Influence du nombre de réplicats dans une analyse différentielle de données RNAseq

Dimension: px
Commencer à balayer dès la page:

Download "Influence du nombre de réplicats dans une analyse différentielle de données RNAseq"

Transcription

1 Influence du nombre de réplicats dans une analyse différentielle de données RNAseq Statisticiens: Sophie Lamarre Steve Van Ginkel Sébastien Déjean - Magali San Cristobal Matthieu Vignes Biologistes: Stéphane Pyronnet Emeline Sarot Agnès Bonnet Remerciements: David Alter, Hatim Hadria et Kais Sahli Réunion du Groupe de travail «Ingénieurs statisticiens de Toulouse» 14 Octobre 2014 Sophie LAMARRE Plateforme GeT-Biopuces à Toulouse

2 PLAN Introduction sur le séquençage Contexte, traitement et méthodologie d analyse des données Résultats: avec jeu de données réelles faible différentiel avec jeu de données réelles fort différentiel Conclusions Perspectives 2

3 1. INTRODUCTION SUR LE SEQUENCAGE L ADN qui est notre patrimoine génétique, est composé de 4 nucléotides: A, T, C, G. A s associe avec T. C s associe avec G. Séquencer c est lire la suite de nucléotides (A, T, C, G) contenu par l ADN 3

4 1. INTRODUCTION SUR LE SEQUENCAGE Le principe du séquencage2 ème génération 1. Découpage de l ADN en petits morceaux On découpe en X paires de bases (nombre de nucléotides) selon la capacité de la machine à séquencer Note: cette étape s appelle la préparation de la librairie (elle contient d autres étapes qui ne sont pas expliquées ici) 2. Création de copies des fragments d ADN Cette étape s appelle l amplification et permet d avoir plus de matériels pour réaliser le séquençage Ces explications ne visent pas être exhaustives mais les plus simples possibles pour s adapter à des non biologistes 4

5 1. INTRODUCTION SUR LE SEQUENCAGE Le principe du séquencage2 ème génération On met les morceaux d ADN amplifiés sur un support appelé puce, pour les séquencer 3. Séquençage Séquençage par synthèse et libération de proton Technologie Ion-Torrent Sur un puits, on a le même fragment en plusieurs copies. On synthétise (fabrique) le brin complémentaire de chaque fragment, en ajoutant un nucléotide donné. Si le nucléotide matche avec le nucléotide du brin complémentaire alors il y aura libération d un proton et on enregistrera dans un fichier les résultats pour chaque tour (insertion de nucléotides). Même principe sauf que l on colorie le nucléotide inséré en fonction de s il est T, C, A ou G. Séquençage par synthèse et libération de fluorescence - Technologie HiSeq, MiSeq On reconnaît si la base est un A, T, C ou G par différentes techniques selon la technologie de séquençage utilisée (fluorescence, libération de proton ). Différents séquenceurs existent: 454, HiSeq, Miseq, SOLiD, Ion Torrent et ont tous leurs particularités. Ces explications ne visent pas être exhaustives mais les plus simples possibles pour s adapter à des non biologistes 5

6 1. INTRODUCTION SUR LE SEQUENCAGE Le principe du séquencage2 ème génération 4. Reconstitution de la séquence d ADN Cette étape appelée alignement ou mapping, vise à replacer les petits morceaux d ADN appelés reads sur le génome de référence pour reconstituer l enchainement de l ADN. Alignement sur le génome de référence Dans cette explication, on ne parlera pas du cas où le génome de référence n est pas connu. La dernière étape consiste à compter combien on a de reads par gène et faire un tableau de comptage qui est ensuite donné au statisticien (après quelques traitements bio informatiques dont nous ne parlerons pas ici). Ces explications ne visent pas être exhaustives mais les plus simples possibles pour s adapter à des non biologistes 6

7 1. INTRODUCTION SUR LE SEQUENCAGE Evolution très rapide du séquençage 1 ère génération: bas débit (un gène à la fois) Années ème génération: haut débit (tous les gènes d un même organisme en même temps) Années 2005 On parlera uniquement de cette génération dans cette présentation HiSeq 2000 Ion Proton 3 ème génération: va de plus en plus vite, pas besoin d amplification, fragments beaucoup plus grands -> l avenir Années 2014 Encore beaucoup d erreur (15%) 7

8 2. CONTEXTE, TRAITEMENT ET MÉTHODOLOGIE D ANALYSE DES DONNÉES Le séquençage haut débit : technologie récente (apparue vers 2005) Beaucoup de paramètres à optimiser au niveau: -manip traitement des données bio informatique -de l analyse statistique Besoin de savoir combien de réplicats (échantillons biologiques) au minimum il faut avoir pour que l étude réalisée soit fiable 8

9 2. CONTEXTE, TRAITEMENT ET MÉTHODOLOGIE D ANALYSE DES DONNÉES Tableau de comptages: Ce que l on aimerait: La réalité: beaucoup de variabilité -> besoin de réplicats 9

10 2. CONTEXTE, TRAITEMENT ET MÉTHODOLOGIE D ANALYSE DES DONNÉES Traitement des données: Import des données avec le package limma (filtrage des comptages selon les jeux de données) Normalisation (permet d identifier et de corriger les biais techniques de telle sorte que les différences d expression ne soient dues qu à des effets biologiques) avec le package EdgeR Analyse différentielle avec le package EdgeR Packages Bioconductor: edger et limma 10

11 2. CONTEXTE, TRAITEMENT ET MÉTHODOLOGIE D ANALYSE DES DONNÉES Analyse des données: Réalisation de l analyse différentielle avec: Tous les réplicats Tous les réplicats X réplicat(s) (tirage aléatoire avec remise) p value 5% Tableau récapitulatif du nombre de gènes différentiellement exprimés Diagrammes de Venn Stabilité du rééchantillonnage 11

12 Jeu de données issu de l équipe 6 INSERM 1037 (Stéphane Pyronnetet Emeline Sarot) comportant 4 conditions avec chacune 5 réplicats biologiques Organisme: Humain Séquenceur: Illumina Hiseq 2000 Problématique: étude de l action d une protéine impliquée dans la destabilisationdu processus de traduction des ARN cellulaires. Interaction de deux facteurs à deux niveaux La p value corrigée ne permettant pas de détecter des gènes DE dans cette étude, nous avons utilisé la p value brute. Data faible différentiel 12

