Travaux dirigés de Biologie Moléculaire 8 semaine 10

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimension: px
Commencer à balayer dès la page:

Download "Travaux dirigés de Biologie Moléculaire 8 semaine 10"

Transcription

1 Travaux dirigés de Biologie Moléculaire 8 semaine 10

2 Exercice 23 : Question 1

3 Gène Sous-unité Poids Fonction Rpo A 2 α 40 kda chacune Assemblage de l enzyme Reconnaissance du promoteur Rpo B β 155 Centre catalytique Rpo C β 160 Centre catalytique Rpo (D) Sigma Spécificité du promoteur

4

5 Exercice 23 : Question 2

6 ARN polymérase d E. coli

7 Modèles possibles d organisation de la région arop Cas 1 : la séquence reconnue par TyrR se situe en amont du motif -35 séquence reconnue par TyrR CTT TTGATC AACAAT Protéine TyrR ARN polymérase Cas 2 : la séquence reconnue par TyrR se situe en aval du +1 CTT TTGATC AACAAT séquence reconnue par TyrR ARN polymérase Protéine TyrR Cas 3 : la séquence reconnue par TyrR se situe entre 35 & -10 séquence reconnue par TyrR CTT TTGATC AACAAT Protéine TyrR ARN polymérase

8 Organisation (réelle) du promoteur arop (promoteur P2) CTT TTGATC AACAAT «fort» «faible» boîte 1 boîte 2-44 ARN polymérase +24 direction de la transcription Protéine TyrR région en amont («upstream») direction opposée à la direction de l ARN polymérase région en aval («downstream») +1 : site d initiation de la transcription

9 Exercice 23, question 4

10 UTP (Uridine Tri Phosphate) dans l ARN

11 Exercice 23, question 6 : ARN Pol chez les eucaryotes les cellules eucaryotes renferment 3 types d ARN pol ces ARN Pol, toutes nucléaires, diffèrent selon les ARN qu elles synthétisent. Type d ARN pol Localisation ARN synthétisés Pol I Nucléole Précurseurs de la plupart des ARNr Pol II Nucléoplasme Précurseurs des ARNm Pol III Nucléoplasme Précurseurs de l ARNr 5s ARNt Différents petits ARN nucléaires et cytosoliques Il existe également des ARN Pol mitochondriales et (chez les plantes) chloroplastiques

12 Exercice 24

13 Transcription procaryote Transcription eucaryote

14

15 +1 Site d'initiation de la transcription 5'- TGGAGGGTATTGACAGCTGCTGCCGCCACTATATTCTCAATAGGTCCACGGCCGG -3' 3'- ACCTCCCATAACTGTCGACGACGGCGGTGATATAAGAGTTCTCCAGGTGCCGGCC -5' séquence 35 séquence -10 ou boite de Pribnow ARN: 5 - AGGUCCACGGCCGG -3 Promoteur typique de cellules d'e. coli montrant la séquence -10 (ou boite de Pribnow), la séquence -35 et le site d'initiation de la transcription Site d'initiation de la transcription 5'- TCACATTTTGTATATAAACTAGCTCCCGAGCCCTAAACTTCATACAGATTCCCAG -3' (brin sens) 3'- AGTGTAAAACATATATTTGATCGAGGGCTCGGGATTTGAAGTATGTCTAAGGGTC -5' (matrice d'adn) Boite TATA ARN : 5'- AUACAGAUUCCCAG...-3' Promoteur (minimal) typique de cellules eucaryotes montrant la boite TATA située environ 30 bp en amont du site d'initiation de la transcription.

16 Eukaryotic transcription

17 Exercice 21

18 Travaux dirigés de Biologie Moléculaire 8 Correction Contrôle continu n 2

19 Exercice n 1 (2 pts) L ADN d E. coli marqué au 15 N présente une densité de 1,724 g/ml ; lorsque cet ADN renferme du 14 N, il a une densité de 1,710g/ml. La bactérie E. coli est tout d abord cultivée pendant plusieurs générations en utilisant un milieu de culture renfermant comme seule source d azote du 14 NH4 puis, dans un second temps, la biomasse obtenue est transférée dans un milieu renfermant du 15 NH4. Quelle sera la densité de l ADN après une génération? Faire un schéma.

20 Exercice n 2 (4 pts) La méthylation de la guanine sur l oxygène en position 6 par la nitrosoguanidine provoque, après réplication, la transition GC-AT ; expliquer comment (faire un schéma au dos). (Rappel : la méthyl-o6 guanine peut s apparier avec la thymine) G C méthylation G me C réplication G me T G C Réparation puis réplication réplication réplication G C A T G me T A T G C G C

21 Exercice n 3 (4 pts) L absorption de l énergie de la lumière UV provoque de nombreuses réactions photochimiques ; à côté des dimères de pyrimidine, il se forme ce que l on appelle les photoproduits 6-4 (atome n 6 d une base liée à l atome n 4 de la base adjacente sur le même brin). Parmi ceux-ci, les dimères cytosine (6-4) sont les plus abondants ; écrire la formule développée d un tel produit. Présenter brièvement le système de réparation qui permet d éliminer efficacement ces lésions.

22 Photoréactivation : élimination directe Système de réparation le plus efficace : 1 seule enzyme intervient et répare

23 Réparation par excision de nucléotides : Système de réparation plus complexe 2 molécules de UvrA et 1 molécule de UvrB forment un complexe qui se déplace le long de l'adn. Quand le complexe rencontre une lésion, un changement de conformation se produit qui entraîne une dénaturation locale de l'hélice d'adn et une pliure de 130. Le dimère d'uvra se dissocie de UvrB et l'endonucléase UvrC (excinuclease) se fixe et coupe le brin d'adn en deux sites séparés de 12 à 13 bases. UvrB et UvrC se dissocient et une hélicase déroule la région endommagée et relâche le brin de 12 nucléotides qui est dégradé. Le trou est comblé par l ADN polymérase I et recollé par la ligase.

