Les bases de données transcriptionnelles en ligne

Dimension: px
Commencer à balayer dès la page:

Download "Les bases de données transcriptionnelles en ligne"

Transcription

1 Les bases de données transcriptionnelles en ligne

2 Différents concepts en régulation transcriptionnelle sites de fixation - in vitro/vivo? - quelle technique? - degré de confiance? facteur de transcription TTGATGTCTCC AGTAATGCGACCATTAC ACCCATTTGGCTTCCCATTTCGA TATCAATTAG ACCCAATTAGTAATAAAT - structure? - classe? - orthologues? matrice - fréq. / poids-position? - type de correction? A C G T gène(s) cible(s) module cis-régulateur - taille/position génomique? TF présents? technique expérimentale utilisée? gène cible?

3 Différents concepts en régulation transcriptionnelle sites de fixation - in vitro/vivo? - quelle technique? - degré de confiance? facteur de transcription TTGATGTCTCC AGTAATGCGACCATTAC ACCCATTTGGCTTCCCATTTCGA TATCAATTAG ACCCAATTAGTAATAAAT - structure? - classe? - orthologues? matrice - fréq. / poids-position? - type de correction? A C G T gène(s) cible(s) module cis-régulateur - taille/position génomique? TF présents? technique expérimentale utilisée? gène cible?

4 Différents concepts en régulation transcriptionnelle sites de fixation - in vitro/vivo? - quelle technique? - degré de confiance? facteur de transcription TTGATGTCTCC AGTAATGCGACCATTAC ACCCATTTGGCTTCCCATTTCGA TATCAATTAG ACCCAATTAGTAATAAAT - structure? - classe? - orthologues? matrice - fréq. / poids-position? - type de correction? A C G T gène(s) cible(s) module cis-régulateur - taille/position génomique? TF présents? technique expérimentale utilisée? gène cible?

5 Différents concepts en régulation transcriptionnelle sites de fixation - in vitro/vivo? - quelle technique? - degré de confiance? facteur de transcription TTGATGTCTCC AGTAATGCGACCATTAC ACCCATTTGGCTTCCCATTTCGA TATCAATTAG ACCCAATTAGTAATAAAT - structure? - classe? - orthologues? matrice - fréq. / poids-position? - type de correction? A C G T gène(s) cible(s) module cis-régulateur - taille/position génomique? TF présents? technique expérimentale utilisée? gène cible?

6 Quelques bases de données

7 base de donnée commerciale (licence payante publique gratuite ) + version

8 Qualité des sites Transfac Scores de qualité 1 : Functionally confirmed factor binding site 2: Binding of pure protein (purified or recombinant) 3: Immunologically characterized binding activity of a cellular extract 4: Binding activity characterized via a known binding sequence 5: Binding of uncharacterized extract protein to a bone fide element 6: No quality assigned

9 Recherche E2F dans Transfac publique classification interacteurs matrices

10 Recherche E2F dans Transfac publique sites de fixation références

11 3 Matrices E2F Transfac quelles différences?

12 [Sandelin A, Alkema W, Engstrom P, Wasserman WW, Lenhard B.] alternative open-source à Transfac taille plus réduite: 459 matrices (oct. 2009) Répartition taxonomique des matrices Origine des données JASPAR in vitro in vivo g fun v i eb e rt es ra t in ts sec es nts te s d a a l o t d p r ma ho c ne o ur 0 PB M I q A D ip E X al 1H A se L -se PILE MS ip-ch p E i i E r N S D M Ch cte Ch CO ba essentiellement des données in-vitro, donc pas de gène cible!

13 Différents concepts en régulation transcriptionnelle sites de fixation - in vitro/vivo? - quelle technique? - degré de confiance? facteur de transcription TTGATGTCTCC AGTAATGCGACCATTAC ACCCATTTGGCTTCCCATTTCGA TATCAATTAG ACCCAATTAGTAATAAAT - structure? - classe? - orthologues? matrice - fréq. / poids-position? - type de correction? A C G T gène(s) cible(s) module cis-régulateur - taille/position génomique? TF présents? technique expérimentale utilisée? gène cible?

14 E2F dans Jaspar

15 But: standardiser et centraliser les informations sur la régulation transcriptionnelle inclut certaines bases de données mise en place d'une architecture unifiée: tout le monde peut mettre ses données dans PAZAR et les rendre publiques ou non... open-access et open-source (TRANSFAC n'en fait pas partie) standards GFF (localisation génomique) et XML

16 aucun gène cible aucun facteur de transcription spécifique d'un gène cible ("gene centric") spécifique d'un FT ("TF centric")

17 E2F dans PAZAR

18 Navigateur UCSC target gene

19 [ Griffith OL et al.] Idée: aller chercher les informations dans la littérature scientifique Comment? en mettant à contribution la communauté scientifique Oreganno met à disposition des curateurs un corpus d'articles scientifiques soumis par des experts identifiés par des approches de text-mining automatiques (recherche de mots typiques comme "transcription factor", "binding site",...)

20 Oreganno inclut également des données provenant d'autres projets à grande échelle

21 E2F dans Oreganno site de fixation polymorphisme

22 Différents concepts en régulation transcriptionnelle sites de fixation - in vitro/vivo? - quelle technique? - degré de confiance? facteur de transcription TTGATGTCTCC AGTAATGCGACCATTAC ACCCATTTGGCTTCCCATTTCGA TATCAATTAG ACCCAATTAGTAATAAAT - structure? - classe? - orthologues? matrice - fréq. / poids-position? - type de correction? A C G T gène(s) cible(s) module cis-régulateur - taille/position génomique? TF présents? technique expérimentale utilisée? gène cible?