13 30 tirages aléatoires parmi 4 réplicats 3 réplicats-2 réplicats Informations: -En bleu turquoise: les valeurs extrêmes (+/-200 (seuil arbitraire) gènes DE par rapport au nombre de gènes DE obtenus avec 5 réplicats) Analyse: Avec 4 réplicats, on reste proche des résultats trouvés avec 5 réplicats A A partir de 3 réplicats, les résultats sont instables: c est la loterie Data faible différentiel 13

14 Exemple: essai 5 3 réplicats 2 réplicats 5 réplicats 4 réplicats Analyse: % de gènes communs Entre 5 et 4 réplicats 326 On retrouve beaucoup de gènes DE uniques à chaque analyse ( réplicats) Data faible différentiel 14

15 Mesure de la stabilité du rééchantillonage: On souhaite savoir si les différents essais permettent de sortir approximativement les mêmes gènes DE pour les analyses: - 4 réplicats - 3 réplicats - 2 réplicats Lorsque la p value brute = 5% Procédure: On concatène toutes les listes de gènes pour tous les essais et on garde une liste de gènes uniques, puis on compte dans combien d essais chaque gène est retrouvé. Data faible différentiel 15

16 4 réplicats p value brute = 5% gènes DE sont retrouvés dans 1 essai seulement Analyse: Beaucoup de gènes DE retrouvés uniquement dans un essai Seulement quelques gènes DE retrouvés dans tous les essais réalisés 32 gènes DE sont retrouvés dans les 30 essais effectués Data faible différentiel 16

17 3 réplicats p value brute = 5% gènes DE sont retrouvés dans 1 essai seulement Analyse: Beaucoup de gènes DE retrouvés uniquement dans un essai De moins en moins de gènes DE retrouvés dans tous les essais réalisés par rapport à 4 réplicats 3 gènes DE sont retrouvés dans les 30 essais effectués Data faible différentiel 17

18 2 réplicats p value brute = 5% gènes DE sont retrouvés dans 1 essai seulement Analyse: Beaucoup de gènes DE retrouvés uniquement dans un essai Aucun gène DE n est présent dans plus de 25 essais (sur 30). 1 gène DE est retrouvé dans 25 essais effectués Data faible différentiel 18

19 Conclusion sur les données à faible différentiel: Plus on a de réplicatset plus l étude est fiable et robuste Il faudrait au minimum 4 réplicats Les résultats «déroutants» observés grâce aux diagrammes de Vennainsi que les résultats sur le rééchantillonnagesont sûrement dûs à l absence d effet biologique Etude à confirmer: Avec un jeu de données comportant au moins 4 réplicatset qui ait des gènes différentiellementexprimés (avec une p value corrigée). Pas facile à trouver -> solutions: -Données simulées -Données réelles fort différentiel (4 réplicats biologiques) 19

20 Jeu de données issu du laboratoire GenPhySE INRA Auzeville(Agnès Bonnet) comportant 2 conditions avec chacune 4 réplicats biologiques Organisme: Brebis Séquenceur: Illumina Hiseq 2000 Problématique: Etude de l'expression des gènes au cours des stades précoces de la folliculogenèseovarienne chez les mammifères de rente (Brebis) Data fort différentiel 20

21 On compare les deux conditions suivantes: Granulosa Stade secondaire VS Ovocyte Stade secondaire Les deux conditions sont très différentes l une de l autre: on est sûr d avoir des gènes différentiellement exprimés Travail avec la p value corrigée à 5% Data fort différentiel 21

22 Toutes combinaisons possibles de 3 réplicatsparmi 4 réplicats idem pour 2 réplicats Informations: -En bleu : les valeurs extrêmes (seuil arbitraire) c est-à-dire inférieures à 4291/2 = 2145,5) Analyse: Moins on a de réplicats, et moins on a gènes DE Importante perte de puissance à partir de 2 réplicats Data fort différentiel 22

23 Exemple: essai 16 4 réplicats 3 réplicats 339 Interprétation: -90% de gènes communs Entre 4 et 2 réplicats(sur nb total de gènes 2 réplicats) -43% de gènes communs Entre 4 et 2 réplicats(sur nb total de gènes 4 réplicats) réplicats Interprétation: -93% de gènes communs Entre 4 et 3 réplicats(sur nb total de gènes 3 réplicats) -62% de gènes communs Entre 4 et 3 réplicats(sur nb total de gènes 4 réplicats) Analyse: Peu de gènes uniques à chaque analyse (4 3 2 réplicats) Data fort différentiel 23

24 3 réplicats p value corrigée = 5% gènes DE sont retrouvés dans les 30 essais effectués Analyse: 780 gènes DE sont retrouvés dans 1 essai seulement Beaucoup de gènes DE retrouvés dans tous les essais «Peu» de gènes DE retrouvés uniquement dans un seul essai Data fort différentiel 24

25 2 réplicats p value corrigée = 5% 841 gènes DE sont retrouvés dans 1 essai seulement Analyse: Peu de gènes DE retrouvés dans tous les essais Beaucoup de gènes DE retrouvés uniquement dans un seul essai 225 gène DE est retrouvé dans 36 essais effectués Data fort différentiel 25

26 Conclusion sur les données à fort différentiel: 2 réplicatsc est c est insuffisant même pour une comparaison de 2 conditions où il est évident que l on a va trouver des gènes différentiellement exprimés Il nous faudrait un jeu de données avec plus de 4 réplicatsafin de pouvoir conclure 26

27 4. CONCLUSION SUR L INFLUENCE DU NOMBRE DE RÉPLICATS Faible différentiel d expression Loterie Simulation pour quantifier le nombre de réplicatsnécessaires en fonction du différentiel Fort différentiel d expression Perte de puissance 27

28 5. PERSPECTIVES Poursuite du travail sur les données simulées Appel à projets Interlabs 2014: Laboratoire Génomique et biotechnologie des fruits (Toulouse) Laboratoire d Ingenieriedes Systèmes Biologiques et des Procédés (Toulouse) Pierre Frasse Matthieu Lauvernier MahomedZouine-Elie Maza Mondher Bouzayen Sophie Lamarre Véronique Le Berre => Lancement de l étude sur au 8réplicats réplicatsbiologiques (comparaison de deux conditions connues) sur la tomate 28