24 Exercice n 4 (4 pts) L ADN du phage T2 est une molécule duplexe de Da. La tête de ce phage fait environ 210 nm de diamètre. Calculer la longueur de l ADN du phage T2 et comparer cette longueur à celle de la tête du virus. Conclure. (rappel : masse molaire d une pb : 660 g/mol) Calcul de la longueur de l ADN du phage T2 Nombre de paires de bases du génome du phage T2 : / 660 = pb ADN de type B => 0,34 nm entre 2 nucléotides adjacents, donc l ADN génomique fait x 0,34 = nm ou env. 62 μm. Comment un ADN de 62 μm de long peut loger dans une tête capsidale de 210 nm (0,2 μm)? En étant condensé.

25 Exercice n 4 1 Da = masse d 1 molécule de H (masse atomique) (1/12 ème de la masse d 1 atome de C) 1 g = masse d 1 mole de H (masse molaire) Retenir que : lorsqu une molécule a une masse atomique de y Da (ici un ADN double brin de Da), alors cette molécule aura une masse molaire de y g/mol (ici, cet ADN fera donc g/mol).

26 Exercice n 5 (3 pts) Comment est organisée l ARN polymérase d E. coli? Réponse attendue Pour information

27 Exercice n 6 (3 pts) Quand une expérience de transcription in vitro est faite en présence d inosine triphosphate (ITP) à la place du GTP, l efficacité de la terminaison de la transcription est diminuée. Pourquoi? (l inosine correspond à la 6-oxo-purine ; elle peut s apparier avec C, formant 2 liaisons H) Principe de la terminaison de transcription ITP => I=C => 2 liaisons H au lieu des 3 entre C et G => boucle instable

EXPRESSION DU PATRIMOINE GENETIQUE : LA TRANSCRIPTION DE L ADN

EXPRESSION DU PATRIMOINE GENETIQUE : LA TRANSCRIPTION DE L ADN EXPRESSION DU PATRIMOINE GENETIQUE : LA TRANSCRIPTION DE L ADN INTRODUCTION - DÉFINITION Rappel : définition moléculaire du gène 5 A B C 3 ARNm ARNr ARNt Protéine fonctionnelle Flux de l information génétique

Plus en détail

Cours de Biologie Moléculaire SVI- S5 ( )

Cours de Biologie Moléculaire SVI- S5 ( ) Cours de Biologie Moléculaire SVI- S5 (2014-15) Le dogme centrale de la Biologie Moléculaire Représente le mécanisme d expression de l information génétique (Francis Crick (fin des années 50) et Nature

Plus en détail

Du gène à la Protéine. Réplication Transcription Traduction

Du gène à la Protéine. Réplication Transcription Traduction Du gène à la Protéine Réplication Transcription Traduction Transfert bidirectionnel de «messages»; de protéines,etc.. Membrane Nucléaire ADN Information Information Réplication Dogme de la biologie moléculaire

Plus en détail

L3-BH01 Cours n 7 Réparation de l ADN

L3-BH01 Cours n 7 Réparation de l ADN S. Bourgerie 2006-07 L3-BH01 Cours n 7 Réparation de l AD Ce cours est présent sur le web à l adresse suivante : http://www.univ-orleans.fr/sciences/bichimie/l/ressources.htm Plan Introduction I- Erreurs

Plus en détail

Travaux dirigés de Biologie Moléculaire N 6 semaine 8

Travaux dirigés de Biologie Moléculaire N 6 semaine 8 Travaux dirigés de Biologie Moléculaire N 6 semaine 8 Exercice n 19 : figure 1 100 sauvage 100 survie cellulaire (%) 10 1 0,1 uvra reca uvra reca 10 1 0,1 uvra reca 0,01 0,01 5 10 Dose d UV (Joules/m 2

Plus en détail

FONCTIONS DES GENES, TRANSCRIPTION ET TRADUCTION

FONCTIONS DES GENES, TRANSCRIPTION ET TRADUCTION FONCTIONS DES GENES, TRANSCRIPTION ET TRADUCTION I. Transcription et propriétés de l ARN La transcription est la synthèse d un ARN à partir d un ADN double brin. La transcription est catalysée par une

Plus en détail

LA TRANSCRIPTION. II / MECANISME GENERAL DE LA TRANSCRIPTION :(schéma 1)

LA TRANSCRIPTION. II / MECANISME GENERAL DE LA TRANSCRIPTION :(schéma 1) FACULTE DE MEDECINE D ALGER MODULE DE GENETIQUE Dr BOUDIAF R. I / DEFINITION / GENERALITES : LA TRANSCRIPTION La transcription est la synthèse enzymatique de tous les ARNS à partir d un ADN matrice. Celle-ci

Plus en détail

Biologie cellulaire. Cours 8 : Synthèse des protéines

Biologie cellulaire. Cours 8 : Synthèse des protéines Département des Troncs Communs Sciences de la Nature Faculté des Sciences de la Nature et de la Vie Université Abderrahmane Mira de Bejaia Biologie cellulaire Cours 8 : Synthèse des protéines Année universitaire

Plus en détail

MÉCANISMES MOLÉCULAIRES DE L EXPRESSION DES GÉNES : LA TRANSCRIPTION DU DNA

MÉCANISMES MOLÉCULAIRES DE L EXPRESSION DES GÉNES : LA TRANSCRIPTION DU DNA MÉCANISMES MOLÉCULAIRES DE L EXPRESSION DES GÉNES : LA TRANSCRIPTION DU DNA I- INTRODUCTION - DÉFINITION Rappel : définition moléculaire du gène Expression moléculaire du gène Clase II A B C Transcription

Plus en détail

Réplication de l ADN

Réplication de l ADN 101-NYA-05 Cours 2 Afin de respecter les droits d auteur, à moins d avis contraire, toutes les figures présentées ont été prises dans le manuel suggéré au début de la session : Campbell, Neil A. 4 e Édition,

Plus en détail

ADN. Night tutorat UE 1

ADN. Night tutorat UE 1 ADN Night tutorat UE 1 L ADN est une molécule allongée qui peut être linéaire ou circulaire, elle subit également différent degrés de compaction. Chez les procaryotes: molécule généralement circulaire

Plus en détail

LA TRANSCRIPTION I. RAPPEL SUR LA STRUCTURE DE L ARN.

