Conception assistée par ordinateur de molécules thérapeutiques

Dimension: px
Commencer à balayer dès la page:

Download "Conception assistée par ordinateur de molécules thérapeutiques"

Transcription

1 Conception assistée par ordinateur de molécules thérapeutiques D. Gilis Bioinformatique génomique et structurale Faculté des sciences appliquées Université Libre de Bruxelles

2 Objectif: illustrer en quoi les techniques de conception assistée par ordinateur, de modélisation, de simulation sont également applicables aux molécules et dans le domaine biomédical. En quoi certaines molécules permettent de guérir, en quoi ont-elles un rôle thérapeutique? interagissent, inhibent, activent certains processus biologiques. Quelques exemples péniciline azidothymidine (AZT) aspirine

3 Cibles de ces molécules: certaines protéines Les protéines sont formées par un agencement d acides aminés. Il y a 20 acides aminés naturels différents ( alphabet à 20 lettres) Il s agit donc d un polymère biologique, dont les briques sont des acides aminés: acide aminé1 acide aminé2 acide aminé3 acide aminé5 acide aminé6 Nombre d acides aminés: de ± 50 à plusieurs milliers, selon la protéine. acide aminé4 Particularité: une protéine adopte une structure tridimensionnelle, qui va lui conférer ses propriétés biologiques.

4 Séquence I C I I Structure 3D Fonction biologique: catalyse, régulation, transport,...

5 Le rôle des protéines est assez divers: catalyse de réactions biochimiques (enzymes)

6 transport de molécules ou ions (hémoglobine)

7 régulation du génome

8 les acides nucléiques (ADN, ARN) ADN ACTTGCATCATCGTATCGTTACATGTAG ARN: messager ACUUGCAUCAUCGUAUCGUUACAUGUAG Protéine I C I I

9 Pour concevoir un nouveau médicaments, l industrie pharmaceutique exploite diverses approches. Par exemple: isolation d un principe actif d une plante suivie d éventuelles modifications chimiques, génération des nouvelles molécules par des techniques combinatoires,... La modélisation in silico peut également aider à concevoir de nouvelles molécules, et à comprendre leur mode de fonctionnement. Illustration des techniques in silico: un antibiotique Mode d action d un antibiotique: empêcher une protéine vitale pour la bactérie de fonctionner correctement. Identifier une cible (protéine); Concevoir une molécule permettant d inhiber cette cible.

10 Identification d une cible On identifie un processus vital pour une bactérie; : réaction biochimique : les produits des réactions

11 Identification d une cible On identifie un processus vital pour une bactérie; On identifie une protéine associée à ce processus, et qui présente suffisamment de différences avec son équivalente (dans sa fonction) éventuellement rencontrée chez l Homme; : réaction biochimique : les produits des réactions

12 Identification d une cible On identifie un processus vital pour une bactérie; On identifie une protéine associée à ce processus, et qui présente suffisamment de différences avec son équivalente (dans sa fonction) éventuellement rencontrée chez l Homme; On recherche une molécule qui bloque le fonctionnement de cette protéine. : réaction biochimique : les produits des réactions

13 Identification d une cible Une cible possible: la dihydrofolate réductase (DHFR) Cet enzyme intervient dans le métabolisme du folate, qui est nécessaire à la division cellulaire. La DHFR est également présente chez l Homme (désavantage).

14 Identification d une cible Une cible possible: la dihydrofolate réductase (DHFR) Cet enzyme intervient dans le métabolisme du folate, qui est nécessaire à la division cellulaire. La DHFR est également présente chez l Homme (désavantage). Mais les DHFR humaines et de microorganismes présentent certaines différences.

15 Identification d une cible Une cible possible: la dihydrofolate réductase (DHFR) Cet enzyme intervient dans le métabolisme du folate, qui est nécessaire à la division cellulaire. La DHFR est également présente chez l Homme (désavantage). Mais les DHFR humaines et de microorganismes présentent certaines différences. Un antibiotique agissant sur la DHFR devrait donc présenter une spécificité suffisante pour celle de micro-organismes. La structure tridimensionnelle a été obtenue expérimentalement.

16 Identification d une cible Une cible possible: la dihydrofolate réductase (DHFR) Cet enzyme intervient dans le métabolisme du folate, qui est nécessaire à la division cellulaire. La DHFR est également présente chez l Homme (désavantage). Mais les DHFR humaines et de microorganismes présentent certaines différences. Un antibiotique agissant sur la DHFR devrait donc présenter une spécificité suffisante pour celle de micro-organismes. La structure tridimensionnelle a été obtenue expérimentalement. Son site actif est identifié

17 Après avoir identifié une cible, Identification d une molécule qui bloque le fonctionnement de la cible Plusieurs approches peuvent être combinées: Connaissant le site actif, on construit une molécule qui s y adaptera. On peut également simuler le positionnement d une molécule dans le site actif et évaluer la force de ses interactions avec la protéine. Le premier ingrédient d une méthode de simulation moléculaire est la fonction d énergie. Celle-ci permet d évaluer les interactions électrostatiques, les interactions de type pont hydrogène, les interactions de Van der Waals,...

18 Les fonctions d énergie On peut distinguer deux grandes classes de fonction d énergie Potentiels semiempiriques Potentiels dérivés d une base de données de protéines de séquences et de structures connues Potentiels semi-empiriques Ces potentiels correspondent à une expression analytique qui décrit les diverses interactions inter-atomiques. Leur forme générale est: E=Eliaison + Eangle + Etorsion + Enon-liés + Eautre

19 berg. 52 The function includes five terms: ž Ai j B / i j G G Ý vdw 12 6 i, j ri j ri j ž Ci j D / i j G Ý EŽ t. hbond ri j ri j i, j q i q j G Ý elec Ž r. r G tor i, j N tor i j i j Ž. Ž r i 2 j 2 2. G Ý S V S V e Ž 1. sol i j j i i, j being calcu program th faces. Unfo in the val surface are surface tha in the com the pairwi et al. 58 : thi consistent w mulation u ligand, frag atoms are and then s volume aro where the five G terms on the right-hand side by protein Obtention des paramètres d une fonction d énergie semi-empirique: soit par are coefficients empirically determined using linear regression by the ato calcul de mécanique quantique, analysis soit from par optimisation a set of protein ligand empirique de manière atom à to g ce que les calculs complexes correspondent with known aux mesures binding constants, expérimentales. shown method ma in Table I. The summations are performed over all nents: buri pairs of ligand atoms, i, and protein atoms, j, in of apolar pr addition to all pairs of atoms in the ligand that are atoms in separated by three or more bonds. charged pr

20 Potentiels dérivés d une base de données Principe: dériver des paramètres énergétiques / des scores au départ de fréquences d observation d associations entre des éléments de séquence et de structure au sein d une base de données de protéines (ou de complexes protéine-ligand) dont on connaît les séquences et les structures. Base de données Eléments de séquence Base de données non biaisée, de structures de bonne qualité et assez grande.

