Les bases de données transcriptionnelles en ligne

Dimension: px
Commencer à balayer dès la page:

Download "Les bases de données transcriptionnelles en ligne"

Transcription

1 Les bases de données transcriptionnelles en ligne

2 Différents concepts en régulation transcriptionnelle sites de fixation - in vitro/vivo? - quelle technique? - degré de confiance? facteur de transcription TTGATGTCTCC AGTAATGCGACCATTAC ACCCATTTGGCTTCCCATTTCGA TATCAATTAG ACCCAATTAGTAATAAAT - structure? - classe? - orthologues? matrice - fréq. / poids-position? - type de correction? A C G T gène(s) cible(s) module cis-régulateur - taille/position génomique? TF présents? technique expérimentale utilisée? gène cible?

3 Différents concepts en régulation transcriptionnelle sites de fixation - in vitro/vivo? - quelle technique? - degré de confiance? facteur de transcription TTGATGTCTCC AGTAATGCGACCATTAC ACCCATTTGGCTTCCCATTTCGA TATCAATTAG ACCCAATTAGTAATAAAT - structure? - classe? - orthologues? matrice - fréq. / poids-position? - type de correction? A C G T gène(s) cible(s) module cis-régulateur - taille/position génomique? TF présents? technique expérimentale utilisée? gène cible?

4 Différents concepts en régulation transcriptionnelle sites de fixation - in vitro/vivo? - quelle technique? - degré de confiance? facteur de transcription TTGATGTCTCC AGTAATGCGACCATTAC ACCCATTTGGCTTCCCATTTCGA TATCAATTAG ACCCAATTAGTAATAAAT - structure? - classe? - orthologues? matrice - fréq. / poids-position? - type de correction? A C G T gène(s) cible(s) module cis-régulateur - taille/position génomique? TF présents? technique expérimentale utilisée? gène cible?

5 Différents concepts en régulation transcriptionnelle sites de fixation - in vitro/vivo? - quelle technique? - degré de confiance? facteur de transcription TTGATGTCTCC AGTAATGCGACCATTAC ACCCATTTGGCTTCCCATTTCGA TATCAATTAG ACCCAATTAGTAATAAAT - structure? - classe? - orthologues? matrice - fréq. / poids-position? - type de correction? A C G T gène(s) cible(s) module cis-régulateur - taille/position génomique? TF présents? technique expérimentale utilisée? gène cible?

6 Quelques bases de données

7 base de donnée commerciale (licence payante publique gratuite ) + version

8 Qualité des sites Transfac Scores de qualité 1 : Functionally confirmed factor binding site 2: Binding of pure protein (purified or recombinant) 3: Immunologically characterized binding activity of a cellular extract 4: Binding activity characterized via a known binding sequence 5: Binding of uncharacterized extract protein to a bone fide element 6: No quality assigned

9 Recherche E2F dans Transfac publique classification interacteurs matrices

10 Recherche E2F dans Transfac publique sites de fixation références

11 3 Matrices E2F Transfac quelles différences?

12 [Sandelin A, Alkema W, Engstrom P, Wasserman WW, Lenhard B.] alternative open-source à Transfac taille plus réduite: 459 matrices (oct. 2009) Répartition taxonomique des matrices Origine des données JASPAR in vitro in vivo g fun v i eb e rt es ra t in ts sec es nts te s d a a l o t d p r ma ho c ne o ur 0 PB M I q A D ip E X al 1H A se L -se PILE MS ip-ch p E i i E r N S D M Ch cte Ch CO ba essentiellement des données in-vitro, donc pas de gène cible!

13 Différents concepts en régulation transcriptionnelle sites de fixation - in vitro/vivo? - quelle technique? - degré de confiance? facteur de transcription TTGATGTCTCC AGTAATGCGACCATTAC ACCCATTTGGCTTCCCATTTCGA TATCAATTAG ACCCAATTAGTAATAAAT - structure? - classe? - orthologues? matrice - fréq. / poids-position? - type de correction? A C G T gène(s) cible(s) module cis-régulateur - taille/position génomique? TF présents? technique expérimentale utilisée? gène cible?

14 E2F dans Jaspar

15 But: standardiser et centraliser les informations sur la régulation transcriptionnelle inclut certaines bases de données mise en place d'une architecture unifiée: tout le monde peut mettre ses données dans PAZAR et les rendre publiques ou non... open-access et open-source (TRANSFAC n'en fait pas partie) standards GFF (localisation génomique) et XML

16 aucun gène cible aucun facteur de transcription spécifique d'un gène cible ("gene centric") spécifique d'un FT ("TF centric")

17 E2F dans PAZAR

18 Navigateur UCSC target gene

19 [ Griffith OL et al.] Idée: aller chercher les informations dans la littérature scientifique Comment? en mettant à contribution la communauté scientifique Oreganno met à disposition des curateurs un corpus d'articles scientifiques soumis par des experts identifiés par des approches de text-mining automatiques (recherche de mots typiques comme "transcription factor", "binding site",...)

20 Oreganno inclut également des données provenant d'autres projets à grande échelle

21 E2F dans Oreganno site de fixation polymorphisme

22 Différents concepts en régulation transcriptionnelle sites de fixation - in vitro/vivo? - quelle technique? - degré de confiance? facteur de transcription TTGATGTCTCC AGTAATGCGACCATTAC ACCCATTTGGCTTCCCATTTCGA TATCAATTAG ACCCAATTAGTAATAAAT - structure? - classe? - orthologues? matrice - fréq. / poids-position? - type de correction? A C G T gène(s) cible(s) module cis-régulateur - taille/position génomique? TF présents? technique expérimentale utilisée? gène cible?

