Les bases de données transcriptionnelles en ligne

Dimension: px
Commencer à balayer dès la page:

Download "Les bases de données transcriptionnelles en ligne"

Transcription

1 Les bases de données transcriptionnelles en ligne

2 Différents concepts en régulation transcriptionnelle sites de fixation - in vitro/vivo? - quelle technique? - degré de confiance? facteur de transcription TTGATGTCTCC AGTAATGCGACCATTAC ACCCATTTGGCTTCCCATTTCGA TATCAATTAG ACCCAATTAGTAATAAAT - structure? - classe? - orthologues? matrice - fréq. / poids-position? - type de correction? A C G T gène(s) cible(s) module cis-régulateur - taille/position génomique? TF présents? technique expérimentale utilisée? gène cible?

3 Différents concepts en régulation transcriptionnelle sites de fixation - in vitro/vivo? - quelle technique? - degré de confiance? facteur de transcription TTGATGTCTCC AGTAATGCGACCATTAC ACCCATTTGGCTTCCCATTTCGA TATCAATTAG ACCCAATTAGTAATAAAT - structure? - classe? - orthologues? matrice - fréq. / poids-position? - type de correction? A C G T gène(s) cible(s) module cis-régulateur - taille/position génomique? TF présents? technique expérimentale utilisée? gène cible?

4 Différents concepts en régulation transcriptionnelle sites de fixation - in vitro/vivo? - quelle technique? - degré de confiance? facteur de transcription TTGATGTCTCC AGTAATGCGACCATTAC ACCCATTTGGCTTCCCATTTCGA TATCAATTAG ACCCAATTAGTAATAAAT - structure? - classe? - orthologues? matrice - fréq. / poids-position? - type de correction? A C G T gène(s) cible(s) module cis-régulateur - taille/position génomique? TF présents? technique expérimentale utilisée? gène cible?

5 Différents concepts en régulation transcriptionnelle sites de fixation - in vitro/vivo? - quelle technique? - degré de confiance? facteur de transcription TTGATGTCTCC AGTAATGCGACCATTAC ACCCATTTGGCTTCCCATTTCGA TATCAATTAG ACCCAATTAGTAATAAAT - structure? - classe? - orthologues? matrice - fréq. / poids-position? - type de correction? A C G T gène(s) cible(s) module cis-régulateur - taille/position génomique? TF présents? technique expérimentale utilisée? gène cible?

6 Quelques bases de données

7 base de donnée commerciale (licence payante publique gratuite ) + version

8 Qualité des sites Transfac Scores de qualité 1 : Functionally confirmed factor binding site 2: Binding of pure protein (purified or recombinant) 3: Immunologically characterized binding activity of a cellular extract 4: Binding activity characterized via a known binding sequence 5: Binding of uncharacterized extract protein to a bone fide element 6: No quality assigned

9 Recherche E2F dans Transfac publique classification interacteurs matrices

10 Recherche E2F dans Transfac publique sites de fixation références

11 3 Matrices E2F Transfac quelles différences?

12 [Sandelin A, Alkema W, Engstrom P, Wasserman WW, Lenhard B.] alternative open-source à Transfac taille plus réduite: 459 matrices (oct. 2009) Répartition taxonomique des matrices Origine des données JASPAR in vitro in vivo g fun v i eb e rt es ra t in ts sec es nts te s d a a l o t d p r ma ho c ne o ur 0 PB M I q A D ip E X al 1H A se L -se PILE MS ip-ch p E i i E r N S D M Ch cte Ch CO ba essentiellement des données in-vitro, donc pas de gène cible!

13 Différents concepts en régulation transcriptionnelle sites de fixation - in vitro/vivo? - quelle technique? - degré de confiance? facteur de transcription TTGATGTCTCC AGTAATGCGACCATTAC ACCCATTTGGCTTCCCATTTCGA TATCAATTAG ACCCAATTAGTAATAAAT - structure? - classe? - orthologues? matrice - fréq. / poids-position? - type de correction? A C G T gène(s) cible(s) module cis-régulateur - taille/position génomique? TF présents? technique expérimentale utilisée? gène cible?

14 E2F dans Jaspar

15 But: standardiser et centraliser les informations sur la régulation transcriptionnelle inclut certaines bases de données mise en place d'une architecture unifiée: tout le monde peut mettre ses données dans PAZAR et les rendre publiques ou non... open-access et open-source (TRANSFAC n'en fait pas partie) standards GFF (localisation génomique) et XML

16 aucun gène cible aucun facteur de transcription spécifique d'un gène cible ("gene centric") spécifique d'un FT ("TF centric")

17 E2F dans PAZAR

18 Navigateur UCSC target gene

19 [ Griffith OL et al.] Idée: aller chercher les informations dans la littérature scientifique Comment? en mettant à contribution la communauté scientifique Oreganno met à disposition des curateurs un corpus d'articles scientifiques soumis par des experts identifiés par des approches de text-mining automatiques (recherche de mots typiques comme "transcription factor", "binding site",...)

20 Oreganno inclut également des données provenant d'autres projets à grande échelle

21 E2F dans Oreganno site de fixation polymorphisme

22 Différents concepts en régulation transcriptionnelle sites de fixation - in vitro/vivo? - quelle technique? - degré de confiance? facteur de transcription TTGATGTCTCC AGTAATGCGACCATTAC ACCCATTTGGCTTCCCATTTCGA TATCAATTAG ACCCAATTAGTAATAAAT - structure? - classe? - orthologues? matrice - fréq. / poids-position? - type de correction? A C G T gène(s) cible(s) module cis-régulateur - taille/position génomique? TF présents? technique expérimentale utilisée? gène cible?