23 [Gallo, S. M., Li, L., Hu, Z. and Halfon, M. S] base de données de modules cis-régulateurs et de TFBS chez la drosophile CRM sans TFBS CRM avec TFBS

24 Take home messages nombreuses bases de données, contenant différents types d'information information généralement parcellaire: TF mais pas de gène cible, CRM sans TF, etc... les matrices des différentes bases de données sont souvent différentes: impact de cette différence? attention à l'origine des données: in-vivo, in-vitro, in-silico

(quelques) méthodes pour l'identification de modules cis-régulateurs (CRM) Carl Herrmann TAGC & Aix-Marseille Université carl.herrmann@univ amu.

(quelques) méthodes pour l'identification de modules cis-régulateurs (CRM) Carl Herrmann TAGC & Aix-Marseille Université carl.herrmann@univ amu. (quelques) méthodes pour l'identification de modules cis-régulateurs (CRM) Carl Herrmann TAGC & Aix-Marseille Université carl.herrmann@univ amu.fr -1Carl Herrmann - M2 "analyse de réseaux biologiques"

Plus en détail

Introduction à l analyse statistique et bioinformatique des puces à ADN

Introduction à l analyse statistique et bioinformatique des puces à ADN Formation INSERM 10 février 2004 Introduction à l analyse statistique et bioinformatique des puces à ADN Gaëlle Lelandais lelandais@biologie.ens.fr 1 Première Partie Analyse d une puce à ADN : Le recherche

Plus en détail

SOMMAIRE. L inventaire des données. Danièle BOUCON. Objectifs. Description. Modèle d inventaire et outils. Méthodologie. Conclusion.

SOMMAIRE. L inventaire des données. Danièle BOUCON. Objectifs. Description. Modèle d inventaire et outils. Méthodologie. Conclusion. Les outils CNES L inventaire des données Danièle BOUCON Réunion PIN du 22 mars 202 Réunion PIN du 22 mars 202 Outils CNES Objectifs SOMMAIRE Description Modèle d inventaire et outils Méthodologie Conclusion

Plus en détail

LA TRANSCRIPTION. Introduction. I. Modalité générale de la transcription. II. Transcription chez les Procaryotes

LA TRANSCRIPTION. Introduction. I. Modalité générale de la transcription. II. Transcription chez les Procaryotes LA TRANSCRIPTION Introduction I. Modalité générale de la transcription II. Transcription chez les Procaryotes 1. L'ARN polymérase 2. Etapes de la transcription a. Initiation b. Elongation c. Terminaison

Plus en détail

Elodie Darbo. To cite this version: HAL Id: tel-00644865 https://tel.archives-ouvertes.fr/tel-00644865v1

Elodie Darbo. To cite this version: HAL Id: tel-00644865 https://tel.archives-ouvertes.fr/tel-00644865v1 Découverte d éléments cis-régulateurs impliqués dans l activation transcriptionnelle du génome zygotique dans l embryon précoce de Drosophila melanogaster Elodie Darbo To cite this version: Elodie Darbo.

Plus en détail

Plateforme de Recherche de Mutations

Plateforme de Recherche de Mutations Plateforme de Recherche de Mutations Jean-Marc Aury contact: pfm@genoscope.cns.fr 29 janvier 2009 Introduction Présentation des données produites par le GSFLX : type, qualité, Méthodes de détection de

Plus en détail

Université de Montréal. Développement d outils pour l analyse de données de ChIP-seq et l identification des facteurs de transcription

Université de Montréal. Développement d outils pour l analyse de données de ChIP-seq et l identification des facteurs de transcription Université de Montréal Développement d outils pour l analyse de données de ChIP-seq et l identification des facteurs de transcription par Eloi Mercier Département de bioinformatique Faculté de médecine

Plus en détail

Etude transcriptomique de la dégradation des parois lignocellulosiques de son et paille de blé durant la croissance de Thermobacillus xylanilyticus

Etude transcriptomique de la dégradation des parois lignocellulosiques de son et paille de blé durant la croissance de Thermobacillus xylanilyticus Journées SFR condorcet Compiègne 8-9 juillet 2015 Projet Hydroseq : UMR FARE-CRRBM Etude transcriptomique de la dégradation des parois lignocellulosiques de son et paille de blé durant la croissance de

Plus en détail

Régulation GAL4 chez S. cerevisiae. Annie Sainsard-Chanet

Régulation GAL4 chez S. cerevisiae. Annie Sainsard-Chanet Régulation GAL4 chez S. cerevisiae Annie Sainsard-Chanet Contrôle de l expression génique Mécanismes qui régulent, augmentent ou diminuent l expression d un gène donné suivant le milieu, le tissu, le stade

Plus en détail

TD1 : Epissage alternatif

TD1 : Epissage alternatif TD1 : Epissage alternatif Le gène de la tropomyosine α de xénope possède trois exons 3' terminaux, appelés exon 9A9', 9B et 9D, dont la sélection différentielle en fonction du contexte tissulaire produit

Plus en détail

Sommaire. Première partie Les concepts de base

Sommaire. Première partie Les concepts de base Sommaire Préface à la troisième édition... Préface à la deuxième édition... Avant-propos à la troisième édition... Avant-propos à la deuxième édition... Avant-propos à la première édition... XV XVII XIX

Plus en détail

MODE D'EMPLOI. La gestion des versions permettra de compléter et de faire évoluer les fiches dans le temps. NOM DE LA RESSOURCE CONTACT FOURNISSEUR

MODE D'EMPLOI. La gestion des versions permettra de compléter et de faire évoluer les fiches dans le temps. NOM DE LA RESSOURCE CONTACT FOURNISSEUR MODE D'EMPLOI Fiche réalisée le Version Rédacteur La gestion des versions permettra de compléter et de faire évoluer les fiches dans le temps. NOM DE LA RESSOURCE Nom, prénom CONTACT FOURNISSEUR Mail Téléphone

Plus en détail

Plateforme Transcriptome Végétale

Plateforme Transcriptome Végétale Plateforme Transcriptome Végétale INRA- Unité de Recherche en Génomique Végétale Journée «Plateformes Génopole», 25 juin 2013. Sandrine Balzergue, balzerg@evry.inra.fr Analyse quan8ta8ve de l expression

Plus en détail

Comment mesurer la couverture d une ressource terminologique pour un corpus?

