A L I M E N T A T I O N A G R I C U L T U R E E N V I R O N N E M E N T

Dimension: px
Commencer à balayer dès la page:

Download "A L I M E N T A T I O N A G R I C U L T U R E E N V I R O N N E M E N T"

Transcription

1 Analyse par RNA-seq de l'expression sexe- dépendante dans le foie et le tissu adipeux blanc de 3 espèces : le porc, le poulet et la souris

2 Contexte Rôle des estrogènes dans l expression sexe-dépendante au niveau hépatique (M2 Nabila Moussaoui) Clodfelter et al., Mol Endo, 2006 Bryzgalova et al., Diabetologia, 2006 Gao et al., Mol Endo, 2006 ARN 4x44K

3 Contexte 3 unités INRA avec un centre d intérêt commun : le métabolisme des lipides SENAH / PHASE (Florence Gondret) GARen / GA (Sandrine Lagarrigue) ToxAlim / AlimH et SA (Pascal Martin) 3 tissus déterminants pour le métabolisme des lipides à l échelle de l organisme Le foie (synthèse (y / transformation / dégradation / stockage) g) Le tissu adipeux blanc (synthèse / stockage) Le muscle (dégradation) Métabolisme très «interconnecté», différences entre tissus, espèces et sexes. ProjetAIPBioressources SOS-RNA (2010) ANR FATinteger (Rennes)

4 Les échantillons Animaux prépubères mâles et femelles de chaque espèce (4 individus/sexe) Foie Tissu adipeux périgonadique 3 espèces x 2 sexes x 2 tissus x 4 individus/lot = 48 échantillons Extraction Trizol Digestion DNAse Purification RNeasy RIN Préparation des librairies (TruSeq Illumina) sur GeT-PlaGe (Nathalie Marsaud). Wan et al., Biostatistics 2012 Séquençage HiSeq2000 2x100 bases sur GeT- PlaGe (Olivier Bouchez) 16 lanes (1 sexe, 1 tissu, 1 indiv/espèce / lane)

5 Des données brutes de qualité en quantité 20,3 à 50, fragments/échantillons Analyse Fastqc et contamination (Gérald Salin) Résultats t sous NG6 (PF Bioinfo) i FastQC => OK (Effets random primers) IGV Integrative Genome Viewer : Robinson et al., Nat Biotech, 2011

6 Alignements Alignement sur les transcrits Ensembl r63 (bwa) #Transcrits : Mouse=93 805, Chicken=23 392, Pig= (Christophe Klopp)

7 Alignements / assemblage Christophe Klopp Yannick Lippi Alignement sur le génome (tophat) Assemblage de transcrits et comptage (Cufflinks) Bam files (3Go/file) + tdf + bai Gtf files Combinaison des résultats (Cuffcompare) Tableaux (Raw+Fpkm : >270K lignes) S1 S2 S3 S4 S5 S6 S7 S8 S9 S10 S11 S12 S13 S14 S15 S16 ENSMUST ENSMUST ENSMUST ENSMUST ENSMUST Analyses différentielles i (CuffDiff) >50% des lignes Exploration des résultats (CummeRbund) Trapnell et al., Nat Protocols, 2012

8 Comparaison Fpkm bwa/ensembl vs Cufflinks

9 Comparaison Fpkm bwa/ensembl vs Cufflinks

10 Gènes les plus exprimés? Albumine!! Filtrée par Cufflinks!! Major urinary proteins (Mup) Autres protéines de phase aigüe (transferrin, -2-HS-glycoprotein, Serpins, -2 microglobulin, haptoglobin, fibrinogen, hemopexin, ) Apolipoprotéines (A-I I, A-II II, C-I I, E) Métabolisme des xénobiotiques (Cyp, Gst, Ces) Assez bonne concordance entre bwa et tophat/cufflinks. Cohérence avec les principales fonctions du foie

11 Trf Gènes les plus exprimés? log

12 Filtrer les données? Pour au moins 1 groupe : Somme des Fpkm > 4 ET au moins 2 individus avec Fpkm>1 Fpkm=1 10 fragments / transcrit «moyen» de 1Kb / librairiei i de 10M % 53% % 60% Transcripts Gènes Transcripts Gènes Foie TAB Filtrés Conservés

13 Gènes différentiellement exprimés : Foie Bwa/Ensr63 + DESeq Anders & Huber, Genome Biol, 2010 Enrichissement de catégories GO GOseq : Young et al., Genome Biol, 2010 # gènes (FDR<10%) 79 Synthèse des lipides Métabolisme des hormones et tdes xénobiotiques 108 Oxydation des lipides

14 Bwa/Ensr63 + DESeq Gènes différentiellement exprimés : TAB Anders & Huber, Genome Biol, 2010 Enrichissement de catégories GO GOseq : Young et al., Genome Biol, 2010 # gènes (FDR<10%) 1017 Développement des vaisseaux / angiogénèse 1293 Biologie du muscle Contaminations tissu environnant? Hétérogénéité é éité cellulaire? l Recherche de gènes spécifiques Kouadjoet al., BMC Genomics, 2007

15 Gènes différentiellement exprimés : ChrY

16 Gènes différentiellement exprimés : Xist

17 Elovl3 Gènes différentiellement exprimés Pnpla3

18 Cufflinks Quelques observations sur les résultats de Cufflinks / Cuffdiff Réglagedesparamètres : Albumine Beaucoup (trop?) de transcrits et de gènes nouveaux Cuffcompare Beaucoup (trop!!) de transcrits avec des valeurs pour un seul individu Cuffdiff Premiers résultats assez décevants : Peu de gènes DE et presque tous identifiés par DESeq Aucun gène du chromosome Y

19 Quelques observations sur les résultats de Cufflinks / Cuffdiff Cuffdiff : Ddit4

20 Quelques observations sur les résultats de Cufflinks / Cuffdiff Cuffdiff : Cyp2b19 Forte homologie Cyp2b13, 2b9, 2b10, 2b23