23 [Gallo, S. M., Li, L., Hu, Z. and Halfon, M. S] base de données de modules cis-régulateurs et de TFBS chez la drosophile CRM sans TFBS CRM avec TFBS

24 Take home messages nombreuses bases de données, contenant différents types d'information information généralement parcellaire: TF mais pas de gène cible, CRM sans TF, etc... les matrices des différentes bases de données sont souvent différentes: impact de cette différence? attention à l'origine des données: in-vivo, in-vitro, in-silico

IV Forum des Assurances d Alger 28/29 novembre 2005 HOTEL EL-AURASSI - ALGER. Tarification en situation d insuffisance de données :

IV Forum des Assurances d Alger 28/29 novembre 2005 HOTEL EL-AURASSI - ALGER. Tarification en situation d insuffisance de données : IV Forum des Assurances d Alger 28/29 novembre 2005 HOTEL EL-AURASSI - ALGER Tarification en situation d insuffisance de données : Approche du risque CAT-NAT par la méthode des scores Par Mounir GHERNOUTI,

Plus en détail

Introduction à l analyse statistique et bioinformatique des puces à ADN

Introduction à l analyse statistique et bioinformatique des puces à ADN Formation INSERM 10 février 2004 Introduction à l analyse statistique et bioinformatique des puces à ADN Gaëlle Lelandais lelandais@biologie.ens.fr 1 Première Partie Analyse d une puce à ADN : Le recherche

Plus en détail

LA TRANSCRIPTION. Introduction. I. Modalité générale de la transcription. II. Transcription chez les Procaryotes

LA TRANSCRIPTION. Introduction. I. Modalité générale de la transcription. II. Transcription chez les Procaryotes LA TRANSCRIPTION Introduction I. Modalité générale de la transcription II. Transcription chez les Procaryotes 1. L'ARN polymérase 2. Etapes de la transcription a. Initiation b. Elongation c. Terminaison

Plus en détail

Plateforme de Recherche de Mutations

Plateforme de Recherche de Mutations Plateforme de Recherche de Mutations Jean-Marc Aury contact: pfm@genoscope.cns.fr 29 janvier 2009 Introduction Présentation des données produites par le GSFLX : type, qualité, Méthodes de détection de

Plus en détail

(quelques) méthodes pour l'identification de modules cis-régulateurs (CRM) Carl Herrmann TAGC & Aix-Marseille Université carl.herrmann@univ amu.

(quelques) méthodes pour l'identification de modules cis-régulateurs (CRM) Carl Herrmann TAGC & Aix-Marseille Université carl.herrmann@univ amu. (quelques) méthodes pour l'identification de modules cis-régulateurs (CRM) Carl Herrmann TAGC & Aix-Marseille Université carl.herrmann@univ amu.fr -1Carl Herrmann - M2 "analyse de réseaux biologiques"

Plus en détail

Etude transcriptomique de la dégradation des parois lignocellulosiques de son et paille de blé durant la croissance de Thermobacillus xylanilyticus

Etude transcriptomique de la dégradation des parois lignocellulosiques de son et paille de blé durant la croissance de Thermobacillus xylanilyticus Journées SFR condorcet Compiègne 8-9 juillet 2015 Projet Hydroseq : UMR FARE-CRRBM Etude transcriptomique de la dégradation des parois lignocellulosiques de son et paille de blé durant la croissance de

Plus en détail

ED Biologie moléculaire. E. Turpin J. Lehmann-Che 5-6 novembre 2007

ED Biologie moléculaire. E. Turpin J. Lehmann-Che 5-6 novembre 2007 ED Biologie moléculaire E. Turpin J. Lehmann-Che 5-6 novembre 2007 PCR 1983: Kary Mullis Amplification in vitro par une méthode enzymatique d'un fragmentd'adn en présence de deux oligonucléotides spécifiques

Plus en détail

Cognit Ive Cas d utilisation

Cognit Ive Cas d utilisation Cognit Ive Cas d utilisation 96-98, rue de Montreuil - 75011 Paris _ opicot@ _ + 33 (0)1 40 09 71 55 Sommaire Présentation de la plateforme Cognit Ive SemanticMail : Traitement sémantique des mails Projets

Plus en détail

MQPerf un outil de diagnostic en mode SaaS des performances optimales du MOM JORAM

MQPerf un outil de diagnostic en mode SaaS des performances optimales du MOM JORAM MQPerf un outil de diagnostic en mode SaaS des performances optimales du MOM JORAM Solutions Linux 20 juin 2012 Serge Lacourte Directeur Général serge.lacourte@scalagent.com www.scalagent.com Plan JORAM

Plus en détail

Plan. Rappel : vision classique de la régulation. Nouvelles possibilités à l ère postgénomique

Plan. Rappel : vision classique de la régulation. Nouvelles possibilités à l ère postgénomique Régulation de l expression des gènes O. Lecompte Laboratoire de Bioinformatique et Génomique Intégratives - IGBMC odile.lecompte@igbmc. fr Plan Rappel : vision classique de la régulation Nouvelles possibilités

Plus en détail

Atelier WEB20 : IBM WebSphere CAST IRON

Atelier WEB20 : IBM WebSphere CAST IRON Atelier WEB20 : IBM WebSphere CAST IRON Plateforme d intégration complète pour connecter l Entreprise avec le cloud Magali Boulet IT Specialist magali.boulet@fr.ibm.com Le Cloud Computing? Applications

Plus en détail

Les phosphorylations des protéines

Les phosphorylations des protéines Les phosphorylations des protéines Contrôle majeur pour réguler différents processus cellulaires : - Division cellulaire - Contraction musculaire - Synthèse protéique - Régulation transcriptionnelle -

Plus en détail

Des haies à maintenir pour leur rôles positifs

Des haies à maintenir pour leur rôles positifs Des haies à maintenir pour leur rôles positifs Besoin : Gérer qualitativement la ressource, de façon pérenne Une demande croissante en bois déchiqueté Besoin : Gérer quantitativement la ressource, de façon

Plus en détail

Évaluation expérimentale de l application de la théorie «Vision-Compréhension» aux patrons de conception