29 Merci pour votre attention 29

Influence du nombre de réplicats dans une analyse différentielle de données RNA-Seq

Influence du nombre de réplicats dans une analyse différentielle de données RNA-Seq Influence du nombre de réplicats dans une analyse différentielle de données RNA-Seq Sophie Lamarre 1, Stéphane Pyronnet 2, Emeline Sarot 2, Sébastien Déjean 3, Magali San Cristobal 3,4 & Matthieu Vignes

Plus en détail

Détection de mutations somatiques par NGS sur GAIIx

Détection de mutations somatiques par NGS sur GAIIx Détection de mutations somatiques par NGS sur GAIIx Aude Lamy Laboratoire de Génétique Somatique des Tumeurs CHU de Rouen Inserm U1079 Faculté de Médecine et Pharmacie de Rouen La médecine personalisée

Plus en détail

Obtention de données génétiques à grande échelle

Obtention de données génétiques à grande échelle Obtention de données génétiques à grande échelle Stéphanie FERREIRA Ph.D. Campus de l Institut Pasteur de Lille 1, rue du Professeur Calmette 59000 LILLE Tel : 03 20 87 71 53 Fax : 03 20 87 72 64 contact@genoscreen.fr

Plus en détail

Le séquençage haut-débit

Le séquençage haut-débit Nouveaux outils en biologie Le séquençage haut-débit DES d hématologie 16 janvier 2015 Paris Alice Marceau-Renaut Laboratoire d hématologie CHRU Lille NGS = Next-Generation Sequencing Whole-genome Whole-exome

Plus en détail

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq Présenté par Xi LIU ATCGCGCTAGCTGGTGTATCGCATCGCGCTAGCTGGTGTATCGCGCTAGCTGGTGTATCGCGCTAGCCTGGTGTATCGCCATCGCGCTAGCTGGCGCTAGCTGAATCGCGCATATG 17 Septembre 2013 Homéoallèles Génome Normalisation Analyse différentielle

Plus en détail

Place et avenir du séquençage haut-débit

Place et avenir du séquençage haut-débit Place et avenir du séquençage haut-débit Olivier Bouchez genomique@toulouse.inra.fr La Plateforme GeT Expertise et mise à disposition d une plateforme technologique en génomique : Séquençage Génotypage

Plus en détail

Génotypage par Séquençage (GBS) : Création d une carte génétique haute densité de Tournesol Population INEDI (RILs PSC8 x XRQ)

Génotypage par Séquençage (GBS) : Création d une carte génétique haute densité de Tournesol Population INEDI (RILs PSC8 x XRQ) Génotypage par Séquençage (GBS) : Création d une carte génétique haute densité de Tournesol Population INEDI (RILs PSC8 x XRQ) Baptiste Mayjonade (IE-CDD SUNRISE) Génétique et génomique des réponses aux

Plus en détail

Séquençage. Bérénice Batut, berenice.batut@udamail.fr. DUT Génie Biologique Option Bioinformatique Année 2014-2015

Séquençage. Bérénice Batut, berenice.batut@udamail.fr. DUT Génie Biologique Option Bioinformatique Année 2014-2015 Séquençage Bérénice Batut, berenice.batut@udamail.fr DUT Génie Biologique Option Bioinformatique Année 2014-2015 Séquençage Séquençage ADN Détermination de l ordre d enchainement des nucléotides d un fragment

Plus en détail

Génotypage et Séquençage. Pierre Mournet

Génotypage et Séquençage. Pierre Mournet Génotypage et Séquençage Pierre Mournet Plan Séquençage/Génotypage Classique (usat, Sanger) Séquençage NGS (Next Generation Sequencing) Séquenceur Préparation Pré-NGS Exemple 1 NGS Exemple 2 NGS Génotypage

Plus en détail

Deux plateformes IBiSA et 3 plateaux techniques regroupés depuis 2010. Responsable scientifique Denis Milan. Coordination des nouveaux investissements

Deux plateformes IBiSA et 3 plateaux techniques regroupés depuis 2010. Responsable scientifique Denis Milan. Coordination des nouveaux investissements RNA-seq Olivier Bouchez Nathalie Marsaud Mercredi 28 mars 2012 Plateforme GeT : Génome et Transcriptome Deux plateformes IBiSA et 3 plateaux techniques regroupés depuis 2010 Responsable scientifique Denis

Plus en détail

metarnaseq: un package pour la méta-analyse de données RNA-seq

metarnaseq: un package pour la méta-analyse de données RNA-seq metarnaseq: un package pour la méta-analyse de données RNA-seq Guillemette Marot, Florence Jaffrézic, Andrea Rau 28/06/13 Overview 1 Introduction 2 Analyse statistique d une seule étude 3 Méta-analyse

Plus en détail

Introduction à l analyse statistique et bioinformatique des puces à ADN

Introduction à l analyse statistique et bioinformatique des puces à ADN Formation INSERM 10 février 2004 Introduction à l analyse statistique et bioinformatique des puces à ADN Gaëlle Lelandais lelandais@biologie.ens.fr 1 Première Partie Analyse d une puce à ADN : Le recherche

Plus en détail

ED Biologie moléculaire. E. Turpin J. Lehmann-Che 5-6 novembre 2007

ED Biologie moléculaire. E. Turpin J. Lehmann-Che 5-6 novembre 2007 ED Biologie moléculaire E. Turpin J. Lehmann-Che 5-6 novembre 2007 PCR 1983: Kary Mullis Amplification in vitro par une méthode enzymatique d'un fragmentd'adn en présence de deux oligonucléotides spécifiques

Plus en détail

Modélisation coalescente pour la détection précoce d un cancer

Modélisation coalescente pour la détection précoce d un cancer Modélisation coalescente pour la détection précoce d un cancer Mathieu Emily 27 Novembre 2007 Bioinformatics Research Center - Université d Aarhus Danemark Mathieu Emily Coalescence et cancer 1 Introduction

Plus en détail

Lettres: A, T, G, C. Mots: à 3 lettres (codons) Phrase: gène (information pour synthétiser une protéine). Ponctuation

Lettres: A, T, G, C. Mots: à 3 lettres (codons) Phrase: gène (information pour synthétiser une protéine). Ponctuation 2- Les molécules d ADN constituent le génome 2-1 La séquence d ADN représente l information génétique Lettres: A, T, G, C Mots: à 3 lettres (codons) Phrase: gène (information pour synthétiser une protéine).