21 Quelques observations sur les résultats de Cufflinks / Cuffdiff DESeq : Cyp2b9

22 Niveau gène ou niveau transcrit? UP DOWN Souris / Foie # de gènes significatifs (FDR<10%) UP DOWN Souris / TAB # de gènes significatifs (FDR<10%)

23 Bilan Technologie RNA-Seq Données brutes de qualité. Améliorer / standardiser les QC pour identifier les échantillons/valeurs aberrants et «nettoyer» les jeux de données Alignements semblent OK mais beaucoup de questions concernant l assemblage de transcrits, le comptage des reads/fragments et la combinaison des résultats de différents échantillons Analyse différentielle : CuffDiff, DESeq (edger) Transcrits alternatifs? CuffDiff, DEXSeq en cours

24 Bilan Technologie RNA-Seq

25 Remerciements Nbil Nabila Moussaoui i(phd) Sandrine Lagarrigue Colette Bétoulières Colette Désert GARen Yannick Lippi Christophe Klopp Florence Gondret Sandrine Tacher Gerald Salin Olivier Bouchez Nathalie Marsaud Financement

http://get.genotoul.fr

http://get.genotoul.fr http://bioinfo.genotoul.fr i f Gestion des données de l HiSeq 2000 Plateformes GenoToul Bioinformatique et GeT-PlaGe Ch. Klopp / G. Salin 07 octobre 2011 gerald.salin@toulouse.inra.fr Contexte NGS Collaboration

Plus en détail

Analyse de données RNAseq sous Galaxy : l'exemple du poulet

Analyse de données RNAseq sous Galaxy : l'exemple du poulet Analyse de données RNAseq sous Galaxy : l'exemple du poulet Pierre François Roux & Sandrine Lagarrigue, Laboratoire de Génétique, UMR INRA Agrocampus Ouest PEGASE Rennes/St Gilles Yvan Le Bras, Projet

Plus en détail

Deux plateformes IBiSA et 3 plateaux techniques regroupés depuis 2010. Responsable scientifique Denis Milan. Coordination des nouveaux investissements

Deux plateformes IBiSA et 3 plateaux techniques regroupés depuis 2010. Responsable scientifique Denis Milan. Coordination des nouveaux investissements RNA-seq Olivier Bouchez Nathalie Marsaud Mercredi 28 mars 2012 Plateforme GeT : Génome et Transcriptome Deux plateformes IBiSA et 3 plateaux techniques regroupés depuis 2010 Responsable scientifique Denis

Plus en détail

Atelier 5/11/2013. Structure de la chromatine et marques épigénétiques

Atelier 5/11/2013. Structure de la chromatine et marques épigénétiques Atelier 5/11/2013 Structure de la chromatine et marques épigénétiques La chromatine ADN ADN + Histones = Nucleosome ADN + Protéines + ARNs = Chromatine Niveau extrême de condensation = Chromosome métaphasique

Plus en détail

Place et avenir du séquençage haut-débit

Place et avenir du séquençage haut-débit Place et avenir du séquençage haut-débit Olivier Bouchez genomique@toulouse.inra.fr La Plateforme GeT Expertise et mise à disposition d une plateforme technologique en génomique : Séquençage Génotypage

Plus en détail

Analyse du développement précoce du fruit chez la tomate par une

Analyse du développement précoce du fruit chez la tomate par une Analyse du développement précoce du fruit chez la tomate par une approche RNAseq Mohamed Zouine Laboratoire GBF Le 7 octobre 2011 Le développement précoce du fruit Bourgeon Floral Fleur Absence de Pollinisation

Plus en détail

Influence du nombre de réplicats dans une analyse différentielle de données RNAseq

Influence du nombre de réplicats dans une analyse différentielle de données RNAseq Influence du nombre de réplicats dans une analyse différentielle de données RNAseq Statisticiens: Sophie Lamarre Steve Van Ginkel Sébastien Déjean - Magali San Cristobal Matthieu Vignes Biologistes: Stéphane

Plus en détail

metarnaseq: un package pour la méta-analyse de données RNA-seq

metarnaseq: un package pour la méta-analyse de données RNA-seq metarnaseq: un package pour la méta-analyse de données RNA-seq Guillemette Marot, Florence Jaffrézic, Andrea Rau 28/06/13 Overview 1 Introduction 2 Analyse statistique d une seule étude 3 Méta-analyse

Plus en détail

Génotypage par Séquençage (GBS) : Création d une carte génétique haute densité de Tournesol Population INEDI (RILs PSC8 x XRQ)

Génotypage par Séquençage (GBS) : Création d une carte génétique haute densité de Tournesol Population INEDI (RILs PSC8 x XRQ) Génotypage par Séquençage (GBS) : Création d une carte génétique haute densité de Tournesol Population INEDI (RILs PSC8 x XRQ) Baptiste Mayjonade (IE-CDD SUNRISE) Génétique et génomique des réponses aux

Plus en détail

Institut de Génomique. olaso@cng.fr

Institut de Génomique. olaso@cng.fr Institut de Génomique PCR quantitative : état des lieux... (de la théorie à la pratique, MIQE, CQ et stratégie de normalisation) olaso@cng.fr Microarray data qpcr data? Règles générales pour la présentation

Plus en détail

Formation Galaxy 13 Novembre 2014. 1 Premiers Pas

Formation Galaxy 13 Novembre 2014. 1 Premiers Pas Formation Galaxy 13 Novembre 2014 1 1-1 Connexion 1 Premiers Pas Connectez-vous sur la plateforme Galaxy SouthGreen à l adresse suivante : http://gohelle.cirad.fr/galaxy/ Utiliser votre adresse email et

Plus en détail

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq Présenté par Xi LIU ATCGCGCTAGCTGGTGTATCGCATCGCGCTAGCTGGTGTATCGCGCTAGCTGGTGTATCGCGCTAGCCTGGTGTATCGCCATCGCGCTAGCTGGCGCTAGCTGAATCGCGCATATG 17 Septembre 2013 Homéoallèles Génome Normalisation Analyse différentielle

Plus en détail

Le séquençage haut-débit

Le séquençage haut-débit Nouveaux outils en biologie Le séquençage haut-débit DES d hématologie 16 janvier 2015 Paris Alice Marceau-Renaut Laboratoire d hématologie CHRU Lille NGS = Next-Generation Sequencing Whole-genome Whole-exome