LA TRANSCRIPTION I. RAPPEL SUR LA STRUCTURE DE L ARN. LA TRANSCRIPTION La transcription est un processus biologique qui permet la synthèse d un ARN (Acide RiboNucléique) à partir d une matrice d ADN (Acide DésoxyRibonucléique). Ce processus correspond à une

Plus en détail

COURS N 7 DE BIOLOGIE CELLULAIRE : LA REPLICATION

COURS N 7 DE BIOLOGIE CELLULAIRE : LA REPLICATION COURS N 7 DE BIOLOGIE CELLULAIRE : LA REPLICATION - Processus qui permet de transmettre l information contenue dans l ADN de générations en générations - Phénomène qui permet de dupliquer l ADN (doublement

Plus en détail

Biologie Moléculaire

Biologie Moléculaire Biologie Moléculaire Sommaire Des liaisons chimiques à la structure des acides nucléiques La Transcription Maturation du transcrit La Traduction La Réplication Les Télomères 1 Des liaisons chimiques à

Plus en détail

Transcription. La transcription constitue l ensemble des mécanismes par lequel l ARNm (messager) est synthétisé

Transcription. La transcription constitue l ensemble des mécanismes par lequel l ARNm (messager) est synthétisé I. Introduction L ADN est le support de l information génétique, son expression en protéines passe par l intermédiaire d une macromolécule représentée par l acide ribonucléique (ARN) II. Définition de

Plus en détail

Du gène à la protéine Campbell, 4 ème édition, chapitre 17. Automne 2013, 101-NYA-05

Du gène à la protéine Campbell, 4 ème édition, chapitre 17. Automne 2013, 101-NYA-05 Du gène à la protéine Campbell, 4 ème édition, chapitre 17 Automne 2013, 101-NYA-05 1 Objectif général à l issue de ce cours Schématiser les principales étapes de la synthèse des protéines en identifiant

Plus en détail

BIOCHIMIE ET BIOLOGIE MOLECULAIRE Biochimie des acides nucléiques et de l information génétique (Professeur Joël Lunardi - PCEM )

BIOCHIMIE ET BIOLOGIE MOLECULAIRE Biochimie des acides nucléiques et de l information génétique (Professeur Joël Lunardi - PCEM ) BIOCHIMIE ET BIOLOGIE MOLECULAIRE Biochimie des acides nucléiques et de l information génétique (Professeur Joël Lunardi - PCEM1 2006-2007) CHAPITRE 1. INTRODUCTION CHAPITRE 2. LES ACIDES NUCLEIQUES I.

Plus en détail

Bases moléculaires de l hérédité et du gène à la protéine Phage injecte matériel génétique (ADN ou protéines) dans E.coli. Protéines marquées

Bases moléculaires de l hérédité et du gène à la protéine Phage injecte matériel génétique (ADN ou protéines) dans E.coli. Protéines marquées Bases moléculaires de l hérédité et du gène à la protéine Phage injecte matériel génétique (ADN ou protéines) dans E.coli Phage injecte matériel génétique (ADN ou protéines) dans E.coli Phage injecte matériel

Plus en détail

Consultations Martinique / Guyane. Activité LABORATOIRE. Dr Odile Béra, CHU de Fort-de-France. Unité Oncogénétique

Consultations Martinique / Guyane. Activité LABORATOIRE. Dr Odile Béra, CHU de Fort-de-France. Unité Oncogénétique Dr Odile Béra, CHU de Fort-de-France Unité Oncogénétique Unité Génétique moléculaire des cancers Consultations Martinique / Guyane Prédisposition génétique cancers SEIN/OVAIRES COLON (Sd de Lynch & PAF)

Plus en détail

III/De la structure à la fonction.. Le B.A.-ba Principes généraux la réplication/la transcription/la traduction

III/De la structure à la fonction.. Le B.A.-ba Principes généraux la réplication/la transcription/la traduction III/De la structure à la fonction.. Le B.A.-ba Principes généraux la réplication/la transcription/la traduction Attention! Seuls les concepts généraux seront explicités en cours Mais vous pouvez approfondir

Plus en détail

Le noyau. Pr Edith CHEVRET Année

Le noyau. Pr Edith CHEVRET Année Le noyau Pr Edith CHEVRET Année 2016-2017 Plan Le noyau Image : Laboratoire de pathologie comparée, Saint Christol-lez-Alès Marc Ravallec / CNRS-INRA- Université Montpellier 2 2 Plan I. Définition II.

Plus en détail

Chapitre VI : LE NOYAU

Chapitre VI : LE NOYAU Chapitre VI : LE NOYAU Le noyau est le plus gros organite cellulaire. Il a une forme sphérique ou ovale et entouré par une enveloppe membranaire qui le sépare du cytoplasme. Sa position dans la cellule

Plus en détail

CHAPITRE III : Synthèse Protéique. ADN ARN Protéines

CHAPITRE III : Synthèse Protéique. ADN ARN Protéines CHAPITRE III : Synthèse Protéique Introduction : L information contenue dans l ADN, c'est-à-dire le matériel génétique, se présente sous forme de séquences nucléotidiques précises, alignées sur les brins

Plus en détail

Stage de Pré-Rentrée de Biochimie. Chapitre 3 : Biologie Moléculaire. Cours

Stage de Pré-Rentrée de Biochimie. Chapitre 3 : Biologie Moléculaire. Cours Stage de Pré-Rentrée de Biochimie Chapitre 3 : Biologie Moléculaire Cours 30 août 2013 1 Les acides nucléiques Il existe plusieurs types d'acides nucléiques, mais essentiellement deux vont nous intéresser,

Plus en détail

Cours de Biologie moléculaire de Licence professionnelle 2011

Cours de Biologie moléculaire de Licence professionnelle 2011 Cours de Biologie moléculaire de Licence professionnelle 2011 Sommaire 1. Introduction 2.1. La structure de l ADN 2.2. La structure de l ARN 2.3. Du gène à la protéine 2.3.1. La réplication 2.3.2. La transcription

Plus en détail

Structure secondaire (α-hélice, feuillet. Structure primaire enchaînement. Structure Tertiaire ---> fonction

Structure secondaire (α-hélice, feuillet. Structure primaire enchaînement. Structure Tertiaire ---> fonction Structure secondaire (α-hélice, feuillet ß ) Structure primaire enchaînement Structure Tertiaire ---> fonction Protéines Fonction Structure tridimensionnelle Structure primaire = enchaînement d acides

Plus en détail

Structure du gène Eucaryote, du gène Procaryote la Transcription, le Code génétique et la Traduction

Structure du gène Eucaryote, du gène Procaryote la Transcription, le Code génétique et la Traduction UNIVERSITE D ALGER Faculté de Médecine et de Médecine Dentaire ZIANIA (Château Neuf) Structure du gène Eucaryote, du gène Procaryote la Transcription, le Code génétique et la Traduction COURS DE GENETIQUE

Plus en détail

LA BIOLOGIE SYNTHETIQUE. Qu est-ce que c est?

