Thème 1 : La Terre dans l Univers, la Vie et l évolution du vivant. Partie 1 : Expression, stabilité et variation du patrimoine génétique

Save this PDF as:

Dimension: px
Commencer à balayer dès la page:

Download "Thème 1 : La Terre dans l Univers, la Vie et l évolution du vivant. Partie 1 : Expression, stabilité et variation du patrimoine génétique"

Transcription

1 Thème 1 : La Terre dans l Univers, la Vie et l évolution du vivant Partie 1 : Expression, stabilité et variation du patrimoine génétique Chapitre 1 : La reproduction conforme de la cellule et la réplication de l ADN TP 3 : Influence d une irradiation par les UV sur une culture de levure On se propose de rechercher l effet de diverses expositions aux radiations ultraviolettes sur les levures (durée croissante : 0s, 15s, 30s, 45/60s et 90s). Matériel à disposition : Deux tubes de suspensions de levures (souche rose ADE2) : suspensions A et B de concentrations différentes Boîtes de pétri avec milieu de culture glosé stérile Râteaux et pipettes stériles Lampe à UV Eau de javel Bec bunsen Culture en conditions stériles : Lorsque l on travaille sur des cultures de microorganismes telles que les levures, il est indispensable de travailler en conditions stériles. Réalisez le protocole suivant : Nettoyer la paillasse : sopalin, eau de javel Se laver les mains : penser à fermer le robinet avec le sopalin Disposer le matériel stérile sur la paillasse (javel à gauche pour les droitiers) Se relaver les mains S installer : fermer la blouse, attacher les cheveux longs Allumer le bec bunsen (flamme bleue) et tracer un cercle qui matérialisera le champ de stérilité autour du bec bunsen Identifier les boites sur le côté ou en dessous et laisser les boites ouvertes devant soi Suspension B : Une boite témoin, notée t=0. Elle ne sera pas exposée aux UV. Penser également à indiquer les initiales du binôme pour retrouver la boîte facilement Suspension A : 4 boites qui seront irradiées selon les durées indiquées. Noter au marqueur les boites (t=15, t=30, t=45/60 et t=90). Pré-ouvrir le tube et le sachet compte goute à proximité de la flamme Les laisser dans le champ de stérilité Après agitation (mais sans retourner le tube) ouvrir le tube, sans toucher le bouchon (à l intérieur) Sortit pipette et râteau (toujours dans le champ de stérilité) Déposer deux gouttes dans la boite Refermer aussitôt le couvercle, placer la pipette dans l eau de javel Passer le râteau dans la flamme : aller-retour rapide Pour chaque boite : ouvrir la boite (dans le champ stérile), étaler le prélèvement, avec le râteau stérile, de façon uniforme sur le milieu gélosé afin de répartir le mieux possible le liquide sur le milieu (mouvement circulaire et répété comme pour faire des crêpes). Un râteau par solution (un pour la solution A, un pour la solution B), puis placer le râteau dans l eau de javel Fermer la boite tout de suite Retourner les boites Apporter les boites vers la lampe à UV pour les exposer aux radiations selon les indications notées : allumer la lampe et lancer le chronomètre Placer les boites dans l incubateur (28-30 C) pour une durée de 5 jours En fin de TP, décontaminer la paillasse à l eau de javel

2 Résultats : Plus le temps d exposition aux UV est important, moins il y a de colonies. Le taux de colonies blanches augmente en fonction du temps d exposition aux UV. L exposition aux UV tue les levures les moins résistantes d où un nombre de colonies moindre lorsque la durée de l irradiation augmente. L apparition de colonies blanches est due à des mutations du matériel génétique des levures. Le nombre de colonies mutées augmente avec la durée d irradiation. TP4 : Plusieurs versions d un gène Rappels : la molécule d ADN porte de nombreux gènes. A chaque gène correspond une information génétique différente, codée sous la forme d une séquence, ou succession de nucléotides. Il peut aussi exister plusieurs versions d un même gène appelées «allèles». Quelle est l origine des différentes versions d un gène? 1. Activité 1 : Différentes version d un gène chez les levures

3 2. Activité 2 : Différentes versions d un gène chez l homme Dans le logiciel Anagène, on compare les différentes séquences des groupes sanguins ABO. Chez l homme, ce sont ces séquences nucléotidiques qui permettent de déterminer le groupe sanguin. Elles sont situées toutes les trois sur un même emplacement du chromosome 9. a) Comparer A et B : localiser et préciser les différences sur la séquence du gène de façon précise. Quelles sont les conséquences pour l individu C/G au nucléotide n 523 ; G/A au nucléotide n 700 ; C/A au nucléotide n 793 et G/C au nucléotide n 800. La conséquence pour l individu est le groupe sanguin qui est différent. b) Comparer A et O : A partir de quelle position se situent les différences sur les deux versions? Ecrire les séquences de ces deux versions entre les positions 255 et 280. Emettre une hypothèse pour expliquer les différences entre les deux versions à partir de la position préalablement repérée. Observer la fin du gène ; l hypothèse est-elle confirmée? ACOD : GGTGACCCCTTGGCTGGCTCCCATTG OCOD : GGTACCCCTTGGCTGGCTCCCATTGT Hypothèse : Il y a peut-être un décalage de la séquence. Vérification de l hypothèse : La mutation porte sur un nucléotide de l allèle A, la Guanine en position 258, qui a été supprimé sur l allèle O. Du coup, toute la séquence se trouve décalée d un nucléotide à partir du nucléotide 258. En fin de gêne, on constate que l allèle O possède un nucléotide de moins que l allèle A. L hypothèse semble donc confirmée. Si on décale la séquence de l allèle O d un nucléotide vers la droite à l aide du logiciel, ou en effectuant une comparaison par alignement, on constate que les séquences sont de nouveau identiques à partir de la position 259 jusqu à la fin du gène. L hypothèse est confirmée. BILAN : Une mutation est la modification de la séquence des nucléotides d un gène par addition, substitution ou délétion. Les conséquences peuvent être : apparition de malformations chez les descendants, cancers, maladies génétiques, mais aussi apparition de nouveaux caractères. Une mutation n est héréditaire que si elle touche les cellules germinales des gamètes (elle n est pas héréditaire si elle ne touche que d autres cellules). Les mutations sont à l origine des allèles.