Plus en détail

Marc DELPECH. CORATA La Rochelle le 21 mai 2008

Marc DELPECH. CORATA La Rochelle le 21 mai 2008 Marc DELPECH CORATA La Rochelle le 21 mai 2008 En 24 ans les progrès ont été considérables Premières utilisation des techniques de génétique moléculaire en diagnostic : 1984 Une palette de techniques très

Plus en détail

Les Evolutions techniques. Marc Delpech Laboratoire de Génétique et Biologie moléculaires de l hôpital Cochin

Les Evolutions techniques. Marc Delpech Laboratoire de Génétique et Biologie moléculaires de l hôpital Cochin Les Evolutions techniques Marc Delpech Laboratoire de Génétique et Biologie moléculaires de l hôpital Cochin 1 Les principales étapes de l évolution technologique 1975 Southern blot 1977 Séquençage Sanger

Plus en détail

15 septembre 2010. Démo #2 MySQL Séquençage

15 septembre 2010. Démo #2 MySQL Séquençage 15 septembre 2010 Démo #2 MySQL Séquençage SQL et MySQL SQL: structured query language langage pour manipuler des données dans des bases de données relationnelles MySQL: Implantation de SQL Ajout à SQL

Plus en détail

Les différentes stratégies de quantification :

Les différentes stratégies de quantification : Les différentes stratégies de quantification : Ce chapitre présente les 2 principales stratégies de quantification relative utilisée classiquement : la méthode des droites standards et celle des Ct. Les

Plus en détail

Christelle REYNES EA 2415 Epidémiologie, Biostatistique et Santé Publique Université Montpellier 1. 8 Juin 2012

Christelle REYNES EA 2415 Epidémiologie, Biostatistique et Santé Publique Université Montpellier 1. 8 Juin 2012 Extraction et analyse des mesures haut-débit pour l identification de biomarqueurs : problèmes méthodologiques liés à la dimension et solutions envisagées EA 2415 Epidémiologie, Biostatistique et Santé

Plus en détail

FORMULAIRE de soumission de PROJET de SEQUENÇAGE A HAUT DEBIT

FORMULAIRE de soumission de PROJET de SEQUENÇAGE A HAUT DEBIT Plate-forme Transcriptome et Epigénome (PF2) FORMULAIRE de soumission de PROJET de SEQUENÇAGE A HAUT DEBIT Séquençage des ARNs (RNA-seq, TSS mapping, mirna-seq) et de produits d immuno-précipitation de

Plus en détail

2: Les enzymes de restriction

2: Les enzymes de restriction 2: Les enzymes de restriction Les enzymes de restriction sont des protéines synthétisées par des bactéries pour se protéger des infections de virus (bactériophages). Ces enzymes coupent l ADN viral à des

Plus en détail

Atelier 5/11/2013. Structure de la chromatine et marques épigénétiques

Atelier 5/11/2013. Structure de la chromatine et marques épigénétiques Atelier 5/11/2013 Structure de la chromatine et marques épigénétiques La chromatine ADN ADN + Histones = Nucleosome ADN + Protéines + ARNs = Chromatine Niveau extrême de condensation = Chromosome métaphasique

Plus en détail

Single Molecule Real Time (SMRT) Sequencing : PacBio RS II

Single Molecule Real Time (SMRT) Sequencing : PacBio RS II Single Molecule Real Time (SMRT) Sequencing : PacBio RS II Input sample Genome DNA, Amplicons, cdna Input sample amounts according to the protocols (10ng-10µg) High Input sample quality (integrity and

Plus en détail

RNAseq et NGS. Adriana Alberti Karine Labadie

RNAseq et NGS. Adriana Alberti Karine Labadie RNAseq et NGS Séquençage et Diversité LES ORGANISMES EUCARYOTES animaux plantes champignons protistes BACTERIES ARCHEES VIRUS METAGENOMES LES SOURCES ADN GENOMIQUE ARN / cdna AMPLICONS BACs ET FOSMIDES

Plus en détail

La synthèse des protéines transcription code génétique traduction

La synthèse des protéines transcription code génétique traduction CEC André-Chavanne BIO 3 OS La synthèse des protéines transcription code génétique traduction I. La «Transcription» : de l ADN à l ARNm. L'adresse suivante permet d accéder à une ANIMATION sur la TRANSCRIPTION.

Plus en détail

Licence d Informatique Année 2001-2002 Option: Introduction à la biologie moléculaire. LA P.C.R. Polymerase Chain Reaction

Licence d Informatique Année 2001-2002 Option: Introduction à la biologie moléculaire. LA P.C.R. Polymerase Chain Reaction Licence d Informatique Année 2001-2002 Option: Introduction à la biologie moléculaire LA P.C.R. Polymerase Chain Reaction "chercher une aiguille dans une meule de foin"? Chercher à repérer un gène particulier

Plus en détail

Tumeurs du sein triple négatif: Biologie moléculaire et projets de recherche

Tumeurs du sein triple négatif: Biologie moléculaire et projets de recherche 64 ème réunion du GERM Tumeurs du sein triple négatif: Biologie moléculaire et projets de recherche Tumeurs du sein triple négatif (TN) 12-17% des cancers du sein Contexte familial porteuses des mutations

Plus en détail

Document d orientation sur les allégations issues d essais de non-infériorité

Document d orientation sur les allégations issues d essais de non-infériorité Document d orientation sur les allégations issues d essais de non-infériorité Février 2013 1 Liste de contrôle des essais de non-infériorité N o Liste de contrôle (les clients peuvent se servir de cette

Plus en détail

La génomique. Etude des génomes et de l ensemble de leurs gènes. Nécessite des outils bioinformatiques. Plusieurs étapes :

La génomique. Etude des génomes et de l ensemble de leurs gènes. Nécessite des outils bioinformatiques. Plusieurs étapes : La génomique Etude des génomes et de l ensemble de leurs gènes La structure Le fonctionnement L évolution Le polymorphisme, Plusieurs étapes : Nécessite des outils bioinformatiques 1 Chronologie sur le

Plus en détail

Utilisation des diagrammes de Voronoï et des algorithmes génétiques pour l'étude des complexes protéine-protéine.