23 [Gallo, S. M., Li, L., Hu, Z. and Halfon, M. S] base de données de modules cis-régulateurs et de TFBS chez la drosophile CRM sans TFBS CRM avec TFBS

24 Take home messages nombreuses bases de données, contenant différents types d'information information généralement parcellaire: TF mais pas de gène cible, CRM sans TF, etc... les matrices des différentes bases de données sont souvent différentes: impact de cette différence? attention à l'origine des données: in-vivo, in-vitro, in-silico

Université de Montréal. Développement d outils pour l analyse de données de ChIP-seq et l identification des facteurs de transcription

Université de Montréal. Développement d outils pour l analyse de données de ChIP-seq et l identification des facteurs de transcription Université de Montréal Développement d outils pour l analyse de données de ChIP-seq et l identification des facteurs de transcription par Eloi Mercier Département de bioinformatique Faculté de médecine

Plus en détail

Etude transcriptomique de la dégradation des parois lignocellulosiques de son et paille de blé durant la croissance de Thermobacillus xylanilyticus

Etude transcriptomique de la dégradation des parois lignocellulosiques de son et paille de blé durant la croissance de Thermobacillus xylanilyticus Journées SFR condorcet Compiègne 8-9 juillet 2015 Projet Hydroseq : UMR FARE-CRRBM Etude transcriptomique de la dégradation des parois lignocellulosiques de son et paille de blé durant la croissance de

Plus en détail

Régulation GAL4 chez S. cerevisiae. Annie Sainsard-Chanet

Régulation GAL4 chez S. cerevisiae. Annie Sainsard-Chanet Régulation GAL4 chez S. cerevisiae Annie Sainsard-Chanet Contrôle de l expression génique Mécanismes qui régulent, augmentent ou diminuent l expression d un gène donné suivant le milieu, le tissu, le stade

Plus en détail

Sommaire. Première partie Les concepts de base

Sommaire. Première partie Les concepts de base Sommaire Préface à la troisième édition... Préface à la deuxième édition... Avant-propos à la troisième édition... Avant-propos à la deuxième édition... Avant-propos à la première édition... XV XVII XIX

Plus en détail

OUTILS DE FINANCEMENT DE L INNOVATION TECHNOLOGIQUE ET DE LA VALORISATION DE LA RECHERCHE

OUTILS DE FINANCEMENT DE L INNOVATION TECHNOLOGIQUE ET DE LA VALORISATION DE LA RECHERCHE OUTILS DE FINANCEMENT DE L INNOVATION TECHNOLOGIQUE ET DE LA VALORISATION DE LA RECHERCHE Un exemple de Projet PNRI Pr. Ahmed Noureddine HELAL 11 Mars 2015, Hôtel Monastir Center, Monastir Notre Projet

Plus en détail

Introduction aux bases de données: application en biologie

Introduction aux bases de données: application en biologie Introduction aux bases de données: application en biologie D. Puthier 1 1 ERM206/Technologies Avancées pour le Génome et la Clinique, http://tagc.univ-mrs.fr/staff/puthier, puthier@tagc.univ-mrs.fr ESIL,

Plus en détail

Lier un site de liaison d'un facteur de transcription et son gène cible

Lier un site de liaison d'un facteur de transcription et son gène cible Berder 2013 : Corrélation, causalité et régulation en biologie Lier un site de liaison d'un facteur de transcription et son gène cible Laurent M. SACHS (sachs@mnhn.fr) Laboratoire Evolution des Régulations

Plus en détail

MODE D'EMPLOI. La gestion des versions permettra de compléter et de faire évoluer les fiches dans le temps. NOM DE LA RESSOURCE CONTACT FOURNISSEUR

MODE D'EMPLOI. La gestion des versions permettra de compléter et de faire évoluer les fiches dans le temps. NOM DE LA RESSOURCE CONTACT FOURNISSEUR MODE D'EMPLOI Fiche réalisée le Version Rédacteur La gestion des versions permettra de compléter et de faire évoluer les fiches dans le temps. NOM DE LA RESSOURCE Nom, prénom CONTACT FOURNISSEUR Mail Téléphone

Plus en détail

Cours d introduction à la génétique de la souris Notion de Souche

Cours d introduction à la génétique de la souris Notion de Souche Cours d introduction à la génétique de la souris Notion de Souche Introduction: - Réponse d un animal à l expérimentation (diapo 1) Facteurs environnementaux et propres à l animal - Notion d animal standardisé

Plus en détail

Atelier 5/11/2013. Structure de la chromatine et marques épigénétiques

Atelier 5/11/2013. Structure de la chromatine et marques épigénétiques Atelier 5/11/2013 Structure de la chromatine et marques épigénétiques La chromatine ADN ADN + Histones = Nucleosome ADN + Protéines + ARNs = Chromatine Niveau extrême de condensation = Chromosome métaphasique

Plus en détail

Approches bioinformatiques de la cis-régulation

Approches bioinformatiques de la cis-régulation 2 Plan Approches bioinformatiques de la cis-régulation Stratégies de découvertes de motifs nucléiques Carl Herrmann TAGC & Univ. Méditerranée - Marseille Rappels sur les mécanismes de régulation transcriptionnelle

Plus en détail

-ii- APPLICATION DES PROPRIETES DE RESONANCE

-ii- APPLICATION DES PROPRIETES DE RESONANCE -ii- APPLICATION DES PROPRIETES DE RESONANCE Michel ZANCA, CHU Montpellier Signification de la résonance et relation de Larmor ω eff = 2 π ν eff = γ B eff La RMN détecte très précisément la fréquence ν

Plus en détail

Laboratoire d'infochimie, ULP, Strasbourg - INTERNET - Version multi-utilisateurs de SXD in house Partie 1: Concept. Partie 2: Description du logiciel

Laboratoire d'infochimie, ULP, Strasbourg - INTERNET - Version multi-utilisateurs de SXD in house Partie 1: Concept. Partie 2: Description du logiciel Version multi-utilisateurs de SXD in house Partie 1: Concept a. Présentation de SXD Internet b. Architecture c. Caractéristiques d. Formats supportés e. Niveaux d utilisation Partie 2: Description du logiciel

Plus en détail

AutoGRAPH Un serveur pour automatiser et visualiser la comparaison de génomes: Application à l identification de nouveaux gènes chez le chien.