Comment mesurer la couverture d une ressource terminologique pour un corpus? Comment mesurer la couverture d une ressource terminologique pour un corpus? Goritsa Ninova, Adeline Nazarenko, Thierry Hamon, Sylvie Szulman LIPN UMR 7030 CNRS Université Paris-Nord 99 av. J.-B. Clément,

Plus en détail

Cours d introduction à la génétique de la souris Notion de Souche

Cours d introduction à la génétique de la souris Notion de Souche Cours d introduction à la génétique de la souris Notion de Souche Introduction: - Réponse d un animal à l expérimentation (diapo 1) Facteurs environnementaux et propres à l animal - Notion d animal standardisé

Plus en détail

Approches bioinformatiques de la cis-régulation

Approches bioinformatiques de la cis-régulation 2 Plan Approches bioinformatiques de la cis-régulation Stratégies de découvertes de motifs nucléiques Carl Herrmann TAGC & Univ. Méditerranée - Marseille Rappels sur les mécanismes de régulation transcriptionnelle

Plus en détail

OUTILS DE FINANCEMENT DE L INNOVATION TECHNOLOGIQUE ET DE LA VALORISATION DE LA RECHERCHE

OUTILS DE FINANCEMENT DE L INNOVATION TECHNOLOGIQUE ET DE LA VALORISATION DE LA RECHERCHE OUTILS DE FINANCEMENT DE L INNOVATION TECHNOLOGIQUE ET DE LA VALORISATION DE LA RECHERCHE Un exemple de Projet PNRI Pr. Ahmed Noureddine HELAL 11 Mars 2015, Hôtel Monastir Center, Monastir Notre Projet

Plus en détail

I. TOUITOU (Mise ligne 15/10/08 LIPCOM-RM) Faculté de Médecine Montpellier-Nîmes

I. TOUITOU (Mise ligne 15/10/08 LIPCOM-RM) Faculté de Médecine Montpellier-Nîmes er cycle PCEM MI5 Génétique moléculaire et clinique Année Universitaire 008-009 Comment apprécier la composante héréditaire des maladies?. Excès de cas familiaux - Les études familiales - - La plupart

Plus en détail

Recherche des transcrits de fusion AML1/ETO et CBFB-MYH11 dans les LAM de l`adulte.

Recherche des transcrits de fusion AML1/ETO et CBFB-MYH11 dans les LAM de l`adulte. Recherche des transcrits de fusion AML1/ETO et CBFB-MYH11 dans les LAM de l`adulte. F.Harieche, W.Assouak, A.Trabzi, M.Saidi, F.Zerhouni, R.M.Hamladji. LAM Entité distincte Leucémies aigues. Transformation

Plus en détail

Cours No 8 - Entrepôt de données XML

Cours No 8 - Entrepôt de données XML B. Amann - Cours No 8 - Entrepôt de données XML 1 Slide 1 Cours No 8 - Entrepôt de données XML Système d information et Web Le Web Slide 2 applications ad hoc recherche manuelle navigation mises à jour

Plus en détail

La PCR en temps réel frederic.gevaudant@bordeaux.inra.fr

La PCR en temps réel frederic.gevaudant@bordeaux.inra.fr La PCR en temps réel frederic.gevaudant@bordeaux.inra.fr INRA Centre de recherche de Bordeaux UMR Biologie du Fruit et Pathologie Historique 1985 : Invention par Kary Mullis de la technique de (PCR). 1991

Plus en détail

Lier un site de liaison d'un facteur de transcription et son gène cible

Lier un site de liaison d'un facteur de transcription et son gène cible Berder 2013 : Corrélation, causalité et régulation en biologie Lier un site de liaison d'un facteur de transcription et son gène cible Laurent M. SACHS (sachs@mnhn.fr) Laboratoire Evolution des Régulations

Plus en détail

AnaEE-France : SI et sémantique

AnaEE-France : SI et sémantique AnaEE-France : SI et sémantique Open Science INRA - Séminaire des 17 19 décembre 2014 St Martin-de-Londres C. Pichot, D. Maurice, H. Raynal et collectif Une infrastructure nationale dédiée à l'étude des

Plus en détail

Introduction aux bases de données: application en biologie

Introduction aux bases de données: application en biologie Introduction aux bases de données: application en biologie D. Puthier 1 1 ERM206/Technologies Avancées pour le Génome et la Clinique, http://tagc.univ-mrs.fr/staff/puthier, puthier@tagc.univ-mrs.fr ESIL,

Plus en détail

Institut de Génomique. olaso@cng.fr

Institut de Génomique. olaso@cng.fr Institut de Génomique PCR quantitative : état des lieux... (de la théorie à la pratique, MIQE, CQ et stratégie de normalisation) olaso@cng.fr Microarray data qpcr data? Règles générales pour la présentation

Plus en détail

Corrigé du TD1. Exercice 1:

Corrigé du TD1. Exercice 1: Corrigé du TD1 Exercice 1: le but était d'aligner des séquences à la main et de compter les substitutions entre acides aminés observées. Le résultat se trouve à cette adresse: http://tagc.univ-mrs.fr/herrmann/bio6/displaymatrix.php

Plus en détail

Chapitre 10 L isolement et la manipulation de gènes. Injection d ADN étranger dans une cellule animale

Chapitre 10 L isolement et la manipulation de gènes. Injection d ADN étranger dans une cellule animale Chapitre 10 L isolement et la manipulation de gènes Injection d ADN étranger dans une cellule animale Comment amplifier un gène d intérêt? Amplification in vivo à l aide du clonage d ADN L ensemble formé

Plus en détail

IV Forum des Assurances d Alger 28/29 novembre 2005 HOTEL EL-AURASSI - ALGER. Tarification en situation d insuffisance de données :