21 Eléments de structures: paramètres permettant de décrire la structure des protéines: Distances entre acides aminés: peuvent se calculer entre atomes (description atomique) ou entre centre géométrique de la chaîne latérale,... Fréquence d association entre des paires d acides aminés et des domaines de distance. Exemple: nombre de fois qu on observera une paire A-G à une distance comprise entre 3,2 et 3,4 Å (nécessité de grouper les distances en domaines).

22 On relie ces fréquences d observation à un paramètre énergétique au travers de la relation de Boltzmann: ΔG= G(SC, ) G(S) = kt i,j log P(s P(s i i,c j ) )P(c j ) On peut travailler au niveau atomique: la protéine est alors représentée par tous ses atomes. On peut travailler à un niveau plus simplifié: la protéine est représentée par certains types d atomes ou par ses acides aminés.

23 Le deuxième ingrédient d une méthode de simulation moléculaire est l algorithme d exploration de l espace conformationnel. Il s agit d une méthode qui permet d explorer les conformations possibles afin de trouver celle d énergie minimum.

24 Plus précisément, on explore l espace des conformations en vue de trouver le minimum d énergie: Energy Structure correspondant au minimum

25 Méthodes d exploration de l espace conformationnel Les méthodes permettant d explorer l espace des conformations sont variées.! Eviter de rester coincé dans un minimum local! Quelques exemples: Méthode de Metropolis Monte Carlo Modification aléatoire de la conformation Evaluation du score de la nouvelle conformation Accepte la nouvelle conformation selon la condition: ε exp (-ΔE / kt) où ε est un nombre aléatoire compris entre 0 et 1 k est la constante de Boltzmann T est la température ΔE est la différence d énergie entre la conformation générée (E1) et la dernière conformation acceptée (E2)

26 Le facteur exp (-ΔE / kt) correspond au rapport du facteur de Boltzmann décrivant la probabilité d avoir les états d énergie E1 et E2 dans un ensemble canonique (mécanique statistique). Algorithme génétique Algorithme qui se base sur les règles de la génétique. Etape 1: création d une population de m solutions possibles, générées aléatoirement. Chaque membre de la population est codé par un vecteur. L énergie de chacun des membres est évaluée. Etape 2: création d une nouvelle population. Par exemple m/2 membres de la population parente sont sélectionés aléatoirement, avec un biais dépendant de leur énergie. Cette nouvelle population est soumise à des opérateurs: Recombinaison entre deux vecteur: ABCDEFGH MNOPQRST => ABCDQRST MNOPEFGH Mutation: modifie un élément du vecteur

27 Exemple complet: simulation du système cible dihydrofolate réductase antibiotique trimethoprim

28 Résultat de la simulation Succession des minima rencontrés en cours de simulation

29 Résultat de la simulation Bleu: solution finale de la simulation Vert: structure obtenue expérimentalement

30 Résultat de la simulation En changeant de méthode de simulation: Bleu: solution finale de la simulation Vert: structure obtenue expérimentalement

31 Conclusions Abordé les ingrédients de la simulation de systèmes biologiques, en relation avec le domaine biomédical. Approches complémentaires aux techniques expérimentales: simlations pour défricher, approches expérimentales sur les quelques solution retenues.

Premier projet (Thèse) : Étude des mécanismes dinteraction protéineligand par une approche couplant la simulation moléculaire et la chimie quantique

Premier projet (Thèse) : Étude des mécanismes dinteraction protéineligand par une approche couplant la simulation moléculaire et la chimie quantique Parmi les projets en cours sur la thématique Bioinformatique du Laboratoire de Biochimie et Génétique Moléculaire (LBGM), deux d entre eux seront présentés ici et sont orientés uniquement vers l utilisation

Plus en détail

Semestre 2 Spécialité «Analyse in silico des complexes macromolécules biologiques-médicaments»

Semestre 2 Spécialité «Analyse in silico des complexes macromolécules biologiques-médicaments» Master In silico Drug Design Semestre 2 Spécialité «Analyse in silico des complexes macromolécules biologiques-médicaments» 30NU01IS INITIATION A LA PROGRAMMATION (6 ECTS) Responsables : D. MESTIVIER,

Plus en détail

Utilisation des diagrammes de Voronoï et des algorithmes génétiques pour l'étude des complexes protéine-protéine.

Utilisation des diagrammes de Voronoï et des algorithmes génétiques pour l'étude des complexes protéine-protéine. Utilisation des diagrammes de Voronoï et des algorithmes génétiques pour l'étude des complexes protéine-protéine. Anne Poupon Biologie et Bioinformatique des Systèmes de Signalisation INRA - Nouzilly France

Plus en détail

LICENCE PROFESSIONNELLE MENTION METIERS DE LA BIOTECHNOLOGIE

LICENCE PROFESSIONNELLE MENTION METIERS DE LA BIOTECHNOLOGIE LICENCE PROFESSIONNELLE MENTION METIERS DE LA BIOTECHNOLOGIE Plus d'infos Crédits ECTS : 180 / Durée : 1 ans / Niveau d'étude : BAC +3 Nature de la formation : Mention Stage : Obligatoire (4) unimes Composante

Plus en détail

MASTER «IN SILICO DRUG DESIGN» (2015-2016) Semestre 2 - Spécialité MMis - MACROMOLECULES BIOLOGIQUES Université Paris Diderot

MASTER «IN SILICO DRUG DESIGN» (2015-2016) Semestre 2 - Spécialité MMis - MACROMOLECULES BIOLOGIQUES Université Paris Diderot MASTER «IN SILICO DRUG DESIGN» (2015-2016) Semestre 2 - Spécialité MMis - MACROMOLECULES BIOLOGIQUES Université Paris Diderot UE1 PROGRAMMATION EN DRUG DESIGN (7 ECTS) Responsable : O. TABOUREAU EC1 -

Plus en détail

La reconnaissance moléculaire: la base du design rationnel Modélisation moléculaire: Introduction Hiver 2006

La reconnaissance moléculaire: la base du design rationnel Modélisation moléculaire: Introduction Hiver 2006 La reconnaissance moléculaire: la base du design rationnel En 1890 Emil Fisher a proposé le modèle "serrure et clé" pour expliquer la façon de fonctionner des systèmes biologiques. Un substrat rentre et