Utilisation des diagrammes de Voronoï et des algorithmes génétiques pour l'étude des complexes protéine-protéine. Utilisation des diagrammes de Voronoï et des algorithmes génétiques pour l'étude des complexes protéine-protéine. Anne Poupon Biologie et Bioinformatique des Systèmes de Signalisation INRA - Nouzilly France

Plus en détail

Le monde des bio-puces

Le monde des bio-puces Le monde des bio-puces D1 Le «dogme central» de la biologie moléculaire Transcription Epissage Traduction ADN ARNpm ARNm Protéines Génome Transcriptome Protéome D2 Puces à ADN Techniques de génomique fonctionnelle

Plus en détail

Master de Bioinformatique et Biologie des Systèmes Toulouse http://m2pbioinfo.biotoul.fr Responsable : Pr. Gwennaele Fichant

Master de Bioinformatique et Biologie des Systèmes Toulouse http://m2pbioinfo.biotoul.fr Responsable : Pr. Gwennaele Fichant Master de Bioinformatique et Biologie des Systèmes Toulouse http://m2pbioinfo.biotoul.fr Responsable : Pr. Gwennaele Fichant Parcours: Master 1 : Bioinformatique et biologie des Systèmes dans le Master

Plus en détail

LA PCR QUANTITATIVE EN TEMPS REEL OU LA "TAQMAN"

LA PCR QUANTITATIVE EN TEMPS REEL OU LA TAQMAN LA PCR QUANTITATIVE EN TEMPS REEL OU LA "TAQMAN" I- Terminologie Le terme TaqMan est souvent utilisé par abus de langage pour désigner : - la technique de PCR quantitative par détection en temps réel de

Plus en détail

Tutoriel pour les enseignants de lycée. Rappel du contenu des programmes au lycée en classe de seconde

Tutoriel pour les enseignants de lycée. Rappel du contenu des programmes au lycée en classe de seconde Tutoriel pour les enseignants de lycée Ce document sert à l enseignant pour préparer différentes séquences pédagogiques afin d aborder : les questions de la génétique, des maladies génétiques, et les métiers

Plus en détail

Formation Galaxy 13 Novembre 2014. 1 Premiers Pas

Formation Galaxy 13 Novembre 2014. 1 Premiers Pas Formation Galaxy 13 Novembre 2014 1 1-1 Connexion 1 Premiers Pas Connectez-vous sur la plateforme Galaxy SouthGreen à l adresse suivante : http://gohelle.cirad.fr/galaxy/ Utiliser votre adresse email et

Plus en détail

UNION INTERNATIONALE POUR LA PROTECTION DES OBTENTIONS VÉGÉTALES

UNION INTERNATIONALE POUR LA PROTECTION DES OBTENTIONS VÉGÉTALES ORIGINAL : anglais DATE : 21 octobre 2010 UNION INTERNATIONALE POUR LA PROTECTION DES OBTENTIONS VÉGÉTALES GENÈVE F DIRECTIVES CONCERNANT LES PROFILS D ADN : CHOIX DES MARQUEURS MOLECULAIRES ET CONSTRUCTION

Plus en détail

Optimisez votre process de fabrication avec la mallette Cut Optimizer Premium

Optimisez votre process de fabrication avec la mallette Cut Optimizer Premium Optimisez votre process de fabrication avec la mallette Cut Optimizer Premium Par Roger Busi, Chef de projet Dans une opération d usinage, différents facteurs interviennent : La pièce avec sa matière et

Plus en détail

VI. L APPORT DES MARQUEURS MOLECULAIRES. A. Définitions

VI. L APPORT DES MARQUEURS MOLECULAIRES. A. Définitions VI. L APPORT DES MARQUEURS MOLECULAIRES Comme nous l avons vu précédemment, l étude des caractères quantitatifs est fondée sur l analyse statistique des performances mesurées des individus. Il en est de

Plus en détail

Séquençage Haut-Débit : HiSeq 2000 et HiSeq 2500 (Illumina)

Séquençage Haut-Débit : HiSeq 2000 et HiSeq 2500 (Illumina) Séquençage Haut-Débit : HiSeq 2000 et HiSeq 2500 (Illumina) avec automatisation sur robot Tecan EVO200 Préparation des librairies High Output - HiSeq 2000 ou 2500 Run : 11 jours -2 Flowcells, 8 lanes /

Plus en détail

Le séquençage à haut débit Juin 2012

Le séquençage à haut débit Juin 2012 Atelier Epigénétique Université Pierre et Marie Curie Le séquençage à haut débit Juin 2012 Stéphane Le Crom (stephane.le_crom@upmc.fr) Laboratoire de Biologie du Développement (UPMC) de la Montagne Sainte

Plus en détail

Cahier de texte de la classe 1 ère 4 - SVT

Cahier de texte de la classe 1 ère 4 - SVT Cahier de texte de la classe 1 ère 4 - SVT DATE SEQUENCE lundi 12 : revoir la fiche méthodologique «utiliser le microscope optique» (disponible sur le site du lycée) Lundi 12 1 er contact avec les élèves.

Plus en détail

Olivier Bouchez, GeT-PlaGe Responsable SéquenS. olivier.bouchez@toulouse.inra.fr

Olivier Bouchez, GeT-PlaGe Responsable SéquenS. olivier.bouchez@toulouse.inra.fr Séquençage Haut-Débit sur GeT Olivier Bouchez, GeT-PlaGe Responsable SéquenS quençage Haut-débit olivier.bouchez@toulouse.inra.fr Localisation des séquenceurss Plateforme Génomique INRA Auzeville Séquenceurs

Plus en détail

Introduction à l approche bootstrap

Introduction à l approche bootstrap Introduction à l approche bootstrap Irène Buvat U494 INSERM buvat@imedjussieufr 25 septembre 2000 Introduction à l approche bootstrap - Irène Buvat - 21/9/00-1 Plan du cours Qu est-ce que le bootstrap?