IV Forum des Assurances d Alger 28/29 novembre 2005 HOTEL EL-AURASSI - ALGER. Tarification en situation d insuffisance de données : IV Forum des Assurances d Alger 28/29 novembre 2005 HOTEL EL-AURASSI - ALGER Tarification en situation d insuffisance de données : Approche du risque CAT-NAT par la méthode des scores Par Mounir GHERNOUTI,

Plus en détail

Quelques notions de génomique fonctionnelle: l exemple des puces à ADN

Quelques notions de génomique fonctionnelle: l exemple des puces à ADN Quelques notions de génomique fonctionnelle: l exemple des puces à ADN Frédéric Devaux Laboratoire de génétique moléculaire Ecole Normale Supérieure Le «dogme central» de la biologie moléculaire Transcription

Plus en détail

ED Biologie moléculaire. E. Turpin J. Lehmann-Che 5-6 novembre 2007

ED Biologie moléculaire. E. Turpin J. Lehmann-Che 5-6 novembre 2007 ED Biologie moléculaire E. Turpin J. Lehmann-Che 5-6 novembre 2007 PCR 1983: Kary Mullis Amplification in vitro par une méthode enzymatique d'un fragmentd'adn en présence de deux oligonucléotides spécifiques

Plus en détail

Utilisation de la fouille de textes et de l extraction d informations en Génomique et Bioinformatique

Utilisation de la fouille de textes et de l extraction d informations en Génomique et Bioinformatique Mastère BBSG-M2 Marseille 2006-2007 Utilisation de la fouille de textes et de l extraction d informations en Génomique et Bioinformatique Bernard Jacq, IBDML CNRS-U2 Marseille Plan Définitions : data mining,

Plus en détail

Atelier 5/11/2013. Structure de la chromatine et marques épigénétiques

Atelier 5/11/2013. Structure de la chromatine et marques épigénétiques Atelier 5/11/2013 Structure de la chromatine et marques épigénétiques La chromatine ADN ADN + Histones = Nucleosome ADN + Protéines + ARNs = Chromatine Niveau extrême de condensation = Chromosome métaphasique

Plus en détail

WCUM pour l analyse d un site Web

WCUM pour l analyse d un site Web WCUM pour l analyse d un site Web Malika Charrad 1 Yves Lechevallier 2 Gilbert Saporta 3 Mohamed Ben Ahmed 4 1,4 Ecole Nationale des Sciences de l Informatique, Tunis 2 INRIA Rocquencourt, Paris 1,3 Conservatoire

Plus en détail

Cognit Ive Cas d utilisation

Cognit Ive Cas d utilisation Cognit Ive Cas d utilisation 96-98, rue de Montreuil - 75011 Paris _ opicot@ _ + 33 (0)1 40 09 71 55 Sommaire Présentation de la plateforme Cognit Ive SemanticMail : Traitement sémantique des mails Projets

Plus en détail

AP SVT. Exercice 1. Exercice 2. Exercice 3.

AP SVT. Exercice 1. Exercice 2. Exercice 3. Exercice 1. AP SVT On cherche à comprendre le mode de transmission de deux caractères chez la Drosophile, organisme diploïde. Effectuez une analyse génétique pour expliquer les résultats des croisements

Plus en détail

La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST.

La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST. La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST. Gaël Le Mahec - p. 1/12 L algorithme BLAST. Basic Local Alignment Search Tool est un algorithme de recherche

Plus en détail

Apport de l'analyse multiélémentaire associée à une démarche de qualité pour la résolution de problèmes environnementaux

Apport de l'analyse multiélémentaire associée à une démarche de qualité pour la résolution de problèmes environnementaux Apport de l'analyse multiélémentaire associée à une démarche de qualité pour la résolution de problèmes environnementaux R. Losno, Professeur, Université Paris 7 Denis-Diderot, LISA EECA - EUROFINS Alan

Plus en détail

Analyse Chromosomique sur Puce à ADN Applications en Prénatal

Analyse Chromosomique sur Puce à ADN Applications en Prénatal Analyse Chromosomique sur Puce à ADN Applications en Prénatal Véronique Satre, Charles Coutton, Gaëlle Vieville, Françoise Devillard et Florence Amblard Maladies génétiques Anomalies chromosomiques Cytogénétique

Plus en détail

Notions de bioinformatique

Notions de bioinformatique Notions de bioinformatique Souvent les avancées des biotechnologies ont été possibles du fait d avancées technologiques relevant d autres domaines que la biologie. - En juillet 1995 le séquençage d Haemophilus

Plus en détail

Professeur Joël LUNARDI

Professeur Joël LUNARDI Biochimie - Biologie moléculaire Chapitre 3 : La réplication du matériel génétique Professeur Joël LUNARDI MED@TICE PCEM1 - Année 2006/2007 Faculté de Médecine de Grenoble - Tous droits réservés. Chapitre

Plus en détail

SFR. Mise en place de la gestion des exigences sous DOORS dans le cadre de la refonte du système d'information commercial 14/11/2007

SFR. Mise en place de la gestion des exigences sous DOORS dans le cadre de la refonte du système d'information commercial 14/11/2007 SFR Mise en place de la gestion des exigences sous DOORS dans le cadre de la refonte du système d'information commercial 14/11/2007 1 Sommaire 1- Le contexte et l historique de la Gestion des EXigences

Plus en détail

PROTEIN COMPLEXES INVOLVED IN PCG FUNCTION

PROTEIN COMPLEXES INVOLVED IN PCG FUNCTION DISS. ETH NO. 21505 PROTEIN COMPLEXES INVOLVED IN PCG FUNCTION A dissertation submitted to ETH ZURICH for the degree of Doctor of Sciences presented by MARIA DERKACHEVA Master of Biology (Honours), Saint-Petersburg

Plus en détail

Comparaison et alignement de séquences 2

Comparaison et alignement de séquences 2 Comparaison et alignement de séquences 2 LV348 -BI Sophie Pasek sophie.pasek@upmc.fr Comment comparer une séquence contre une banque? Comparaison séquence/banque Pourquoi? : Réunir un échantillon taxonomique