Évaluation expérimentale de l application de la théorie «Vision-Compréhension» aux patrons de conception Évaluation expérimentale de l application de la théorie «Vision-Compréhension» aux patrons de conception Bertrand Van den Plas Faculté d Informatique Facultés Universitaires Notre-Dame de la Paix 21 septembre

Plus en détail

La différenciation cellulaire

La différenciation cellulaire La différenciation cellulaire Définitions Différenciation cellulaire : Processus par lequel une cellule peu ou pas différenciée acquiert les caractéristiques d un type cellulaire sur le plan morphologique

Plus en détail

FOUILLE DE TEXTES Méthodes et enjeux

FOUILLE DE TEXTES Méthodes et enjeux FOUILLE DE TEXTES Méthodes et enjeux 23 mars 2007 Adeline Nazarenko Laboratoire d Informatique de Paris-Nord UMR7030 Université Paris 13 & CNRS adeline.nazarenko@lipn.univ-paris13.fr Plan Applications

Plus en détail

Lier un site de liaison d'un facteur de transcription et son gène cible

Lier un site de liaison d'un facteur de transcription et son gène cible Berder 2013 : Corrélation, causalité et régulation en biologie Lier un site de liaison d'un facteur de transcription et son gène cible Laurent M. SACHS (sachs@mnhn.fr) Laboratoire Evolution des Régulations

Plus en détail

SOMMAIRE. L inventaire des données. Danièle BOUCON. Objectifs. Description. Modèle d inventaire et outils. Méthodologie. Conclusion.

SOMMAIRE. L inventaire des données. Danièle BOUCON. Objectifs. Description. Modèle d inventaire et outils. Méthodologie. Conclusion. Les outils CNES L inventaire des données Danièle BOUCON Réunion PIN du 22 mars 202 Réunion PIN du 22 mars 202 Outils CNES Objectifs SOMMAIRE Description Modèle d inventaire et outils Méthodologie Conclusion

Plus en détail

Cours d introduction à la génétique de la souris Notion de Souche

Cours d introduction à la génétique de la souris Notion de Souche Cours d introduction à la génétique de la souris Notion de Souche Introduction: - Réponse d un animal à l expérimentation (diapo 1) Facteurs environnementaux et propres à l animal - Notion d animal standardisé

Plus en détail

La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST.

La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST. La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST. Gaël Le Mahec - p. 1/12 L algorithme BLAST. Basic Local Alignment Search Tool est un algorithme de recherche

Plus en détail

Digital Workplace et Gestion des connaissances Concepts et mise en oeuvre

Digital Workplace et Gestion des connaissances Concepts et mise en oeuvre Avant-propos 1. Objectif du livre 17 2. Illustrations des exemples de ce livre 18 2.1 Office 365 comme plateforme technologique pour une digital workplace 18 2.2 SharePoint et Yammer à l honneur 18 3.

Plus en détail

Chapitre 4. Génotype, phénotype et environnement

Chapitre 4. Génotype, phénotype et environnement Chapitre 4 Génotype, phénotype et environnement Comment s établit le phénotype macroscopique? Le phénotype ne se résume pas toujours à la simple expression du génome, les relations entre génotypes et phénotypes

Plus en détail

Offres de Formation Licence et Master

Offres de Formation Licence et Master FACULTE DES LETTRES SCIENCES HUMAINES ET SOCIALES ANNEE UNIVERSITAIRE : 00 DEPARTEMENT : Français SPECIALITE : Langue française Offres de Formation Licence et Master Premier semestre 0% 0% 0h00 6 expression

Plus en détail

Cours No 8 - Entrepôt de données XML

Cours No 8 - Entrepôt de données XML B. Amann - Cours No 8 - Entrepôt de données XML 1 Slide 1 Cours No 8 - Entrepôt de données XML Système d information et Web Le Web Slide 2 applications ad hoc recherche manuelle navigation mises à jour

Plus en détail

PGI et classes de 1ère STMG Plan de l intervention

PGI et classes de 1ère STMG Plan de l intervention PGI et classes de 1ère STMG Plan de l intervention Principes généraux Une approche différente en première et terminale Le rôle du PGI dans l enseignement Les choix préalables du formateur Liste de considérations

Plus en détail

Génomique intégrative du coactivateur transcriptionnel PRC

Génomique intégrative du coactivateur transcriptionnel PRC UNIVERSITE DE NANTES FACULTE DE MEDECINE Génomique intégrative du coactivateur transcriptionnel PRC THESE DE DOCTORAT Ecole doctorale: Biologie Santé Nantes Angers Discipline: sciences de la vie et de

Plus en détail

REGULATION DE L EXPRESSION DES GENES.

REGULATION DE L EXPRESSION DES GENES. REGULATION DE L EXPRESSION DES GENES. Modification épigénétiques : viennent s ajouter à la séquence nucléotidique. La séquence nucléotidique est transmise intacte de la cellule mère à la cellule fille.

Plus en détail

Préparer un état de l art

Préparer un état de l art Préparer un état de l art Khalil DRIRA LAAS-CNRS, Toulouse Unité de recherche ReDCAD École Nationale d ingénieurs de Sfax Étude de l état de l art? Une étude ciblée, approfondie et critique des travaux

Plus en détail

Inventaire québécois des émissions. Infocentre de santé publique

Inventaire québécois des émissions. Infocentre de santé publique Les émissions atmosphériques des sources fixes et mobiles Julie Paradis, MDDEP Magalie Canuel, INSPQ JASP, 1 er décembre 2011 Plan de la présentation Inventaire québécois des émissions atmosphériques (IQÉA)

Plus en détail

Mémoire d Actuariat Tarification de la branche d assurance des accidents du travail Aymeric Souleau aymeric.souleau@axa.com 3 Septembre 2010 Plan 1 Introduction Les accidents du travail L assurance des