Plus en détail

Conception de Médicament

Conception de Médicament Conception de Médicament Approche classique HTS Chimie combinatoire Rational Drug Design Ligand based (QSAR) Structure based (ligand et ou macromolec.) 3DQSAR Docking Virtual screening Needle in a Haystack

Plus en détail

OGM : pour le meilleur? Ou pour le pire?(ou les deux ) Laroche Fabrice, biologiste fablaroche@gmail.com- 0624290703

OGM : pour le meilleur? Ou pour le pire?(ou les deux ) Laroche Fabrice, biologiste fablaroche@gmail.com- 0624290703 OGM : pour le meilleur? Ou pour le pire?(ou les deux ) Laroche Fabrice, biologiste fablaroche@gmail.com- 0624290703 (Nouvelles techniques de manipulation du vivant Inf OGM 0ctobre 2011) I. Petite mise

Plus en détail

Quelques termes-clef de biologie moléculaire et leur définition

Quelques termes-clef de biologie moléculaire et leur définition Acide aminé (AA) Quelques termes-clef de biologie moléculaire et leur définition Isabelle Quinkal INRIA Rhône-Alpes Septembre 2003 Petite molécule dont l enchaînement compose les protéines - on dit qu

Plus en détail

CHAPITRE 4 - LA COMPLEXITÉ DES RELATIONS ENRE GÈNES, PHÉNOTYPES ET ENVIRONNEMENT

CHAPITRE 4 - LA COMPLEXITÉ DES RELATIONS ENRE GÈNES, PHÉNOTYPES ET ENVIRONNEMENT CHAPITRE 4 - LA COMPLEXITÉ DES RELATIONS ENRE GÈNES, PHÉNOTYPES ET ENVIRONNEMENT Introduction Tous les individus de la même espèce possèdent le même patrimoine génétique, cependant chaque individu est

Plus en détail

PHENOTYPE - GENOTYPE Le phénotype d un individu : - peut être observé uniquement à l échelle moléculaire et à l échelle cellulaire PROTEINES ENZYMES

PHENOTYPE - GENOTYPE Le phénotype d un individu : - peut être observé uniquement à l échelle moléculaire et à l échelle cellulaire PROTEINES ENZYMES REVISIONS DE 1 S. Vous devez indiquer pour chaque proposition si celle-ci est vraie (V) ou fausse (F) en cochant la case correspondante ; une abstention ou une réponse trop peu lisible seront considérées

Plus en détail

THÈME 3 : DU GÉNOTYPE AU PHÉNOTYPE. CHAPITRE 1 : la relation entre ADN et protéines

THÈME 3 : DU GÉNOTYPE AU PHÉNOTYPE. CHAPITRE 1 : la relation entre ADN et protéines THÈME 3 : DU GÉNOTYPE AU PHÉNOTYPE CHAPITRE 1 : la relation entre ADN et protéines Les caractères d un individu dépendent de plusieurs facteurs : certains dépendent des caractères présents dans la famille

Plus en détail

Méthodes d apprentissage :

Méthodes d apprentissage : Méthodes d apprentissage : application au tri de complexes protéines-protéines Jérôme Azé Apprentissage: tâches Apprentissage non supervisé (Eisen, ) Apprentissage supervisé (arbres de décision, k-ppv,

Plus en détail

Série : STL Spécialité biotechnologies SESSION 2014 BACCALAURÉAT TECHNOLOGIQUE

Série : STL Spécialité biotechnologies SESSION 2014 BACCALAURÉAT TECHNOLOGIQUE BACCALAURÉAT TECHNLGIQUE Série : STL Spécialité biotechnologies SESSIN 2014 CBSV : sous épreuve coefficient 4 Biotechnologies : sous épreuve coefficient 4 Durée totale de l épreuve: 4 heures Les sujets

Plus en détail

CHAPITRE 3 LA SYNTHESE DES PROTEINES

CHAPITRE 3 LA SYNTHESE DES PROTEINES CHAITRE 3 LA SYNTHESE DES ROTEINES On sait qu un gène détient dans sa séquence nucléotidique, l information permettant la synthèse d un polypeptide. Ce dernier caractérisé par sa séquence d acides aminés

Plus en détail

Présentation succincte. Jean Cavarelli. Septembre 2014

Présentation succincte. Jean Cavarelli. Septembre 2014 Master Sciences du Vivant Spécialité Biologie structurale, bioinformatique et biotechnologies Parcours Biologie structurale intégrative et bio-informatique Présentation succincte. Jean Cavarelli Septembre

Plus en détail

Licence-Master Bioinformatique Contrôle continu 06/03/06. Correction

Licence-Master Bioinformatique Contrôle continu 06/03/06. Correction Licence-Master Bioinformatique Contrôle continu 06/03/06 Correction -«Vraies» questions de cours -«fausses» questions de cours: questions pour voir si pouviez imaginer une réponse crédible qui n était

Plus en détail

Prédiction des Propriétés Biologiques

Prédiction des Propriétés Biologiques SOMMAIRE PROCHEMIST VERSION 6.4 Prédiction des Propriétés Biologiques P.Urbaniak (Cadcom) Avant-Propos PARTIE I) ANALYSE MULTIRESOLUTION 1) Algorithme. Limites et perspectives 2)Exemples 3) La constitution

Plus en détail

Génétique et épigénétique

Génétique et épigénétique Le génome : avancées scientifiques et thérapeutiques et conséquences sociales The genome: scientific and therapeutic developments and social consequences 2002 Éditions scientifiques et médicales Elsevier

Plus en détail

Analyse des propriétés de matériaux sous choc par simulations moléculaires (Monte Carlo et dynamique moléculaire)

Analyse des propriétés de matériaux sous choc par simulations moléculaires (Monte Carlo et dynamique moléculaire) Analyse des propriétés de matériaux sous choc par simulations moléculaires (Monte Carlo et dynamique moléculaire) Laurent Soulard CEA-DAM Ile-de-France laurent.soulard@cea.fr 1 Problématique La DAM est

Plus en détail

Heuristique et métaheuristique. 8. Optimisation combinatoire et métaheuristiques. Optimisation combinatoire. Problème du voyageur de commerce

Heuristique et métaheuristique. 8. Optimisation combinatoire et métaheuristiques. Optimisation combinatoire. Problème du voyageur de commerce Heuristique et métaheuristique IFT1575 Modèles de recherche opérationnelle (RO) 8. Optimisation combinatoire et métaheuristiques Un algorithme heuristique permet d identifier au moins une solution réalisable

Plus en détail

Introduction aux Méthodes de Monte Carlo

Introduction aux Méthodes de Monte Carlo Méthodes de Monte Carlo pour la Modélisation et le Calcul Intensif Applications à la Physique Numérique et à la Biologie Séminaire CIMENT GRID Introduction aux Méthodes de Monte Carlo Olivier François