Plus en détail

Accès au Contenu Informationnel pour les Masses de Données de Documents

Accès au Contenu Informationnel pour les Masses de Données de Documents Accès au Contenu Informationnel pour les Masses de Données de Documents Grappa LILLE 3 - UR Futurs INRIA MOSTRARE Laboratoire d Informatique de Paris 6 Laboratoire de Recherche en Informatique Orsay -

Plus en détail

L ANALYSE DE DONNÉES AU SERVICE DES UTILISATEURS. Lorène Allano 16 Avril 2013

L ANALYSE DE DONNÉES AU SERVICE DES UTILISATEURS. Lorène Allano 16 Avril 2013 L ANALYSE DE DONNÉES AU SERVICE DES UTILISATEURS Lorène Allano 16 Avril 2013 Question? Expert Aide à la décision Expériences Digitalisation Analyse automatique Visualisation Outils adapté Données numériques

Plus en détail

La VMC hygroréglable ATLANTIC. Toutes les solutions pour l habitat VMC HYGROREGLABLE. VMC Hygro Type EA VMC Hygro Type EB VMC Hygro Gaz

La VMC hygroréglable ATLANTIC. Toutes les solutions pour l habitat VMC HYGROREGLABLE. VMC Hygro Type EA VMC Hygro Type EB VMC Hygro Gaz www.atlantic-ventilation.com VMC HYGROREGLABLE La VMC hygroréglable ATLANTIC Toutes les solutions pour l habitat VMC Hygro Type EA VMC Hygro Type EB VMC Hygro Gaz La VMC hygroréglable ATLANTIC, toutes

Plus en détail

Les défis de la Bioinformatique:

Les défis de la Bioinformatique: Les défis de la Bioinformatique: Une introduction à la Journée du 19 octobre Marie-Paule LEFRANC Journées du CINES 19-21 octobre 2004 organisées par Laetitia Regnier Importance des facteurs génétiques

Plus en détail

Développement d un traitement pour l ataxie de Friedreich. Dr. Jacques P. Tremblay Université Laval Québec, Canada

Développement d un traitement pour l ataxie de Friedreich. Dr. Jacques P. Tremblay Université Laval Québec, Canada Développement d un traitement pour l ataxie de Friedreich Dr. Jacques P. Tremblay Université Laval Québec, Canada Ataxie de Friedreich Maladie héréditaire Transmission récessive Liée au chromosome 9 Due

Plus en détail

Quelques notions de génomique fonctionnelle: l exemple des puces à ADN

Quelques notions de génomique fonctionnelle: l exemple des puces à ADN Quelques notions de génomique fonctionnelle: l exemple des puces à ADN Frédéric Devaux Laboratoire de génétique moléculaire Ecole Normale Supérieure Le «dogme central» de la biologie moléculaire Transcription

Plus en détail

Laboratoire d'infochimie, ULP, Strasbourg - INTERNET - Version multi-utilisateurs de SXD in house Partie 1: Concept. Partie 2: Description du logiciel

Laboratoire d'infochimie, ULP, Strasbourg - INTERNET - Version multi-utilisateurs de SXD in house Partie 1: Concept. Partie 2: Description du logiciel Version multi-utilisateurs de SXD in house Partie 1: Concept a. Présentation de SXD Internet b. Architecture c. Caractéristiques d. Formats supportés e. Niveaux d utilisation Partie 2: Description du logiciel

Plus en détail

Détecter les clients potentiels

Détecter les clients potentiels V1 Détecter les clients potentiels Copyright Siemens Enterprise Communications GmbH & Co KG 2008. Tous droits réservés. Page 1 Oct-08 Uniquement pour diffusion interne Tendances du marché Taille du marché

Plus en détail

Etude de l expression de gènes impliqués dans les voies de défense et les mécanismes épigénétiques

Etude de l expression de gènes impliqués dans les voies de défense et les mécanismes épigénétiques Résumé En Français Résumé de la thèse de Monsieur Jam Nazeer AHMAD Titre Etude de l expression de gènes impliqués dans les voies de défense et les mécanismes épigénétiques chez la tomate infectée par le

Plus en détail

-ii- APPLICATION DES PROPRIETES DE RESONANCE

-ii- APPLICATION DES PROPRIETES DE RESONANCE -ii- APPLICATION DES PROPRIETES DE RESONANCE Michel ZANCA, CHU Montpellier Signification de la résonance et relation de Larmor ω eff = 2 π ν eff = γ B eff La RMN détecte très précisément la fréquence ν

Plus en détail

Compatibilité avec les gaz. Domaines d application. Caractéristiques principales. Caractéristiques de construction

Compatibilité avec les gaz. Domaines d application. Caractéristiques principales. Caractéristiques de construction EQUIEMENTS RÉCAUFFEUR RX Réchauffeurs électriques - aute pression Maintiennent constante la phase gazeuse d un réseau ou d une centrale Compatibilité avec les gaz es réchauffeurs électriques RX sont prévus

Plus en détail

LES BACTERIOPHAGES. Petit phage à ADN: Phage à ARN:

LES BACTERIOPHAGES. Petit phage à ADN: Phage à ARN: LES BACTERIOPHAGES. Par définition, ce sont les virus des Bactéries. Chaque Bactéries possèdent son propre phage. Ils sont facilement isolables car ils se développent parallèlement aux Bactéries. Ils se

Plus en détail

Livre Blanc. Construire un système d information collaboratif de pilotage de l action publique. Mai 2010

Livre Blanc. Construire un système d information collaboratif de pilotage de l action publique. Mai 2010 Livre Blanc Construire un système d information collaboratif de pilotage de l action publique Mai 2010 Un livre blanc édité par : NQI - Network Quality Intelligence Tél. : +33 4 92 96 24 90 E-mail : info@nqicorp.com