Plus en détail

NOTE. Objet : Message XML pour l'émission de déclarations aux SSA Nombre de pages : 68. Table des matières

NOTE. Objet : Message XML pour l'émission de déclarations aux SSA Nombre de pages : 68. Table des matières Section ONSS Répertoires A l'attention de : Secrétariats Sociaux Copie à : B. Smets Contact : P.Y.Delvoye NOTE Objet : aux SSA Nombre de pages : 68 Table des matières 1. Message XML pour l émission de

Plus en détail

Plan d Evaluation (phase 1) Version 1.1

Plan d Evaluation (phase 1) Version 1.1 Evaluation des Systèmes de Transcription enrichie d Emissions Radiophoniques (ESTER) Plan d Evaluation (phase 1) Version 1.1 Dernière mise à jour le 21 novembre 2003. 1 Préambule Ce document décrit le

Plus en détail

TD1 : Epissage alternatif

TD1 : Epissage alternatif TD1 : Epissage alternatif Le gène de la tropomyosine α de xénope possède trois exons 3' terminaux, appelés exon 9A9', 9B et 9D, dont la sélection différentielle en fonction du contexte tissulaire produit

Plus en détail

Présentation 5. Chapitre 1 La démarche marketing 19 1 Définitions 19

Présentation 5. Chapitre 1 La démarche marketing 19 1 Définitions 19 S ommaire Présentation 5 Chapitre 1 La démarche marketing 19 1 Définitions 19 A. Le marketing de l offre 19 B. Le marketing de la demande 20 C. Le marketing de l échange 21 2 Une histoire du marketing

Plus en détail

Comment exploiter les commentaires d internautes pour la recommandation automatique

Comment exploiter les commentaires d internautes pour la recommandation automatique Comment exploiter les commentaires d internautes pour la recommandation automatique Damien Poirier Paris, le 11 juin 2012 1/32 Contexte et problématique 2/32 Contexte et problématique 3/32 Contexte Mise

Plus en détail

LOCAL TRUST Charte Open-Source

LOCAL TRUST Charte Open-Source LOCAL TRUST Charte Open-Source Juillet 2011 Pourquoi cette Charte? ATEXO, dans son développement, met en avant le caractère open-source de ses solutions LOCAL TRUST Or la désignation "open-source" fait

Plus en détail

Calibration de systèmes de levé mobiles

Calibration de systèmes de levé mobiles 1/30 Calibration de systèmes de levé mobiles S. Levilly, N. Seube ENSTA Bretagne Brest, FRANCE et CIDCO Rimouski Qc, CANADA Journées AFHy, Juin 2014 Les systèmes mobiles Ils sont généralement constitués

Plus en détail

Dans ce chapitre nous allons étudier une méthode pratique d anti-phishing, ce qui consiste à un système de classification automatique.

Dans ce chapitre nous allons étudier une méthode pratique d anti-phishing, ce qui consiste à un système de classification automatique. I INTRODUCTION Les pages de phishing sont l un des problèmes majeurs de sécurité sur internet. La majorité des attaques utilisent des méthodes sophistiquées comme les fausses pages pour tromper les utilisateurs

Plus en détail

NET@XIS OFFRE DE SERVICES OFFSHORE SAP

NET@XIS OFFRE DE SERVICES OFFSHORE SAP NET@XIS OFFRE DE SERVICES OFFSHORE SAP SOMMAIRE Introduction... 3 Scénarii & tendances...4 Offre de services Netaxis.8 Méthodologie... 9 Infrastructure Technique...11 Livrables...12 Management de Project...13

Plus en détail

OUTILS DE FINANCEMENT DE L INNOVATION TECHNOLOGIQUE ET DE LA VALORISATION DE LA RECHERCHE

OUTILS DE FINANCEMENT DE L INNOVATION TECHNOLOGIQUE ET DE LA VALORISATION DE LA RECHERCHE OUTILS DE FINANCEMENT DE L INNOVATION TECHNOLOGIQUE ET DE LA VALORISATION DE LA RECHERCHE Un exemple de Projet PNRI Pr. Ahmed Noureddine HELAL 11 Mars 2015, Hôtel Monastir Center, Monastir Notre Projet

Plus en détail

Extraction de connaissances à partir de sources non ontologiques

Extraction de connaissances à partir de sources non ontologiques Extraction de connaissances à partir de sources non ontologiques Fabien Amarger 1,2, Jean-Pierre Chanet 2, Ollivier Haemmerlé 1, Nathalie Hernandez 1, Catherine Roussey 2 1 IRIT UMR 5505, UTM, Département

Plus en détail

ICH Q3D Guide relatif aux impuretés élémentaires

ICH Q3D Guide relatif aux impuretés élémentaires ICH Q3D Guide relatif aux impuretés élémentaires Andrea Lodi et Hendrik de Jong 3 décembre 2014 Structure de la présentation Durée : 30 min Introduction et raison d être AL Périmètre du guide HdJ Aspects

Plus en détail

WCUM pour l analyse d un site Web

WCUM pour l analyse d un site Web WCUM pour l analyse d un site Web Malika Charrad 1 Yves Lechevallier 2 Gilbert Saporta 3 Mohamed Ben Ahmed 4 1,4 Ecole Nationale des Sciences de l Informatique, Tunis 2 INRIA Rocquencourt, Paris 1,3 Conservatoire

Plus en détail

Ocularis. NOVADIS 14 place Marie Jeanne Bassot 92 300 Levallois Perret Tel : +(33) 1 41 34 03 90 Fax : +(33) 1 41 34 09 91 www.novadis.