LA BIOLOGIE SYNTHETIQUE. Qu est-ce que c est? LA BIOLOGIE SYNTHETIQUE Qu est-ce que c est? L ADN Qu est-ce: L ADN Molécule renfermant l'ensemble des informations nécessaires au développementet au fonctionnementd'un organisme. Support de l'hérédité:

Plus en détail

POSEZ VOS QUESTIONS de cours CI-DESSOUS :

POSEZ VOS QUESTIONS de cours CI-DESSOUS : POSEZ VOS QUESTIONS de cours CI-DESSOUS : 2. Groupe 6: Quelles sont les expériences qui ont permis de découvrir le code génétique (2 pts) et qu'est ce que l'effet Wobble (1 pt)? Ce sont 2 expériences différentes

Plus en détail

STRUCTURE ET FONCTION DES GÈNES ET DES CHROMOSOMES

STRUCTURE ET FONCTION DES GÈNES ET DES CHROMOSOMES Faculté de Médecine de Sousse Tunisie Année Universitaire 209-2010 Deuxième Année Médecine Support pédagogique illustré relatif au cours: STRUCTURE ET FONCTION DES GÈNES ET DES CHROMOSOMES Pr. Ag. ELGHEZAL

Plus en détail

Cours de physiologie Cellulaire LES RIBOSOMES

Cours de physiologie Cellulaire LES RIBOSOMES 1 LES RIBOSOMES I. Introduction Seul le microscope électronique permet d observer ces organites décrits pour la première fois par Palade en 1953. Présents dans toutes les cellules, les ribosomes sont situés

Plus en détail

Séance 5. Les Acides Nucléiques. 3. Conservation de l information génétique: Réplication semi-conservative de l ADN

Séance 5. Les Acides Nucléiques. 3. Conservation de l information génétique: Réplication semi-conservative de l ADN UNIVERSITE MOHAMMED V-AGDAL FACULTE DES SCIENCES Les Acides Nucléiques DEPARTEMENT DE BIOLOGIE Filière Sciences de la Vie (SVI) Module de Biochimie (M 11) Élément : Biochimie structurale - Semestre 3-2005-2006

Plus en détail

l Comparaison des différentes polymérases :

l Comparaison des différentes polymérases : La réplication et la réparation de l''adn I_ Le mécanisme de la réplication A. Généralités On dit que la réplication est semiconservative, c'estàdire que l'original est conservé. C'est un mécanisme très

Plus en détail

Cours Biologie cellulaire

Cours Biologie cellulaire Cours Biologie cellulaire GLBE102_ L1-S1 Le Noyau et la Transcription Généralités Un organite interphasique (disparaît en fin de prophase) Contient l ADN de la cellule = génome (sauf ADN mito. et chloroplastique)

Plus en détail

Chapitre 3 : La cellule bactérienne, génétique et synthèse protéique

Chapitre 3 : La cellule bactérienne, génétique et synthèse protéique Chapitre 3 : La cellule bactérienne, génétique et synthèse protéique Attention, ce cours suppose la connaissance de notions de base en génétique, notamment les notions de transcription, traduction ainsi

Plus en détail

Stage de Pré-Rentrée de Biochimie. Chapitre 3 : Biologie Moléculaire. Correction des exercices

Stage de Pré-Rentrée de Biochimie. Chapitre 3 : Biologie Moléculaire. Correction des exercices Stage de Pré-Rentrée de Biochimie Chapitre 3 : Biologie Moléculaire Correction des exercices 3 septembre 2013 1 Question 1 Parmi les séquences suivantes, laquelle s hybride parfaitement avec ce fragment?

Plus en détail

LA REPLICATION DE L ADN

LA REPLICATION DE L ADN LA REPLICATION DE L ADN I. INTRODUCTION. II. LA REPLICATION CHEZ LES PROCARYOTES. III. LA REPLICATION CHEZ LES EUCARYOTES. I. INTRODUCTION. La réplication permet de transmettre tout le patrimoine génétique,

Plus en détail

A T C G A T C G CORRECTION TD Ecole Manip RADIO (Montpellier) Base. Sucre 3. Base Purine Base Pyrimidine. G= Guanine C= Cytosine

A T C G A T C G CORRECTION TD Ecole Manip RADIO (Montpellier) Base. Sucre 3. Base Purine Base Pyrimidine. G= Guanine C= Cytosine CORRECTION TD 2 2011-2012 Question N1. Concernant la structure de l'adn (double brin) qu'elles sont la ou les réponses exactes? A) Dans un ADN, le rapport : nombre de A /nombre de G est égal à 1. B) Plus

Plus en détail

Réplication de l ADN

Réplication de l ADN Réplication de l ADN Généralités Premières notions La réplication C est l opération qui va permettre de perpétrer la molécule d ADN, support de l information génétique. C est une opération très complexe

Plus en détail

CHAPITRE 1 : LA REPRODUCTION CONFORME DE LA CELLULE ET LA RÉPLICATION DE L'ADN

CHAPITRE 1 : LA REPRODUCTION CONFORME DE LA CELLULE ET LA RÉPLICATION DE L'ADN CHAPITRE 1 : LA REPRODUCTION CONFORME DE LA CELLULE ET LA RÉPLICATION DE L'ADN RAPPELS : STRUCTURE DE L'ADN RAPPELS : STRUCTURE DE L'ADN Il existe différentes représentations possibles pour l'adn. Les

Plus en détail

CHAPITRE 2 : LES MUTATIONS : ORIGINE DE LA VARIABILITÉ GÉNÉTIQUE

CHAPITRE 2 : LES MUTATIONS : ORIGINE DE LA VARIABILITÉ GÉNÉTIQUE CHAPITRE 2 : LES MUTATIONS : ORIGINE DE LA VARIABILITÉ GÉNÉTIQUE LES DIFFÉRENTS TYPES DE MUTATION Lors de la réplication de l ADN en phase S, les ADN polymérases ajoutent 6,4 milliards de nucléotides (ensemble