Plus en détail

ANALYSE DE L HYDRATATION DE LA PEAU AVEC LE SPECTROPHOTOMETRE PROCHE INFRAROUGE PORTABLE LABSPEC PRO

ANALYSE DE L HYDRATATION DE LA PEAU AVEC LE SPECTROPHOTOMETRE PROCHE INFRAROUGE PORTABLE LABSPEC PRO ANALYSE DE L HYDRATATION DE LA PEAU AVEC LE SPECTROPHOTOMETRE PROCHE INFRAROUGE PORTABLE LABSPEC PRO Présentation Introduction I. Matériel et Méthode II. Résultats III. Discussion Comparaison avec d autres

Plus en détail

Inventaire québécois des émissions. Infocentre de santé publique

Inventaire québécois des émissions. Infocentre de santé publique Les émissions atmosphériques des sources fixes et mobiles Julie Paradis, MDDEP Magalie Canuel, INSPQ JASP, 1 er décembre 2011 Plan de la présentation Inventaire québécois des émissions atmosphériques (IQÉA)

Plus en détail

Comparaison et alignement. de séquences 2 LV348 -BI. sophie.pasek@upmc.fr. Sophie Pasek

Comparaison et alignement. de séquences 2 LV348 -BI. sophie.pasek@upmc.fr. Sophie Pasek Comparaison et alignement de séquences 2 LV348 -BI Sophie Pasek sophie.pasek@upmc.fr Comment comparer une séquence contre une banque? Comparaison séquence/banque Pourquoi? : Réunir un échantillon taxonomique

Plus en détail

Bac S - Sujet de SVT - Session 2012 - Emirats Arabes Unis STABILITÉ ET VARIABILITÉ DES GÉNOMES ET ÉVOLUTION

Bac S - Sujet de SVT - Session 2012 - Emirats Arabes Unis STABILITÉ ET VARIABILITÉ DES GÉNOMES ET ÉVOLUTION Bac S - Sujet de SVT - Session 2012 - Emirats Arabes Unis 1ère PARTIE : Restitution des connaissances (8 points). STABILITÉ ET VARIABILITÉ DES GÉNOMES ET ÉVOLUTION Après avoir défini en introduction la

Plus en détail

AutoGRAPH Un serveur pour automatiser et visualiser la comparaison de génomes: Application à l identification de nouveaux gènes chez le chien.

AutoGRAPH Un serveur pour automatiser et visualiser la comparaison de génomes: Application à l identification de nouveaux gènes chez le chien. AutoGRAPH Un serveur pour automatiser et visualiser la comparaison de génomes: Application à l identification de nouveaux gènes chez le chien. Thomas DERRIEN CNRS-UMR6061 Génétique et Développement Université

Plus en détail

Vue générale de la régulation du cycle cellulaire par les complexes cyclines/cdk

Vue générale de la régulation du cycle cellulaire par les complexes cyclines/cdk Vue générale de la régulation du cycle cellulaire par les complexes cyclines/cdk actif Différentes Cdk peuvent s associer avec différentes Cyclines Cdk active: tyrosine et thréonine Kinase (phosphoryle

Plus en détail

Mise en place de serveurs Galaxy dans le cadre du réseau CATI BBRIC

Mise en place de serveurs Galaxy dans le cadre du réseau CATI BBRIC Mise en place de serveurs Galaxy dans le cadre du réseau CATI BBRIC {Sebastien.Carrere, Ludovic.Legrand,Jerome.Gouzy}@toulouse.inra.fr {Fabrice.Legeai,Anthony.Bretaudeau}@rennes.inra.fr CATI BBRIC 35 bioinformaticiens

Plus en détail

Séquençage du génome complet du VHC par une approche de Long range PCR

Séquençage du génome complet du VHC par une approche de Long range PCR Séquençage du génome complet du VHC par une approche de Long range PCR Sylvie LARRAT MCU-PH Laboratoire de Virologie CHU de Grenoble L hépatite C Épidémiologie 160 M porteurs chroniques 500 000 décès /

Plus en détail

Ocularis. NOVADIS 14 place Marie Jeanne Bassot 92 300 Levallois Perret Tel : +(33) 1 41 34 03 90 Fax : +(33) 1 41 34 09 91 www.novadis.

Ocularis. NOVADIS 14 place Marie Jeanne Bassot 92 300 Levallois Perret Tel : +(33) 1 41 34 03 90 Fax : +(33) 1 41 34 09 91 www.novadis. Ocularis NOVADIS 14 place Marie Jeanne Bassot 92 300 Levallois Perret Tel : +(33) 1 41 34 03 90 Fax : +(33) 1 41 34 09 91 www.novadis.eu Ocularis La dernière génération de plateforme VMS d OnSSI, Ocularis,

Plus en détail

La SOA était une mode. Nous en avons fait un standard.

La SOA était une mode. Nous en avons fait un standard. La SOA était une mode. Nous en avons fait un standard. Agenda 1 Présentation 2 Les solutions it-toolbox 3 Notre valeur ajoutée 4 Le centre d excellence 5 Equipe et démarche 6 Références et plateformes

Plus en détail

La Cible Sommaire F o c u s

La Cible Sommaire F o c u s La Cible Sommaire F o c u s F o n d a t e u r : J e a n L e B I S S O N N A I S D i r e c t e u r d e l a p u b l i c a t i o n : M a r t i n e M I N Y R é d a c t e u r e n c h e f : S e r g e C H A N

Plus en détail

FazaANGEL supervision pro-active

FazaANGEL supervision pro-active presentation FazaAngel - page 1/7 FazaANGEL supervision pro-active FazaAngel : supervision pro-active fazaangel surveille tous les «éléments de votre infrastructure : télécom, réseau, serveur, site web

Plus en détail

POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA

POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA Amplification spécifique Détection spécifique Clonage dans des vecteurs Amplification in vitro PCR Hybridation moléculaire - hôte cellulaire

Plus en détail

Evolutions technologiques et intégration européenne, la nécessaire mutation des échanges banque-entreprise

Evolutions technologiques et intégration européenne, la nécessaire mutation des échanges banque-entreprise Evolutions technologiques et intégration européenne, la nécessaire mutation des échanges banque-entreprise Hervé Postic - Directeur UTSIT Petit-déjeuner Axway "ETEBAC - Suite" 10 juin 2008 UTSIT en deux