AutoGRAPH Un serveur pour automatiser et visualiser la comparaison de génomes: Application à l identification de nouveaux gènes chez le chien. AutoGRAPH Un serveur pour automatiser et visualiser la comparaison de génomes: Application à l identification de nouveaux gènes chez le chien. Thomas DERRIEN CNRS-UMR6061 Génétique et Développement Université

Plus en détail

Développement d un traitement pour l ataxie de Friedreich. Dr. Jacques P. Tremblay Université Laval Québec, Canada

Développement d un traitement pour l ataxie de Friedreich. Dr. Jacques P. Tremblay Université Laval Québec, Canada Développement d un traitement pour l ataxie de Friedreich Dr. Jacques P. Tremblay Université Laval Québec, Canada Ataxie de Friedreich Maladie héréditaire Transmission récessive Liée au chromosome 9 Due

Plus en détail

Mise en place de serveurs Galaxy dans le cadre du réseau CATI BBRIC

Mise en place de serveurs Galaxy dans le cadre du réseau CATI BBRIC Mise en place de serveurs Galaxy dans le cadre du réseau CATI BBRIC {Sebastien.Carrere, Ludovic.Legrand,Jerome.Gouzy}@toulouse.inra.fr {Fabrice.Legeai,Anthony.Bretaudeau}@rennes.inra.fr CATI BBRIC 35 bioinformaticiens

Plus en détail

FazaANGEL supervision pro-active

FazaANGEL supervision pro-active presentation FazaAngel - page 1/7 FazaANGEL supervision pro-active FazaAngel : supervision pro-active fazaangel surveille tous les «éléments de votre infrastructure : télécom, réseau, serveur, site web

Plus en détail

Ocularis. NOVADIS 14 place Marie Jeanne Bassot 92 300 Levallois Perret Tel : +(33) 1 41 34 03 90 Fax : +(33) 1 41 34 09 91 www.novadis.

Ocularis. NOVADIS 14 place Marie Jeanne Bassot 92 300 Levallois Perret Tel : +(33) 1 41 34 03 90 Fax : +(33) 1 41 34 09 91 www.novadis. Ocularis NOVADIS 14 place Marie Jeanne Bassot 92 300 Levallois Perret Tel : +(33) 1 41 34 03 90 Fax : +(33) 1 41 34 09 91 www.novadis.eu Ocularis La dernière génération de plateforme VMS d OnSSI, Ocularis,

Plus en détail

POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA

POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA Amplification spécifique Détection spécifique Clonage dans des vecteurs Amplification in vitro PCR Hybridation moléculaire - hôte cellulaire

Plus en détail

La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST.

La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST. La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST. Gaël Le Mahec - p. 1/12 L algorithme BLAST. Basic Local Alignment Search Tool est un algorithme de recherche

Plus en détail

Séminaire: Méthodes et outils d'analyse de données textuelles, un nouveau souffle?

Séminaire: Méthodes et outils d'analyse de données textuelles, un nouveau souffle? Séminaire: Méthodes et outils d'analyse de données textuelles, un nouveau souffle? Daniel K. Schneider TECFA FPSE - Université de Genève daniel.schneider@unige.ch Unité de technologie de l'éducation Université

Plus en détail

Evolutions technologiques et intégration européenne, la nécessaire mutation des échanges banque-entreprise

Evolutions technologiques et intégration européenne, la nécessaire mutation des échanges banque-entreprise Evolutions technologiques et intégration européenne, la nécessaire mutation des échanges banque-entreprise Hervé Postic - Directeur UTSIT Petit-déjeuner Axway "ETEBAC - Suite" 10 juin 2008 UTSIT en deux

Plus en détail

De GenoSol à GenoBiome, mise en place d une structure analytique pour évaluer l état biologique du sol

De GenoSol à GenoBiome, mise en place d une structure analytique pour évaluer l état biologique du sol De GenoSol à GenoBiome, mise en place d une structure analytique pour évaluer l état biologique du sol Lionel RANJARD, Samuel Dequiedt, Pierre-Alain Maron, Anne-Laure Blieux. UMR Agroécologie-plateforme

Plus en détail

La GRC en temps de crise, difficile équilibre entre sentiment de sécurité et réduction des coûts

<Insert Picture Here> La GRC en temps de crise, difficile équilibre entre sentiment de sécurité et réduction des coûts La GRC en temps de crise, difficile équilibre entre sentiment de sécurité et réduction des coûts Christophe Bonenfant Cyril Gollain La GRC en période de croissance Gouvernance Gestion

Plus en détail

Informations techniques

Informations techniques Informations techniques Force développée par un vérin Ø du cylindre (mm) Ø de la tige (mm) 12 6 16 6 20 8 25 10 32 12 40 16 50 20 63 20 80 25 100 25 125 32 160 40 200 40 250 50 320 63 ction Surface utile

Plus en détail

Artica Proxy Appliance Haute disponibilite

Artica Proxy Appliance Haute disponibilite Artica Proxy Appliance Haute disponibilite Table des matières Introduction... 2 Prérequis... 2 Architectures... 3 Fabriquer une sorte de clusteur.... 3 Si le serveur secondaire est passerelle de statistiques,

Plus en détail

1A 01 Brassage génétique et sa contribution à la diversité génétique Ex 2.1 SUJET 1

1A 01 Brassage génétique et sa contribution à la diversité génétique Ex 2.1 SUJET 1 SUJET 1 On réalise deux croisements expérimentaux chez la drosophile afin d étudier le devenir de deux caractères : la couleur du corps et l aspect des ailes au cours de la reproduction sexuée La longueur

Plus en détail

L'ELECTRONIQUE AU. Innov'Day PEP Bellignat 24 Avril 2014

L'ELECTRONIQUE AU. Innov'Day PEP Bellignat 24 Avril 2014 L'ELECTRONIQUE AU SERVICE DU MOULE Innov'Day PEP Bellignat 24 Avril 2014 Sommaire Le Monde de SISE L'Electronique dans un Moule Inconvénients de l'electronique actuelle L'Architecture future de l'electronique