Plus en détail

08/05/2016. La TRANSCRIPTION. Eucaryotes. La synthèse des protéines. Procaryotes. La TRANSCRIPTION. cours_bm_2015_transcription_pr_makrelouf 1

08/05/2016. La TRANSCRIPTION. Eucaryotes. La synthèse des protéines. Procaryotes. La TRANSCRIPTION. cours_bm_2015_transcription_pr_makrelouf 1 La TRANSCRIPTION La synthèse des protéines Eucaryotes Procaryotes La TRANSCRIPTION cours_bm_2015_transcription_pr_makrelouf 1 MÉCANISME GÉNÉRAL DE LA TRANSCRIPTION La transcription est une biosynthèse

Plus en détail

Cours Biologie cellulaire ULBI 101 _ L1-S1

Cours Biologie cellulaire ULBI 101 _ L1-S1 Cours Biologie cellulaire ULBI 101 _ L1-S1 RMI_Partie 2-1 Le Noyau et la Transcription 5- Définition des organites et des fonctions associées 5.1 Noyau : ADN et information génétique - Généralités - Structure

Plus en détail

BIOLOGIE MOLECULAIRE DU GENE

BIOLOGIE MOLECULAIRE DU GENE BIOLOGIE MOLECULAIRE DU GENE PLAN Cours I- Structure de l'adn et Polymorphisme Cours II- Structure du gène eucaryote et du gène procaryote Cours III - Le code génétique, les modifications post transcriptionnel

Plus en détail

REPLICATION DE L ADN

REPLICATION DE L ADN REPLICATION DE L ADN I/ Caractéristiques fondamentales de la réplication 1. Modèle de réplication: La réplication peut se faire suivant 3 modèles représentés sur la figure 1. -Modèle conservatif : Les

Plus en détail

Biologie moléculaire en 30 fiches

Biologie moléculaire en 30 fiches Philippe LETTA Biologie moléculaire en 0 fiches e édition Dunod, Paris, 00, 0 ISB --0-0- Table des matières Partie Structure Fiche onstituants Fiche Structure Fiche rganisation 0 Fiche ompaction Fiche

Plus en détail

QCM Biologie Moléculaire

QCM Biologie Moléculaire QCM Biologie Moléculaire 1. Information génétique 1. L information génétique eucaryote est supportée par : A. De l ADN B. De l ARN C. Des molécules bicaténaires de polymères de nucléotides D. Des séquences

Plus en détail

Procaryotes RÉGULATION DE L EXPRESSION GÉNÉTIQUE. 1. L opéron lactose

Procaryotes RÉGULATION DE L EXPRESSION GÉNÉTIQUE. 1. L opéron lactose Procaryotes RÉGULATION DE L EXPRESSION GÉNÉTIQUE 1. L opéron lactose STRUCTURE DU LACTOSE liaison β-galactosidique β-galactosidase galactose lactose glucose CROISSANCE BACTÉRIENNE EN PRÉSENCE DE GLUCOSE

Plus en détail

Chapitre 3 : L expression de l information génétique. Activité 1 : Les deux étapes de l expression de l information génétique

Chapitre 3 : L expression de l information génétique. Activité 1 : Les deux étapes de l expression de l information génétique Connaissances L'ADN contient des unités d'information appelées gènes. Le génome est l ensemble du matériel génétique d un organisme. Chez les eucaryotes, la transcription a lieu dans le noyau, la traduction

Plus en détail

Polytech UEF1. BONCOMPAGNI Éric MCU - Univ. Nice Sophia Antipolis Site WEB : sites.unice.fr/eb. Outils moléculaires pour l analyse des génomes

Polytech UEF1. BONCOMPAGNI Éric MCU - Univ. Nice Sophia Antipolis Site WEB : sites.unice.fr/eb. Outils moléculaires pour l analyse des génomes Polytech UEF1 BONCOMPAGNI Éric MCU - Univ. Nice Sophia Antipolis Site WEB : sites.unice.fr/eb Outils moléculaires pour l analyse des génomes Pourquoi la génétique moléculaire? La génétique formelle renseigne

Plus en détail

Information Génétique et hérédité 1- Réplication, mitose, méiose

Information Génétique et hérédité 1- Réplication, mitose, méiose Information Génétique et hérédité 1- Réplication, mitose, méiose REPLICATION DE L ADN et CYCLE CELLULAIRE quantité d'adn 4C 2C G 1 S G 2 M G 1 5 12 15 16 duplication de l'adn mitose temps heures CYCLE

Plus en détail

Partie 2: Expression génétique

Partie 2: Expression génétique belkadibouchra@yahoo.fr Faculté des Sciences - Rabat Laboratoire de Microbiologie et Biologie Moléculaire -------------------------------------- Université Mohamed V - Agdal Faculté des Sciences B.P. 1014

Plus en détail

ORGANISATION MOLÉCULAIRE DES GÈNES ET RÉPLICATION DE L ADN

ORGANISATION MOLÉCULAIRE DES GÈNES ET RÉPLICATION DE L ADN ORGANISATION MOLÉCULAIRE DES GÈNES ET RÉPLICATION DE L ADN I- Définition moléculaire du gène Génos qui donne naissance Classe II (structure) Classe III Classe I Gène A Gène B Gène C mrna trna rrna Protéines

Plus en détail

La division cellulaire Chapitre 5 Anatomie

La division cellulaire Chapitre 5 Anatomie La division cellulaire Chapitre 5 Anatomie La division cellulaire est le mode de multiplication de toute cellule. Elle lui permet de se diviser en plusieurs cellules-filles (deux le plus souvent). C'est

Plus en détail

Réplication de l ADN

Réplication de l ADN Réplication de l ADN Réplication de l ADN: expériences historiques I] Expérience de Meselson et Stahl Replication de l ADN est semie-conservative Expérience de Meselson et Stahl :1958 -Cultive E.Coli sur

Plus en détail

TD TRANSCRIPTION 1 I II III IV P σ. Radioactivité 125 cpm cpm 130 cpm cpm. α 2 ββ Marqueurs + + α 2 ββ. 3 kb.