Plus en détail

TISSUE MICROARRAYS (PUCES TISSULAIRES) Dr Gaëlle Fromont CHU Poitiers

TISSUE MICROARRAYS (PUCES TISSULAIRES) Dr Gaëlle Fromont CHU Poitiers TISSUE MICROARRAYS (PUCES TISSULAIRES) Dr Gaëlle Fromont CHU Poitiers Principe Construction Techniques réalisables sur TMA Analyse des résultats: lecture Interprétation - Intégration des résultats Intérêts

Plus en détail

Informations techniques

Informations techniques Informations techniques Force développée par un vérin Ø du cylindre (mm) Ø de la tige (mm) 12 6 16 6 20 8 25 10 32 12 40 16 50 20 63 20 80 25 100 25 125 32 160 40 200 40 250 50 320 63 ction Surface utile

Plus en détail

Thème 10 : Développer un concept et une architecture technique de produit

Thème 10 : Développer un concept et une architecture technique de produit Thème 10 : Développer un concept et une architecture technique de produit Serghei Floricel et Eduardo Miranda Si vous réfléchissez encore à un moyen technique pour réaliser un produit qui fonctionne et

Plus en détail

AOP et industrialisation de la production d applications

AOP et industrialisation de la production d applications IrisaTech AOP et industrialisation de la production d applications Didier GIRARD Directeur Technique d IMPROVE Réf ITF0010 Page 1 IMPROVE Santé : Éditeur Résurgences depuis 1996, 15 Hôpitaux Interconnexion

Plus en détail

TABLE DES MATIERES PARTIE A BIOLOGIE MOLECULAIRE 3. LESIONS ET REPARATIONS DE L ADN 41 AVANT-PROPOS 1. LES ACIDES NUCLEIQUES 3

TABLE DES MATIERES PARTIE A BIOLOGIE MOLECULAIRE 3. LESIONS ET REPARATIONS DE L ADN 41 AVANT-PROPOS 1. LES ACIDES NUCLEIQUES 3 TABLE DES MATIERES AVANT-PROPOS XI PARTIE A BIOLOGIE MOLECULAIRE 1. LES ACIDES NUCLEIQUES 3 1.1 STRUCTURE DE LA CHAINE POLYNUCLEOTIDIQUE 4 Les bases 4 Les pentoses 5 Nucléosides et nucléotides 5 La chaîne

Plus en détail

Séminaire: Méthodes et outils d'analyse de données textuelles, un nouveau souffle?

Séminaire: Méthodes et outils d'analyse de données textuelles, un nouveau souffle? Séminaire: Méthodes et outils d'analyse de données textuelles, un nouveau souffle? Daniel K. Schneider TECFA FPSE - Université de Genève daniel.schneider@unige.ch Unité de technologie de l'éducation Université

Plus en détail

La GRC en temps de crise, difficile équilibre entre sentiment de sécurité et réduction des coûts

<Insert Picture Here> La GRC en temps de crise, difficile équilibre entre sentiment de sécurité et réduction des coûts La GRC en temps de crise, difficile équilibre entre sentiment de sécurité et réduction des coûts Christophe Bonenfant Cyril Gollain La GRC en période de croissance Gouvernance Gestion

Plus en détail

Registre STS Numéro d accréditation : STS 0197

Registre STS Numéro d accréditation : STS 0197 Norme internationale : ISO/CEI 17025:2005 Norme suisse : SN EN ISO/CEI 17025:2005 ABL Analytics SA Rue Victor-Helg 18 2800 Delémont Responsable : Responsable SM : Blaise Allemann Lucas Costato Téléphone

Plus en détail

1A 01 Brassage génétique et sa contribution à la diversité génétique Ex 2.1 SUJET 1

1A 01 Brassage génétique et sa contribution à la diversité génétique Ex 2.1 SUJET 1 SUJET 1 On réalise deux croisements expérimentaux chez la drosophile afin d étudier le devenir de deux caractères : la couleur du corps et l aspect des ailes au cours de la reproduction sexuée La longueur

Plus en détail

Les différentes missions

Les différentes missions DU SITEL 2000- Les différentes missions Mission principale : Architecture, études, mise en œuvre et exploitation des ressources informatiques de l Université Mission d expertise Mission académique DU SITEL

Plus en détail

Structures Familles, domaines et sites protéiques Ontologie Cluster de transcrits. O. Lecompte Bioinformatique

Structures Familles, domaines et sites protéiques Ontologie Cluster de transcrits. O. Lecompte Bioinformatique Banques Séquences nucléiques protéiques mixtes Structures Familles, domaines et sites protéiques Ontologie Cluster de transcrits PROSITE banque de motifs et de profils caractéristiques de domaines ou de

Plus en détail

De GenoSol à GenoBiome, mise en place d une structure analytique pour évaluer l état biologique du sol

De GenoSol à GenoBiome, mise en place d une structure analytique pour évaluer l état biologique du sol De GenoSol à GenoBiome, mise en place d une structure analytique pour évaluer l état biologique du sol Lionel RANJARD, Samuel Dequiedt, Pierre-Alain Maron, Anne-Laure Blieux. UMR Agroécologie-plateforme

Plus en détail

SERVICE PROPRIETE INTELLECTUELLE

SERVICE PROPRIETE INTELLECTUELLE SERVICE PROPRIETE INTELLECTUELLE ÉTUDIER - CRÉER PROTÉGER - MONÉTISER é PNO Consultants sas 7 rue Rouget de L Isle 75001 Paris 01.44.77.91.00 france@pnoconsultants.com Introduction Qui est PNO? Créé en

Plus en détail

Les outils du génie génétique.