Plus en détail

Chapitre 10 L isolement et la manipulation de gènes. Injection d ADN étranger dans une cellule animale

Chapitre 10 L isolement et la manipulation de gènes. Injection d ADN étranger dans une cellule animale Chapitre 10 L isolement et la manipulation de gènes Injection d ADN étranger dans une cellule animale Comment amplifier un gène d intérêt? Amplification in vivo à l aide du clonage d ADN L ensemble formé

Plus en détail

DIAGNOSTIC PRÉNATAL NON INVASIF : LE SANG MATERNEL

DIAGNOSTIC PRÉNATAL NON INVASIF : LE SANG MATERNEL 6 LE TEST DIAGNOSTIC PRÉNATAL NON INVASIF : LE SANG MATERNEL Source : les cellules trophoblastiques Fetal cell Cell isolation Détection 5-6SA Disparition rapide après accouchement Pas de persistance après

Plus en détail

A L I M E N T A T I O N A G R I C U L T U R E E N V I R O N N E M E N T

A L I M E N T A T I O N A G R I C U L T U R E E N V I R O N N E M E N T Analyse par RNA-seq de l'expression sexe- dépendante dans le foie et le tissu adipeux blanc de 3 espèces : le porc, le poulet et la souris Contexte Rôle des estrogènes dans l expression sexe-dépendante

Plus en détail

Principales techniques utilisées en génie génétique Ces différentes techniques peuvent également se combiner entre elles. Séquençage de l ADN

Principales techniques utilisées en génie génétique Ces différentes techniques peuvent également se combiner entre elles. Séquençage de l ADN Principales techniques utilisées en génie génétique Ces différentes techniques peuvent également se combiner entre elles Séquençage de l ADN 1- Un brin complémentaire de l ADN à séquencer est fabriqué

Plus en détail

Le séquençage à haut débit Mars 2011

Le séquençage à haut débit Mars 2011 Atelier Epigénétique Université Pierre et Marie Curie Le séquençage à haut débit Mars 2011 Stéphane Le Crom (lecrom@biologie.ens.fr) Institut de Biologie de l École normale supérieure (IBENS) de la Montagne

Plus en détail

exemple de végétaux exposés au benzène atmosphérique Sylvain Dumez sylvain.dumez@univ-lille2.fr

exemple de végétaux exposés au benzène atmosphérique Sylvain Dumez sylvain.dumez@univ-lille2.fr Approches écotoxicogénomiques et application à la biosurveillance exemple de végétaux exposés au benzène atmosphérique Sylvain Dumez sylvain.dumez@univ-lille2.fr Laboratoire des Sciences végétales et fongiques,

Plus en détail

POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA

POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA Amplification spécifique Détection spécifique Clonage dans des vecteurs Amplification in vitro PCR Hybridation moléculaire - hôte cellulaire

Plus en détail

Interprétation des résultats et troubleshooting

Interprétation des résultats et troubleshooting Interprétation des résultats et troubleshooting Le Service de séquençage du Centre d innovation Génome Québec et Université McGill utilise des appareils 3730xl DNA Analyzer d Applied Biosystems. Cette

Plus en détail

Modalités d exécution des prestations NGS réalisées via l UMR 8199-2013

Modalités d exécution des prestations NGS réalisées via l UMR 8199-2013 Modalités d exécution des prestations NGS réalisées via l UMR 8199-2013 I. Préparation des librairies en vue du séquençage Haut débit via HiSeq et MiSeq 1.1 Points communs à toutes préparations de librairies

Plus en détail

Étude de la biodiversité fongique à l aide de techniques de pyroséquençage

Étude de la biodiversité fongique à l aide de techniques de pyroséquençage Étude de la biodiversité fongique à l aide de techniques de pyroséquençage Biodiversité fongique Biodiversité: diversité spécifique d une communauté écologique, correspondant au nombre d espèces et à leur

Plus en détail

TD Révision BIO57. Connaissance et Technique du gène

TD Révision BIO57. Connaissance et Technique du gène TD Révision BIO57 Connaissance et Technique du gène Novembre 2007 Cécile BAUDOT cecile.baudot@medecine.univ-mrs.fr INSERM 910 «Génétique Médicale et Génomique Fonctionnelle» Maladies Neuromusculaires Le

Plus en détail

Analyse in silico de génomes, protéomes et transcriptomes. «Génomique comparative» V.2012.1. Protocole TD

Analyse in silico de génomes, protéomes et transcriptomes. «Génomique comparative» V.2012.1. Protocole TD Magistère Biotechnologies Analyse in silico de génomes, protéomes et transcriptomes «Génomique comparative» V.2012.1 Protocole TD Notes : Scripts et données sur : http://rna.igmors.u-psud.fr/gautheret/cours/analinsilico

Plus en détail

A la rencontre du séquençage haut-débit nouvelle génération. Infosys Building, Kuwait

A la rencontre du séquençage haut-débit nouvelle génération. Infosys Building, Kuwait A la rencontre du séquençage haut-débit nouvelle génération Infosys Building, Kuwait 2001 : Aboutissement du projet Génome Humain Ancêtres & Renouveau 2010 Hélicos, Ion torrent, Pacbio, Oxford Nanopore

Plus en détail

Télémédecine, télésanté :

Télémédecine, télésanté : Télémédecine, télésanté : vision prospective Table ronde du Collège des Economistes de la Santé, 15 mai 2014. «État des lieux et perspectives de latélémédecine»? Robert PICARD Référent Santé, CGEiet Plan

Plus en détail

Les virus dans les aliments : un nouveau défi pour les laboratoires de microbiologie

Les virus dans les aliments : un nouveau défi pour les laboratoires de microbiologie : un nouveau défi pour les laboratoires de microbiologie Véronique ZULIANI, Institut de la Filière Porcine Jean Christophe Augustin, ENVA, ASA Qu est ce qu un virus? Microorganisme de 15 à 40 nm Environ

Plus en détail

BIN 1002: INTÉGRATION BIOSCIENCES/INFORMATIQUE

BIN 1002: INTÉGRATION BIOSCIENCES/INFORMATIQUE BIN 1002: INTÉGRATION BIOSCIENCES/INFORMATIQUE Plan de Cours Automne 2015 Professeurs: Sylvie Hamel, Département d Informatique et de Recherche Opérationnelle Guillaume Lettre, Institut de Cardiologie

Plus en détail

FONCTIONNEMENT ET RECOMMANDATION DE LA PLATEFORME GeT- BIOPUCES

FONCTIONNEMENT ET RECOMMANDATION DE LA PLATEFORME GeT- BIOPUCES La plateforme GeT- Biopuces réalise vos expériences depuis le design des sondes jusqu à l analyse statistique des données. Elle met à votre disposition l'équipement nécessaire pour réaliser vos expériences

Plus en détail

La CGH-array : une nouvelle technique de diagnostic en cytogénétique

La CGH-array : une nouvelle technique de diagnostic en cytogénétique La CGH-array : une nouvelle technique de diagnostic en cytogénétique Olivier Pichon (Ingénieur) Laboratoire de cytogénétique de Nantes, Service de Génétique Médicale Les techniques classiques de cytogénétique

Plus en détail

AutoGRAPH Un serveur pour automatiser et visualiser la comparaison de génomes: Application à l identification de nouveaux gènes chez le chien.