4 COURS : I- La division cellulaire La division cellulaire, ou mitose, est le processus par lequel une cellule, appelée cellule mère, donne naissance à deux cellules filles qui possèderont le même nombre de chromosomes qu elle. La mitose comprend quatre phases au cours desquelles l organisation des chromosomes est modifiée. Ces quatre phases sont : La prophase : Les chromosomes, présents dans la chromatine du noyau sous forme décondensée, sont constitués de deux chromatides. Ils se condensent progressivement et deviennent observables au microscope optique. L enveloppe nucléaire (l enveloppe du noyau) se désorganise et disparait. La métaphase : Les chromosomes (leurs centromères) s alignent sur un même plan au centre de la cellule ; le plan équatorial. L anaphase : Les chromatides de chaque chromosome se séparent, chaque chromatide étant tirée vers l un des pôles de la cellule. La télophase : Les chromosomes à une chromatide se décondensent à chaque pôle cellulaire. L enveloppe nucléaire se reconstitue autour d eux. Le cytoplasme se divise pour constituer les deux cellules filles. Une cellule mère possédant n paires de chromosomes à deux chromatides, en début de mitose, donnera deux cellules filles possédant n paires de chromosomes homologues mais à une seule chromatide (chromosomes simples). La mitose permet donc le partage égal des chromatides sœurs entre les deux cellules filles (voir schéma à la fin du cours). II- Le mécanisme de la mitose 1) L expérience de Meselson et Stahl Elle a permis de comprendre le mode de réplication de l ADN. Dans les conditions de l expérience, si la réplication se fait selon le mode conservatif, on attend uniquement de l ADN de densité élevée (1,80) et de l ADN de densité faible (1,65), après transfert des bactéries dur un milieu contenant de l azote 14 N. Or ce n est pas le cas. Si la réplication se fait selon le mode dispersif, on s attend à obtenir uniquement de l ADN de densités intermédiaires. Ce n est pas le cas non plus. Seule la réplication semiconservative permet d expliquer les résultats obtenus : de l ADN de densité intermédiaires et de l ADN de densités faibles en proportions croissantes à chaque génération. 2) La réplication de l ADN

5 Les deux brins de la double hélice se séparent. Chaque brin sert de modèle pour la synthèse d un nouveau brin d ADN. Cette synthèse est effectuée par l ADN polymérase, une enzyme qui associe un nucléotide complémentaire en face de chaque nuclotide du brin ancien. La molécule mère d ADN est ainsi copiée en deux molécules filles, de séquences nucléotidiques identiques à celle de la molécule mère. III- Le cycle cellulaire Le cycle cellulaire est la succession d une mitose et d une interphase, constituée des phases G 1, S et G 2. Phase S : Synthèse d ADN, la quantité d ADN double dans la cellule ; chaque gène est duplique en deux copies présentes sur chaque chromatide sœur. Au cours de la mitose, les chromatides sœurs sont réparties de façon égale entre les deux cellules filles. Les cellules filles possèdent donc une information génétique identique à celle de la cellule mère : la mitose est donc une reproduction cellulaire conforme.

6

Séquence 1. Reproduction conforme de la cellule et réplication de l ADN Variabilité génétique et mutation de l ADN

Séquence 1. Reproduction conforme de la cellule et réplication de l ADN Variabilité génétique et mutation de l ADN Séquence 1 Reproduction conforme de la cellule et réplication de l ADN Variabilité génétique et mutation de l ADN Sommaire 1. Reproduction conforme de la cellule et réplication de l ADN 2. Variabilité

Plus en détail

LA MITOSE CUEEP - USTL DÉPARTEMENT SCIENCES BAHIJA DELATTRE

LA MITOSE CUEEP - USTL DÉPARTEMENT SCIENCES BAHIJA DELATTRE Biologie LA MITOSE CUEEP - USTL DÉPARTEMENT SCIENCES BAHIJA DELATTRE Février 2006 I. L'INTRODUCTION Chaque cellule d'un organisme supérieur provient de la multiplication d'une cellule préexistante (cellule

Plus en détail

CHAPITRE 3 LA SYNTHESE DES PROTEINES

CHAPITRE 3 LA SYNTHESE DES PROTEINES CHAITRE 3 LA SYNTHESE DES ROTEINES On sait qu un gène détient dans sa séquence nucléotidique, l information permettant la synthèse d un polypeptide. Ce dernier caractérisé par sa séquence d acides aminés

Plus en détail

Chapitre 7 : Structure de la cellule Le noyau cellulaire

Chapitre 7 : Structure de la cellule Le noyau cellulaire UE2 : Structure générale de la cellule Chapitre 7 : Structure de la cellule Le noyau cellulaire Professeur Michel SEVE Année universitaire 2010/2011 Université Joseph Fourier de Grenoble - Tous droits

Plus en détail

3: Clonage d un gène dans un plasmide

3: Clonage d un gène dans un plasmide 3: Clonage d un gène dans un plasmide Le clonage moléculaire est une des bases du génie génétique. Il consiste à insérer un fragment d'adn (dénommé insert) dans un vecteur approprié comme un plasmide par

Plus en détail

1 les caractères des êtres humains.

1 les caractères des êtres humains. Quelques rappels des classes précédentes ACTIVITÉ livre pages 8 et 9 : apprendre le bilan de la page 9 Les êtres vivants sont répartis en espèces. Chaque être vivant est formé de cellules. schéma d une

Plus en détail

Information génétique

Information génétique chapitre 3 Information génétique et division cellulaire L étude de la division cellulaire est abordée pour découvrir comment est transmise et conservée l information génétique portée par les chromosomes.