Plus en détail

TEPZZ 6Z85Z5A T EP 2 608 505 A2 (19) (11) EP 2 608 505 A2 (12) DEMANDE DE BREVET EUROPEEN

TEPZZ 6Z85Z5A T EP 2 608 505 A2 (19) (11) EP 2 608 505 A2 (12) DEMANDE DE BREVET EUROPEEN (19) TEPZZ 6Z8ZA T (11) EP 2 608 0 A2 (12) DEMANDE DE BREVET EUROPEEN (43) Date de publication: 26.06.13 Bulletin 13/26 (21) Numéro de dépôt: 12197432.3 (1) Int Cl.: H04M 3/487 (06.01) H04M 7/00 (06.01)

Plus en détail

MAB Solut. vos projets. MABLife Génopole Campus 1 5 rue Henri Desbruères 91030 Evry Cedex. www.mabsolut.com. intervient à chaque étape de

MAB Solut. vos projets. MABLife Génopole Campus 1 5 rue Henri Desbruères 91030 Evry Cedex. www.mabsolut.com. intervient à chaque étape de Mabsolut-DEF-HI:Mise en page 1 17/11/11 17:45 Page1 le département prestataire de services de MABLife de la conception à la validation MAB Solut intervient à chaque étape de vos projets Création d anticorps

Plus en détail

Titre: Domaine scientifique : Mots clés : Directeurs de thèse : Institution des directeurs de thèse : Adresse email des directeurs de thèse :

Titre: Domaine scientifique : Mots clés : Directeurs de thèse : Institution des directeurs de thèse : Adresse email des directeurs de thèse : Titre: Détermination de l ensemble des ARNs non codants chez Ostreococcus, un modèle d algue unicellulaire marine infectée par des virus à ADN double brin Domaine scientifique : Génomique Mots clés : ARN

Plus en détail

LES ESCALIERS. Du niveau du rez-de-chaussée à celui de l'étage ou à celui du sous-sol.

LES ESCALIERS. Du niveau du rez-de-chaussée à celui de l'étage ou à celui du sous-sol. LES ESCALIERS I. DÉF I NIT I O N Un escalier est un ouvrage constitué d'une suite de marches et de paliers permettant de passer à pied d'un niveau à un autre. Ses caractéristiques dimensionnelles sont

Plus en détail

Bases de données des mutations

Bases de données des mutations Bases de données des mutations CFMDB CFTR2 CFTR-France / Registre Corinne THEZE, Corinne BAREIL Laboratoire de génétique moléculaire Montpellier Atelier Muco, Lille, 25-27 septembre 2014 Accès libre http://www.genet.sickkids.on.ca/app

Plus en détail

Conception assistée par ordinateur de molécules thérapeutiques

Conception assistée par ordinateur de molécules thérapeutiques Conception assistée par ordinateur de molécules thérapeutiques D. Gilis Bioinformatique génomique et structurale Faculté des sciences appliquées Université Libre de Bruxelles Objectif: illustrer en quoi

Plus en détail

1 Introduction à l infrastructure Active Directory et réseau

1 Introduction à l infrastructure Active Directory et réseau 1 Introduction à l infrastructure Active Directory et réseau Objectifs d examen de ce chapitre Ce premier chapitre, qui donne un aperçu des technologies impliquées par la conception d une infrastructure

Plus en détail

Mercredi 15 Janvier 2014

Mercredi 15 Janvier 2014 De la conception au site web Mercredi 15 Janvier 2014 Loïc THOMAS Géo-Hyd Responsable Informatique & Ingénierie des Systèmes d'information loic.thomas@anteagroup.com 02 38 64 26 41 Architecture Il est

Plus en détail

Titre. Mots clés Source. Date de publication Février 2001 Nombre de pages 39 Langue Liens avec autres normes

Titre. Mots clés Source. Date de publication Février 2001 Nombre de pages 39 Langue Liens avec autres normes Statut du document Titre Mots clés Source Date de publication Février 2001 Nombre de pages 39 Langue Liens avec autres normes Situation courante Final Draft electronic business XML (ebxml) Technical Architecture

Plus en détail

CATALOGUE DES PRESTATIONS DE LA

CATALOGUE DES PRESTATIONS DE LA 1/23 La plate-forme Biopuces et Séquençage de Strasbourg est équipée des technologies Affymetrix et Agilent pour l étude du transcriptome et du génome sur puces à ADN. SOMMAIRE ANALYSE TRANSCRIPTIONNELLE...

Plus en détail

Les nouvelles architectures des SI : Etat de l Art

Les nouvelles architectures des SI : Etat de l Art Les nouvelles architectures des SI : Etat de l Art Objectif Mesurer concrètement les apports des nouvelles applications SI. Être capable d'évaluer l'accroissement de la complexité des applications. Prendre

Plus en détail

APPROCHE DE L ECONOMIE PAR LA PRODUCTION

APPROCHE DE L ECONOMIE PAR LA PRODUCTION APPROCHE DE L ECONOMIE PAR LA PRODUCTION Totalité des produits = Totalité des Revenus = Totalité des Dépenses DEPENSE Achats de biens et services Revenus primaires REVENU PRODUCTION redistribution des

Plus en détail

Présentation GRC/CRM. La relation client personnalisée

Présentation GRC/CRM. La relation client personnalisée Présentation GRC/CRM La relation client personnalisée L informatique en toute simplicité Les apports d une GRC/CRM collaborative Les sociétés : ont un intérêt majeur à améliorer leur efficacité commerciale.