Plus en détail

Séquençage Haut-Débit : HiSeq 2000 et HiSeq 2500 (Illumina)

Séquençage Haut-Débit : HiSeq 2000 et HiSeq 2500 (Illumina) Séquençage Haut-Débit : HiSeq 2000 et HiSeq 2500 (Illumina) avec automatisation sur robot Tecan EVO200 Préparation des librairies High Output - HiSeq 2000 ou 2500 Run : 11 jours -2 Flowcells, 8 lanes /

Plus en détail

Introduction sur les nouvelles technologies de séquençages (NGS) et l'analyse des données générées sous Galaxy

Introduction sur les nouvelles technologies de séquençages (NGS) et l'analyse des données générées sous Galaxy Introduction sur les nouvelles technologies de séquençages (NGS) et l'analyse des données générées sous Galaxy Yvan Le Bras, Projet e-biogenouest, CNRS UMR 6074 IRISA-INRIA, Rennes I. Informations globales

Plus en détail

FORMATION RADSEQ SOUS GALAXY. Intervenant(s) : Yvan Le Bras, Cyril Monjeaud

FORMATION RADSEQ SOUS GALAXY. Intervenant(s) : Yvan Le Bras, Cyril Monjeaud FORMATION RADSEQ SOUS GALAXY Intervenant(s) : Yvan Le Bras, Cyril Monjeaud E-BIOGENOUEST Programme fédérateur Biogenouest co-financé par les Régions Bretagne et Pays de la Loire 24 mois Lancé depuis Mai

Plus en détail

Plateforme Transcriptome Végétale

Plateforme Transcriptome Végétale Plateforme Transcriptome Végétale INRA- Unité de Recherche en Génomique Végétale Journée «Plateformes Génopole», 25 juin 2013. Sandrine Balzergue, balzerg@evry.inra.fr Analyse quan8ta8ve de l expression

Plus en détail

Modalités d exécution des prestations NGS réalisées via l UMR 8199-2013

Modalités d exécution des prestations NGS réalisées via l UMR 8199-2013 Modalités d exécution des prestations NGS réalisées via l UMR 8199-2013 I. Préparation des librairies en vue du séquençage Haut débit via HiSeq et MiSeq 1.1 Points communs à toutes préparations de librairies

Plus en détail

Détection de mutations somatiques par NGS sur GAIIx

Détection de mutations somatiques par NGS sur GAIIx Détection de mutations somatiques par NGS sur GAIIx Aude Lamy Laboratoire de Génétique Somatique des Tumeurs CHU de Rouen Inserm U1079 Faculté de Médecine et Pharmacie de Rouen La médecine personalisée

Plus en détail

L étude des gènes et des protéines facilitée par l utilisation du web service ProteINSIDE

L étude des gènes et des protéines facilitée par l utilisation du web service ProteINSIDE L étude des gènes et des protéines facilitée par l utilisation du web service ProteINSIDE KASPRIC Nicolas Thèse débutée en février 2013 Equipe Amuvi Encadrants : Muriel BONNET Brigitte PICARD Avec l appui

Plus en détail

Le séquençage à haut débit Juin 2012

Le séquençage à haut débit Juin 2012 Atelier Epigénétique Université Pierre et Marie Curie Le séquençage à haut débit Juin 2012 Stéphane Le Crom (stephane.le_crom@upmc.fr) Laboratoire de Biologie du Développement (UPMC) de la Montagne Sainte

Plus en détail

Quelques définitions

Quelques définitions Quelques définitions Sandrine Lagarrigue et Pascale Le Roy 1 Journée Technique SYSAAF La mise en œuvre des outils de la génomique : enjeux pour le SYSAAF et ses adhérents. 03 juin 2015. Rennes Le génome

Plus en détail

Cartographie protéique du muscle

Cartographie protéique du muscle C. MOLETTE Cartographie protéique du muscle Bouley et al., 2004 Cartographie protéique du muscle 500 spots détectés 129 protéines identifiées Autres fonctions Voies métaboliques 75 produits de gènes différents

Plus en détail

Modulation de l épissage alternatif par la protéine de fusion EWS-FLI1 dans le sarcome d Ewing

Modulation de l épissage alternatif par la protéine de fusion EWS-FLI1 dans le sarcome d Ewing Olivier SAULNIER Master 2 biologie informatique Université Paris Diderot, Paris 7 2014 2015 Modulation de l épissage alternatif par la protéine de fusion EWS-FLI1 dans le sarcome d Ewing Directeur d équipe

Plus en détail

Savons-nous vraiment ce que font les pesticides à nos cellules? Le cas des récepteurs à la dioxine et aux estrogènes

Savons-nous vraiment ce que font les pesticides à nos cellules? Le cas des récepteurs à la dioxine et aux estrogènes Savons-nous vraiment ce que font les pesticides à nos cellules? Le cas des récepteurs à la dioxine et aux estrogènes Luc Gaudreau Département de Biologie, Faculté des Sciences Quelques données concernant

Plus en détail

CONTRÔLE DU MÉTABOLISME ET DE LA PROLIFÉRATION PAR LES MICROARN ET LES ACTEURS DU CYCLE CELLULAIRE

CONTRÔLE DU MÉTABOLISME ET DE LA PROLIFÉRATION PAR LES MICROARN ET LES ACTEURS DU CYCLE CELLULAIRE UNIVERSITE MONTPELLIER 1 UFR MEDECINE THÈSE Présentée pour obtenir le grade de DOCTEUR DE L UNIVERSITE MONTPELLIER I Discipline : Biochimie et Biologie Moléculaire École doctorale : Sciences Chimiques

Plus en détail

Génotypage et Séquençage. Pierre Mournet

Génotypage et Séquençage. Pierre Mournet Génotypage et Séquençage Pierre Mournet Plan Séquençage/Génotypage Classique (usat, Sanger) Séquençage NGS (Next Generation Sequencing) Séquenceur Préparation Pré-NGS Exemple 1 NGS Exemple 2 NGS Génotypage

Plus en détail

Recherche des transcrits de fusion AML1/ETO et CBFB-MYH11 dans les LAM de l`adulte.