Plus en détail

Le Listryo contre le VIH

Le Listryo contre le VIH Le Listryo contre le VIH «La Vie contre la mort» en langage bactérien Yoann DÉSIR Le Listryo contre le VIH W-X-R-T Trp-Ola-Arg-Thr à cycliser dans l'organisme en un cyclopeptide de 4 acides aminés dextrogyres

Plus en détail

Cours de Biologie Cellulaire L1 2006/2007

Cours de Biologie Cellulaire L1 2006/2007 Cours de Biologie Cellulaire L1 2006/2007 Qu est ce que la biologie cellulaire? La biologie cellulaire étudie les cellules et leurs organites, les processus vitaux qui s'y déroulent ainsi que les mécanismes

Plus en détail

L utilisation des micro-organismes pour la production de carburants et de produits (bio)-chimiques

L utilisation des micro-organismes pour la production de carburants et de produits (bio)-chimiques L utilisation des micro-organismes pour la production de carburants et de produits (bio)-chimiques I R. A L I S O N B R O G N A U X U N I T É D E B I O - I N D U S T R I E S G E M B L O U X A G R O B I

Plus en détail

MABioVis. Bio-informatique et la

MABioVis. Bio-informatique et la MABioVis Modèles et Algorithmes pour la Bio-informatique et la Visualisation Visite ENS Cachan 5 janvier 2011 MABioVis G GUY MELANÇON (PR UFR Maths Info / EPI GRAVITE) (là, maintenant) - MABioVis DAVID

Plus en détail

D 005 Annex 30, page 1. Projet: D005 IPC Revision WG Definition Project Classe/sous-classe: C40B EP Proposition du Rapporteur Date : 22.11.

D 005 Annex 30, page 1. Projet: D005 IPC Revision WG Definition Project Classe/sous-classe: C40B EP Proposition du Rapporteur Date : 22.11. Annex 30, page 1 Projet: D005 IPC Revision WG Definition Project Classe/sous-classe: C40B EP Proposition du Rapporteur Date : 22.11.04 Titre - C40B Chimie combinatoire, bibliothèques, p.ex. chimiothèques

Plus en détail

Calendrier de la Session de. Rattrapage (11 au 20 Juin 2014)

Calendrier de la Session de. Rattrapage (11 au 20 Juin 2014) Calendrier de la Session de Rattrapage (11 au 20 Juin 2014) 1 ère Année LA Protection de l Environnement (1 ère PE) Pollution Marine Math Chimie Générale Biologie Cellulaire Microbiologie Génétique Biologie

Plus en détail

PHARMACIEN POLYTECHNICIEN SCIENCES CHIMIQUES VERSUS DE LA SANTÉ SCIENCES BIOLOGIQUES?

PHARMACIEN POLYTECHNICIEN SCIENCES CHIMIQUES VERSUS DE LA SANTÉ SCIENCES BIOLOGIQUES? PHARMACIEN POLYTECHNICIEN DE LA SANTÉ SCIENCES CHIMIQUES VERSUS SCIENCES BIOLOGIQUES? Professeur Pascale Cohen Professeur Marc Leborgne ISPB-Pharmacie Université Lyon I Quelle est la place actuelle de

Plus en détail

Fiabiliser les résultats [PROGRAMME] et dans les fours Méthodes de séparation. Préparation de l échantillon. [COORDINATEUR] Pr. R.

Fiabiliser les résultats [PROGRAMME] et dans les fours Méthodes de séparation. Préparation de l échantillon. [COORDINATEUR] Pr. R. 60 ÉCOLE EUROPÉENNE DES SCIENCES ANALYTIQUES Connaissances de base en chimie sur l atome et la lumière 4 jours Être capable de choisir la technique appropriée Fiabiliser les résultats Définitions en absorption

Plus en détail

Simulation des mouvements de protéines membranaires Application aux Complexes II et III de la chaine respiratoire

Simulation des mouvements de protéines membranaires Application aux Complexes II et III de la chaine respiratoire Simulation des mouvements de protéines membranaires Application aux Complexes II et III de la chaine respiratoire M. Beurton-Aimar 1 N. Parisey 2 F. Vallée 1 1 UMR 5800 - LaBRI - Université de Bordeaux

Plus en détail

Biotechnologies. 114-1 - - 1 -Les Biotechnologies

Biotechnologies. 114-1 - - 1 -Les Biotechnologies 114-1 - - 1 -Les Utilisation des processus biologiques pour produire des biens et des services. Les biotechologies tirent leur efficacité des techniques clés engendrées par les progrès conjoints de la

Plus en détail

Sommaire INTRODUCTION GÉNÉRALE... 5 CHAPITRE I : L ACTIVITÉ ANTICANCÉREUSE DES COMPLEXES DE PLATINE... 8. A Le cisplatine... 8

Sommaire INTRODUCTION GÉNÉRALE... 5 CHAPITRE I : L ACTIVITÉ ANTICANCÉREUSE DES COMPLEXES DE PLATINE... 8. A Le cisplatine... 8 Sommaire INTRODUCTION GÉNÉRALE... 5 CHAPITRE I : L ACTIVITÉ ANTICANCÉREUSE DES COMPLEXES DE PLATINE... 8 A Le cisplatine.... 8 A.I Découverte de l activité anti-tumorale du cisplatine... 8 A.II Activité

Plus en détail

Cahier de texte de la classe 1 ère 3 - SVT

Cahier de texte de la classe 1 ère 3 - SVT Cahier de texte de la classe 1 ère 3 - SVT DATE SEQUENCE jeudi 8 : revoir la fiche méthodologique «utiliser le microscope optique» (disponible sur le site du lycée) Jeudi 8 1 er contact avec les élèves.