Plus en détail

Chapitre 5 : La transcription. Professeur Joël LUNARDI

Chapitre 5 : La transcription. Professeur Joël LUNARDI Chapitre 5 : La transcription UE1 : Biochimie Biologie moléculaire Professeur Joël LUNARDI Année universitaire 2011/2012 Université Joseph Fourier de Grenoble - Tous droits réservés. Chapitre 5. La transcription

Plus en détail

SFR. Mise en place de la gestion des exigences sous DOORS dans le cadre de la refonte du système d'information commercial 14/11/2007

SFR. Mise en place de la gestion des exigences sous DOORS dans le cadre de la refonte du système d'information commercial 14/11/2007 SFR Mise en place de la gestion des exigences sous DOORS dans le cadre de la refonte du système d'information commercial 14/11/2007 1 Sommaire 1- Le contexte et l historique de la Gestion des EXigences

Plus en détail

Moteurs de recommandations & pertinence de la conversation. Hervé Mignot herve.mignot@equancy.com 24 Mai 2011

Moteurs de recommandations & pertinence de la conversation. Hervé Mignot herve.mignot@equancy.com 24 Mai 2011 Moteurs de recommandations & pertinence de la conversation Hervé Mignot herve.mignot@equancy.com 24 Mai 2011 Equancy en quelques mots Un cabinet de conseil spécialisé en marketing et communication. Une

Plus en détail

10. Base de données et Web. OlivierCuré [ocure@univ-mlv.fr]

10. Base de données et Web. OlivierCuré [ocure@univ-mlv.fr] 10. Base de données et Web 313 Evolution de l'information Ordre de grandeur : 314 1Mo : 1 gros roman 200Mo : ce que mémorise un être humain dans sa vie. 900Mo : information contenue dans le génome d'une

Plus en détail

Le service de ToIP sur le réseau régional SYRHANO

Le service de ToIP sur le réseau régional SYRHANO AST-MG-v2 Le service de ToIP sur le réseau régional SYRHANO JTR 2010 - ToIP - Lyon CRIHAN - Alain Bidaud / Julien Bourdon Le service de ToIP sur SYRHANO Agenda SYRHANO : contexte régional Présentation

Plus en détail

M1 BE, BV, BBSG 17 Décembre 2007

M1 BE, BV, BBSG 17 Décembre 2007 M1 BE, BV, BBSG 17 Décembre 2007 BIOLOGIE MOLECULAIRE EUCARYOTE (Sans document ni calculette ; durée 2h) Librement inspiré de Wang et al. CELL, 105, 851 862, 2001 et Cao et al. MOL CEL BIOL, 25, 364 376,

Plus en détail

E.I.A CARDIO : BIOLOGIE

E.I.A CARDIO : BIOLOGIE E.I.A CARDIO : BIOLOGIE A SAVOIR ABSOLUMENT( ou pas ) - La formule de Friedewald et ses conditions d application - Les différentes classes de dyslipidémie - Les différents facteurs de risques cardiovasculaires

Plus en détail

Fusion : l interopérabilité chez Oracle

Fusion : l interopérabilité chez Oracle Standardisation et interopérabilité Fusion : l interopérabilité chez Oracle Lionel Dubreuil,, Applications Technology Product Manager, Oracle France, lionel.dubreuil@oracle.com 29/03/2006 Page : 1 Oracle

Plus en détail

ALCATEL ICT SERVICES. Olivier Vallet. All rights reserved 2005, Alcatel

ALCATEL ICT SERVICES. Olivier Vallet. All rights reserved 2005, Alcatel ALCATEL ICT SERVICES Olivier Vallet Alcatel et le Sourcing IT Page 2 1. Alcatel en 2005 2. Un peu d Histoire: 2001 2006 3. La contribution de la Stratégie de Sourcing à la rationalisation IT 4. La Stratégie

Plus en détail

energy BOX WEB Automates de GTB

energy BOX WEB Automates de GTB energy BOX WEB Automates de GTB Un Energy BOX WEB est un automate complet de GTB intégrant un serveur WEB en supervision. Cet automate a été conçu pour offrir à nos clients une solution simple et compacte

Plus en détail

Introduc)on à Ensembl/ Biomart : Par)e pra)que

Introduc)on à Ensembl/ Biomart : Par)e pra)que Introduc)on à Ensembl/ Biomart : Par)e pra)que Stéphanie Le Gras Jean Muller NAVIGUER DANS ENSEMBL : PARTIE PRATIQUE 2 Naviga)on dans Ensembl : Pra)que Exercice 1 1.a. Quelle est la version de l assemblage

Plus en détail

XBRL, Solvabilité II et l Autorité de Contrôle Prudentiel

XBRL, Solvabilité II et l Autorité de Contrôle Prudentiel XBRL, Solvabilité II et l Autorité de Contrôle Prudentiel Conférence XBRL France - XBRL Europe Mardi 23 octobre 2012 Jean-Luc MENDA, Directeur Adjoint Responsable du Système d information Autorité de contrôle

Plus en détail

IGEL : Le «cloud sourcing», un nouveau marché pour les clients légers

IGEL : Le «cloud sourcing», un nouveau marché pour les clients légers Communiqué de presse IGEL : Le «cloud sourcing», un nouveau marché pour les clients légers IGEL considère que le cloud computing est l élément central d une nouvelle vague d externalisation dont les petites

Plus en détail

Dr E. CHEVRET UE2.1 2013-2014. Aperçu général sur l architecture et les fonctions cellulaires

Dr E. CHEVRET UE2.1 2013-2014. Aperçu général sur l architecture et les fonctions cellulaires Aperçu général sur l architecture et les fonctions cellulaires I. Introduction II. Les microscopes 1. Le microscope optique 2. Le microscope à fluorescence 3. Le microscope confocal 4. Le microscope électronique

Plus en détail

Notions d asservissements et de Régulations

Notions d asservissements et de Régulations I. Introduction I. Notions d asservissements et de Régulations Le professeur de Génie Electrique doit faire passer des notions de régulation à travers ses enseignements. Les notions principales qu'il a

Plus en détail

Les Entrepôts de Données

Les Entrepôts de Données Les Entrepôts de Données Grégory Bonnet Abdel-Illah Mouaddib GREYC Dépt Dépt informatique :: GREYC Dépt Dépt informatique :: Cours Cours SIR SIR Systèmes d information décisionnels Nouvelles générations