Recherche des transcrits de fusion AML1/ETO et CBFB-MYH11 dans les LAM de l`adulte. Recherche des transcrits de fusion AML1/ETO et CBFB-MYH11 dans les LAM de l`adulte. F.Harieche, W.Assouak, A.Trabzi, M.Saidi, F.Zerhouni, R.M.Hamladji. LAM Entité distincte Leucémies aigues. Transformation

Plus en détail

Tolérance au jeûne chez le loup de mer : Recherche des déterminants génomiques grâce aux NGS

Tolérance au jeûne chez le loup de mer : Recherche des déterminants génomiques grâce aux NGS Tolérance au jeûne chez le loup de mer : Recherche des déterminants génomiques grâce aux NGS E. Desmarais J.C. Avarre, C. Breton, K. Belkhir et B. Guinand Institut des Sciences de l Evolution - Montpellier

Plus en détail

FONCTIONNEMENT ET RECOMMANDATION DE LA PLATEFORME GeT- BIOPUCES

FONCTIONNEMENT ET RECOMMANDATION DE LA PLATEFORME GeT- BIOPUCES La plateforme GeT- Biopuces réalise vos expériences depuis le design des sondes jusqu à l analyse statistique des données. Elle met à votre disposition l'équipement nécessaire pour réaliser vos expériences

Plus en détail

Intégration des approches métagénomiques dans l'étude de la diversité des coléoptères saproxyliques : progrès et perspectives

Intégration des approches métagénomiques dans l'étude de la diversité des coléoptères saproxyliques : progrès et perspectives Intégration des approches métagénomiques dans l'étude de la diversité des coléoptères saproxyliques : progrès et perspectives Rodolphe Rougerie (1), Christophe Bouget (2) & Carlos Lopez-Vaamonde (1) (1)

Plus en détail

Séquençage du génome complet du VHC par une approche de Long range PCR

Séquençage du génome complet du VHC par une approche de Long range PCR Séquençage du génome complet du VHC par une approche de Long range PCR Sylvie LARRAT MCU-PH Laboratoire de Virologie CHU de Grenoble L hépatite C Épidémiologie 160 M porteurs chroniques 500 000 décès /

Plus en détail

Identifier des éléments biologiques dans les reads sans assemblage ni génome de référence. Pierre Peterlongo, Nadia Pisanti and Marie-France Sagot

Identifier des éléments biologiques dans les reads sans assemblage ni génome de référence. Pierre Peterlongo, Nadia Pisanti and Marie-France Sagot Identifier des éléments biologiques dans les reads sans assemblage ni génome de référence Pierre Peterlongo, Nadia Pisanti and Marie-France Sagot Que faire des reads? Premiers reflexes Avec un génome de

Plus en détail

Physiologie du Pancréas endocrine

Physiologie du Pancréas endocrine Physiologie du Pancréas endocrine 1 I. Introduction II. Insuline Plan 1. Sécrétion 2. Régulation 3. Actions physiologiques 4. Mode d action III. Glucagon 2 2eme Année de médecine 1 Cellules β I. Introduction

Plus en détail

Single Molecule Real Time (SMRT) Sequencing : PacBio RS II

Single Molecule Real Time (SMRT) Sequencing : PacBio RS II Single Molecule Real Time (SMRT) Sequencing : PacBio RS II Input sample Genome DNA, Amplicons, cdna Input sample amounts according to the protocols (10ng-10µg) High Input sample quality (integrity and

Plus en détail

FORMULAIRE de soumission de PROJET de SEQUENÇAGE A HAUT DEBIT

FORMULAIRE de soumission de PROJET de SEQUENÇAGE A HAUT DEBIT Plate-forme Transcriptome et Epigénome (PF2) FORMULAIRE de soumission de PROJET de SEQUENÇAGE A HAUT DEBIT Séquençage des ARNs (RNA-seq, TSS mapping, mirna-seq) et de produits d immuno-précipitation de

Plus en détail

Influence du nombre de réplicats dans une analyse différentielle de données RNA-Seq

Influence du nombre de réplicats dans une analyse différentielle de données RNA-Seq Influence du nombre de réplicats dans une analyse différentielle de données RNA-Seq Sophie Lamarre 1, Stéphane Pyronnet 2, Emeline Sarot 2, Sébastien Déjean 3, Magali San Cristobal 3,4 & Matthieu Vignes

Plus en détail

3. Biotechnologie de l ADN

3. Biotechnologie de l ADN 3. Biotechnologie de l ADN 3.1. Technologie de l ADN recombinant 3.1.1. Isolation d ADN et d ARN 3.1.2. Fragmentation de l ADN (les Endonucléases) 3.1.3. Analyse d ADN sur d agarose et d acrylamide 3.1.4.

Plus en détail

Olivier Bouchez, GeT-PlaGe Responsable SéquenS. olivier.bouchez@toulouse.inra.fr

Olivier Bouchez, GeT-PlaGe Responsable SéquenS. olivier.bouchez@toulouse.inra.fr Séquençage Haut-Débit sur GeT Olivier Bouchez, GeT-PlaGe Responsable SéquenS quençage Haut-débit olivier.bouchez@toulouse.inra.fr Localisation des séquenceurss Plateforme Génomique INRA Auzeville Séquenceurs

Plus en détail

cumulonumbio 2015 Situa1on et besoins en cancérologie alain.viari@inria.fr cumulonumbio 2015

cumulonumbio 2015 Situa1on et besoins en cancérologie alain.viari@inria.fr cumulonumbio 2015 Situa1on et besoins en cancérologie alain.viari@inria.fr cancer : maladie du génome Theodor Boveri (1862-1915) chromosomes = support matériel de l hérédité (+ SuKon) hypothèse: cellule tumorale - > dérèglement

Plus en détail

Séquençage. Bérénice Batut, berenice.batut@udamail.fr. DUT Génie Biologique Option Bioinformatique Année 2014-2015