Plus en détail

Modélisation coalescente pour la détection précoce d un cancer

Modélisation coalescente pour la détection précoce d un cancer Modélisation coalescente pour la détection précoce d un cancer Mathieu Emily 27 Novembre 2007 Bioinformatics Research Center - Université d Aarhus Danemark Mathieu Emily Coalescence et cancer 1 Introduction

Plus en détail

Plan. Comparaison de 2 séquences. Dotplot, alignement optimal Recherche de similarité. Alignement multiple. Phylogénie moléculaire

Plan. Comparaison de 2 séquences. Dotplot, alignement optimal Recherche de similarité. Alignement multiple. Phylogénie moléculaire Plan 1 Banques de données 2 Comparaison de 2 séquences Dotplot, alignement optimal Recherche de similarité 3 Alignement multiple l 4 Phylogénie moléculaire Recherche de similarité 1 séquence (Query) comparée

Plus en détail

Master de Bioinformatique et Biologie des Systèmes Toulouse http://m2pbioinfo.biotoul.fr Responsable : Pr. Gwennaele Fichant

Master de Bioinformatique et Biologie des Systèmes Toulouse http://m2pbioinfo.biotoul.fr Responsable : Pr. Gwennaele Fichant Master de Bioinformatique et Biologie des Systèmes Toulouse http://m2pbioinfo.biotoul.fr Responsable : Pr. Gwennaele Fichant Parcours: Master 1 : Bioinformatique et biologie des Systèmes dans le Master

Plus en détail

Macromolécules et la Cellule

Macromolécules et la Cellule Macromolécules et la Cellule Macromolécules Campbell chapitre 5 Macromolécules Définition: Molécule géante formée par l assemblage de plusieurs petites molécules organiques Macromolécules Définition:

Plus en détail

L effet tunnel. BCM 2505 Introduction à l enzymologie Effet tunnel Page 1/7

L effet tunnel. BCM 2505 Introduction à l enzymologie Effet tunnel Page 1/7 L effet tunnel La matière est habituellement traitée comme une particule. Cependant, elle peut également être traitée comme une vague (dualité onde-particule). Les propriétés associées au comportement

Plus en détail

Chapitre 2. La synthèse protéique : la relation entre le génotype et le phénotype.

Chapitre 2. La synthèse protéique : la relation entre le génotype et le phénotype. Chapitre 2. La synthèse protéique : la relation entre le génotype et le phénotype. Les maladies génétiques comme la drépanocytose ou l'albinisme sont liées à des modifications du génotype des individus

Plus en détail

Université du Québec à Montréal

Université du Québec à Montréal RECUEIL D EXERCICES DE BICHIMIE 6. Les acides nucléiques 6.2. Réplication, transcription et traduction P P P CH 2 H N H N N NH NH 2 Université du Québec à Montréal 6.2. Réplication, transcription et traduction

Plus en détail

Projet de modélisation des réseaux biologiques et complexes par équations différentielles

Projet de modélisation des réseaux biologiques et complexes par équations différentielles Projet de modélisation des réseaux biologiques et complexes par équations différentielles GIRAUD Sandra MERLET-BILLON Maryvonne 1 Partie I : Etude d un mode le de l ope ron lactose Introduction Le système

Plus en détail

BTS ESTHÉTIQUE COSMÉTIQUE SCIENCES BIOLOGIQUES ET COSMÉTOLOGIQUES U32

BTS ESTHÉTIQUE COSMÉTIQUE SCIENCES BIOLOGIQUES ET COSMÉTOLOGIQUES U32 BTS ESTHÉTIQUE COSMÉTIQUE SCIENCES BIOLOGIQUES ET COSMÉTOLOGIQUES U32 SESSION 2012 Durée : 3 heures 30 minutes Coefficient : 4 Matériel autorisé : aucun - L usage de la calculatrice est interdite Dès que

Plus en détail

Au menu aujourd hui. Les éléments chimiques et l eau. http://eau.tourdumonde.free.fr/image%20partie%20pedagogique/molecule%20etat%20de%20l'eau2.

Au menu aujourd hui. Les éléments chimiques et l eau. http://eau.tourdumonde.free.fr/image%20partie%20pedagogique/molecule%20etat%20de%20l'eau2. La chimie de la vie Au menu aujourd hui Les éléments chimiques et l eau http://eau.tourdumonde.free.fr/image%20partie%20pedagogique/molecule%20etat%20de%20l'eau2.jpg Au menu aujourd hui Les éléments chimiques

Plus en détail

exemple de végétaux exposés au benzène atmosphérique Sylvain Dumez sylvain.dumez@univ-lille2.fr

exemple de végétaux exposés au benzène atmosphérique Sylvain Dumez sylvain.dumez@univ-lille2.fr Approches écotoxicogénomiques et application à la biosurveillance exemple de végétaux exposés au benzène atmosphérique Sylvain Dumez sylvain.dumez@univ-lille2.fr Laboratoire des Sciences végétales et fongiques,

Plus en détail

Cahier de texte de la classe 1 ère 4 - SVT

Cahier de texte de la classe 1 ère 4 - SVT Cahier de texte de la classe 1 ère 4 - SVT DATE SEQUENCE lundi 12 : revoir la fiche méthodologique «utiliser le microscope optique» (disponible sur le site du lycée) Lundi 12 1 er contact avec les élèves.

Plus en détail

PRINCIPES POUR L ANALYSE DES RISQUES LIÉS AUX ALIMENTS DÉRIVÉS DES BIOTECHNOLOGIES MODERNES

PRINCIPES POUR L ANALYSE DES RISQUES LIÉS AUX ALIMENTS DÉRIVÉS DES BIOTECHNOLOGIES MODERNES -1- PRINCIPES POUR L ANALYSE DES RISQUES LIÉS AUX ALIMENTS DÉRIVÉS DES BIOTECHNOLOGIES MODERNES SECTION 1 INTRODUCTION CAC/GL 44-2003 1. Pour de nombreux aliments, le niveau de sécurité sanitaire généralement

Plus en détail

Acides Nucléiques. ADN et ARN Unités de base : les nucléotides donc les nucléotides = monomères ADN et ARN = polynucléotides = polymères

Acides Nucléiques. ADN et ARN Unités de base : les nucléotides donc les nucléotides = monomères ADN et ARN = polynucléotides = polymères Acides Nucléiques ADN et ARN Unités de base : les nucléotides donc les nucléotides = monomères ADN et ARN = polynucléotides = polymères Structure d un nucléotide Tous composés d une base azotée, d un sucre

Plus en détail

Gene Predictis parce que je suis unique

Gene Predictis parce que je suis unique Gene Predictis parce que je suis unique Route de Chantemerle 64 - CP 160 - CH-1763 Granges-Paccot Téléphone: +41 26 466 15 45 Fax: +41 26 466 15 46 info@genepredictis.com www.genepredictis.com Gene Predictis

Plus en détail

OPTIMISATION MULTICRITERE STOCHASTIQUE

OPTIMISATION MULTICRITERE STOCHASTIQUE OPTIMISATION MULTICRITERE STOCHASTIQUE Michel DUMAS, Gilles ARNAUD, Fabrice GAUDIER CEA/DEN/DMS/SFME/LETR michel.dumas@cea.r gilles.arnaud@cea.r abrice.gaudier @cea.r Introduction L optimisation multicritère

Plus en détail

Christelle REYNES EA 2415 Epidémiologie, Biostatistique et Santé Publique Université Montpellier 1. 8 Juin 2012

Christelle REYNES EA 2415 Epidémiologie, Biostatistique et Santé Publique Université Montpellier 1. 8 Juin 2012 Extraction et analyse des mesures haut-débit pour l identification de biomarqueurs : problèmes méthodologiques liés à la dimension et solutions envisagées EA 2415 Epidémiologie, Biostatistique et Santé

Plus en détail

3. Biotechnologie de l ADN

3. Biotechnologie de l ADN 3. Biotechnologie de l ADN 3.1. Technologie de l ADN recombinant 3.1.1. Isolation d ADN et d ARN 3.1.2. Fragmentation de l ADN (les Endonucléases) 3.1.3. Analyse d ADN sur d agarose et d acrylamide 3.1.4.