AutoGRAPH Un serveur pour automatiser et visualiser la comparaison de génomes: Application à l identification de nouveaux gènes chez le chien. AutoGRAPH Un serveur pour automatiser et visualiser la comparaison de génomes: Application à l identification de nouveaux gènes chez le chien. Thomas DERRIEN CNRS-UMR6061 Génétique et Développement Université

Plus en détail

5. Validité de la méta-analyse

5. Validité de la méta-analyse 5. Validité de la méta-analyse 5.1. Poids de la preuve d une méta-analyse Le poids de la preuve d un résultat scientifique quantifie le degré avec lequel ce résultat s approche de la réalité. Il ne s agit

Plus en détail

Quelques termes-clef de biologie moléculaire et leur définition

Quelques termes-clef de biologie moléculaire et leur définition Acide aminé (AA) Quelques termes-clef de biologie moléculaire et leur définition Isabelle Quinkal INRIA Rhône-Alpes Septembre 2003 Petite molécule dont l enchaînement compose les protéines - on dit qu

Plus en détail

Méthodes et techniques de la biologie du développement

Méthodes et techniques de la biologie du développement Méthodes et techniques de la biologie du développement 1. Etude de l expression des gènes : Détecter les transcrits et les protéines au cours de l ontogenèse l outil anticorps 1.1. La RT-PCR La réaction

Plus en détail

Structure de corrélations entre les gènes et impact sur la pertinence des signatures génomiques

Structure de corrélations entre les gènes et impact sur la pertinence des signatures génomiques Structure de corrélations entre les gènes et impact sur la pertinence des signatures génomiques F. Valet, E. Gravier, Y. De Rycke et B. Asselain Institut Curie, Ecole des Mines de Paris, Inserm U900 Journées

Plus en détail

CHAPITRE 3 LA SYNTHESE DES PROTEINES

CHAPITRE 3 LA SYNTHESE DES PROTEINES CHAITRE 3 LA SYNTHESE DES ROTEINES On sait qu un gène détient dans sa séquence nucléotidique, l information permettant la synthèse d un polypeptide. Ce dernier caractérisé par sa séquence d acides aminés

Plus en détail

Méthodes Statistiques Appliquées à la Qualité et à la Gestion des Risques - Le Contrôle Statistique

Méthodes Statistiques Appliquées à la Qualité et à la Gestion des Risques - Le Contrôle Statistique Méthodes Statistiques Appliquées à la Qualité et à la Gestion des Risques - Le Contrôle Statistique Jean Gaudart Laboratoire d Enseignement et de Recherche sur le Traitement de l Information Médicale jean.gaudart@univmed.fr

Plus en détail

Interprétation des résultats

Interprétation des résultats Plateforme de séquençage Cochin Interprétation des résultats Grace à la base de données vous avez un accès direct à vos séquences. Pour valider la qualité de ces séquences vous devez visualiser leur chromatogramme.

Plus en détail

8.3.3 Réactifs. La polymérase catalyse la synthèse de brins complémentaires d ADN.

8.3.3 Réactifs. La polymérase catalyse la synthèse de brins complémentaires d ADN. 8.3.3 Réactifs 1. AD polymérase: La polymérase catalyse la synthèse de brins complémentaires d AD. Des polymérases qui sont résistantes à la chaleur sont utilisées, telles que la Taq polymérase (Thermus

Plus en détail

Gènes Diffusion - EPIC 2010

Gènes Diffusion - EPIC 2010 Gènes Diffusion - EPIC 2010 1. Contexte. 2. Notion de génétique animale. 3. Profil de l équipe plateforme. 4. Type et gestion des données biologiques. 5. Environnement Matériel et Logiciel. 6. Analyses

Plus en détail

Gene Predictis parce que je suis unique

Gene Predictis parce que je suis unique Gene Predictis parce que je suis unique Route de Chantemerle 64 - CP 160 - CH-1763 Granges-Paccot Téléphone: +41 26 466 15 45 Fax: +41 26 466 15 46 info@genepredictis.com www.genepredictis.com Gene Predictis

Plus en détail

Sécurisation d un lien radio impulsionnel ultra large bande UWB-IR

Sécurisation d un lien radio impulsionnel ultra large bande UWB-IR Sécurisation d un lien radio impulsionnel ultra large bande UWB-IR Encadré par: Jean-Marie GORCE, Cédric LAURADOUX et Benoit MISCOPEIN Ahmed BENFARAH 09/06/2011, présentation au séminaire CITI Plan de

Plus en détail

Etude du transcriptome et du protéome en Neurooncologie

Etude du transcriptome et du protéome en Neurooncologie Etude du transcriptome et du protéome en Neurooncologie Principes, aspects pratiques, applications cliniques François Ducray Neurologie Mazarin, Unité Inserm U711 Groupe hospitalier Pitié-Salpêtrière Etude

Plus en détail

Séquençage haut débit (Next Generation Sequencing) 12/03/2012 Pascal Le Bourgeois, M1BBT, EM8BTGM 1

Séquençage haut débit (Next Generation Sequencing) 12/03/2012 Pascal Le Bourgeois, M1BBT, EM8BTGM 1 Séquençage haut débit (Next Generation Sequencing) 1 Pyroséquençage (454) Margulies M. et al. (2005). Genome sequencing in microfabricated high-density picolitre reactors. Nature 437:376-80 Pas de banques

Plus en détail

Les outils du génie génétique.