Séquençage. Bérénice Batut, berenice.batut@udamail.fr. DUT Génie Biologique Option Bioinformatique Année 2014-2015 Séquençage Bérénice Batut, berenice.batut@udamail.fr DUT Génie Biologique Option Bioinformatique Année 2014-2015 Séquençage Séquençage ADN Détermination de l ordre d enchainement des nucléotides d un fragment

Plus en détail

Biologie Intégrative Projet Fédérateur Biogenouest

Biologie Intégrative Projet Fédérateur Biogenouest Biologie Intégrative Projet Fédérateur Biogenouest Coordinateurs: C. Pineau (INSERM U625 & PF protéomique BGO) D. Eveillard (LINA Université de Nantes UMR CNRS 6241) Animateur: Y. Le Bras (Biogenouest)

Plus en détail

DNA-seqciblé : principales méthodes d'enrichissement

DNA-seqciblé : principales méthodes d'enrichissement DNA-seqciblé : principales méthodes d'enrichissement DU de séquençage haut-débit Module 1 : Séquençage nouvelle génération - Technologies & applications 17 octobre 2013 Amélie PITON piton@igbmc.fr 1 Introduction

Plus en détail

RNAseq et NGS. Adriana Alberti Karine Labadie

RNAseq et NGS. Adriana Alberti Karine Labadie RNAseq et NGS Séquençage et Diversité LES ORGANISMES EUCARYOTES animaux plantes champignons protistes BACTERIES ARCHEES VIRUS METAGENOMES LES SOURCES ADN GENOMIQUE ARN / cdna AMPLICONS BACs ET FOSMIDES

Plus en détail

PHARMACIEN POLYTECHNICIEN SCIENCES CHIMIQUES VERSUS DE LA SANTÉ SCIENCES BIOLOGIQUES?

PHARMACIEN POLYTECHNICIEN SCIENCES CHIMIQUES VERSUS DE LA SANTÉ SCIENCES BIOLOGIQUES? PHARMACIEN POLYTECHNICIEN DE LA SANTÉ SCIENCES CHIMIQUES VERSUS SCIENCES BIOLOGIQUES? Professeur Pascale Cohen Professeur Marc Leborgne ISPB-Pharmacie Université Lyon I Quelle est la place actuelle de

Plus en détail

Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure

Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure Marie Verbanck Laboratoire de Mathématiques Appliquées, Agrocampus OUEST Soutenance de thèse - 4 septembre

Plus en détail

Mise en place du NGS en routine diagnostic - Validation, Organisation, Développements

Mise en place du NGS en routine diagnostic - Validation, Organisation, Développements Mise en place du NGS en routine diagnostic - Validation, Organisation, Développements Atelier sur le Diagnostic Moléculaire de la Mucoviscidose 2014 - Lille Stratégie analytique Préparation library (1,5

Plus en détail

TRAITEMENT BIOINFORMATIQUE DE DONNÉES RNA-Seq

TRAITEMENT BIOINFORMATIQUE DE DONNÉES RNA-Seq TRAITEMENT BIOINFORMATIQUE DE DONNÉES RNA-Seq http://genoweb.toulouse.inra.fr/~formation/9_galaxy_rnaseq_fp/ /Biostat Formateurs Cédric Cabau Céline Noirot Matthias Zytnicki /Biostat Plan Introduction

Plus en détail

Les principes du sequençage haut-débit

Les principes du sequençage haut-débit Les principes du sequençage haut-débit Mardi 23 avril 2013 Dr H. EL HOUSNI Organisation Génomique Podhala'et'al.'Trends'in'genetics'2012' Costa V et al. J BioMed BioTech 2010 32 ans Costa V et al. J BioMed

Plus en détail

Plateforme de bioinformatique

Plateforme de bioinformatique Plateforme de bioinformatique Arnaud Droit Centre de Recherche du CHU de Québec Laboratoire de biologie computa;onelle Compréhension des différences 2005 Génome du chimpanzee Nous sommes identiques ± 1%

Plus en détail

Cumulo Numbio 2015. La révolution next-generation sequencing et les enjeux de l'expansion de la bioinformatique pour les biologistes.

Cumulo Numbio 2015. La révolution next-generation sequencing et les enjeux de l'expansion de la bioinformatique pour les biologistes. Cumulo Numbio 2015 La révolution next-generation sequencing et les enjeux de l'expansion de la bioinformatique pour les biologistes. Human genome sequence June 26th 2000: official announcement of the completion

Plus en détail

Institut Français de Bioinformatique (IFB) : mettre en place une infrastructure informatique dédiée aux sciences de la vie

Institut Français de Bioinformatique (IFB) : mettre en place une infrastructure informatique dédiée aux sciences de la vie 1 / 1 Institut Français de Bioinformatique (IFB) : mettre en place une infrastructure informatique dédiée aux sciences de la vie J-F. Gibrat Unité Mathématique, Informatique et Génome, INRA, Jouy-en-Josas

Plus en détail

Obtention de données génétiques à grande échelle

Obtention de données génétiques à grande échelle Obtention de données génétiques à grande échelle Stéphanie FERREIRA Ph.D. Campus de l Institut Pasteur de Lille 1, rue du Professeur Calmette 59000 LILLE Tel : 03 20 87 71 53 Fax : 03 20 87 72 64 contact@genoscreen.fr

Plus en détail

Lutte contre la surcharge pondérale

Lutte contre la surcharge pondérale Lutte contre la surcharge pondérale I. Répartition des graisses corporelles Généralités Inégalités hommes/femmes Causes de l obésité II. Contrôle des la masse corporelle Réduire l apport énergétique alimentaire

Plus en détail

QUALVIVOL QUALité des VIandes de VOLailles

QUALVIVOL QUALité des VIandes de VOLailles QUALVIVOL QUALité des VIandes de VOLailles C. Berri, E. le Bihan-Duval (INRA, URA), F. Pitel (INRA, LGC) V. Sibut (URA, ITAVI) AGENAVI VII Colloque AGENAE-GENANIMAL Du 21 au 23 octobre 2009 Tours Approche

Plus en détail

L'expression d'une forme active de ChREBP conduit à la réinduction de la lipogenèse dans un modèle animal de déficience en LXR et SREBP-1c

L'expression d'une forme active de ChREBP conduit à la réinduction de la lipogenèse dans un modèle animal de déficience en LXR et SREBP-1c L'expression d'une forme active de conduit à la réinduction de la lipogenèse dans un modèle animal de déficience en LXR et SREBP-1c Audrey POUPEAU Equipe Signalisation Insuline et, Glucotoxicité Département

Plus en détail

Corps humain et santé : l exercice physique. Partie 1 : l adaptation physiologique lors d un effort physique.

