Prise en charge du cancer colorectal à l heure de l oncogénétique et des thérapies ciblées

Transcription

1 Prise en charge du cancer colorectal à l heure de l oncogénétique et des thérapies ciblées Jean-François Fléjou Service d Anatomie Pathologique Hôpital Saint-Antoine, AP-HP, UPMC - Paris 6, France

2 Sommaire Immunohistochimie comme aide à l oncogénétique (et à l évaluation pronostique?) MSI / MMR / HNPCC : un exemple réussi MYH : un exemple raté Les lésions festonnées (choix de l orateur ) Quelques mots sur la saga de l EGFR et de KRAS

3 Sommaire Immunohistochimie comme aide à l oncogénétique (et à l évaluation pronostique?) MSI / MMR / HNPCC : un exemple réussi MYH : un exemple raté Les lésions festonnées (choix de l orateur ) Quelques mots sur la saga de l EGFR et de KRAS

4 «MSI» (Médicalisation du Système d Information) (Mouvement Social Italien) (Molecular Simulations Inc) (Marketing Science Institute) (Mindness Self Indulgence). Microsatellite Instability Quoi? Comment? Pourquoi? Quand?

5 5 3 G T A A A A A T T T T C A C A C A C A C A G T G T G T G T G T GT 3 5 MMR gene inactivation Loss of MMR protein expression hmsh2 hmlh1 hmsh6 hpms2 hmsh2 hmlh1 hmsh3 hmlh3 hmsh2 hmlh1 hmsh3 hpms2 MMR DEFICIENCY MLH1 5 3 A T A A A A T T T T Mismatch Repair System (MMR) C A C A C A C A C A G T G T G T G T G T 3 5 BAT26 D17S270 Microsatellite Instable Cancers (MSI) (A)n repeat (CA)n repeat N N TCCAAAAAAAAAAAAAAAAAAGTC GCTTCACACACACACACACACACATCC TCCAAAAAAAAAAAAAAAAAGTC GCTTCACACACACACACACACATCC T T TCCAAAAAAAAAAAAAAAAGTC TCCAAAAAAAAAAAAAAAGTC GCTTCACACACACACACACATCC GCTTCACACACACACACATCC

6 NEOANTIGENE PERTES DE FONCTION PROTEIIIIN STIMULATION REPONSE IMMUNITAIRE ANTI-TUMORALE ATG STOP PREMATURE (PTC) mrna NNNNNNNNN 5 UTR 3 UTR GENE CIBLE MSI

7 TRANSCRIPTOMIC PROFILE OF COLORECTAL CANCERS MSI MSS CONTROLS

8 Cancers MSI-H SPORADIQUE Tardif Environ 15% des cancers du - Côlon (35.000) - Estomac (8.000) - Endomètre (5.000) HEREDITAIRE HNPCC (Syndrome de Lynch) Précoce Localisation multiple Ségrégation familiale autosomique dominante Inactivation somatique d un gène MMR (Méthylation du promoteur de hmlh1) ovaire, pancréas, cerveau, rein, voie biliaire, lymphomes... Mutation constitutionnelle d un gène MMR (Mutation ponctuelle de hmlh1 ou hmsh2... )

9 MSI Microsatellite Instability Quoi? Comment? Pourquoi? Quand?

10 Diagnostic du phénotype MSI Comment? PCR gold standard d instabilité quel tissu (congelé, paraffine), quel panel de microsatellites, quel seuil? Immunohistochimie à la recherche de la perte d expression d une protéine MMR quels anticorps (2 à 4), quels critères? Pourquoi? Aide au diagnostic des formes familiales (HNPCC) Aide à l évaluation pronostique Aide à la décision thérapeutique Quand? Les indications restent discutées

11 Avantages : PCR Conséquence fonctionnelle de l inactivation du MMR, indépendante du mécanisme Caractère objectif (?) Inconvénients : Disponibilité limitée Non contrôle morphologique (?) Panel variable selon les centres Avantages : IHC Oriente sur la protéine et donc le gène en cause Largement disponible Contrôle morphologique Inconvénients : Caractère subjectif (?) Type et panel d AC variables Dépend de la fixation Sensibilité ne peut être parfaite

12 Expérience de Saint-Antoine Choix par le pathologiste d un bloc comportant tumeur + tissu sain - IHC : hmlh1 (clone G , 1:70) et hmsh2 (clone FE11, 1:100). hmsh6 (et hpms2) à la demande Perte totale par les cellules tumorales exigée, avec témoins internes (cellules épithéliales et lymphocytes) positifs - PCR : 2 coupes de 10mm du même bloc sans macro- ni microdissection, extraction ADN, PCR pentaplex mononucléotidique (Suraweera et al, Gastroenterology 2002), MSI > 2 marqueurs instables

13 hmlh1 hmsh2

14 Résultats Saint-Antoine Anatomie Pathologique LCGBM (O Lascols, R Hamelin) IHC MLH1/MSH2/(MSH6) et PCR pentaplex 566 CCR MSI : 48 Perte expression : 51 IHC perte IHC pas de perte PCR MSI 46 2 PCR MSS Résultats très proches, dans cette série hospitalière monocentrique Les résultats sont différents dans une série de population multicentrique (perte de sensibilité et de spécificité de l IHC) Chapusot et al, Am J Surg Pathol 2004