Plus en détail

L étude des gènes et des protéines facilitée par l utilisation du web service ProteINSIDE

L étude des gènes et des protéines facilitée par l utilisation du web service ProteINSIDE L étude des gènes et des protéines facilitée par l utilisation du web service ProteINSIDE KASPRIC Nicolas Thèse débutée en février 2013 Equipe Amuvi Encadrants : Muriel BONNET Brigitte PICARD Avec l appui

Plus en détail

Analyse de données longitudinales continues avec applications

Analyse de données longitudinales continues avec applications Université de Liège Département de Mathématique 29 Octobre 2002 Analyse de données longitudinales continues avec applications David MAGIS 1 Programme 1. Introduction 2. Exemples 3. Méthodes simples 4.

Plus en détail

Rapport de Projet Informatique Simulation Monte-Carlo du modèle XY

Rapport de Projet Informatique Simulation Monte-Carlo du modèle XY Rapport de Projet Informatique Simulation Monte-Carlo du modèle XY Alejandro Daniel Paredes Cabrel sous la direction de : Xavier Leoncini Centre de Physique Théorique de Marseille Fevrier- 29 Objectif

Plus en détail

Modélisation prédictive et incertitudes. P. Pernot. Laboratoire de Chimie Physique, CNRS/U-PSUD, Orsay

Modélisation prédictive et incertitudes. P. Pernot. Laboratoire de Chimie Physique, CNRS/U-PSUD, Orsay Modélisation prédictive et incertitudes P. Pernot Laboratoire de Chimie Physique, CNRS/U-PSUD, Orsay Plan 1 Incertitudes des modèles empiriques 2 Identification et caractérisation des paramètres incertains

Plus en détail

Cumulo Numbio 2015. La révolution next-generation sequencing et les enjeux de l'expansion de la bioinformatique pour les biologistes.

Cumulo Numbio 2015. La révolution next-generation sequencing et les enjeux de l'expansion de la bioinformatique pour les biologistes. Cumulo Numbio 2015 La révolution next-generation sequencing et les enjeux de l'expansion de la bioinformatique pour les biologistes. Human genome sequence June 26th 2000: official announcement of the completion

Plus en détail

Chapitre 0-2 Introduction générale au cours de BCPST1

Chapitre 0-2 Introduction générale au cours de BCPST1 Chapitre 0-2 Introduction générale au cours de BCPST Extrait du programme I. Les grandeurs en sciences physiques Définition : une grandeur est une observable du système On peut la mettre en évidence a.

Plus en détail

POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA

POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA Amplification spécifique Détection spécifique Clonage dans des vecteurs Amplification in vitro PCR Hybridation moléculaire - hôte cellulaire

Plus en détail

Journée de rencontres ANSES - IGN - INA - Labex Bézout

Journée de rencontres ANSES - IGN - INA - Labex Bézout Journée de rencontres ANSES - IGN - INA - Labex Bézout Présentation du LAMA Stéphane Sabourau 3 mars 2014 Présentation générale Le Laboratoire d Analyse et Mathématiques Appliquées (LAMA) est composé de

Plus en détail

Modélisation et Vérification des Réseaux de Régulations entre Gènes

Modélisation et Vérification des Réseaux de Régulations entre Gènes Modélisation et Vérification des Réseaux de Régulations entre Gènes Loïc Paulevé JDOC 2010-29 avril 2010 Directeur : Co-encadrant : Olivier Roux Morgan Magnin Laboratoire : IRCCyN, UMR CNRS 6597 Équipe

Plus en détail

Les méthodes de séparation basées sur l extraction

Les méthodes de séparation basées sur l extraction Les méthodes de séparation basées sur l extraction L extraction liquide - liquide C est l extraction d un soluté S d un solvant A par un solvant B non miscible au premier. Deux paramètres sont importants

Plus en détail

Clonage de Vénus et transformation de E.Coli.

Clonage de Vénus et transformation de E.Coli. Clonage de Vénus et transformation de E.Coli. Samueal Joseph, Romain Laverrière, Elias Laudato, Noé Mage Assisstants : Gisele Dewhurst, Charlotte Gehin, Miwa Umebayashi Résumé [1] L expérience consiste

Plus en détail

III CRITERES POUR CHOISIR UN COUPLE DE FLUOROPHORES

III CRITERES POUR CHOISIR UN COUPLE DE FLUOROPHORES Page : 17/ 77 III CRITERES POUR CHOISIR UN COUPLE DE FLUOROPHORES Le choix d un couple donneur-accepteur dépend de la technique utilisée (FRET, TR- FRET, BRET, etc.) et des molécules disponibles pour ces

Plus en détail

SOCLE COMMUN - La Compétence 3 Les principaux éléments de mathématiques et la culture scientifique et technologique

SOCLE COMMUN - La Compétence 3 Les principaux éléments de mathématiques et la culture scientifique et technologique SOCLE COMMUN - La Compétence 3 Les principaux éléments de mathématiques et la culture scientifique et technologique DOMAINE P3.C3.D1. Pratiquer une démarche scientifique et technologique, résoudre des

Plus en détail

VI. Domaines protéiques

VI. Domaines protéiques Chapitre 1 Structure des protéines I. Rappels Définitions II. La Protein Data Bank (PDB) III. Angles dièdres et diagramme de ramachandran IV. Structures secondaires V. Structures supersecondaires VI. Domaines

Plus en détail

Les OGM. 5 décembre 2008. Nicole Mounier

Les OGM. 5 décembre 2008. Nicole Mounier Les OGM 5 décembre 2008 Nicole Mounier Université Claude Bernard Lyon 1 CGMC, bâtiment Gregor Mendel 43, boulevard du 11 Novembre 1918 69622 Villeurbanne Cedex OGM Organismes Génétiquement Modifiés Transfert

Plus en détail

2.0 Interprétation des cotes d évaluation des risques relatifs aux produits

2.0 Interprétation des cotes d évaluation des risques relatifs aux produits 2.0 Interprétation des cotes d évaluation des risques relatifs aux produits L interprétation des cotes attribuées dans le cadre des évaluations des risques relatifs aux produits décrite plus loin repose