Les outils du génie génétique. Les outils du génie génétique. I\ Les enzymes. On va se servir des enzymes pour couper, coller et synthétiser des acides nucléiques. A\ Les polymérases. Toutes les polymérases agissent de 5 vers 3. En

Plus en détail

Présentation du plan de cours et du site Internet

Présentation du plan de cours et du site Internet Cours #1: Introduction à la modélisation et au contrôle de procédés industriels Guy Gauthier, ing., Ph.D. 6 janvier 015 Source de l image: www.mlssystems.com/thermoforming.htm Présentation du plan de cours

Plus en détail

Ingénierie des réseaux. Chapitre V : Mobile IP. ESEN Université De La Manouba

Ingénierie des réseaux. Chapitre V : Mobile IP. ESEN Université De La Manouba Ingénierie des réseaux Chapitre V : Mobile IP ESEN Université De La Manouba Contexte Depuis quelques années déjà les terminaux informatiques deviennent moins encombrants et par conséquent plus mobiles.

Plus en détail

WinPackage et WWMSD. L'équipe du CITIC74 : info[at]citic74[dot]fr. Copyright CITIC74 GNU Free Documentation Licence

WinPackage et WWMSD. L'équipe du CITIC74 : info[at]citic74[dot]fr. Copyright CITIC74 GNU Free Documentation Licence WinPackage et WWMSD L'équipe du CITIC74 : info[at]citic74[dot]fr Sommaire Contexte Contexte technique Processus de déploiement WinPackage WWMSD (Windows Workstation Management System Daemon) Conclusion

Plus en détail

UNIVERSITÉ DU QUÉBEC À MONTRÉAL MODÉLISATION CONNEXIONNISTE DU REPÉRAGE DE L'INFORMATION

UNIVERSITÉ DU QUÉBEC À MONTRÉAL MODÉLISATION CONNEXIONNISTE DU REPÉRAGE DE L'INFORMATION UNIVERSITÉ DU QUÉBEC À MONTRÉAL MODÉLISATION CONNEXIONNISTE DU REPÉRAGE DE L'INFORMATION THÈSE PRÉSENTÉE COMME EXIGENCE PARTIELLE DU DOCTORAT EN INFORMATIQUE COGNITIVE PAR GUY DESJARDINS AOÛT 2006 TABLE

Plus en détail

L'ELECTRONIQUE AU. Innov'Day PEP Bellignat 24 Avril 2014

L'ELECTRONIQUE AU. Innov'Day PEP Bellignat 24 Avril 2014 L'ELECTRONIQUE AU SERVICE DU MOULE Innov'Day PEP Bellignat 24 Avril 2014 Sommaire Le Monde de SISE L'Electronique dans un Moule Inconvénients de l'electronique actuelle L'Architecture future de l'electronique

Plus en détail

Lot 3: Problématique d interopérabilité LM2O 19/11/2010

Lot 3: Problématique d interopérabilité LM2O 19/11/2010 Lot 3: Problématique d interopérabilité LM2O 19/11/2010 Partenaires LM²O Transformations de Modèles MDI Coordination du lot Mesures et indicateurs d'interopérabilité Modélisation d'entreprise Démarche

Plus en détail

Cycle cellulaire Partie 2

Cycle cellulaire Partie 2 17/02/2015 THIERRY Guilhem L2 CR : BORG Manon BMCP Pr. A. AUTILLO TOUATI 16 pages Cycle cellulaire Partie 2 Plan : A. Les protéines codées par des gènes dits "suppresseurs de tumeurs" I. La protéine p53

Plus en détail

Etude du transcriptome et du protéome en Neurooncologie

Etude du transcriptome et du protéome en Neurooncologie Etude du transcriptome et du protéome en Neurooncologie Principes, aspects pratiques, applications cliniques François Ducray Neurologie Mazarin, Unité Inserm U711 Groupe hospitalier Pitié-Salpêtrière Etude

Plus en détail

Contrôle de l expression génétique chez les eucaryotes

Contrôle de l expression génétique chez les eucaryotes Contrôle de l expression génétique chez les eucaryotes 1 ère partie : la transcription - Chapitre III : Les autres classes de facteurs de transcription Cours de Mr Le Dréan I Autres familles de la superclasse

Plus en détail

RÉGULATION DE L EXPRESSION DES GÈNES

RÉGULATION DE L EXPRESSION DES GÈNES RÉGULATION DE L EXPRESSION DES GÈNES Comme nous l avons vu, le programme de transcription n est pas fixe. La cellule sait adapter ce programme aux conditions extérieures, au mieux de son économie. Chez

Plus en détail

D é ce m b re 2 01 0 L e ttr e d 'i n fo r m a t i o n n 2 2 E d i to r i al L a f r o n ti è r e so c i ale L a p r i s e d e c o n s c i e n c e d e s e n tr e p r i s e s e n m a ti è re D e s e xa

Plus en détail

PLATEFORME DE SUPERVISION

PLATEFORME DE SUPERVISION PLATEFORME DE SUPERVISION ACCOR SOLUTIONS - Page 1/10 - PRESENTATION GENERALE SMART VE est une plateforme de supervision développée par Accor, spécifiquement dédiée aux infrastructures de recharge pour

Plus en détail

LES ESCALIERS. Du niveau du rez-de-chaussée à celui de l'étage ou à celui du sous-sol.

LES ESCALIERS. Du niveau du rez-de-chaussée à celui de l'étage ou à celui du sous-sol. LES ESCALIERS I. DÉF I NIT I O N Un escalier est un ouvrage constitué d'une suite de marches et de paliers permettant de passer à pied d'un niveau à un autre. Ses caractéristiques dimensionnelles sont

Plus en détail

Outil libre de catalogage et de localisation de l information. JC. Desconnets (IRD - ESPACE) http://www.mdweb-project.org/

Outil libre de catalogage et de localisation de l information. JC. Desconnets (IRD - ESPACE) http://www.mdweb-project.org/ Outil libre de catalogage et de localisation de l information JC. Desconnets (IRD - ESPACE) http://www.mdweb-project.org/ Historique et partenariat En 2002 Programme ROSELT (Observatoire de la Désertification)

Plus en détail