15 Perte MSH2 (HNPCC connu), MSS en PCR Opéré après radio-chimiothérapie néo-adjuvante, très peu de tumeur résiduelle. MLH1 MSH2

16 L étude de MSH6 et de PMS2 est-elle utile en complément de MLH1 et MSH2? 210 cancers consécutifs de moins de 50 ans

17 Résultats IHC MMR MLH1 et MSH2 «systématiques» (pas de contexte) Pas de perte : MSS, pas de Lynch Perte MLH1 : Lynch MLH1 ou sporadique MSI Perte MSH2 : Lynch MSH2 Contexte évocateur Lynch : Perte MLH1 ou MSH2 : idem Pas de perte MLH1 ni MSH2, faire MSH6 et PMS2 Perte MSH6 : Lynch MSH6 Perte PMS2 : Lynch PMS2 Pas de perte : sans doute pas Lynch (mais voir PCR MSI et consultation oncogénétique +++)

18 Am J Surg Pathol 2008

19 Morphologie des cancers MSI Peu différenciés (médullaires), mucineux, bien limités, inflammatoires intra (LIE) et péri-tumoraux (Crohn like) Score «MSpath» Bonne sensibilité, mauvaise spécificité

20 Diagnostic du phénotype MSI Comment? PCR gold standard d instabilité quel tissu (congelé, paraffine), quel panel de microsatellites, quel seuil? Immunohistochimie à la recherche de la perte d expression d une protéine MMR quels anticorps (2 à 4), quels critères Pourquoi? Aide au diagnostic des formes familiales (HNPCC) (Intérêt de méthylation MLH1 et/ou mutation BRAF) Aide à l évaluation pronostique Aide à la décision thérapeutique Quand? Les indications restent discutées

21 Diagnostic du syndrome HNPCC Des indications peu claires American Gastroenterological Association guidelines Lenz, H.-J. J Clin Oncol; 23:

22 Prédisposition héréditaire aux cancers UCP : cancer du spectre HNPCC ans < 40 ans ou atcd 1er degré ou atcd personnel Consultation d oncogénétique RER MSI MSS Côlon Gche/rectum ou adénome Côlon droit IHC recommandée MLH1- MSH2/MSH6- IHC Analyse constitutionnelle MMR Olschwang et Eisinger, 2005

23 2 types de cancer colorectal Tumeurs LOH + (85%) Tumeurs MSI + (15%) HNPCC : 2-4%, mutation gène MMR Sporadiques : >10%, méthylation promoteur MLH1 Femmes âgées, côlon droit Mutation BRAF (40%) Comment distinguer formes familiales et sporadiques, quand la clinique n est pas typique, ou est trompeuse?? 2 candidats : BRAF, méthylation MLH1

24 Recherche de méthylation du promoteur de MLH1, ADN extrait des mêmes blocs de paraffine que l IHC et le pentaplex MSI 38 tumeurs MSI 18 MLH1 M 20 MLH1 U 18/18 perte MLH1 (IHC) 6/16 (38%) mutées BRAF 7/20 perte MLH1 (IHC) 13/20 perte MSH2 (IHC) Données moléculaire s 0/18 HNPCC 4/7 HNPCC 8/13 HNPCC Clinique Capel et al, INSERMU762, Oncogene 2007

25 Meilleur pronostic des CCR MSI Elsaleh et al. Lancet 2000 Parc et al. Gut 2004

26 MSI et chimiosensibilité des CCR 5FU In vitro : MSI induit une résistance au 5FU In vivo : résultats discordants Elsaleh et al. Lancet 2000 Ribic et al. NEJM 2003

27 Disease-free survival probability Disease-free survival according to chemotherapy All tumors (P = 0.03) 83.6% 70.8% FOLFOX4, 69 patients, 11 recurrences FL, 123 patients, 38 recurrences Time after surgery (months) MSS tumors (P = 0.18) MSI tumors (P = 0.02) 100% 80.8% 73.3% FOLFOX, 59 patients, 11 recurrences FL, 103 patients, 30 recurrences 57.9% FOLFOX, 10 patients, 0 recurrence FL, 20 patients, 8 recurrences FOLFOX > FL (not significant for MSS tumors)

28 ASCO 2006 update of recommendations for the use of tumor markers in gastrointestinal cancer MSI ascertained by PCR is not recommended at this time to determine the prognosis of operable colorectal cancer nor to predict the effectiveness of FU adjuvant chemotherapy Locker GY et al. J Clin Oncol 2006 Editorial - J Clin Oncol 2007, CR Boland Clinical uses of MSI testing in CRC: an ongoing challenge MSI should be taken into account in future trials of chemotherapy for colorectal cancer

29 Immunohistochimie MMR JR Jass, 2005 : «The fact that the pathologist can contribute to the diagnosis of a serious disorder by using a strategy that is both simple and cost-effective represents an important medical advance» LA Aaltonen, 2006 : «Immunohistochemistry is the ideal method, there is no benefit doing both. MSI is control for IHC»