Plus en détail

Réduction de la consommation énergétique des datacenter : optimisation du conditionnement d air, influence de. l architecture

Réduction de la consommation énergétique des datacenter : optimisation du conditionnement d air, influence de. l architecture Réduction de la consommation énergétique des datacenter : optimisation du conditionnement d air, influence de Orange Labs l architecture David Nörtershäuser, Recherche & Développement Stéphane Le Masson,

Plus en détail

Système de mesure et d enregistrement ESS III pression et température

Système de mesure et d enregistrement ESS III pression et température Système de mesure et d enregistrement ESS III pression et température CONTROLE Caractéristiques: Système de mesure et d enregistrement pour pression et température des conduites d alimentation des réseaux

Plus en détail

Durée i1 24 h. TD 24 h Semestre 3 Objectifs. Savoir présenter un rapport de travail en anglais et commenter le déroulement d une expérimentation.

Durée i1 24 h. TD 24 h Semestre 3 Objectifs. Savoir présenter un rapport de travail en anglais et commenter le déroulement d une expérimentation. SOM3AG23 scientifique 2 Le semestre 3 et 4 Maquette enseignements Intitulé ECTS Coeff. CM TD TP scientifique 2 3 3 24 Biostatistiques 2 3 3 12 12 Synthèse documentaire et projet stage 2 2 6 Filières professionnelles

Plus en détail

Chapitre 4. Génotype, phénotype et environnement

Chapitre 4. Génotype, phénotype et environnement Chapitre 4 Génotype, phénotype et environnement Comment s établit le phénotype macroscopique? Le phénotype ne se résume pas toujours à la simple expression du génome, les relations entre génotypes et phénotypes

Plus en détail

Comparaison entre la v6 et la v7 de BackupAssist

Comparaison entre la v6 et la v7 de BackupAssist Comparaison entre la v6 et la v7 de BackupAssist Table des matières 1. Les nouveautés de BackupAssist v7... 2 2. Tableau comparatif... 3 3. Systèmes d exploitation et environnements pris en charge Nouveau!...

Plus en détail

Data Mining. Vincent Augusto 2012-2013. École Nationale Supérieure des Mines de Saint-Étienne. Data Mining. V. Augusto.

Data Mining. Vincent Augusto 2012-2013. École Nationale Supérieure des Mines de Saint-Étienne. Data Mining. V. Augusto. des des Data Mining Vincent Augusto École Nationale Supérieure des Mines de Saint-Étienne 2012-2013 1/65 des des 1 2 des des 3 4 Post-traitement 5 représentation : 6 2/65 des des Définition générale Le

Plus en détail

Table des matières 1. Avant-propos. Chapitre 1 Introduction à l'alm pour Visual Studio 2010

Table des matières 1. Avant-propos. Chapitre 1 Introduction à l'alm pour Visual Studio 2010 Table des matières 1 Avant-propos Chapitre 1 Introduction à l'alm pour Visual Studio 2010 1. Introduction....15 2. Microsoft et l ALM....15 2.1 Introduction à l ALM...15 2.2 Offre et outils...18 3. La

Plus en détail

Les Enjeux du Smart Water. Eau. Novembre 2013 Fabrice Renault Directeur commercial France. Schneider Electric Fabrice Renault 1

Les Enjeux du Smart Water. Eau. Novembre 2013 Fabrice Renault Directeur commercial France. Schneider Electric Fabrice Renault 1 Les Enjeux du Smart Water Eau Novembre 2013 Fabrice Renault Directeur commercial France Schneider Electric Fabrice Renault 1 Plus les villes grandissent, plus leurs défis augmentent Vieillissement et saturation

Plus en détail

TRANSFOLIO. Système billettique de gestion centralisée. www.parkeon.com. Personnalisation avancée. Hautes performances

TRANSFOLIO. Système billettique de gestion centralisée. www.parkeon.com. Personnalisation avancée. Hautes performances TRANSFOLIO Système billettique de gestion centralisée Personnalisation avancée Hautes performances Multimodalité, Interopérabilité, multi-opérateurs Interface Web, simple et ergonomique www.parkeon.com

Plus en détail

1 - Diag26000. Le réseau de partenaires. La formation partenaires. Diag26000. FORMITEL. Stratégie méthode - outils

1 - Diag26000. Le réseau de partenaires. La formation partenaires. Diag26000. FORMITEL. Stratégie méthode - outils 1-1 2 3 Le réseau de partenaires La formation partenaires co-construit par des experts Issu d'un groupe de travail Centrale Ethique, Diag2600 permet de réaliser un diagnostic RSE basé sur les 7 questions

Plus en détail

Aujourd hui, les entreprises

Aujourd hui, les entreprises COÛT TOTAL DE POSSESSION DE PANDA CLOUD OFFICE PROTECTION Page 2 I. Synthèse Aujourd hui, les entreprises dépendent fortement de leur système d information pour mener leur activité au quotidien et, par

Plus en détail

Les Data Management Platforms (DMP)

Les Data Management Platforms (DMP) (DMP) Un outil marketing précieux pour les annonceurs Par Vihan Sharma, European Data Products Director Acxiom France Better Connections. Better Results. Parole d expert Acxiom Les Data Management Platforms

Plus en détail

CODIFICATION. NOTA : Dans le cas d'un vérin avec fixation sur corps par tourillon intermédiaire MT4 indiquer RQ ou RW= (en mm)

CODIFICATION. NOTA : Dans le cas d'un vérin avec fixation sur corps par tourillon intermédiaire MT4 indiquer RQ ou RW= (en mm) HRB HFB 1 CODIFICATION ALESAGE mm 32 40 50 63 80 100 125 160 TIGE mm 16 22 22 28 28 36 36 45 45 56 56 70 70 90 90 110 SERIE HR CNOMO 160 bar - à tirants HF CNOMO 160 bar - à contre brides INDICE B Indice