Ocularis. NOVADIS 14 place Marie Jeanne Bassot 92 300 Levallois Perret Tel : +(33) 1 41 34 03 90 Fax : +(33) 1 41 34 09 91 www.novadis. Ocularis NOVADIS 14 place Marie Jeanne Bassot 92 300 Levallois Perret Tel : +(33) 1 41 34 03 90 Fax : +(33) 1 41 34 09 91 www.novadis.eu Ocularis La dernière génération de plateforme VMS d OnSSI, Ocularis,

Plus en détail

Bioinformatique fonctionnelle des protéines et analyse structurale de réseaux d'interactions

Bioinformatique fonctionnelle des protéines et analyse structurale de réseaux d'interactions Bioinformatique fonctionnelle des protéines et analyse structurale de réseaux d'interactions intégration Populations Organismes Tissus, organes Relations inter-espèces, Équilibres écologiques Développement,

Plus en détail

Analyse statistique des profils et de l activité des participants d un MOOC

Analyse statistique des profils et de l activité des participants d un MOOC Analyse statistique des profils et de l activité des participants d un MOOC Avner Bar-Hen 1, Hubert Javaux 2, Nathalie Villa-Vialaneix 3 1 Université Paris Descartes, MAP5 UFR Math-Info, 45, rue des Saints-Pères,

Plus en détail

Découverte de Règles Associatives Hiérarchiques entre termes. Sandra BSIRI Hamza Mahdi ZARG AYOUNA Chiraz L.Chérif Sadok BENYAHIA

Découverte de Règles Associatives Hiérarchiques entre termes. Sandra BSIRI Hamza Mahdi ZARG AYOUNA Chiraz L.Chérif Sadok BENYAHIA Découverte de Règles Associatives Hiérarchiques entre termes Sandra BSIRI Hamza Mahdi ZARG AYOUNA Chiraz L.Chérif Sadok BENYAHIA 1 Plan Problématique et État de l art Nouvelle approche Approche Conceptuelle

Plus en détail

ING Commercial Banking. XML en Europe de l Est : vers de nouvelles opportunités

ING Commercial Banking. XML en Europe de l Est : vers de nouvelles opportunités ING Commercial Banking XML en Europe de l Est : vers de nouvelles opportunités Agenda Typologie des clients Evolution des standards XML o Evolutions universelles o Evolutions dans les marchés/pays spécifiques

Plus en détail

Sommaire. Les fonc2onnalités a6endues DU SIGB... 3 mise en œuvre du projet... Prix 10 Durée du marché... 11

Sommaire. Les fonc2onnalités a6endues DU SIGB... 3 mise en œuvre du projet... Prix 10 Durée du marché... 11 1 Sommaire Important... 3 Les fonc2onnalités a6endues DU SIGB... 3 mise en œuvre du projet... 6 Prix 10 Durée du marché... 11 2 1 IMPORTANT Le présent cadre de réponse devra être renseigné point par point.

Plus en détail

La SOA était une mode. Nous en avons fait un standard.

La SOA était une mode. Nous en avons fait un standard. La SOA était une mode. Nous en avons fait un standard. Agenda 1 Présentation 2 Les solutions it-toolbox 3 Notre valeur ajoutée 4 Le centre d excellence 5 Equipe et démarche 6 Références et plateformes

Plus en détail

ANALYSE DE L HYDRATATION DE LA PEAU AVEC LE SPECTROPHOTOMETRE PROCHE INFRAROUGE PORTABLE LABSPEC PRO

ANALYSE DE L HYDRATATION DE LA PEAU AVEC LE SPECTROPHOTOMETRE PROCHE INFRAROUGE PORTABLE LABSPEC PRO ANALYSE DE L HYDRATATION DE LA PEAU AVEC LE SPECTROPHOTOMETRE PROCHE INFRAROUGE PORTABLE LABSPEC PRO Présentation Introduction I. Matériel et Méthode II. Résultats III. Discussion Comparaison avec d autres

Plus en détail

Évaluation de la classification et segmentation d'images en environnement incertain

Évaluation de la classification et segmentation d'images en environnement incertain Évaluation de la classification et segmentation d'images en environnement incertain EXTRACTION ET EXPLOITATION DE L INFORMATION EN ENVIRONNEMENTS INCERTAINS / E3I2 EA3876 2, rue F. Verny 29806 Brest cedex

Plus en détail

Version 7.1_5.0. Release Notes

Version 7.1_5.0. Release Notes Sommaire 1.1. Viadeis Extranet...3 1.2. Viadeis CRM...3 1. NOUVEAUTES... 4 1.1. Viadeis Extranet...4 1.2. Viadeis CRM...4 1.2.1. Global...4 1.2.2. Module Viadeis CRM Devis vers GesCo...5 2. EVOLUTIONS...

Plus en détail

Institut de Génomique. olaso@cng.fr

Institut de Génomique. olaso@cng.fr Institut de Génomique PCR quantitative : état des lieux... (de la théorie à la pratique, MIQE, CQ et stratégie de normalisation) olaso@cng.fr Microarray data qpcr data? Règles générales pour la présentation

Plus en détail

Département Enseignement DIAGNOSTIC PARTENARIAT ECOLE ENTREPRISES

Département Enseignement DIAGNOSTIC PARTENARIAT ECOLE ENTREPRISES Département Enseignement DIAGNOSTIC PARTENARIAT ECOLE ENTREPRISES QUI SOMMES-NOUS? MEJT, dont le siège est basé à Champagne au Mont d Or (69) a été créée en 1994 par Gilles GUILLERME. A sa création, MEJT

Plus en détail

éléments répétés gènes des ARN stables (ARNr, ARNt) gènes protéiques Nb de gènes, taille du génome et complexité pseudogènes régions régulatrices

éléments répétés gènes des ARN stables (ARNr, ARNt) gènes protéiques Nb de gènes, taille du génome et complexité pseudogènes régions régulatrices Plan 3. Annotation des génomes a) Annotation structurale : localisation des éléments génétiques éléments répétés gènes des ARN stables (ARNr, ARNt) gènes protéiques Nb de gènes, taille du génome et complexité