Plus en détail

De la physico-chimie à la radiobiologie Les radicaux libres

De la physico-chimie à la radiobiologie Les radicaux libres Les nouvelles orientations en radiobiologie et radiopathologie SFRP - 18 novembre 2004 De la physico-chimie à la radiobiologie Les radicaux libres Pr. Monique Gardès-Albert Laboratoire de Chimie-Physique

Plus en détail

ANNEXE 1 BTS AGENCEMENT DE L'ENVIRONNEMENT ARCHITECTURAL Programme de mathématiques

ANNEXE 1 BTS AGENCEMENT DE L'ENVIRONNEMENT ARCHITECTURAL Programme de mathématiques ANNEXE BTS AGENCEMENT DE L'ENVIRONNEMENT ARCHITECTURAL Programme de mathématiques L'enseignement des mathématiques dans les sections de techniciens supérieurs Agencement de l'environnement architectural

Plus en détail

Document de présentation technique. Blocage du comportement

Document de présentation technique. Blocage du comportement G Data Document de présentation technique Blocage du comportement Marco Lauerwald Marketing Go safe. Go safer. G Data. Table des matières 1 Blocage du comportement mission : lutter contre les menaces inconnues...

Plus en détail

La simulation Monte Carlo

La simulation Monte Carlo La simulation Monte Carlo Pascal Boulet pascal.boulet@univ-provence.fr Réseau français de chimie théorique 2011 Outline Introduction à la simulation numérique et au calcul Historique et méthodes Introduction

Plus en détail

Activités en FIabilité et MAintenance au sein de l équipe FIGAL du Laboratoire Jean Kuntzmann

Activités en FIabilité et MAintenance au sein de l équipe FIGAL du Laboratoire Jean Kuntzmann Activités en FIabilité et MAintenance au sein de l équipe FIGAL du Laboratoire Jean Kuntzmann Laurent Doyen Laboratoire Jean Kuntzmann (LJK) Département probabilités et statistique Equipe FIGAL LJK - Grenoble

Plus en détail

La production de médicaments par les OGM

La production de médicaments par les OGM La production de médicaments par les OGM L.M. HOUDEBINE Unité de biologie du Développement et Biotechnologies INRA 78352 Jouy-en-Josas Cedex Depuis les temps les plus reculés, les communautés humaines

Plus en détail

Chapitre 1. La cellule : unité morphologique et fonctionnelle

Chapitre 1. La cellule : unité morphologique et fonctionnelle Chapitre 1. La cellule : unité morphologique et fonctionnelle 1. Historique de la biologie : Les premières cellules eucaryotes sont apparues il y a 3 milliards d années. Les premiers Homo Sapiens apparaissent

Plus en détail

Chapitre 14: La génétique

Chapitre 14: La génétique Chapitre 14: La génétique A) Les gènes et les protéines, ça te gêne? 1) a) Quel est l élément de base des vivants? Les cellules b) Qu a-t-elle en son centre? Un noyau c) Qu y retrouve-t-on sous forme de

Plus en détail

La survie nette actuelle à long terme Qualités de sept méthodes d estimation

La survie nette actuelle à long terme Qualités de sept méthodes d estimation La survie nette actuelle à long terme Qualités de sept méthodes d estimation PAR Alireza MOGHADDAM TUTEUR : Guy HÉDELIN Laboratoire d Épidémiologie et de Santé publique, EA 80 Faculté de Médecine de Strasbourg

Plus en détail

Chapitre 2 - VARIABILITÉ GÉNÉTIQUE ET MUTATION DE L ADN

Chapitre 2 - VARIABILITÉ GÉNÉTIQUE ET MUTATION DE L ADN Chapitre 2 - VARIABILITÉ GÉNÉTIQUE ET MUTATION DE L ADN Les organismes ne peuvent survivre que si leur ADN est soigneusement répliqué et protégé des altérations chimiques et physiques qui pourraient changer

Plus en détail

Influence du nombre de réplicats dans une analyse différentielle de données RNAseq

Influence du nombre de réplicats dans une analyse différentielle de données RNAseq Influence du nombre de réplicats dans une analyse différentielle de données RNAseq Statisticiens: Sophie Lamarre Steve Van Ginkel Sébastien Déjean - Magali San Cristobal Matthieu Vignes Biologistes: Stéphane

Plus en détail

Métaheuristique. Jérémy CHANUT Charles BALLARINI

Métaheuristique. Jérémy CHANUT Charles BALLARINI Métaheuristique Jérémy CHANUT Charles BALLARINI 15 octobre 2012 CHAPITRE 1 INTRODUCTION Ce projet consiste en la résolution du problème des composants électroniques par deux méthodes : Recuit simulé Algorithme

Plus en détail

LICENCE ACADEMIQUE EN CHIMIE FONDAMENTALE

LICENCE ACADEMIQUE EN CHIMIE FONDAMENTALE LICENCE ACADEMIQUE EN CHIMIE FONDAMENTALE Domaine : Sciences de la Matière -SM- (D02) Filière : Chimie Option : Chimie Rattachement Administratif Faculté : Faculté des Sciences Département : Département

Plus en détail

CONSTRUIRE UNE SÉQUENCE PÉDAGOGIQUE UTILISANT UN LOGICIEL DE SIMULATION DE GAZ

CONSTRUIRE UNE SÉQUENCE PÉDAGOGIQUE UTILISANT UN LOGICIEL DE SIMULATION DE GAZ CONSTRUIRE UNE SÉQUENCE PÉDAGOGIQUE UTILISANT UN LOGICIEL DE SIMULATION DE GAZ C.1. Prise en mains rapide du logiciel Atelier Théorie Cinétique pour l'enseignant Sauver les deux fichiers Gaz.htm et gaz.jar

Plus en détail

Ecole Centrale Paris Année 2009-2010 1 ère année. Cours «Biologie». Vendredi 28 mai 2010

Ecole Centrale Paris Année 2009-2010 1 ère année. Cours «Biologie». Vendredi 28 mai 2010 Ecole Centrale Paris Année 2009-2010 1 ère année. Cours «Biologie». Vendredi 28 mai 2010 Contrôle des Connaissances. 2 ème session) (Durée : 1h30, tous documents autorisés, ordinateur interdit) Important

Plus en détail

LES CONSTITUANTS MOLÉCULAIRES DU VIVANT

LES CONSTITUANTS MOLÉCULAIRES DU VIVANT Préparation à l Agrégation Interne Paris VI 2009-2010 Séances des 19 et 23 septembre LES CONSTITUANTS MOLÉCULAIRES DU VIVANT Les mots clés : Lipide, glucide, protide, acide nucléique, monomère, polymère,