Plus en détail

TP N 3 La composition chimique du vivant

TP N 3 La composition chimique du vivant Thème 1 : La Terre dans l'univers, la vie et l'évolution du vivant : une planète habitée Chapitre II : La nature du vivant TP N 3 La composition chimique du vivant Les conditions qui règnent sur terre

Plus en détail

Dr E. CHEVRET UE2.1 2013-2014. Aperçu général sur l architecture et les fonctions cellulaires

Dr E. CHEVRET UE2.1 2013-2014. Aperçu général sur l architecture et les fonctions cellulaires Aperçu général sur l architecture et les fonctions cellulaires I. Introduction II. Les microscopes 1. Le microscope optique 2. Le microscope à fluorescence 3. Le microscope confocal 4. Le microscope électronique

Plus en détail

Les débuts de la génétique

Les débuts de la génétique HPITRE 9 DES DÉBTS DE L ÉNÉTIQE X ENJEX TELS DES BIOTEHNOLOIES 1 Les débuts de la génétique est avec les travaux de regor Mendel vers la fin du XIX e siècle que furent posées les bases de la génétique.

Plus en détail

Univers Vivant Révision. Notions STE

Univers Vivant Révision. Notions STE Univers Vivant Révision Notions STE Chap. 13) L Écologie 1) a) Qu est-ce que l empreinte écologique? L empreinte écologique correspond à la surface terrestre et aquatique totale nécessaire à un individu,

Plus en détail

CHROMATOGRAPHIE SUR COUCHE MINCE

CHROMATOGRAPHIE SUR COUCHE MINCE CHROMATOGRAPHIE SUR COUCHE MINCE I - PRINCIPE La chromatographie est une méthode physique de séparation de mélanges en leurs constituants; elle est basée sur les différences d affinité des substances à

Plus en détail

INFORMATION GÉNÉTIQUE et REPRODUCTION SEXUÉE

INFORMATION GÉNÉTIQUE et REPRODUCTION SEXUÉE Partie 1, Chapitre 4 INFORMATION GÉNÉTIQUE et REPRODUCTION SEXUÉE Constat : à l'exception des jumeaux, chaque individu est unique. Ses caractères héréditaires dependent des info génétiques (allèles) portées

Plus en détail

Les OGM. 5 décembre 2008. Nicole Mounier

Les OGM. 5 décembre 2008. Nicole Mounier Les OGM 5 décembre 2008 Nicole Mounier Université Claude Bernard Lyon 1 CGMC, bâtiment Gregor Mendel 43, boulevard du 11 Novembre 1918 69622 Villeurbanne Cedex OGM Organismes Génétiquement Modifiés Transfert

Plus en détail

INAUGURATION LABORATOIRE DE THERAPIE CELLULAIRE 16 FEVRIER 2012 DOSSIER DE PRESSE

INAUGURATION LABORATOIRE DE THERAPIE CELLULAIRE 16 FEVRIER 2012 DOSSIER DE PRESSE INAUGURATION LABORATOIRE DE THERAPIE CELLULAIRE 16 FEVRIER 2012 DOSSIER DE PRESSE Contact presse : Cathy Josse 03 22 66 87 83 / 06 86 30 46 57 josse.cathy@chu-amiens.fr 1 COMMUNIQUE DE SYNTHESE Le 16 février

Plus en détail

ATELIER IMAGEJ. Différentes applications vous sont proposées pour apprendre à utiliser quelques fonctions d ImageJ :

ATELIER IMAGEJ. Différentes applications vous sont proposées pour apprendre à utiliser quelques fonctions d ImageJ : Différentes applications vous sont proposées pour apprendre à utiliser quelques fonctions d ImageJ : 1. ANALYSE QUANTITATIVE D UN GEL D ELECTROPHORESE... 2 2. NUMERATION DE COLONIES BACTERIENNES SUR UNE

Plus en détail

Stabilitéet variabilitédes génomes au cours de la reproduction sexuée

Stabilitéet variabilitédes génomes au cours de la reproduction sexuée Stabilitéet variabilitédes génomes au cours de la reproduction sexuée 1 1 Reproduction sexuée et stabilitéde l espèce 2 2 L évolution du nombre de chromosones au cours de la reproduction sexuelle Le cycle

Plus en détail

Planches pour le Diagnostic microscopique du paludisme

Planches pour le Diagnostic microscopique du paludisme République Démocratique du Congo Ministère de la Santé Programme National de Lutte Contre le Paludisme Planches pour le Diagnostic microscopique du paludisme Ces planches visent à améliorer le diagnostic

Plus en détail

KIT ELISA dosage immunologique anti-bsa REF : ELISA A RECEPTION DU COLIS : Vérifier la composition du colis indiquée ci-dessous en pages 1 et 2

KIT ELISA dosage immunologique anti-bsa REF : ELISA A RECEPTION DU COLIS : Vérifier la composition du colis indiquée ci-dessous en pages 1 et 2 KIT ELISA dosage immunologique anti-bsa REF : ELISA : 0033 (0)169922672 : 0033 (0)169922674 : www.sordalab.com @ : sordalab@wanadoo.fr A RECEPTION DU COLIS : Vérifier la composition du colis indiquée ci-dessous

Plus en détail

Coordinateur Roland Calderon

Coordinateur Roland Calderon SVT-3 e -/Sciences de la Vie et de la Terre-/ erre-/-programme 2008 LIVRE DU PROFESSEUR Coordinateur Roland Calderon Les auteurs Vincent Béranger Professeur à Paris Louis-Marie Couteleau Professeur à Paris

Plus en détail

Journée SITG, Genève 15 octobre 2013. Nicolas Lachance-Bernard M.ATDR Doctorant, Laboratoire de systèmes d information géographique

Journée SITG, Genève 15 octobre 2013. Nicolas Lachance-Bernard M.ATDR Doctorant, Laboratoire de systèmes d information géographique Monitorint spatio-temporel intégré de la mobilité urbaine Monitoring spatio-temporel de l ADN urbain Une réponse aux défis, problèmes, enjeux et risques des milieux urbains Nicolas Lachance-Bernard M.ATDR

Plus en détail

L universalité et la variabilité de l ADN

L universalité et la variabilité de l ADN L universalité et la variabilité de l DN Unité 4 3 μm hromosomes observés en microscopie électronique à balayage. Les chromosomes, présents dans le noyau, sont constitués d acide désoxyribonucléique (DN).