TD TRANSCRIPTION 1 I II III IV P σ. Radioactivité 125 cpm cpm 130 cpm cpm. α 2 ββ Marqueurs + + α 2 ββ. 3 kb. TD TRANSCRIPTION 1 Problème 1 A) Un chercheur a cloné, dans un vecteur plasmidique, un insert de 5 kb, correspondant à une très petite portion du chromosome d Escherichia coli (génome complet d E. coli

Plus en détail

Les acides nucléiques

Les acides nucléiques Les acides nucléiques 1. Introduction 2. Structure de l'adn 3. Structure des ARN 4. Techniques d'études Introduction Reproduction = propriété essentielle des êtres vivants Chaque génération une copie du

Plus en détail

TRANSCRIPTION. Comment les gènes sont copiés en transcrits : ARN Comment les ARN sont utilisés comme modèles pour produire les protéines.

TRANSCRIPTION. Comment les gènes sont copiés en transcrits : ARN Comment les ARN sont utilisés comme modèles pour produire les protéines. TRANSCRIPTION Comment les gènes sont copiés en transcrits : ARN Comment les ARN sont utilisés comme modèles pour produire les protéines. I) Comparaison procaryotes et eucaryotes. A) Vue générale Procaryotes

Plus en détail

Chapitre III : Mécanismes moléculaires de l expression de l information génétique

Chapitre III : Mécanismes moléculaires de l expression de l information génétique Chapitre III : Mécanismes moléculaires de l expression de l information génétique Test de Brachet sur des cellules de racine d Oignon (M.O.) Le vert de méthyle colore en vert l ADN, la pyronine colore

Plus en détail

Réparation de l ADN. Généralités. Premières notions. Pourquoi une réparation sophistiquée de l ADN et pas de l ARN?

Réparation de l ADN. Généralités. Premières notions. Pourquoi une réparation sophistiquée de l ADN et pas de l ARN? Réparation de l ADN Généralités Premières notions Pourquoi une réparation sophistiquée de l ADN et pas de l ARN? Dans une cellule somatique il n y a que deux allèles (copies) d un gène donné et qui se

Plus en détail

STRUCTURE DE L ADN. L ADN est constitué d un ensemble de nucléosides dans leur forme monophosphate.

STRUCTURE DE L ADN. L ADN est constitué d un ensemble de nucléosides dans leur forme monophosphate. STRUCTURE DE L ADN I. STRUCTURE DE L ADN. II. STRUCTURE DE LA DOUBLE HELICE. III. ASPECT PHYSICO-CHIMIQUE DE L ADN. I. STRUCTURE DE L ADN. L ADN est constitué d un ensemble de nucléosides dans leur forme

Plus en détail

Cours Biologie cellulaire ULBI 101 _ L1-S1

Cours Biologie cellulaire ULBI 101 _ L1-S1 Cours Biologie cellulaire ULBI 101 _ L1-S1 RMI_Partie 2-2 Le Noyau et la Transcription 5- Définition des organites et des fonctions associées 5.1 Noyau : ADN et information génétique - Généralités - Structure

Plus en détail

COURS N 8 DE BIOLOGIE CELLULAIRE : LA TRANSCRIPTION

COURS N 8 DE BIOLOGIE CELLULAIRE : LA TRANSCRIPTION COURS N 8 DE BIOLOGIE CELLULAIRE : LA TRANSCRIPTION

Plus en détail

ORGANISATION DU GÉNOME 4ème séance 2016

ORGANISATION DU GÉNOME 4ème séance 2016 ORGANISATION DU GÉNOME 4ème séance 2016 Un Génome est l ensemble de l information héréditaire d un organisme, présente en totalité dans chaque cellule. Caractéristiques des génomes procaryotes: Chromosome

Plus en détail

C Les mutations sont aussi causées par des mutagènes chimiques selon 3 mécanismes : 5-Bromo-Uracile (5BU) et Thymine

C Les mutations sont aussi causées par des mutagènes chimiques selon 3 mécanismes : 5-Bromo-Uracile (5BU) et Thymine COURS N 2 DE BIOCHIMIE BIOLOGIE MOLECULAIRE : MUTATIONS - REPARATIONS La personne qui tape ces cours a découvert comment mettre de beaux trucs avec Word bref ça va limiter les paint tout pourris (mais

Plus en détail

Réplication de l ADN

Réplication de l ADN Réplication de l ADN L ADN des différents êtres vivants L ADN est la molécule universelle de l hérédité chromosomique : Même type de structure soit 2 brins chez tous les êtres vivants : ( animal, plante,

Plus en détail

Chapitre 7 Les acides nucléiques

Chapitre 7 Les acides nucléiques Chapitre 7 Les acides nucléiques Section 3: La réplication de l ADN http://highered.mcgrawhill.com/olcweb/cgi/pluginpop.cgi?it=swf::535::535::/sites/dl/free/0072 437316/120076/micro04.swf::DNA%20Replication%20Fork

Plus en détail

MÉCANISMES MOLÉCULAIRES DE L EXPRESSION DES GÉNES : LA TRADUCTION OU BIOSYNTHÈSE DES PROTÉINES

MÉCANISMES MOLÉCULAIRES DE L EXPRESSION DES GÉNES : LA TRADUCTION OU BIOSYNTHÈSE DES PROTÉINES MÉCANISMES MOLÉCULAIRES DE L EXPRESSION DES GÉNES : LA TRADUCTION OU BIOSYNTHÈSE DES PROTÉINES Le sens de lecture L ARN polymérase lit le brin matrice dans la direction 3 vers 5 de façon à synthétiser

Plus en détail

Enseignement de Biologie Cellulaire : Biologie Moléculaire

Enseignement de Biologie Cellulaire : Biologie Moléculaire Enseignement de Biologie Cellulaire : Biologie Moléculaire Université des Antilles-Guyane Première Année des Etudes de Santé Dr Maryse ETIENNE-JULAN-OTTO IV- La conservation de l ADN 1 Deux Mécanismes

Plus en détail

REGULATION DE L EXPRESSION DES GENES

REGULATION DE L EXPRESSION DES GENES REGULATION DE L EXPRESSION DES GENES 1. Circuits fondamentaux de contrôle Ce sont des circuits de contrôle permettant d ajuster les synthèses protéiques en fonction des besoins. Pour cela, les cellules