Corps humain et santé : l exercice physique. Partie 1 : l adaptation physiologique lors d un effort physique. Corps humain et santé : l exercice physique. Partie 1 : l adaptation physiologique lors d un effort physique. Au cours de l activité physique, les muscles ont des besoins accrus. La couverture de ces besoins

Plus en détail

TD1 : Traitement d'un Fichier Brut de Séquences Transcrites.

TD1 : Traitement d'un Fichier Brut de Séquences Transcrites. TD1 : Traitement d'un Fichier Brut de Séquences Transcrites. Dans le cadre de cette formation, nous allons utiliser des données Illumina (75-bases 'pair-ends') issues du transcriptome de plusieurs individus

Plus en détail

PERCIMAP. Oreochromis niloticus. Construction d une carte RH à haute densité du génome de Tilapia CNRS UMR 6061

PERCIMAP. Oreochromis niloticus. Construction d une carte RH à haute densité du génome de Tilapia CNRS UMR 6061 PERCIMAP Construction d une carte RH à haute densité du génome de Tilapia Oreochromis niloticus CIRAD UPR20 Aquaculture et gestion des ressources aquatiques, Montpellier H. D Cotta E. Pepey J.F. Baroiller

Plus en détail

Séquençage haut débit 5 mars 26 mars (14h) C. Gaspin, C. Klopp, J. Mariette & G. Salin

Séquençage haut débit 5 mars 26 mars (14h) C. Gaspin, C. Klopp, J. Mariette & G. Salin Séquençage haut débit 5 mars 26 mars (14h) C. Gaspin, C. Klopp, J. Mariette & G. Salin Plan de la session Bioinformatique & séquençage haut débit Date Intervenant (s) Libellé 05/03 G. Salin Introduction

Plus en détail

Lier un site de liaison d'un facteur de transcription et son gène cible

Lier un site de liaison d'un facteur de transcription et son gène cible Berder 2013 : Corrélation, causalité et régulation en biologie Lier un site de liaison d'un facteur de transcription et son gène cible Laurent M. SACHS (sachs@mnhn.fr) Laboratoire Evolution des Régulations

Plus en détail

Notre Mission. Notre vision. Nos valeurs

Notre Mission. Notre vision. Nos valeurs Notre Mission Pour répondre aux besoins de la communauté scientifique d analyser des échantillons par le contenu moléculaire ou par l image, Excilone propose une gamme complète de services en micro et

Plus en détail

Introduc)on à Ensembl/ Biomart : Par)e pra)que

Introduc)on à Ensembl/ Biomart : Par)e pra)que Introduc)on à Ensembl/ Biomart : Par)e pra)que Stéphanie Le Gras Jean Muller NAVIGUER DANS ENSEMBL : PARTIE PRATIQUE 2 Naviga)on dans Ensembl : Pra)que Exercice 1 1.a. Quelle est la version de l assemblage

Plus en détail

LABORATOIRE D ANALYSES DE BIOLOGIE MEDICALE. Glycémie.0.75 g/l N: 0.70 1.10 4.16 mmol/l

LABORATOIRE D ANALYSES DE BIOLOGIE MEDICALE. Glycémie.0.75 g/l N: 0.70 1.10 4.16 mmol/l La régulation de la glycémie Introduction : Qu est ce que la glycémie? Quelles sont les valeurs normales de la glycémie? Document 1: bilan sanguin d une personne non diabétique (à jeun) Docteur P Pharmacien

Plus en détail

Les besoins de la communauté des sciences de la vie en termes d infrastructure informatique

Les besoins de la communauté des sciences de la vie en termes d infrastructure informatique 1 / 31 Les besoins de la communauté des sciences de la vie en termes d infrastructure informatique J-F. Gibrat Unité Mathématique, Informatique et Génome, INRA, Jouy-en-Josas Séminaire IDRIS, Orsay, 14

Plus en détail

La synthèse des protéines transcription code génétique traduction

La synthèse des protéines transcription code génétique traduction CEC André-Chavanne BIO 3 OS La synthèse des protéines transcription code génétique traduction I. La «Transcription» : de l ADN à l ARNm. L'adresse suivante permet d accéder à une ANIMATION sur la TRANSCRIPTION.

Plus en détail

De la biologie molécualire à la génomique

De la biologie molécualire à la génomique De la biologie molécualire à la génomique Pierre Neuvial École Nationale de la Statistique et de l Administration Économique Méthodes statistiques pour la biologie Plan du cours 1 Introduction à la biologie

Plus en détail

Tumeurs du sein triple négatif: Biologie moléculaire et projets de recherche

Tumeurs du sein triple négatif: Biologie moléculaire et projets de recherche 64 ème réunion du GERM Tumeurs du sein triple négatif: Biologie moléculaire et projets de recherche Tumeurs du sein triple négatif (TN) 12-17% des cancers du sein Contexte familial porteuses des mutations

Plus en détail

Enjeux de la biologie haut débit en oncologie

Enjeux de la biologie haut débit en oncologie Enjeux de la biologie haut débit en oncologie Pascal BARBRY, CNRS, Sophia Antipolis o Les technologies haut-débit ont enrichi considérablement nos approches quantitatives en biologie. o Des applications

Plus en détail

Les virus dans les aliments : un nouveau défi pour les laboratoires de microbiologie

Les virus dans les aliments : un nouveau défi pour les laboratoires de microbiologie : un nouveau défi pour les laboratoires de microbiologie Véronique ZULIANI, Institut de la Filière Porcine Jean Christophe Augustin, ENVA, ASA Qu est ce qu un virus? Microorganisme de 15 à 40 nm Environ