Plus en détail

ALCATEL EYE-BOX LA RÉPONSE AUX BESOINS ESSENTIELS DE COMMUNICATION DES TPE/PME

ALCATEL EYE-BOX LA RÉPONSE AUX BESOINS ESSENTIELS DE COMMUNICATION DES TPE/PME ALCATEL EYE-BOX LA RÉPONSE AUX BESOINS ESSENTIELS DE COMMUNICATION DES TPE/PME L OFFRE ALCATEL EYE-BOX La réponse aux besoins essentiels de communication des TPE/PME Une solution de communication, de collaboration

Plus en détail

Comment reproduire les résultats de l article : POP-Java : Parallélisme et distribution orienté objet

Comment reproduire les résultats de l article : POP-Java : Parallélisme et distribution orienté objet Comment reproduire les résultats de l article : POP-Java : Parallélisme et distribution orienté objet Beat Wolf 1, Pierre Kuonen 1, Thomas Dandekar 2 1 icosys, Haute École Spécialisée de Suisse occidentale,

Plus en détail

Rôle des acides biliaires dans la régulation de l homéostasie du glucose : implication de FXR dans la cellule bêta-pancréatique

Rôle des acides biliaires dans la régulation de l homéostasie du glucose : implication de FXR dans la cellule bêta-pancréatique Rôle des acides biliaires dans la régulation de l homéostasie du glucose : implication de FXR dans la cellule bêta-pancréatique Tuteur : Anne Muhr-Tailleux cardiovasculaires et diabète (Equipe 1) Institut

Plus en détail

Recherche sémantique d information textuelle

Recherche sémantique d information textuelle Unité Mathématique, Informatique et Génome T e c h n i q u e s d ' e x p l o i t a t i o n d e s d o c u m e n t s m u l t i m é d i a s Recherche sémantique d information textuelle Claire Nédellec, Pascale

Plus en détail

Centre Universitaire LA CITADELLE 220, avenue de l Université B.P 5526 59379 DUNKERQUE CEDEX 1 GUIDE DES ETUDES LICENCE PROFESSIONNELLE

Centre Universitaire LA CITADELLE 220, avenue de l Université B.P 5526 59379 DUNKERQUE CEDEX 1 GUIDE DES ETUDES LICENCE PROFESSIONNELLE Centre Universitaire LA CITADELLE 220, avenue de l Université B.P 5526 59379 DUNKERQUE CEDEX 1 GUIDE DES ETUDES LICENCE PROFESSIONNELLE Chimie Industrielle (anciennement : Industries chimiques et pharmaceutiques)

Plus en détail

Université Toulouse 3 Paul Sabatier (UT3 Paul Sabatier) Mathilde de TAFFIN de TILQUES. 29 Octobre 2013. tre :

Université Toulouse 3 Paul Sabatier (UT3 Paul Sabatier) Mathilde de TAFFIN de TILQUES. 29 Octobre 2013. tre : Université Toulouse 3 Paul Sabatier (UT3 Paul Sabatier) Mathilde de TAFFIN de TILQUES 29 Octobre 2013 tre : Contrôle transcriptionnel de l'identité musculaire chez la drosophile : Modules Cis-Régulateurs

Plus en détail

Le terme «ERP» provient du nom de la méthode MRP (Manufacturing Ressource Planning) utilisée dans les années 70 pour la gestion et la planification

Le terme «ERP» provient du nom de la méthode MRP (Manufacturing Ressource Planning) utilisée dans les années 70 pour la gestion et la planification Séminaire national Alger 12 Mars 2008 «L Entreprise algérienne face au défi du numérique : État et perspectives» CRM et ERP Impact(s) sur l entreprise en tant qu outils de gestion Historique des ERP Le

Plus en détail

Mise en place d une solution automatique de stockage et de visualisation de données de capture des interactions chromatiniennes à l échelle génomique

Mise en place d une solution automatique de stockage et de visualisation de données de capture des interactions chromatiniennes à l échelle génomique Rapport de stage de deuxième année de DUT Génie Biologique option Bioinformatique Mise en place d une solution automatique de stockage et de visualisation de données de capture des interactions chromatiniennes

Plus en détail

Cognit Ive Cas d utilisation

Cognit Ive Cas d utilisation Cognit Ive Cas d utilisation 96-98, rue de Montreuil - 75011 Paris _ opicot@ _ + 33 (0)1 40 09 71 55 Sommaire Présentation de la plateforme Cognit Ive SemanticMail : Traitement sémantique des mails Projets

Plus en détail

Enterprise Data Quality : fiabilisez vos processus E-Business Suite en améliorant la qualité des données

Enterprise Data Quality : fiabilisez vos processus E-Business Suite en améliorant la qualité des données Enterprise Data Quality : fiabilisez vos processus E-Business Suite en améliorant la qualité des données Sommaire 1 2 3 4 Introduction : enjeux de la qualité de données Enterprise Data Quality : positionnement

Plus en détail

Connaissance Client et Digital : quels enjeux pour quelles valeurs? Non à la personnalisation bidon! Vente Privée Orange Gan Assurances

Connaissance Client et Digital : quels enjeux pour quelles valeurs? Non à la personnalisation bidon! Vente Privée Orange Gan Assurances Connaissance Client et Digital : quels enjeux pour quelles valeurs? Non à la personnalisation bidon! WIDE COFFEE Vente Privée Orange Gan Assurances 1 Serge Hauser Nathalie Patrat Chrystel Galissié A G

Plus en détail

EP 1 764 748 A1 (19) (11) EP 1 764 748 A1 (12) DEMANDE DE BREVET EUROPEEN. (43) Date de publication: 21.03.2007 Bulletin 2007/12

EP 1 764 748 A1 (19) (11) EP 1 764 748 A1 (12) DEMANDE DE BREVET EUROPEEN. (43) Date de publication: 21.03.2007 Bulletin 2007/12 (19) (12) DEMANDE DE BREVET EUROPEEN (11) EP 1 764 748 A1 (43) Date de publication: 21.03.2007 Bulletin 2007/12 (51) Int Cl.: G07B 17/00 (2006.01) (21) Numéro de dépôt: 06119629.1 (22) Date de dépôt: 28.08.2006

Plus en détail

Notice biographique Repères biographiques communs

Notice biographique Repères biographiques communs Notice biographique Repères biographiques communs Nom : GOURBAL Prénom : BENJAMIN Section : 67 Corps : Maître de conférences Equipe de recherche Grade : CN Ecologie et Evolution des Interactions UMR 5244

Plus en détail

Licence Professionnelle en Statistique et Informatique Décisionnelle (S.I.D.)