Plus en détail

Comprendre l Univers grâce aux messages de la lumière

Comprendre l Univers grâce aux messages de la lumière Seconde / P4 Comprendre l Univers grâce aux messages de la lumière 1/ EXPLORATION DE L UNIVERS Dans notre environnement quotidien, les dimensions, les distances sont à l échelle humaine : quelques mètres,

Plus en détail

Séquence 2. L expression du patrimoine génétique. Sommaire

Séquence 2. L expression du patrimoine génétique. Sommaire Séquence 2 L expression du patrimoine génétique Sommaire 1. La synthèse des protéines 2. Phénotypes, génotypes et environnement Synthèse de la séquence 2 Exercices de la séquence 2 Glossaire des séquences

Plus en détail

Ni tout noir, ni tout blanc Consignes Thème I - Observer

Ni tout noir, ni tout blanc Consignes Thème I - Observer Ni tout noir, ni tout blanc Consignes Thème I - Observer BUT : Etudier les synthèses additives et soustractives Comprendre la notion de couleur des objets COMPETENCES : Rechercher et trier des informations

Plus en détail

Carte encadrement glitter

Carte encadrement glitter Carte encadrement glitter - Logiciel: PHOTOFILTRE http://photofiltre.free.fr/ - Logiciel: UnFREEz http://ressources3.techno.free.fr/didacticiels/unfreez/ - Installer le plugin: Importation GIF animé http://photofiltre.free.fr/frames.htm

Plus en détail

IBCP- Service Culture Cell- Règlement Intérieur des laboratoires de culture cellulaire

IBCP- Service Culture Cell- Règlement Intérieur des laboratoires de culture cellulaire IBCP- Service Culture Cell- Règlement Intérieur des laboratoires de culture cellulaire Table des matières I -Liste des laboratoires de culture cellulaire de l IBCP :... 2 II -Conditions requises pour l

Plus en détail

TD de Biochimie 4 : Coloration.

TD de Biochimie 4 : Coloration. TD de Biochimie 4 : Coloration. Synthèse de l expérience 2 Les questions posées durant l expérience 2 Exposé sur les méthodes de coloration des molécules : Générique Spécifique Autres Questions Pourquoi

Plus en détail

TP n 1: Initiation au laboratoire

TP n 1: Initiation au laboratoire Centre Universitaire d El-Tarf Institut des Sciences Agronomiques 3 ème année Contrôle de Qualité en Agroalimentaire TP n 1: Initiation au laboratoire Introduction L analyse de la matière vivante au laboratoire

Plus en détail

AUTOPORTE III Notice de pose

AUTOPORTE III Notice de pose AUTOPORTE III Notice de pose Vous avez acquis le système AUTOPORTE, nous vous en remercions. Veuillez lire attentivement cette notice, vous serez à même de faire fonctionner correctement ce système. FONCTIONNEMENT

Plus en détail

Fiche 19 La couleur des haricots verts et cuisson

Fiche 19 La couleur des haricots verts et cuisson Fiche 19 La couleur des haricots verts et cuisson Objectif : Valider ou réfuter des «précisions culinaires»* permettant de "conserver une belle couleur verte" lors la cuisson des haricots verts frais (gousses

Plus en détail

Alarme domestique- Présentation

Alarme domestique- Présentation STI2D PROJET SIN Alarme domestique- Présentation Document réponses Séquence découverte Le fonctionnement du système d alarme domestique: (Démarche d investigation) Après avoir fait une présentation de

Plus en détail

NETTOYAGE ET CONDITIONNEMENT DU MATERIEL DE SOINS EN VUE DE LA STERILISATION

NETTOYAGE ET CONDITIONNEMENT DU MATERIEL DE SOINS EN VUE DE LA STERILISATION NETTOYAGE ET CONDITIONNEMENT DU MATERIEL DE SOINS EN VUE DE LA STERILISATION OBJECTIFS SPECIFIQUES : ENUMERER SANS ERREUR LES ELEMENTS QUI COMPOSENT LE MATERIEL COURANT DE SOINS EXPLIQUER CHACUNE DES TECHNIQUES

Plus en détail

Tests de comparaison de moyennes. Dr Sahar BAYAT MASTER 1 année 2009-2010 UE «Introduction à la biostatistique»

Tests de comparaison de moyennes. Dr Sahar BAYAT MASTER 1 année 2009-2010 UE «Introduction à la biostatistique» Tests de comparaison de moyennes Dr Sahar BAYAT MASTER 1 année 2009-2010 UE «Introduction à la biostatistique» Test de Z ou de l écart réduit Le test de Z : comparer des paramètres en testant leurs différences

Plus en détail

4 : MÉTHODES D ANALYSE UTILISÉES EN ÉCOLOGIE MICROBIENNE

4 : MÉTHODES D ANALYSE UTILISÉES EN ÉCOLOGIE MICROBIENNE 4 : MÉTHODES D ANALYSE UTILISÉES EN ÉCOLOGIE MICROBIENNE L écologie microbienne (ou étude des micro-organismes de l environnement) étudie : les relations entre les différentes populations de micro-organismes

Plus en détail

Spectrophotométrie - Dilution 1 Dilution et facteur de dilution. 1.1 Mode opératoire :

Spectrophotométrie - Dilution 1 Dilution et facteur de dilution. 1.1 Mode opératoire : Spectrophotométrie - Dilution 1 Dilution et facteur de dilution. 1.1 Mode opératoire : 1. Prélever ml de la solution mère à la pipette jaugée. Est-ce que je sais : Mettre une propipette sur une pipette

Plus en détail

Transformations nucléaires

Transformations nucléaires Transformations nucléaires Stabilité et instabilité des noyaux : Le noyau d un atome associé à un élément est représenté par le symbole A : nombre de masse = nombre de nucléons (protons + neutrons) Z :

Plus en détail

DIFFRACTion des ondes

DIFFRACTion des ondes DIFFRACTion des ondes I DIFFRACTION DES ONDES PAR LA CUVE À ONDES Lorsqu'une onde plane traverse un trou, elle se transforme en onde circulaire. On dit que l'onde plane est diffractée par le trou. Ce phénomène

Plus en détail

MYRIAD. l ADN isolé n est à présent plus brevetable!

