète et de l'obésité. Tuteur : Jean-Sébastien Annicotte EGID CNRS UMR8199 Faculté de Médecine-Pôle Recherche, 2eme étage Bd J. Leclercq

Plus en détail

Identification de nouveaux membres dans des familles d'interleukines

Identification de nouveaux membres dans des familles d'interleukines Identification de nouveaux membres dans des familles d'interleukines Nicolas Beaume Jérôme Mickolajczak Gérard Ramstein Yannick Jacques 1ère partie : Définition de la problématique Les familles de gènes

Plus en détail

Module Analyse de Génomes 2011-2012 Master 2 module FMBS 326 Immunoinformatique

Module Analyse de Génomes 2011-2012 Master 2 module FMBS 326 Immunoinformatique Module Analyse de Génomes 2011-2012 Master 2 module FMBS 326 Immunoinformatique Planning du Module : Date Heure Salle 12/12 9h-12h TD info TA1Z bat 25 13h-17h TD info TA1Z bat 25 13/12 9h-12h TD info TA1Z

Plus en détail

Séquençage. Bérénice Batut, berenice.batut@udamail.fr. DUT Génie Biologique Option Bioinformatique Année 2014-2015

Séquençage. Bérénice Batut, berenice.batut@udamail.fr. DUT Génie Biologique Option Bioinformatique Année 2014-2015 Séquençage Bérénice Batut, berenice.batut@udamail.fr DUT Génie Biologique Option Bioinformatique Année 2014-2015 Séquençage Séquençage ADN Détermination de l ordre d enchainement des nucléotides d un fragment

Plus en détail

Dynamique et évolution des génomes

Dynamique et évolution des génomes Dynamique et évolution des génomes Charles Robert Darwin (1809-1882) Cours BIM 3 novembre 2009 Bernard Dujon Les séquences des homologues divergent Les cartes génétiques se réarrangent 1 Les lots de gènes

Plus en détail

Biologie cellulaire. Perfectionnement à la culture cellulaire. Programme. ParTIe PraTIQUe. ParTIe THÉorIQUe. durée : 4 jours

Biologie cellulaire. Perfectionnement à la culture cellulaire. Programme. ParTIe PraTIQUe. ParTIe THÉorIQUe. durée : 4 jours Biologie cellulaire Perfectionnement à la culture cellulaire durée : 4 jours ingénieurs, chercheurs et chefs de projet connaissances de base en culture cellulaire ou validation du module «initiation à

Plus en détail

Lier un site de liaison d'un facteur de transcription et son gène cible

Lier un site de liaison d'un facteur de transcription et son gène cible Berder 2013 : Corrélation, causalité et régulation en biologie Lier un site de liaison d'un facteur de transcription et son gène cible Laurent M. SACHS (sachs@mnhn.fr) Laboratoire Evolution des Régulations

Plus en détail

Génotypage et Séquençage. Pierre Mournet

Génotypage et Séquençage. Pierre Mournet Génotypage et Séquençage Pierre Mournet Plan Séquençage/Génotypage Classique (usat, Sanger) Séquençage NGS (Next Generation Sequencing) Séquenceur Préparation Pré-NGS Exemple 1 NGS Exemple 2 NGS Génotypage

Plus en détail

1 Des innovations génétiques favorables

1 Des innovations génétiques favorables ACTIVITÉ 1 Des innovations génétiques favorables ou défavorables Les mutations sont des innovations génétiques qui apparaissent de manière aléatoire dans le génome des organismes. Elles peuvent avoir des

Plus en détail

Anomalies chromosomiques

Anomalies chromosomiques Master bioinformatique, Université de Rouen Janvier 2013 Sylvain Mareschal [@etu.univ-rouen.fr] Anomalies chromosomiques Speicher & Carter (2005) Nat Rev Genet. Oct;6(10):782-92. The new cytogenetics:

Plus en détail

TD Bioinformatique : Sequence Alignment. Pourquoi faire une recherche par similarité?

TD Bioinformatique : Sequence Alignment. Pourquoi faire une recherche par similarité? TD Bioinformatique : Sequence lignment Pourquoi faire une recherche par similarité? - Savoir si ma séquence ressemble à d'autres déjà connues. - Trouver toutes les séquences d'une même famille. - Rechercher

Plus en détail

Développement d un traitement pour l ataxie de Friedreich. Dr. Jacques P. Tremblay Université Laval Québec, Canada

Développement d un traitement pour l ataxie de Friedreich. Dr. Jacques P. Tremblay Université Laval Québec, Canada Développement d un traitement pour l ataxie de Friedreich Dr. Jacques P. Tremblay Université Laval Québec, Canada Ataxie de Friedreich Maladie héréditaire Transmission récessive Liée au chromosome 9 Due