Plus en détail

Module 2: Les échelles

Module 2: Les échelles Module 2: Les échelles Echelles et mesure en sciences sociales - Mesurer des concepts abstraits/complexes (p.ex. attitudes) - Mesures et questionnaires (questions Echelles (tests, indices) - Echelles conceptuelles

Plus en détail

Chapitre IX: Propriétés des gaz IX.1 Etats de la matière

Chapitre IX: Propriétés des gaz IX.1 Etats de la matière Nature des gaz IX.1 Etats de la matière Solide : - volume et forme déterminée - empilements denses de molécules qui ne se déplacent pas Interactions décroissantes entre molécules Liquide : -volume déterminé

Plus en détail

Le logiciel pour la mesure des charges en soins infirmiers. Mars 2003

Le logiciel pour la mesure des charges en soins infirmiers. Mars 2003 Mars 2003 PRNVISUEL Son origine Ses avantages Sa personnalisation Configuration - PRNVISUEL Configuration - PRN 6.0 Ses modules clés: Patients Offre Son évolution page 3 Extrants page 4 page 29 page 8

Plus en détail

PEI Sage 100 CRM. Présentation Fonctionnelle. Version i7.7

PEI Sage 100 CRM. Présentation Fonctionnelle. Version i7.7 Version i7.7 Sommaire 1 INTRODUCTION... 4 1.1 Proposition de valeur...4 1.2 Détails de la solution...4 2 MODULE PROSPECTION ET VENTE... 6 2.1 Sociétés et Contacts : Informations contextuelles...6 2.2 Parc

Plus en détail

Recherche des transcrits de fusion AML1/ETO et CBFB-MYH11 dans les LAM de l`adulte.

Recherche des transcrits de fusion AML1/ETO et CBFB-MYH11 dans les LAM de l`adulte. Recherche des transcrits de fusion AML1/ETO et CBFB-MYH11 dans les LAM de l`adulte. F.Harieche, W.Assouak, A.Trabzi, M.Saidi, F.Zerhouni, R.M.Hamladji. LAM Entité distincte Leucémies aigues. Transformation

Plus en détail

Fouille de données : quelques applications en SHS

Fouille de données : quelques applications en SHS Fouille de données : quelques applications en SHS Séminaire «!document numérique!», INTD-CNAM 23 novembre 2010 (Paris) Julien VELCIN, laboratoire ERIC Informatique et humanités numériques!! Université

Plus en détail

Reconnaissance des formes : Classement d ensembles d objets

Reconnaissance des formes : Classement d ensembles d objets Reconnaissance des formes : Classement d ensembles d objets Données Méthodes Extraction de connaissances Applications Expertise Apprentissage Bernard FERTIL Directeur de Recherche CNRS Équipe LXAO, UMR

Plus en détail

Elodie Darbo. To cite this version: HAL Id: tel-00644865 https://tel.archives-ouvertes.fr/tel-00644865v1

Elodie Darbo. To cite this version: HAL Id: tel-00644865 https://tel.archives-ouvertes.fr/tel-00644865v1 Découverte d éléments cis-régulateurs impliqués dans l activation transcriptionnelle du génome zygotique dans l embryon précoce de Drosophila melanogaster Elodie Darbo To cite this version: Elodie Darbo.

Plus en détail

ATELIER EPIGENETIQUE

ATELIER EPIGENETIQUE Juin 2012 ATELIER EPIGENETIQUE Utilisation de la Q-PCR pour analyser des données de ChIP ou de MeDIP Emmanuèle Mouchel-Vielh I. La PCR quantitative: principe et généralités II. Interprétation des résultats

Plus en détail

Big data : vers une nouvelle science des risques?

Big data : vers une nouvelle science des risques? Big data : vers une nouvelle science des risques? Serge Abiteboul INRIA et ENS Cachan Conseil national du numérique et Académie des sciences Big data et science des risques 1 Organisation Big data en bref

Plus en détail

Gamme de terminaux SIP Mitel 6800

Gamme de terminaux SIP Mitel 6800 Gamme de terminaux SIP Mitel 6800 Gamme de terminaux SIP performante et polyvalente pour les entreprises de toutes tailles. La gamme Mitel 6800 propose une vaste gamme de terminaux dotés de nombreuses

Plus en détail

AutoGRAPH Un serveur pour automatiser et visualiser la comparaison de génomes: Application à l identification de nouveaux gènes chez le chien.

AutoGRAPH Un serveur pour automatiser et visualiser la comparaison de génomes: Application à l identification de nouveaux gènes chez le chien. AutoGRAPH Un serveur pour automatiser et visualiser la comparaison de génomes: Application à l identification de nouveaux gènes chez le chien. Thomas DERRIEN CNRS-UMR6061 Génétique et Développement Université

Plus en détail

Université de Montréal. Développement d outils pour l analyse de données de ChIP-seq et l identification des facteurs de transcription

Université de Montréal. Développement d outils pour l analyse de données de ChIP-seq et l identification des facteurs de transcription Université de Montréal Développement d outils pour l analyse de données de ChIP-seq et l identification des facteurs de transcription par Eloi Mercier Département de bioinformatique Faculté de médecine

Plus en détail

Dossier de candidature

Dossier de candidature Dossier de candidature Introduction: Avant d entreprendre la création d une entreprise, mais également à l occasion du développement d une nouvelle activité, il est absolument conseillé d élaborer un business

Plus en détail

Contrôle Externe de Qualité - CQE Norme et son application aux CQE éléments trace dans différents pays. Essais de standardisation

Contrôle Externe de Qualité - CQE Norme et son application aux CQE éléments trace dans différents pays. Essais de standardisation Contrôle Externe de Qualité - CQE Norme et son application aux CQE éléments trace dans différents pays. Essais de standardisation J Arnaud DBI, CHU de Grenoble CQE et assurance qualité Méthodes analytiques

Plus en détail

Resolution limit in community detection

Resolution limit in community detection Introduction Plan 2006 Introduction Plan Introduction Introduction Plan Introduction Point de départ : un graphe et des sous-graphes. But : quantifier le fait que les sous-graphes choisis sont des modules.