Plus en détail

MI1 Métabolisme et Nutrition - Stockage et mobilisation des molécules énergétiques - Cristol Année Universitaire 2007-2008

MI1 Métabolisme et Nutrition - Stockage et mobilisation des molécules énergétiques - Cristol Année Universitaire 2007-2008 Stockage et mobilisation des réserves énergétiques Les schémas joints sont ceux qui étaient sur le fichier du ronéo de l an dernier ; ceux qui sont sur le poly de la corpo étaient mal sortis. P.41 : triacylglycérol

Plus en détail

Quelques termes-clef de biologie moléculaire et leur définition

Quelques termes-clef de biologie moléculaire et leur définition Acide aminé (AA) Quelques termes-clef de biologie moléculaire et leur définition Isabelle Quinkal INRIA Rhône-Alpes Septembre 2003 Petite molécule dont l enchaînement compose les protéines - on dit qu

Plus en détail

Etude transcriptomique de la dégradation des parois lignocellulosiques de son et paille de blé durant la croissance de Thermobacillus xylanilyticus

Etude transcriptomique de la dégradation des parois lignocellulosiques de son et paille de blé durant la croissance de Thermobacillus xylanilyticus Journées SFR condorcet Compiègne 8-9 juillet 2015 Projet Hydroseq : UMR FARE-CRRBM Etude transcriptomique de la dégradation des parois lignocellulosiques de son et paille de blé durant la croissance de

Plus en détail

Ressources pour le lycée technologique

Ressources pour le lycée technologique éduscol Chimie biochimie sciences du vivant Classe de première Ressources pour le lycée technologique Présentation Thème 3 du programme Les systèmes vivants maintiennent leur intégrité et leur identité

Plus en détail

Plan. nergétique. Vue d ensemble d

Plan. nergétique. Vue d ensemble d Bioénerg nergétique * Vue d ensemble d du métabolismem PACES 2011-2012 Dr. A. Boullier Plan Introduction Bioénergétique Cycle de Krebs Chaîne respiratoire Métabolisme des glucides Métabolisme des lipides

Plus en détail

Biologie Moléculaire et Organismes Modèles

Biologie Moléculaire et Organismes Modèles Biologie Moléculaire et Organismes Modèles Sami Khuri Department of Computer Science San José State University khuri@cs.sjsu.edu Usine de Protéines Les protéines sont responsables de la plupart des fonctions

Plus en détail

10 Structure et catabolisme des Lipoprotéines

10 Structure et catabolisme des Lipoprotéines 10 Structure et catabolisme des Lipoprotéines Deux sources principales de lipides pour l organisme : Exogènes : via l intestin Endogènes : via le foie Les lipides circulent dans le sang en association

Plus en détail

Les Evolutions techniques. Marc Delpech Laboratoire de Génétique et Biologie moléculaires de l hôpital Cochin

Les Evolutions techniques. Marc Delpech Laboratoire de Génétique et Biologie moléculaires de l hôpital Cochin Les Evolutions techniques Marc Delpech Laboratoire de Génétique et Biologie moléculaires de l hôpital Cochin 1 Les principales étapes de l évolution technologique 1975 Southern blot 1977 Séquençage Sanger

Plus en détail

http://sigenae-workbench.toulouse.inra.fr

http://sigenae-workbench.toulouse.inra.fr -- 1 -- Vos traitements bioinformatiques avec GALAXY DOKEOS http://sigenae-workbench.toulouse.inra.fr -- 2 -- Galaxy pour vos traitements (bio)informatiques Vidéo disponible sur «sig-learning» Présentation

Plus en détail

Professeur Michel SEVE

Professeur Michel SEVE UE2 : Structure générale de la cellule Chapitre 2 : Structure de la cellule Le réticulum endoplasmique Professeur Michel SEVE Année universitaire 2010/2011 Université Joseph Fourier de Grenoble - Tous

Plus en détail

exemple de végétaux exposés au benzène atmosphérique Sylvain Dumez sylvain.dumez@univ-lille2.fr

exemple de végétaux exposés au benzène atmosphérique Sylvain Dumez sylvain.dumez@univ-lille2.fr Approches écotoxicogénomiques et application à la biosurveillance exemple de végétaux exposés au benzène atmosphérique Sylvain Dumez sylvain.dumez@univ-lille2.fr Laboratoire des Sciences végétales et fongiques,

Plus en détail

Génération d anticorps monoclonaux par immunisation génique

Génération d anticorps monoclonaux par immunisation génique Génération d anticorps monoclonaux par immunisation génique Gen2Bio 2010 Saint-Malo, mardi 30 mars 2010 Un partenariat Demandeur PADAM In Cell Art Projet Anticorps monoclonaux Gen2Bio 2010 Saint-Malo,

Plus en détail

Apport des NGS dans l'amélioration des algues

Apport des NGS dans l'amélioration des algues Des approches originales basées sur le séquençage nouvelle génération Apport des NGS dans l'amélioration des algues Gregory Carrier Laboratoire PBA Physiologie et Biotechnologie des Algues Direction: Gaël

Plus en détail

AutoGRAPH Un serveur pour automatiser et visualiser la comparaison de génomes: Application à l identification de nouveaux gènes chez le chien.