Plus en détail

BACCALAURÉAT GÉNÉRAL SCIENCES DE LA VIE ET DE LA TERRE

BACCALAURÉAT GÉNÉRAL SCIENCES DE LA VIE ET DE LA TERRE BACCALAURÉAT GÉNÉRAL SESSION 2013 SCIENCES DE LA VIE ET DE LA TERRE Série S Durée de l'épreuve : 3h30 Coefficient : 6 ENSEIGNEMENT OBLIGATOIRE L'usage de la calculatrice n'est pas autorisé. Dès que le

Plus en détail

La PCR en temps réel

La PCR en temps réel La PCR en temps réel Hôpital La Rabta Tunis 6 juin 2013 Dr Sabine Favre-Bonté Maître de Conférences, Université Claude Bernard Lyon 1 UMR CNRS 5557 Ecologie Microbienne Equipe Multi-résistance environnementale

Plus en détail

Détection des duplications en tandem au niveau nucléique à l'aide de la théorie des flots

Détection des duplications en tandem au niveau nucléique à l'aide de la théorie des flots Université Toulouse 3 Paul Sabatier(UT3 Paul Sabatier) Informatique Spécialité Bioinformatique Eric AUDEMARD lundi 28 novembre 2011 Détection des duplications en tandem au niveau nucléique à l'aide de

Plus en détail

Classification d ARN codants et d ARN non-codants

Classification d ARN codants et d ARN non-codants Classification d ARN codants et d ARN non-codants THÈSE présentée et soutenue publiquement le 31 mars 2009 pour l obtention du Doctorat de l Université des Sciences et Technologies de Lille (spécialité

Plus en détail

Guide de référence du logiciel MiSeq Reporter pour les tests IVD

Guide de référence du logiciel MiSeq Reporter pour les tests IVD Guide de référence du logiciel MiSeq Reporter pour les tests IVD DESTINÉ AU DIAGNOSTIC IN VITRO UNIQUEMENT EXCLUSIF À ILLUMINA Nº 15038356 Rév. A FRA Mars 2014 Ce document et son contenu sont exclusifs

Plus en détail

Le chercheur responsable, en collaboration avec le personnel technique de

Le chercheur responsable, en collaboration avec le personnel technique de Direction des services vétérinaires Procédure normalisée de fonctionnement Objet : Gestion des colonies internes de souris Numéro : RE-1 Portée : Ceci est une directive de la Direction des services vétérinaires

Plus en détail

Plateforme Transgenèse/Zootechnie/Exploration Fonctionnelle IBiSA. «Anexplo» Service Transgenèse. Catalogue des prestations

Plateforme Transgenèse/Zootechnie/Exploration Fonctionnelle IBiSA. «Anexplo» Service Transgenèse. Catalogue des prestations Plateforme Transgenèse/Zootechnie/Exploration Fonctionnelle IBiSA «Anexplo» Service Transgenèse Catalogue des prestations 04/01/12 - Page 1 sur 8 Présentation du service de Transgenèse Le service de Transgenèse

Plus en détail

Diagnostic prénatal non invasif : Du GénotypageRhésus Fœtal au Diagnostic de la Trisomie 21

Diagnostic prénatal non invasif : Du GénotypageRhésus Fœtal au Diagnostic de la Trisomie 21 Diagnostic prénatal non invasif : Du GénotypageRhésus Fœtal au Diagnostic de la Trisomie 21 Dr. A. Levy-Mozziconacci UniteFonctionnelle de Biologie Materno-Fœtale et Centre de Médecine Fœtale, APHM, AMU,

Plus en détail

La Génomique Biologie, informatique, évolution. Hugues Roest Crollius hrc@ens.fr Dyogen Group L3 Introduction aux sciences du vivant 03.12.

La Génomique Biologie, informatique, évolution. Hugues Roest Crollius hrc@ens.fr Dyogen Group L3 Introduction aux sciences du vivant 03.12. La Génomique Biologie, informatique, évolution Hugues Roest Crollius hrc@ens.fr Dyogen Group L3 Introduction aux sciences du vivant 03.12.2013 La «génomique fonctionnelle» La «génomique évolutive» human

Plus en détail

Anomalies chromosomiques et tumeurs d Ewing

Anomalies chromosomiques et tumeurs d Ewing Anomalies chromosomiques et tumeurs d Ewing Sylvain Blachon IRISA/INRIA Rennes - projet SITCON 21 Octobre 2008 Sylvain Blachon (IRISA/INRIA Rennes - projet SITCON) Anomalies chromosomiques et tumeurs d

Plus en détail