Plus en détail

LES RÉGULATIONS: *******

LES RÉGULATIONS: ******* LES RÉGULATIONS: ******* ************************************************** ******* Comprendre un système de régulation par l analyse de données scientifiques Travail réalisé par Gabriel Mota, Erminia

Plus en détail

L a gamme financière en Belgique

L a gamme financière en Belgique L a gamme financière en Belgique Des outils pour la gestion efficace de vos risques financiers. Tout entrepreneur prend des risques : - accorder des délais de paiements à ses clients, - faire confiance

Plus en détail

Méthodologie d Accompagnement. de Projet de Certification ISO 9001

Méthodologie d Accompagnement. de Projet de Certification ISO 9001 Méthodologie d Accompagnement de Projet de Certification ISO 9001 Janvier 2011 Postulats ISO 9001, c est : Maîtriser ce que l on fait Savoir s améliorer On part du principe que : Le niveau de maîtrise

Plus en détail

ISTEX LA PLATEFORME ISTEX INFORMATION SCIENTIFIQUE ET TECHNIQUE INITIATIVE D EXCELLENCE EN

ISTEX LA PLATEFORME ISTEX INFORMATION SCIENTIFIQUE ET TECHNIQUE INITIATIVE D EXCELLENCE EN ISTEX INITIATIVE D EXCELLENCE EN INFORMATION SCIENTIFIQUE ET TECHNIQUE LA PLATEFORME ISTEX DÉROULEMENT DE LA PRÉSENTATION Les chargements des données dans la plateforme Usage 1 : Outils de découvertes

Plus en détail

ED 1. Jacques Elion. M1 Biologie Santé UE Maladies Génétiques et Cancer. Remerciements Anne Dumay Grégory Gautier. jacques.elion@inserm.

ED 1. Jacques Elion. M1 Biologie Santé UE Maladies Génétiques et Cancer. Remerciements Anne Dumay Grégory Gautier. jacques.elion@inserm. M1 Biologie Santé UE Maladies Génétiques et Cancer Année universitaire 2013-2014 ED 1 Jacques Elion jacques.elion@inserm.fr Remerciements Anne Dumay Grégory Gautier CONTEXTE Facteur de transcription Nucléaire

Plus en détail

1.1 Exemple introductif d un cube de données... 2

1.1 Exemple introductif d un cube de données... 2 1.1 Exemple introductif d un cube de données............... 2 2.1 Pré-traitement des données avec les outils OLAP [MHW00]...... 14 2.2 Architecture d un système intégrant SGBD, OLAP et MOLAP [Fu05] 16

Plus en détail

Séminaire: Méthodes et outils d'analyse de données textuelles, un nouveau souffle?

Séminaire: Méthodes et outils d'analyse de données textuelles, un nouveau souffle? Séminaire: Méthodes et outils d'analyse de données textuelles, un nouveau souffle? Daniel K. Schneider TECFA FPSE - Université de Genève daniel.schneider@unige.ch Unité de technologie de l'éducation Université

Plus en détail

Pré-étude portant sur l'implémentation et l'organisation d'un système de gestion des connaissances au SPF Finances

Pré-étude portant sur l'implémentation et l'organisation d'un système de gestion des connaissances au SPF Finances Pré-étude portant sur l'implémentation et l'organisation d'un système de gestion des s au SPF Finances Information (Processus 44) versus Gestion de la Connaissance (Processus 78) Version validée par le

Plus en détail

Vers un enseignement structuré de la médecine factuelle à l'ulb

Vers un enseignement structuré de la médecine factuelle à l'ulb Vers un enseignement structuré de la médecine factuelle à l'ulb Jean-Paul Sculier Service des soins intensifs et urgences oncologiques Oncologie Thoracique Institut Jules Bordet ULB Déclaration Absence

Plus en détail

AnaEE-France : SI et sémantique

AnaEE-France : SI et sémantique AnaEE-France : SI et sémantique Open Science INRA - Séminaire des 17 19 décembre 2014 St Martin-de-Londres C. Pichot, D. Maurice, H. Raynal et collectif Une infrastructure nationale dédiée à l'étude des

Plus en détail

Analyse Chromosomique sur Puce à ADN Applications en Prénatal

Analyse Chromosomique sur Puce à ADN Applications en Prénatal Analyse Chromosomique sur Puce à ADN Applications en Prénatal Véronique Satre, Charles Coutton, Gaëlle Vieville, Françoise Devillard et Florence Amblard Maladies génétiques Anomalies chromosomiques Cytogénétique

Plus en détail

Présentation du plan de cours et du site Internet

Présentation du plan de cours et du site Internet Cours #1: Introduction à la modélisation et au contrôle de procédés industriels Guy Gauthier, ing., Ph.D. 6 janvier 015 Source de l image: www.mlssystems.com/thermoforming.htm Présentation du plan de cours

Plus en détail

Gestion de données à large échelle. Anne Doucet LIP6 Université Paris 6

Gestion de données à large échelle. Anne Doucet LIP6 Université Paris 6 Gestion de données à large échelle Anne Doucet LIP6 Université Paris 6 1 Plan Contexte Les réseaux P2P Non structurés Structurés Hybrides Localisation efficace et Interrogation complète et exacte des données.