MYRIAD. l ADN isolé n est à présent plus brevetable! MYRIAD La Cour Suprême des Etats-Unis revient sur plus de 30 ans de pratique : l ADN isolé n est à présent plus brevetable! Mauvaise passe pour les inventions en biotechnologies sur le territoire américain.

Plus en détail

[WINDOWS 7 - LES FICHIERS] 28 avril 2010. Logiciel / Windows

[WINDOWS 7 - LES FICHIERS] 28 avril 2010. Logiciel / Windows Ce dossier a une forme un peu différente des précédentes : c est un ensemble de «fiches» décrivant chacune une des opérations que l on peut effectuer avec un fichier (enregistrer, renommer, etc.). Chaque

Plus en détail

EXERCICES : MECANISMES DE L IMMUNITE : pages 406 407 408 409 410

EXERCICES : MECANISMES DE L IMMUNITE : pages 406 407 408 409 410 EXERCICES : MECANISMES DE L IMMUNITE : pages 406 407 408 409 410 EXERCICE 1 PAGE 406 : EXPERIENCES A INTERPRETER Question : rôles respectifs du thymus et de la moelle osseuse dans la production des lymphocytes.

Plus en détail

Bleu comme un Schtroumpf Démarche d investigation

Bleu comme un Schtroumpf Démarche d investigation TP Bleu comme un Schtroumpf Démarche d investigation Règles de sécurité Blouse, lunettes de protection, pas de lentilles de contact, cheveux longs attachés. Toutes les solutions aqueuses seront jetées

Plus en détail

Plateforme Transgenèse/Zootechnie/Exploration Fonctionnelle IBiSA. «Anexplo» Service Transgenèse. Catalogue des prestations

Plateforme Transgenèse/Zootechnie/Exploration Fonctionnelle IBiSA. «Anexplo» Service Transgenèse. Catalogue des prestations Plateforme Transgenèse/Zootechnie/Exploration Fonctionnelle IBiSA «Anexplo» Service Transgenèse Catalogue des prestations 04/01/12 - Page 1 sur 8 Présentation du service de Transgenèse Le service de Transgenèse

Plus en détail

MODE D EMPLOI DU LOGICIEL LIGNES DE TEMPS A partir du film La Mort aux trousses d Alfred Hitchcock

MODE D EMPLOI DU LOGICIEL LIGNES DE TEMPS A partir du film La Mort aux trousses d Alfred Hitchcock MODE D EMPLOI DU LOGICIEL LIGNES DE TEMPS A partir du film La Mort aux trousses d Alfred Hitchcock Pour ouvrir un projet Pour ouvrir un fichier projet, lancez Lignes de temps et cliquez sur Fichier ->

Plus en détail

Se repérer dans l écran de Foxmail

Se repérer dans l écran de Foxmail Se repérer dans l écran de Foxmail Fenêtre des dossiers 4 5 Les noms qui ont été rentrés dans le carnet d adresses apparaissent ici. Un double-clic sur le nom lance la fenêtre «Nouveau Message» pas besoin

Plus en détail

AGRÉGATION DE SCIENCES DE LA VIE - SCIENCES DE LA TERRE ET DE L UNIVERS

AGRÉGATION DE SCIENCES DE LA VIE - SCIENCES DE LA TERRE ET DE L UNIVERS AGRÉGATION DE SCIENCES DE LA VIE - SCIENCES DE LA TERRE ET DE L UNIVERS CONCOURS EXTERNE ÉPREUVES D ADMISSION session 2010 TRAVAUX PRATIQUES DE CONTRE-OPTION DU SECTEUR A CANDIDATS DES SECTEURS B ET C

Plus en détail

Mise en pratique : Etude de spectres

Mise en pratique : Etude de spectres Mise en pratique : Etude de spectres Introduction La nouvelle génération de spectromètre à détecteur CCD permet de réaliser n importe quel spectre en temps réel sur toute la gamme de longueur d onde. La

Plus en détail

Chapitre 2 - Complexité des relations entre génotype et phénotype

Chapitre 2 - Complexité des relations entre génotype et phénotype Chapitre 2 - Complexité des relations entre génotype et phénotype Chaque chromosome est en double exemplaire Donc chaque gène (situé sur son locus) est en double exemplaires : et peut être sous différente

Plus en détail

ROTOLINE NOTICE DE POSE

ROTOLINE NOTICE DE POSE ROTOLINE NOTICE DE POSE Nous vous remercions d avoir choisi le Système ROTOLINE pour ouvrir votre portail. Veuillez lire attentivement cette notice, vous serez à même de faire fonctionner ce système correctement.

Plus en détail

RAPPORT SUR LE CONCOURS D ADMISSION AUX ÉCOLES NATIONALES VÉTÉRINAIRES CONCOURS B ENV

RAPPORT SUR LE CONCOURS D ADMISSION AUX ÉCOLES NATIONALES VÉTÉRINAIRES CONCOURS B ENV Ministère de l'agriculture et de la pêche Service des Concours Agronomiques et Vétérinaires RAPPORT SUR LE CONCOURS D ADMISSION AUX ÉCOLES NATIONALES VÉTÉRINAIRES CONCOURS B ENV Session 2005 Ministère

Plus en détail

Bases moléculaires des mutations Marc Jeanpierre

Bases moléculaires des mutations Marc Jeanpierre Bases moléculaires des mutations Marc Jeanpierre Chaque enfant qui naît hérite de 10 à 30 nouvelles mutations ponctuelles. L essentiel des ces mutations sont heureusement des variations neutres de séquence

Plus en détail

TABLEAU CROISE DYNAMIQUE

TABLEAU CROISE DYNAMIQUE TABLEAU CROISE DYNAMIQUE Cours Excel 3 ème Partie LEA3 Page 1 Cours Excel 3 ème Partie LEA3 Page 2 FILTRER UN CHAMP Il y a des moments ou vous ne voulez pas avoir une vision globale des données mais plutôt