Plus en détail

LIENS DE CORRESPONDANCE

LIENS DE CORRESPONDANCE Filière _ Génie Civil Mécanique des solides et Transferts thermiques Méthodes Numériques et calcul Scientifique Physique du Bâtiment Eléments et outils de conception d un projet de construction Equivalents

Plus en détail

Bioinformatique fonctionnelle des protéines et analyse structurale de réseaux d'interactions

Bioinformatique fonctionnelle des protéines et analyse structurale de réseaux d'interactions Bioinformatique fonctionnelle des protéines et analyse structurale de réseaux d'interactions intégration Populations Organismes Tissus, organes Relations inter-espèces, Équilibres écologiques Développement,

Plus en détail

Tutoriel pour les enseignants de lycée. Rappel du contenu des programmes au lycée en classe de seconde

Tutoriel pour les enseignants de lycée. Rappel du contenu des programmes au lycée en classe de seconde Tutoriel pour les enseignants de lycée Ce document sert à l enseignant pour préparer différentes séquences pédagogiques afin d aborder : les questions de la génétique, des maladies génétiques, et les métiers

Plus en détail

Interactions protéine:ligand

Interactions protéine:ligand Interactions protéine:ligand R489 E235 ASP K198 D233 E231 E235 R489 K198 D233 E231 E235 R489 K198 D233 E231 R217 ASN R217 ASN R217 Mastère Ingénierie des BioMolécules Module Bioinformatique Structurale

Plus en détail

Scale up Scale down : vers une meilleure intégration industrielle des biotechnologies blanches

Scale up Scale down : vers une meilleure intégration industrielle des biotechnologies blanches Agro-Bio Tech Scale up Scale down : vers une meilleure intégration industrielle des biotechnologies blanches Frank Delvigne (Ulg GxABT) Exploitation industrielle des micro organismes : biotechnologies

Plus en détail

Quels sont les parcours de biologie en L2? Amphi 6 à 12h15 le 5 avril

Quels sont les parcours de biologie en L2? Amphi 6 à 12h15 le 5 avril Quels sont les parcours de biologie en L2? Amphi 6 à 12h15 le 5 avril Parcours en Biologie en Licence Parcours de Biochimie et Chimie Biopharmaceutique (BCB) Rainer Hienerwadel Parcours Biologie cellulaire

Plus en détail

Chapitre 1. L algorithme génétique

Chapitre 1. L algorithme génétique Chapitre 1 L algorithme génétique L algorithme génétique (AG) est un algorithme de recherche basé sur les mécanismes de la sélection naturelle et de la génétique. Il combine une stratégie de survie des

Plus en détail

THEME 1 A EXPRESSION, STABILITE ET VARIATION DU PATRIMOINE GENETIQUE

THEME 1 A EXPRESSION, STABILITE ET VARIATION DU PATRIMOINE GENETIQUE THEME 1 A EXPRESSION, STABILITE ET VARIATION DU PATRIMOINE GENETIQUE CHAPITRE 3 L EXPRESSION DU PATRIMOINE GENETIQUE I. LA RELATION GENES-PROTEINES Les protéines interviennent dans le fonctionnement d

Plus en détail

Les méthodes d optimisation appliquées à la conception de convertisseurs électromécaniques. Elec 2311 : S7

Les méthodes d optimisation appliquées à la conception de convertisseurs électromécaniques. Elec 2311 : S7 Les méthodes d optimisation appliquées à la conception de convertisseurs électromécaniques Elec 2311 : S7 1 Plan du cours Qu est-ce l optimisation? Comment l optimisation s intègre dans la conception?

Plus en détail

Chapitre 2 : Organisation de la cellule

Chapitre 2 : Organisation de la cellule Partie 1 : notions de biologie cellulaire DAEU- Cours Sciences de la Nature & de la Vie- Marc Cantaloube Chapitre 2 : Organisation de la cellule La cellule est l unité de base des êtres vivants. Il existe

Plus en détail

Virus: Virus: Diversité génétique. Diversité génétique et variation antigénique. Virus: Conséquences épidémiologiques et thérapeutiques

Virus: Virus: Diversité génétique. Diversité génétique et variation antigénique. Virus: Conséquences épidémiologiques et thérapeutiques Virus: Diversité génétique et variation antigénique Conséquences épidémiologiques et thérapeutiques M. Segondy Virus: Diversité génétique Virus: Génome + Capside ± Enveloppe 1 Virus: Diversité génétique

Plus en détail

OPERON LACTOSE CHEZ LES PROCARYOTES IX. RÉGULATION DE L EXPRESSION GÉNÉTIQUE «OPERON LACTOSE CHEZ LES PROCARYOTES»

OPERON LACTOSE CHEZ LES PROCARYOTES IX. RÉGULATION DE L EXPRESSION GÉNÉTIQUE «OPERON LACTOSE CHEZ LES PROCARYOTES» 76 IX. RÉGULATION DE L EXPRESSION GÉNÉTIQUE «OPERON LACTOSE CHEZ LES PROCARYOTES» Avec l étude de l opéron lactose, François Jacob, Jacques Monod et André Lwoff ont été les premiers scientifiques à décrire

Plus en détail

Résumé. Delphine Théard

Résumé. Delphine Théard Delphine Théard Département de Biologie Cellulaire, section Biologie Cellulaire des Membranes, Centre Medical Universitaire de Groningue, Université de Groningue, 9713 AV Groningue, Pays-Bas - 135 - Résumé

Plus en détail

Introduction à la biochimie SBI4U

Introduction à la biochimie SBI4U Résultat d apprentissage pour le test : Je décris les innovations technologiques et les besoins de la société à l aide de la structure et la fonction des macromolécules, les réactions biochimiques et des

Plus en détail

A : Vrai : La biotechnologie est l'ensemble des techniques qui utilisent des microorganismes,

A : Vrai : La biotechnologie est l'ensemble des techniques qui utilisent des microorganismes, Ecurie du 1/02/12 1: AE A : Vrai : La biotechnologie est l'ensemble des techniques qui utilisent des microorganismes, des cellules animales, végétales ou leurs constituants à des fins industrielles (agro

Plus en détail

Chapitre 4 Les Protéines : définitions et Structures. Professeur Michel SEVE

Chapitre 4 Les Protéines : définitions et Structures. Professeur Michel SEVE UE1: Biomolécules (1) : Acides aminés et protéines Chapitre 4 Les Protéines : définitions et Structures Professeur Michel SEVE Année universitaire 2011/2012 Université Joseph Fourier de Grenoble - Tous

Plus en détail