Plus en détail

SOMMAIRE. Présentation 3. Marketing de l offre 15 Marketing de la demande 16 Marketing de l échange 16

SOMMAIRE. Présentation 3. Marketing de l offre 15 Marketing de la demande 16 Marketing de l échange 16 Présentation 3 Chapitre 1 Le concept de marketing 15 1 Définitions 15 Marketing de l offre 15 Marketing de la demande 16 Marketing de l échange 16 2 Principaux outils du marketing 16 3 Les critiques envers

Plus en détail

Management des processus opérationnels

Management des processus opérationnels Ecole Nationale Supérieure de Management Master Management des organisations Management des processus opérationnels Dr TOUMI Djamila Cours n 4: l approche processus et le management du système d informations

Plus en détail

Compatibilité avec les gaz. Domaines d application. Caractéristiques principales. Caractéristiques de construction

Compatibilité avec les gaz. Domaines d application. Caractéristiques principales. Caractéristiques de construction EQUIEMENTS RÉCAUFFEUR RX Réchauffeurs électriques - aute pression Maintiennent constante la phase gazeuse d un réseau ou d une centrale Compatibilité avec les gaz es réchauffeurs électriques RX sont prévus

Plus en détail

Dès qu'une action atteint un certain degré de complexité ou qu'il s'agit d'actions collectives il est nécessaire d'organiser, c'est-à-dire de diviser et coordonner. L'organisation suppose donc division

Plus en détail

JOSY. Paris - 4 février 2010

JOSY. Paris - 4 février 2010 JOSY «Authentification centralisée pour les applications web» Paris - 4 février 2010 Sommaire de la journée Présentations de quelques technologies OpenId CAS Shibboleth Retour d expériences Contexte :

Plus en détail

Axiscope Startup Empowerment Platform: Offre de services logiciels pour accélérer le time-to-market de votre activité sur le WEB

Axiscope Startup Empowerment Platform: Offre de services logiciels pour accélérer le time-to-market de votre activité sur le WEB AXISCOPE STARTUP EMPOWERMENT PLATFORM Axiscope Startup Empowerment Platform: Offre de services logiciels pour accélérer le time-to-market de votre activité sur le WEB www.axiscope.com 09/10/2015 AXISCOPE

Plus en détail

Guide d utilisation Web of Knowledge : Web of Science Endnote Web

Guide d utilisation Web of Knowledge : Web of Science Endnote Web Guide d utilisation Web of Knowledge : Web of Science Endnote Web G. Jan - Bibliothèque de l Observatoire Océanologique de Banyuls sur Mer (UPMC-CNRS) - Janvier 2008 1 Sommaire : Index p.3 Termes spécifiques

Plus en détail

Extraction des séquences inter-langues pour la Traduction Automatique

Extraction des séquences inter-langues pour la Traduction Automatique Extraction des séquences inter-langues pour la Traduction Automatique Cyrine Nasri LORIA MOSIC Dirigée par : Pr. Kamel Smaili, Pr. Yahya Slimani et Dr Chiraz Latiri 1/26 Cyrine Nasri Extraction des séquences

Plus en détail

8. Amplification et séquençage des acides nucléiques

8. Amplification et séquençage des acides nucléiques 8. Amplification et séquençage des acides nucléiques ADN chromosomique, plasmides (ADN bactérienne), ARN messager Rupture cellulaire Isolation et purification des acides nucléiques Concentration et amplification

Plus en détail

Fusion de classifiers visuels et textuels pour un système de recherche d images

Fusion de classifiers visuels et textuels pour un système de recherche d images Fusion de classifiers visuels et textuels pour un système de recherche d images Sabrina Tollari, Hervé Glotin, Jacques Le Maitre Université du Sud Toulon-Var Giens, 16 juin 2004 1 Plan Problématique Du

Plus en détail

TABLE DES MATIERES PARTIE A BIOLOGIE MOLECULAIRE 3. LESIONS ET REPARATIONS DE L ADN 41 AVANT-PROPOS 1. LES ACIDES NUCLEIQUES 3

TABLE DES MATIERES PARTIE A BIOLOGIE MOLECULAIRE 3. LESIONS ET REPARATIONS DE L ADN 41 AVANT-PROPOS 1. LES ACIDES NUCLEIQUES 3 TABLE DES MATIERES AVANT-PROPOS XI PARTIE A BIOLOGIE MOLECULAIRE 1. LES ACIDES NUCLEIQUES 3 1.1 STRUCTURE DE LA CHAINE POLYNUCLEOTIDIQUE 4 Les bases 4 Les pentoses 5 Nucléosides et nucléotides 5 La chaîne

Plus en détail

La PCR en temps réel frederic.gevaudant@bordeaux.inra.fr

La PCR en temps réel frederic.gevaudant@bordeaux.inra.fr La PCR en temps réel frederic.gevaudant@bordeaux.inra.fr INRA Centre de recherche de Bordeaux UMR Biologie du Fruit et Pathologie Historique 1985 : Invention par Kary Mullis de la technique de (PCR). 1991

Plus en détail

La signature électronique au service de l'émission de factures dématérialisées. Un cas B-to-C

La signature électronique au service de l'émission de factures dématérialisées. Un cas B-to-C La signature électronique au service de l'émission de factures dématérialisées Un cas B-to-C 1 Plan de la présentation Les origines de dématérialisation des factures Enjeux de la dématérialisation Rappel

Plus en détail

Dossier de Presse. Présentation. du portail éducatif. myschool! Ministère de l'éducation nationale, de la Formation professionnelle et des Sports

Dossier de Presse. Présentation. du portail éducatif. myschool! Ministère de l'éducation nationale, de la Formation professionnelle et des Sports Grand-Duché de Luxembourg Ministère de l'éducation nationale, de la Formation professionnelle et des Sports Dossier de Presse Présentation du portail éducatif myschool! Luxembourg, le 5 décembre 2002 Quand

Plus en détail

Modélisation de la structure 3D des protéines

Modélisation de la structure 3D des protéines Modélisation de la structure 3D des protéines We are drowning in data and starving for knowledge -R.D. Roger Unité Mathématique Informatique et Génome Séminaire AGENAE, Seignosse-le-Pénon, 20-21 mai 2003

Plus en détail