Plus en détail

TRAVAUX PRATIQUESDE BIOCHIMIE L1

TRAVAUX PRATIQUESDE BIOCHIMIE L1 TRAVAUX PRATIQUESDE BICHIMIE L1 PRINTEMPS 2011 Les acides aminés : chromatographie sur couche mince courbe de titrage Etude d une enzyme : la phosphatase alcaline QUELQUES RECMMANDATINS IMPRTANTES Le port

Plus en détail

10. Instruments optiques et Microscopes Photomètre/Cuve

10. Instruments optiques et Microscopes Photomètre/Cuve 0. Instruments s et Microscopes GENERAL CATALOGUE 00/ Cuve à usage unique pour spectrophotomètre Cuve jetable, moulée en et en pour UV. Avec parois traitées Kartell ment pour une transparence optimale

Plus en détail

Compétence 3-1 S EXPRIMER A L ECRIT Fiche professeur

Compétence 3-1 S EXPRIMER A L ECRIT Fiche professeur Compétence 3-1 S EXPRIMER A L ECRIT Fiche professeur Nature de l activité : Réaliser 3 types de productions écrites (réécriture de notes, production d une synthèse de documents, production d une argumentation)

Plus en détail

LA TRANSMISSION DES CARACTÈRES

LA TRANSMISSION DES CARACTÈRES LA TRANSMISSION DES CARACTÈRES HÉRÉDITAIRES BIO-5065-2 GUIDE D APPRENTISSAGE BIOLOGIE Janvier 2005 Version révisée (avril 2005) 2 Ce document, produit par la Commission scolaire Marie-Victorin, reprend

Plus en détail

Collecter des informations statistiques

Collecter des informations statistiques Collecter des informations statistiques FICHE MÉTHODE A I Les caractéristiques essentielles d un tableau statistique La statistique a un vocabulaire spécifique. L objet du tableau (la variable) s appelle

Plus en détail

Les renseignements suivants sont destinés uniquement aux personnes qui ont reçu un diagnostic de cancer

Les renseignements suivants sont destinés uniquement aux personnes qui ont reçu un diagnostic de cancer Information importante pour les personnes atteintes d un cancer du poumon non à petites cellules de stade avancé Les renseignements suivants sont destinés uniquement aux personnes qui ont reçu un diagnostic

Plus en détail

POSTE INFORMATIQUE. Mr DUJARDIN a acheté du matériel informatique sur une boutique en ligne afin de se monter un PC. N'y

POSTE INFORMATIQUE. Mr DUJARDIN a acheté du matériel informatique sur une boutique en ligne afin de se monter un PC. N'y NOM : Prénom : Classe : POSTE INFORMATIQUE Date : CI4 : TRANSPORT & TRANSMISSION DES SIGNAUX SUPPORT DE L INFORMATION AVM11 : Assemblage d un poste informatique Problématique Mr DUJARDIN a acheté du matériel

Plus en détail

Introduction au Monde VégétalV. Les Champignons. Les Algues. Introduction au Monde Animal. Les Invertébr. (Les Lichens)

Introduction au Monde VégétalV. Les Champignons. Les Algues. Introduction au Monde Animal. Les Invertébr. (Les Lichens) Enseignement de Biologie des Organismes 11 ère ère année de de Licence DEUG STS STPIBGS Introduction au Monde VégétalV Les Champignons Les Algues Introduction au Monde Animal Les Invertébr brés (Les Lichens)

Plus en détail

Objectifs pédagogiques : spectrophotomètre Décrire les procédures d entretien d un spectrophotomètre Savoir changer l ampoule d un

Objectifs pédagogiques : spectrophotomètre Décrire les procédures d entretien d un spectrophotomètre Savoir changer l ampoule d un CHAPITRE 6 : LE SPECTROPHOTOMETRE Objectifs pédagogiques : Citer les principaux éléments d un dun spectrophotomètre Décrire les procédures d entretien d un spectrophotomètre p Savoir changer l ampoule

Plus en détail

Séquence 6. Mais ces espèces pour autant ne sont pas identiques et parfois d ailleurs ne se ressemblent pas vraiment.

Séquence 6. Mais ces espèces pour autant ne sont pas identiques et parfois d ailleurs ne se ressemblent pas vraiment. Sommaire Séquence 6 Nous avons vu dans les séances précédentes qu au cours des temps géologiques des espèces différentes se sont succédé, leur apparition et leur disparition étant le résultat de modifications

Plus en détail

Enquête sur le don de moelle osseuse

Enquête sur le don de moelle osseuse Enquête sur le don de moelle osseuse Réalisée auprès des étudiants de première année à l Université de Poitiers en septembre 2012 En France, pour que leur vie continue, 2 400 malades ont besoin d un don

Plus en détail

SEQUENÇAGE LI-COR DNA 4200

SEQUENÇAGE LI-COR DNA 4200 SEQUENÇAGE LI-COR DNA 4200 Le gel de séquence contient 64 puits au maximum soit 16 clones traités en parallèle. Les oligos utilisés (modifiés en 5 ) fluorescent à 700/800 nm. Une amorce permet de séquencer

Plus en détail

pka D UN INDICATEUR COLORE

pka D UN INDICATEUR COLORE TP SPETROPHOTOMETRIE Lycée F.BUISSON PTSI pka D UN INDIATEUR OLORE ) Principes de la spectrophotométrie La spectrophotométrie est une technique d analyse qualitative et quantitative, de substances absorbant

Plus en détail

Test d immunofluorescence (IF)

Test d immunofluorescence (IF) Test d immunofluorescence (IF) 1.1 Prélèvement du cerveau et échantillonnage Avant toute manipulation, il est fondamental de s assurer que tout le personnel en contact avec un échantillon suspect soit

Plus en détail

Prezi. Table des matières

Prezi. Table des matières Prezi Table des matières 1. Inscription... 2 2. ouvrir prezi... 4 3. créer une nouvelle présentation... 4 3.1. Ajout de texte... 5 3.2. Modifier (éditer) le texte... 5 3.3. Insérer une image... 5 3.4.