AutoGRAPH Un serveur pour automatiser et visualiser la comparaison de génomes: Application à l identification de nouveaux gènes chez le chien. AutoGRAPH Un serveur pour automatiser et visualiser la comparaison de génomes: Application à l identification de nouveaux gènes chez le chien. Thomas DERRIEN CNRS-UMR6061 Génétique et Développement Université

Plus en détail

Les biobanques pour les débutants

Les biobanques pour les débutants Les biobanques pour les débutants C Dubourg B Turlin 14 octobre 2010 CHU de Rennes Définition Collection d échantillons biologiques humains Réunion, à des fins scientifiques, de prélèvements biologiques

Plus en détail

Série : STL Spécialité biotechnologies SESSION 2014 BACCALAURÉAT TECHNOLOGIQUE

Série : STL Spécialité biotechnologies SESSION 2014 BACCALAURÉAT TECHNOLOGIQUE BACCALAURÉAT TECHNLGIQUE Série : STL Spécialité biotechnologies SESSIN 2014 CBSV : sous épreuve coefficient 4 Biotechnologies : sous épreuve coefficient 4 Durée totale de l épreuve: 4 heures Les sujets

Plus en détail

Fastqc : Vérification de la qualité des reads. Pipeline ARCAD

Fastqc : Vérification de la qualité des reads. Pipeline ARCAD Se connecter à marmadais : Activer le FortiClient : Serveur : vpn-montpellier.cirad.fr Port : 443 User : prénom non pswd : votre mot de passe CIRAD Pipeline ARCAD FileZilla : Permet de transférer les fichiers

Plus en détail

évaluation des risques professionnels

évaluation des risques professionnels évaluation des professionnels Inventaire des Etablissement : Faculté de Médecine Unité de travail : Laboratoire de Biochimie Médicale Année : 2013 Locaux Bureaux Salle de Microscopie Culture cellulaire

Plus en détail

Les microarrays: technologie pour interroger le génome

Les microarrays: technologie pour interroger le génome Les microarrays: technologie pour interroger le génome Patrick DESCOMBES patrick.descombes@frontiers-in-genetics.org Plate forme génomique NCCR Frontiers in Genetics Université de Genève http://genomics.frontiers-in-genetics.org

Plus en détail

SyMeTRIC. projet régional pour le développement de la Médecine Systémique. alban.gaignard@univ-nantes.fr

SyMeTRIC. projet régional pour le développement de la Médecine Systémique. alban.gaignard@univ-nantes.fr SyMeTRIC projet régional pour le développement de la Médecine Systémique alban.gaignard@univ-nantes.fr portage scientifique : Jérémie Bourdon (LINA), Richard Redon (Inst. du Thorax) Systems Medicine Développer

Plus en détail

METABOLISME DES IONS ET DE l EAU

METABOLISME DES IONS ET DE l EAU METABOLISME DES IONS ET DE l EAU 1 GENERALITES Le corps humain est composé de 60 à 70% d eau. Cette eau se répartit dans deux compartiments, intra et extracellulaire. Ce dernier peut être lui même scindé

Plus en détail

A la rencontre du séquençage haut-débit nouvelle génération. Infosys Building, Kuwait

A la rencontre du séquençage haut-débit nouvelle génération. Infosys Building, Kuwait A la rencontre du séquençage haut-débit nouvelle génération Infosys Building, Kuwait 2001 : Aboutissement du projet Génome Humain Ancêtres & Renouveau 2010 Hélicos, Ion torrent, Pacbio, Oxford Nanopore

Plus en détail

Post-traitement et analyse des données

Post-traitement et analyse des données V. Garcia J. Dupiot Post-traitement et analyse des données PAGE 1 Post-traitement et analyse des données Post-traitement. Production des séquences Evaluation de la qualité de séquençage Analyse / pipeline

Plus en détail

Objectif : identifier la mutation responsable de la maladie parmi les millions de polymorphisme.

Objectif : identifier la mutation responsable de la maladie parmi les millions de polymorphisme. Identification de gènes morbides Analyses mutationnelles Maladies monogéniques Objectif : identifier la mutation responsable de la maladie parmi les millions de polymorphisme. Plan : Variations du nombre

Plus en détail

ED 1. Jacques Elion. M1 Biologie Santé UE Maladies Génétiques et Cancer. Remerciements Anne Dumay Grégory Gautier. jacques.elion@inserm.

ED 1. Jacques Elion. M1 Biologie Santé UE Maladies Génétiques et Cancer. Remerciements Anne Dumay Grégory Gautier. jacques.elion@inserm. M1 Biologie Santé UE Maladies Génétiques et Cancer Année universitaire 2013-2014 ED 1 Jacques Elion jacques.elion@inserm.fr Remerciements Anne Dumay Grégory Gautier CONTEXTE Facteur de transcription Nucléaire

Plus en détail

CHAPITRE 3 LA SYNTHESE DES PROTEINES

CHAPITRE 3 LA SYNTHESE DES PROTEINES CHAITRE 3 LA SYNTHESE DES ROTEINES On sait qu un gène détient dans sa séquence nucléotidique, l information permettant la synthèse d un polypeptide. Ce dernier caractérisé par sa séquence d acides aminés

Plus en détail

Développement d une architecture de type GRID pour l analyse des données d expression biologiques

Développement d une architecture de type GRID pour l analyse des données d expression biologiques Développement d une architecture de type GRID pour l analyse des données d expression biologiques O. Delemar, T. Vermat, F. Paillier & M. Deleeuw GENOME express FuturVIEW 2 ntexte biologique : nome et

Plus en détail

Christelle REYNES EA 2415 Epidémiologie, Biostatistique et Santé Publique Université Montpellier 1. 8 Juin 2012

Christelle REYNES EA 2415 Epidémiologie, Biostatistique et Santé Publique Université Montpellier 1. 8 Juin 2012 Extraction et analyse des mesures haut-débit pour l identification de biomarqueurs : problèmes méthodologiques liés à la dimension et solutions envisagées EA 2415 Epidémiologie, Biostatistique et Santé

Plus en détail

Etude du transcriptome et du protéome en Neurooncologie

Etude du transcriptome et du protéome en Neurooncologie Etude du transcriptome et du protéome en Neurooncologie Principes, aspects pratiques, applications cliniques François Ducray Neurologie Mazarin, Unité Inserm U711 Groupe hospitalier Pitié-Salpêtrière Etude

Plus en détail

Vos traitements bioinformatiques avec GALAXY. Sarah Maman Maria Bernard École Bioinformatique AVIESAN 2015

Vos traitements bioinformatiques avec GALAXY. Sarah Maman Maria Bernard École Bioinformatique AVIESAN 2015 Vos traitements bioinformatiques avec GALAXY Sarah Maman Maria Bernard École Bioinformatique AVIESAN 2015 Galaxy Project Equipe Galaxy project : Le Center for Comparative Genomics and Bioinformatics -

Plus en détail