Plus en détail

LES BASES MOLECULAIRES DE L ORGANISATION DU GENOME HUMAIN

LES BASES MOLECULAIRES DE L ORGANISATION DU GENOME HUMAIN LES BASES MOLECULAIRES DE L ORGANISATION DU GENOME HUMAIN I. STRUCTURE DE L ADN Le génome humain est contenu dans des NOYAUX (EUCARYOTES) Petite quantité d ADN en dehors du noyau dans la MITOCHONDRIE Sous

Plus en détail

Tutorat Santé de Caen. Biologie moléculaire

Tutorat Santé de Caen. Biologie moléculaire Tutorat Santé de Caen Biologie moléculaire Structure des acides nucléiques Liaison ester entre le C5 de l ose et le phosphate Liaison N-Osidique entre le C1 de l ose et la base azotée NucléoTide = Phosphate

Plus en détail

Biologie moléculaire et Génie génétique

Biologie moléculaire et Génie génétique Université Mohamed Khider-Biskra Faculté des sciences exactes et des sciences de la nature et de la vie Département des sciences de la nature et de la vie Biologie moléculaire et Génie génétique Mr. BENSLAMA

Plus en détail

Variabilité et régulation de l expression génique

Variabilité et régulation de l expression génique BIOLOGIE CELLULAIRE - Stage de Pré-Rentrée UE1 - - 2010/2011 - Variabilité et régulation de l expression génique Objectifs Comprendre la séquence des différentes étapes menant du gène à la protéine Comprendre

Plus en détail

Thème 1A-Expression, stabilité et variation du programme génétique

Thème 1A-Expression, stabilité et variation du programme génétique Extrait du bulletin officiel : Thème 1. La Terre dans l Univers, la vie et l évolution du vivant Thème 1 - A Expression, stabilité et variation du patrimoine génétique Ce thème s appuie sur les connaissances

Plus en détail

Corrigé série N 2. Exercice 1 QCS (V/F)

Corrigé série N 2. Exercice 1 QCS (V/F) Exercice 1 Corrigé série N 2 QCS (V/F) V1-Les acides nucléiques sont des polymères de nucléotides F2-Un nucléotide est un enchaînement base glucide F3-Les bases azotées sont toutes complémentaires F4-Les

Plus en détail

COURS N 11 DE BIOLOGIE CELLULAIRE : NOYAU ET CYCLE CELLULAIRE

COURS N 11 DE BIOLOGIE CELLULAIRE : NOYAU ET CYCLE CELLULAIRE COURS N 11 DE BIOLOGIE CELLULAIRE : NOYAU ET CYCLE CELLULAIRE I Noyau : structure : - Pore Nucléaire : structure en panier de basket composée de 3 anneaux perpendiculaires à l axe ainsi que de filaments

Plus en détail

Outils de génie génétique 1.TERMINOLOGIE ENZYMES UTILISÉS SONDES MOLECULAIRE ET HYBRIDATION MOLECULAIRE

Outils de génie génétique 1.TERMINOLOGIE ENZYMES UTILISÉS SONDES MOLECULAIRE ET HYBRIDATION MOLECULAIRE Outils de génie génétique 1.TERMINOLOGIE ENZYMES UTILISÉS SONDES MOLECULAIRE ET HYBRIDATION MOLECULAIRE 1 Terminologie ADN recombinant : combinaison de deux molécules d ADN appartenant à deux espèces différentes;

Plus en détail

Fiche d exercices 8 : Patrimoine génétique

Fiche d exercices 8 : Patrimoine génétique Fiche d exercices 8 : Patrimoine génétique Exercice 1 Patrimoine génétique 1/9 2/9 Exercice 3 I-Restitution de connaissances 1- La séquence d un polypeptide a) est déterminée par la séquence des nucléotides

Plus en détail

CHAPITRE 3: La replication

CHAPITRE 3: La replication CHAPITRE 3: La replication A/ Definition La replication est une etape biochimiqiue qui permet de recopier de facon fidele (sans erreur au niveau des bases) la molecule d'adn. Elle porte egalment le nom

Plus en détail

L expression génétique REVUE

L expression génétique REVUE L expression génétique REVUE 1. Donne trois différences entre l ADN et l ARN. L Adn est le matériel génétique qui contrôle la synthèse des protéines, alors que l ARN aide l Adn et participe à la synthèse

Plus en détail

Fascicule d'exercices de biologie moléculaire Par Camille CHOCHOIS et Alexandre RICHARD

Fascicule d'exercices de biologie moléculaire Par Camille CHOCHOIS et Alexandre RICHARD Fascicule d'exercices de biologie moléculaire Par Camille CHOCHOIS et Alexandre RICHARD Ces exercices seront corrigés et expliqués dans l'armature de biologie moléculaire qui aura lieu le 15/11/12. Nous

Plus en détail

LES SYSTEMES DE REPARATION DE L'ADN

LES SYSTEMES DE REPARATION DE L'ADN ^. FACULTE DE MEDECINE D ALGER MODULE DE GENETIQUE Dr Boudiaf Benaferi R. LES SYSTEMES DE REPARATION DE L'ADN I / INTRODUCTION : La réplication et la conservation de la structure primaire de l'adn peuvent,

Plus en détail

Séance TUTORAT 3 24/11/2016

Séance TUTORAT 3 24/11/2016 Séance TUTORAT 3 24/11/2016 Programme M. Heydel Transcription Traduction Techniques exploration ADN M. Masson. TRANSCRIPTION en 5 et 3, régions UTR untraslated region = régions transcrites mais non traduites

Plus en détail

Chapitre 11 La régulation de l expression des gènes chez les bactéries et leurs virus

Chapitre 11 La régulation de l expression des gènes chez les bactéries et leurs virus Chapitre 11 La régulation de l expression des gènes chez les bactéries et leurs virus Une représentation du complexe répresseur lac-adn, telle qu elle a été déterminée par crystallographie aux rayons X

Plus en détail

La Réplication de l ADN

La Réplication de l ADN La Réplication de l ADN Année universitaire 2016-2017 Dr Hanachi.S I.Introduction Pendant le cycle Cellulaire, la cellule duplique son contenu puis se divise en deux - Nouvel organisme chez les êtres unicellulaires