Plus en détail

Biochimie I. Extraction et quantification de l hexokinase dans Saccharomyces cerevisiae 1. Assistants : Tatjana Schwabe Marcy Taylor Gisèle Dewhurst

Biochimie I. Extraction et quantification de l hexokinase dans Saccharomyces cerevisiae 1. Assistants : Tatjana Schwabe Marcy Taylor Gisèle Dewhurst Biochimie I Extraction et quantification de l hexokinase dans Saccharomyces cerevisiae 1 Daniel Abegg Sarah Bayat Alexandra Belfanti Assistants : Tatjana Schwabe Marcy Taylor Gisèle Dewhurst Laboratoire

Plus en détail

Variables Aléatoires. Chapitre 2

Variables Aléatoires. Chapitre 2 Chapitre 2 Variables Aléatoires Après avoir réalisé une expérience, on ne s intéresse bien souvent à une certaine fonction du résultat et non au résultat en lui-même. Lorsqu on regarde une portion d ADN,

Plus en détail

PARTIE I Compte pour 75 %

PARTIE I Compte pour 75 % PARTIE I Compte pour 75 % Instructions : Noircissez la lettre correspondant à la bonne réponse sur la feuille de réponse fournie. 1. Dans le diagramme, quelles structures font partie du système nerveux

Plus en détail

Indicateur d'unité Voyant Marche/Arrêt

Indicateur d'unité Voyant Marche/Arrêt Notice MESURACOLOR Colorimètre à DEL Réf. 22020 Indicateur d'unité Voyant Marche/Arrêt Indicateur Etalonnage Bouton Marche/Arrêt Indicateur de sélection de la longueur d'onde Indicateur de mode chronomètre

Plus en détail

Stage : "Développer les compétences de la 5ème à la Terminale"

Stage : Développer les compétences de la 5ème à la Terminale Stage : "Développer les compétences de la 5ème à la Terminale" Session 2014-2015 Documents produits pendant le stage, les 06 et 07 novembre 2014 à FLERS Adapté par Christian AYMA et Vanessa YEQUEL d après

Plus en détail

Comment utiliser WordPress»

Comment utiliser WordPress» Comment utiliser WordPress» Comment utiliser WordPress» Table des matières» Table des matières Guide de démarrage rapide»... 2 Tableau de bord de WordPress»... 3 Rédiger un article»... 3 Modifier l article»...

Plus en détail

Suivi d une réaction lente par chromatographie

Suivi d une réaction lente par chromatographie TS Activité Chapitre 8 Cinétique chimique Suivi d une réaction lente par chromatographie Objectifs : Analyser un protocole expérimental de synthèse chimique Analyser un chromatogramme pour mettre en évidence

Plus en détail

MISE EN SERVICE D UN RESEAU DE CAMERA DE VIDEOSURVEILLANCE

MISE EN SERVICE D UN RESEAU DE CAMERA DE VIDEOSURVEILLANCE ACTIVITE de FORMATION ACTIVITE : MISE EN SERVICE D UN RESEAU DE CAMERA DE VIDEOSURVEILLANCE CONDITIONS D EXERCICE - Moyens et Ressources @ TAXONOMIE 1 2 3 4 Internet Logiciel Doc. PC Outillages Matériels

Plus en détail

Préface. Les étudiants de l Association des Médecins et Pharmaciens du Coeur (AMPC)

Préface. Les étudiants de l Association des Médecins et Pharmaciens du Coeur (AMPC) Préface Notre association regroupe les énergies bénévoles d étudiants en médecine et en pharmacie, avec pour objectif d aider et accompagner enfants, adolescents et jeunes adultes confrontés à la maladie.

Plus en détail

Que faire lorsqu on considère plusieurs variables en même temps?

Que faire lorsqu on considère plusieurs variables en même temps? Chapitre 3 Que faire lorsqu on considère plusieurs variables en même temps? On va la plupart du temps se limiter à l étude de couple de variables aléatoires, on peut bien sûr étendre les notions introduites

Plus en détail

Adobe Illustrator Logiciel de dessin vectoriel et de Cartographie Assistée par Ordinateur

Adobe Illustrator Logiciel de dessin vectoriel et de Cartographie Assistée par Ordinateur Adobe Illustrator Logiciel de dessin vectoriel et de Cartographie Assistée par Ordinateur I- Ouverture d une nouvelle feuille de travail Fichier / Nouveau (ou ctrl + N) Indiquer dans la fenêtre qui s ouvre

Plus en détail

Guide d usage pour Word 2007

Guide d usage pour Word 2007 Formation TIC Septembre 2012 florian.jacques@etsup.com Guide d usage pour Word 2007 ETSUP 8 villa du Parc Montsouris 75014 PARIS SOMMAIRE Interface... 2 Organiser son espace de travail... 3 La barre d

Plus en détail

La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST.

La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST. La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST. Gaël Le Mahec - p. 1/12 L algorithme BLAST. Basic Local Alignment Search Tool est un algorithme de recherche

Plus en détail

Les tests génétiques à des fins médicales

Les tests génétiques à des fins médicales Les tests génétiques à des fins médicales Les tests génétiques à des fins médicales Nous avons tous hérité d une combinaison unique de gènes de la part de nos parents. Cette constitution originale et l

Plus en détail

(aq) sont colorées et donnent à la solution cette teinte violette, assimilable au magenta.»

(aq) sont colorées et donnent à la solution cette teinte violette, assimilable au magenta.» Chapitre 5 / TP 1 : Contrôle qualité de l'eau de Dakin par dosage par étalonnage à l'aide d'un spectrophotomètre Objectif : Vous devez vérifier la concentration massique d'un désinfectant, l'eau de Dakin.

Plus en détail

Résonance Magnétique Nucléaire : RMN

Résonance Magnétique Nucléaire : RMN 21 Résonance Magnétique Nucléaire : RMN Salle de TP de Génie Analytique Ce document résume les principaux aspects de la RMN nécessaires à la réalisation des TP de Génie Analytique de 2ème année d IUT de

Plus en détail

Production d une protéine recombinante

Production d une protéine recombinante 99 Production d une protéine recombinante Lic. B. PIRSON Lic. J-M. SERONT ISICHt - Mons Production de la protéine recombinante GFP (Green Fluorescent Protein d Aequoria victoria) par une bactérie ( E.