Licence Professionnelle en Statistique et Informatique Décisionnelle (S.I.D.) Université de Lille 2 - Droit et Santé Ecole Supérieure des Affaires & Institut Universitaire de Technologie (IUT-C) Département Statistique et Traitement Informatique des Données Licence Professionnelle

Plus en détail

AGRO EDI EUROPE. La normalisation. Vendredi 5 Novembre 2010

AGRO EDI EUROPE. La normalisation. Vendredi 5 Novembre 2010 AGRO EDI EUROPE La normalisation Vendredi 5 Novembre 2010 Plan AGRO EDI EUROPE : présentation et expériences La normalisation UN/CEFACT ASSOCIATION 1901, CRÉÉE EN 1992 Harmonisation des Échanges de Données

Plus en détail

GénoToul 2010, Hôtel de Région Midi Pyrénées, Toulouse, 10 décembre 2010

GénoToul 2010, Hôtel de Région Midi Pyrénées, Toulouse, 10 décembre 2010 GénoToul 2010, Hôtel de Région Midi Pyrénées, Toulouse, 10 décembre 2010 Analyse de la diversité moléculaire des régions génomiques de 30 gènes du développement méristématique dans une core collection

Plus en détail

Une interface graphique de modélisation basée sur le formalisme de Forrester

Une interface graphique de modélisation basée sur le formalisme de Forrester Une interface graphique de modélisation basée sur le formalisme de Forrester un plugin de modélisation GVLE Patrick Chabrier INRA (Institut National de la Recherche Agronomique) (INRA) Stage Forrester

Plus en détail

Mise en œuvre de l architecture SINP. Forum ATEN des TIC 4 juin 2014. Y. Lebeau MEDDE/DGALN/DEB/PEM4

Mise en œuvre de l architecture SINP. Forum ATEN des TIC 4 juin 2014. Y. Lebeau MEDDE/DGALN/DEB/PEM4 Mise en œuvre de l architecture SINP Forum ATEN des TIC 4 juin 2014 Y. Lebeau MEDDE/DGALN/DEB/PEM4 1 Principes d architecture retenus Diffusion de l information pour tous Accès simple à l information,

Plus en détail

ELOECM Conference2015

ELOECM Conference2015 ELOECM Conference2015 Dématérialisation de courriers ELO DocXtractor Florent Melchers Consultant Projet et Avant-vente f.melchers@elo-digital.fr Intérêt d une solution de dématérialisation Nos clients

Plus en détail

IMMUNOLOGIE. La spécificité des immunoglobulines et des récepteurs T. Informations scientifiques

IMMUNOLOGIE. La spécificité des immunoglobulines et des récepteurs T. Informations scientifiques IMMUNOLOGIE La spécificité des immunoglobulines et des récepteurs T Informations scientifiques L infection par le VIH entraîne des réactions immunitaires de l organisme qui se traduisent par la production

Plus en détail

Définition, typologie et méthodologie d évaluation des avantages immatériels dans le cadre du service universel postal

Définition, typologie et méthodologie d évaluation des avantages immatériels dans le cadre du service universel postal Mai 2010 Définition, typologie et méthodologie d évaluation des avantages immatériels dans le cadre du service universel postal Synthèse des principaux résultats de l étude confiée au cabinet WIK-Consult

Plus en détail

Utilisation d informations visuelles dynamiques en asservissement visuel Armel Crétual IRISA, projet TEMIS puis VISTA L asservissement visuel géométrique Principe : Réalisation d une tâche robotique par

Plus en détail

IV Forum des Assurances d Alger 28/29 novembre 2005 HOTEL EL-AURASSI - ALGER. Tarification en situation d insuffisance de données :

IV Forum des Assurances d Alger 28/29 novembre 2005 HOTEL EL-AURASSI - ALGER. Tarification en situation d insuffisance de données : IV Forum des Assurances d Alger 28/29 novembre 2005 HOTEL EL-AURASSI - ALGER Tarification en situation d insuffisance de données : Approche du risque CAT-NAT par la méthode des scores Par Mounir GHERNOUTI,

Plus en détail

Le Cloud ou l informatique d entreprise à la carte. Copyright Olivier PAVIE ValorConseil PACA Novembre 2013

Le Cloud ou l informatique d entreprise à la carte. Copyright Olivier PAVIE ValorConseil PACA Novembre 2013 Le Cloud ou l informatique d entreprise à la carte Copyright Olivier PAVIE ValorConseil PACA Novembre 2013 Qu est-ce que ValorConseil? Qui est Olivier Pavie? Pourquoi passer au Cloud? Le Cloud c est quoi?

Plus en détail

Sélection d un moteur de recherche pour intranet : Les sept points à prendre en compte

Sélection d un moteur de recherche pour intranet : Les sept points à prendre en compte Sélection d un moteur de recherche pour intranet : Les sept points à prendre en compte 1Les bases : vos objectifs 2 Sélection d un moteur de recherche pour intranet : Les sept points à prendre en compte

Plus en détail

Introduction au Data-Mining

Introduction au Data-Mining Introduction au Data-Mining Alain Rakotomamonjy - Gilles Gasso. INSA Rouen -Département ASI Laboratoire PSI Introduction au Data-Mining p. 1/25 Data-Mining : Kèkecé? Traduction : Fouille de données. Terme

Plus en détail