Plus en détail

TUTORAT UE Séance n 10 Semaine du 24/11/2014 Transcription, traduction Pr Maudelonde et Cornillot

TUTORAT UE Séance n 10 Semaine du 24/11/2014 Transcription, traduction Pr Maudelonde et Cornillot TUTORAT UE1 2014-2015 Séance n 10 Semaine du 24/11/2014 Transcription, traduction Pr Maudelonde et Cornillot Séance préparée par Maxime MAUREY, Benjamin HAYOUN (TSN) QCM n 1 : A propos de la transcription,

Plus en détail

Séance 3. Les Acides Nucléiques. IV- Caractéristiques physicochimiques et fonctionnelles de l ADN

Séance 3. Les Acides Nucléiques. IV- Caractéristiques physicochimiques et fonctionnelles de l ADN UNIVERSITE MOHAMMED V-AGDAL FACULTE DES SCIENCES Les Acides Nucléiques DEPARTEMENT DE BIOLOGIE Filière Sciences de la Vie (SVI) Module de Biochimie (M 11) Elément : Biochimie structurale - Semestre 3-2005-2006

Plus en détail

Base moléculaire de l'hérédité structure de l'a.d.n et l'a.r.n

Base moléculaire de l'hérédité structure de l'a.d.n et l'a.r.n Base moléculaire de l'hérédité structure de l'a.d.n et l'a.r.n Introduction : La démonstration par Watson et Crick en 1953, que l acide désoxyribonucléique avait une structure en double hélice est considérée

Plus en détail

X- Rôles multiples de l ARN. A- L ARN catalytique

X- Rôles multiples de l ARN. A- L ARN catalytique X- Rôles multiples de l ARN A- L ARN catalytique ! Seules les protéines ont une activité catalytique : idée profondément ancrée en biochimie! Arguments Structures tridimensionnelles variées Diversité chaînes

Plus en détail

La réplication de l ADN. SBI4U L. Kutchaw HBwyNrkYnp0 -qar5ib_6as

La réplication de l ADN. SBI4U L. Kutchaw  HBwyNrkYnp0  -qar5ib_6as La réplication de l ADN SBI4U L. Kutchaw http://www.youtube.com/watch?v= HBwyNrkYnp0 http://www.youtube.com/watch?v= -qar5ib_6as Le 3 théories de la réplication de l ADN La théorie conservatrice: la réplication

Plus en détail

La réplication de l ADN. SBI4U L. Kutchaw HBwyNrkYnp0 -qar5ib_6as

La réplication de l ADN. SBI4U L. Kutchaw  HBwyNrkYnp0  -qar5ib_6as La réplication de l ADN SBI4U L. Kutchaw http://www.youtube.com/watch?v= HBwyNrkYnp0 http://www.youtube.com/watch?v= -qar5ib_6as Le 3 théories de la réplication de l ADN La théorie conservatrice: la réplication

Plus en détail

Biologie Moléculaire et Organismes Modèles

Biologie Moléculaire et Organismes Modèles Biologie Moléculaire et Organismes Modèles Sami Khuri Department of Computer Science San José State University khuri@cs.sjsu.edu Plan du Cours Biologie Moléculaire et Organismes Modèles Qu est-ce que la

Plus en détail

REPUBLIQUE ALGERIENNE DEMOCRATIQUE ET POPULAIRE MINISTERE DE L ENSEIGNEMENT SUPERIEUR ET DE LA RECHERCHE SCIENTIFIQUE

REPUBLIQUE ALGERIENNE DEMOCRATIQUE ET POPULAIRE MINISTERE DE L ENSEIGNEMENT SUPERIEUR ET DE LA RECHERCHE SCIENTIFIQUE REPUBLIQUE ALGERIENNE DEMOCRATIQUE ET POPULAIRE MINISTERE DE L ENSEIGNEMENT SUPERIEUR ET DE LA RECHERCHE SCIENTIFIQUE UNIVERSITE BADJI MOKHTAR-ANNABA FACULTE DE MEDECINE Département de médecine 1 ère Année

Plus en détail

A FAUX c est le produit de la chaleur de combustion biologique et du coefficient d utilisation digestive de l aliment

A FAUX c est le produit de la chaleur de combustion biologique et du coefficient d utilisation digestive de l aliment 1) Quelles sont les 2 propositions exactes? A) La valeur énergétique d un aliment est le rapport entre la chaleur de combustion biologique et le coefficient d utilisation digestive de cet aliment. B) Le

Plus en détail

LA TRANSCRIPTION. Introduction. I. Modalité générale de la transcription. II. Transcription chez les Procaryotes

LA TRANSCRIPTION. Introduction. I. Modalité générale de la transcription. II. Transcription chez les Procaryotes LA TRANSCRIPTION Introduction I. Modalité générale de la transcription II. Transcription chez les Procaryotes 1. L'ARN polymérase 2. Etapes de la transcription a. Initiation b. Elongation c. Terminaison

Plus en détail

ENSEIGNEMENT DE BIOLOGIE CELLULAIRE : BIOLOGIE MOLÉCULAIRE

ENSEIGNEMENT DE BIOLOGIE CELLULAIRE : BIOLOGIE MOLÉCULAIRE ENSEIGNEMENT DE BIOLOGIE CELLULAIRE : BIOLOGIE MOLÉCULAIRE UNIVERSITÉ DES ANTILLES-GUYANE PREMIÈRE ANNÉE DES ETUDES DE SANTÉ DR MARYSE ETIENNE-JULAN-OTTO Gènes VI B. LEWIN DeBoeck Université BIBLIOGRAPHIE

Plus en détail

Régulation de l expression des génomes

Régulation de l expression des génomes Cours Module L5-BH-05 Régulation de l expression des génomes Mercredi de 13h30 à 15h30 & Jeudi de 8h00 à 10h00 (sem. 0 à 5/6) S. Bourgerie sylvain.bourgerie@univ-orleans.fr Université d Orléans UFR Sciences

Plus en détail

FLUX D INFORMATION GÉNÉTIQUE

FLUX D INFORMATION GÉNÉTIQUE FLUX D INFORMATION GÉNÉTIQUE 3 TRADUCTION C est le mécanisme par lequel le flux d information va passer de la forme acide nucléique (alphabet à 4 lettres) à la forme protéine (alphabet à 20 lettres) selon

Plus en détail