Plus en détail

Chapitre 2 : Caractéristiques du mouvement d un solide

Chapitre 2 : Caractéristiques du mouvement d un solide Chapitre 2 : Caractéristiques du mouvement d un solide I Rappels : Référentiel : Le mouvement d un corps est décris par rapport à un corps de référence et dépend du choix de ce corps. Ce corps de référence

Plus en détail

Université de Montréal. Développement d outils pour l analyse de données de ChIP-seq et l identification des facteurs de transcription

Université de Montréal. Développement d outils pour l analyse de données de ChIP-seq et l identification des facteurs de transcription Université de Montréal Développement d outils pour l analyse de données de ChIP-seq et l identification des facteurs de transcription par Eloi Mercier Département de bioinformatique Faculté de médecine

Plus en détail

IMMUNOLOGIE. La spécificité des immunoglobulines et des récepteurs T. Informations scientifiques

IMMUNOLOGIE. La spécificité des immunoglobulines et des récepteurs T. Informations scientifiques IMMUNOLOGIE La spécificité des immunoglobulines et des récepteurs T Informations scientifiques L infection par le VIH entraîne des réactions immunitaires de l organisme qui se traduisent par la production

Plus en détail

Vieillissement moléculaire et cellulaire

Vieillissement moléculaire et cellulaire Vieillissement moléculaire et cellulaire Yves Courtois Lorsque, en 1961, Léonard HAYFLICK, aux USA, re - mit en cause le concept général de l'immortalité des cellules, il apportait à la recherche en gérontologie

Plus en détail

www.gbo.com/bioscience 1 Culture Cellulaire Microplaques 2 HTS- 3 Immunologie/ HLA 4 Microbiologie/ Bactériologie Containers 5 Tubes/ 6 Pipetage

www.gbo.com/bioscience 1 Culture Cellulaire Microplaques 2 HTS- 3 Immunologie/ HLA 4 Microbiologie/ Bactériologie Containers 5 Tubes/ 6 Pipetage 2 HTS 3 Immunologie / Immunologie Informations Techniques 3 I 2 ELISA 96 Puits 3 I 4 ELISA 96 Puits en Barrettes 3 I 6 en Barrettes de 8 Puits 3 I 7 en Barrettes de 12 Puits 3 I 8 en Barrettes de 16 Puits

Plus en détail

eedd LA PLANETE N EST PAS UNE POUBELLE 1/7

eedd LA PLANETE N EST PAS UNE POUBELLE 1/7 eedd LA PLANETE N EST PAS UNE POUBELLE 1/7 I- ETUDE D UNE PHOTOGRAPHIE DE YANN ARTHUS-BERTRAND : Stockage d ordures dans la périphérie de Saint-Domingue en République dominicaine au cœur des Caraïbes Légende

Plus en détail

TP : Suivi d'une réaction par spectrophotométrie

TP : Suivi d'une réaction par spectrophotométrie Nom : Prénom: n groupe: TP : Suivi d'une réaction par spectrophotométrie Consignes de sécurité de base: Porter une blouse en coton, pas de nu-pieds Porter des lunettes, des gants (en fonction des espèces

Plus en détail

"La collimation est la première cause de mauvaises images dans les instruments amateurs" Walter Scott Houston

La collimation est la première cause de mauvaises images dans les instruments amateurs Walter Scott Houston "La collimation est la première cause de mauvaises images dans les instruments amateurs" Walter Scott Houston F.Defrenne Juin 2009 Qu est-ce que la collimation en fait? «Newton»? Mais mon télescope est

Plus en détail

TD : Codage des images

TD : Codage des images TD : Codage des images Les navigateurs Web (Netscape, IE, Mozilla ) prennent en charge les contenus textuels (au format HTML) ainsi que les images fixes (GIF, JPG, PNG) ou animée (GIF animée). Comment

Plus en détail

Conférence technique internationale de la FAO

Conférence technique internationale de la FAO Décembre 2009 ABDC-10/7.2 F Conférence technique internationale de la FAO Biotechnologies agricoles dans les pays en développement: choix et perspectives pour les cultures, les forêts, l élevage, les pêches

Plus en détail

Séquence 4 : Objet/objet technique, besoin, Fonct. d usage, F. d estime. Séance sur l objet/objet technique, besoin, Fonct.

Séquence 4 : Objet/objet technique, besoin, Fonct. d usage, F. d estime. Séance sur l objet/objet technique, besoin, Fonct. Séquence 4 : Objet/objet technique, besoin, Fonct. d usage, F. d estime Séance sur l objet/objet technique, besoin, Fonct. d usage Situation Je distribue une poche avec 3 objets techniques et 3 objets

Plus en détail

Hépatite B. Le virus Structure et caractéristiques 07/02/2013

Hépatite B. Le virus Structure et caractéristiques 07/02/2013 Hépatite B Le virus Structure et caractéristiques o o o Famille des Hepadnaviridae Genre orthohepadnavirus Enveloppé, capside icosaédrique, 42 nm 1 Le virus Structure et caractéristiques En microscopie

Plus en détail

La Clé informatique. Formation Excel XP Aide-mémoire

La Clé informatique. Formation Excel XP Aide-mémoire La Clé informatique Formation Excel XP Aide-mémoire Septembre 2005 Table des matières Qu est-ce que le logiciel Microsoft Excel?... 3 Classeur... 4 Cellule... 5 Barre d outil dans Excel...6 Fonctions habituelles

Plus en détail

Cellules procaryotes Service histologie Pr.k.mebarek

Cellules procaryotes Service histologie Pr.k.mebarek Cellules procaryotes Service histologie Pr.k.mebarek I) Les cellules procaryotes II) Les cellules eucaryotes o 1) Caractéristiques générales des cellules eucaryotes o 2) Organisation des cellules eucaryotes

Plus en détail

Génétique et génomique Pierre Martin

Génétique et génomique Pierre Martin Génétique et génomique Pierre Martin Principe de la sélections Repérage des animaux intéressants X Accouplements Programmés Sélection des meilleurs mâles pour la diffusion Index diffusés Indexation simultanée

Plus en détail