Les outils du génie génétique. Les outils du génie génétique. I\ Les enzymes. On va se servir des enzymes pour couper, coller et synthétiser des acides nucléiques. A\ Les polymérases. Toutes les polymérases agissent de 5 vers 3. En

Plus en détail

Analyse de la variance Comparaison de plusieurs moyennes

Analyse de la variance Comparaison de plusieurs moyennes Analyse de la variance Comparaison de plusieurs moyennes Biostatistique Pr. Nicolas MEYER Laboratoire de Biostatistique et Informatique Médicale Fac. de Médecine de Strasbourg Mars 2011 Plan 1 Introduction

Plus en détail

Le risque Idiosyncrasique

Le risque Idiosyncrasique Le risque Idiosyncrasique -Pierre CADESTIN -Magali DRIGHES -Raphael MINATO -Mathieu SELLES 1 Introduction Risque idiosyncrasique : risque non pris en compte dans le risque de marché (indépendant des phénomènes

Plus en détail

Cahier de texte de la classe 1 ère 3 - SVT

Cahier de texte de la classe 1 ère 3 - SVT Cahier de texte de la classe 1 ère 3 - SVT DATE SEQUENCE jeudi 8 : revoir la fiche méthodologique «utiliser le microscope optique» (disponible sur le site du lycée) Jeudi 8 1 er contact avec les élèves.

Plus en détail

Génétique kits. Kit de précipitation de l ADN. Réf : 117 029. Français p 1. Version : 8003

Génétique kits. Kit de précipitation de l ADN. Réf : 117 029. Français p 1. Version : 8003 kits Français p 1 Kit de précipitation de l ADN Version : 8003 1 Composition Quantité nécessaire pour 25 tests. - 25 ml de solution d ADN (de saumon) à 1mg/mL (tampon Tris-HCI 0,010 M, ph 8,0 en présence

Plus en détail

Recherche et analyse de polymorphismes SNP

Recherche et analyse de polymorphismes SNP Recherche et analyse de polymorphismes SNP 1- Tablet : Détection visuelle de SNP avec Tablet Tablet est un outil graphique de visualisation d assemblage et d alignement de séquences issues de NGS (Next

Plus en détail

Biologie Intégrative Projet Fédérateur Biogenouest

Biologie Intégrative Projet Fédérateur Biogenouest Biologie Intégrative Projet Fédérateur Biogenouest Coordinateurs: C. Pineau (INSERM U625 & PF protéomique BGO) D. Eveillard (LINA Université de Nantes UMR CNRS 6241) Animateur: Y. Le Bras (Biogenouest)

Plus en détail

Stratégie de management des ressources microbiennes : application au suivi des stations d épuration industrielle du groupe Sanofi

Stratégie de management des ressources microbiennes : application au suivi des stations d épuration industrielle du groupe Sanofi Stratégie de management des ressources microbiennes : application au suivi des stations d épuration industrielle du groupe Sanofi Mise en place d outils de biologie moléculaire Céline Martinez, Pierre

Plus en détail

http://get.genotoul.fr

http://get.genotoul.fr http://bioinfo.genotoul.fr i f Gestion des données de l HiSeq 2000 Plateformes GenoToul Bioinformatique et GeT-PlaGe Ch. Klopp / G. Salin 07 octobre 2011 gerald.salin@toulouse.inra.fr Contexte NGS Collaboration

Plus en détail

DEVOIR DE SCIENCES DE LA VIE et de LA TERRE. Septembre 2014.

DEVOIR DE SCIENCES DE LA VIE et de LA TERRE. Septembre 2014. DEVOIR DE SCIENCES DE LA VIE et de LA TERRE. Septembre 2014. Vous devez choisir pour chaque question proposée, zéro, une ou plusieurs réponses exactes parmi celles proposées ou bien répondez à la question.

Plus en détail

Les microarrays: technologie pour interroger le génome

Les microarrays: technologie pour interroger le génome Les microarrays: technologie pour interroger le génome Patrick DESCOMBES patrick.descombes@frontiers-in-genetics.org Plate forme génomique NCCR Frontiers in Genetics Université de Genève http://genomics.frontiers-in-genetics.org

Plus en détail

TP R sur les réseaux neuronaux

TP R sur les réseaux neuronaux TP R sur les réseaux neuronaux Emmanuel Rachelson and Matthieu Vignes 14 mars 2013, SupAero - ISAE 1 Un tutoriel simple: le calcul de la racine carrée Dans ce tutoriel, un réseau neuronal va être construit

Plus en détail

Génotypage par séquençage d une grande population (BCNAM) de sorgho.

Génotypage par séquençage d une grande population (BCNAM) de sorgho. Generation Challenge Programme Research Initiative II : Amélioration de la productivité et de la qualité du grain de sorgho dans les régions soudanosahéliennes. Génotypage par séquençage d une grande population

Plus en détail

Data Management. Daniel BOICHUT 11 janvier 2010. Umanis Département Santé/CRO. Plan du cours. Les différentes étapes de l essai clinique

Data Management. Daniel BOICHUT 11 janvier 2010. Umanis Département Santé/CRO. Plan du cours. Les différentes étapes de l essai clinique Data Management Daniel BOICHUT 11 janvier 2010 DIU FARC TEC 2010 1 Plan du cours Les différentes étapes de l essai clinique Le Data Management dans les essais cliniques Le métier de Data Manager 2 Les

Plus en détail

Plateforme de bioinformatique

Plateforme de bioinformatique Plateforme de bioinformatique Arnaud Droit Centre de Recherche du CHU de Québec Laboratoire de biologie computa;onelle Compréhension des différences 2005 Génome du chimpanzee Nous sommes identiques ± 1%

Plus en détail

Des OGM et d André 1999. Yves Bertheau INRA Versailles

Des OGM et d André 1999. Yves Bertheau INRA Versailles Des OGM et d André 1999 Yves Bertheau INRA Versailles Les OGM en Europe Refus de nombreux consommateurs Étiquetage et coexistence pour assurer le libre choix des consommateurs et producteurs L utilisation

Plus en détail

Les logiciels présents partout dans le monde de l entreprise, dans la recherche et dans la vie quotidienne

Les logiciels présents partout dans le monde de l entreprise, dans la recherche et dans la vie quotidienne Les logiciels présents partout dans le monde de l entreprise, dans la recherche et dans la vie quotidienne Nicolas Dzik Altran Sud Ouest nicolas.dzik@altran.com Les rencontres de l AVAMIP Toulouse, 2 octobre

Plus en détail

Les principes du sequençage haut-débit

Les principes du sequençage haut-débit Les principes du sequençage haut-débit Mardi 23 avril 2013 Dr H. EL HOUSNI Organisation Génomique Podhala'et'al.'Trends'in'genetics'2012' Costa V et al. J BioMed BioTech 2010 32 ans Costa V et al. J BioMed

Plus en détail

Examen de Génomique et Protéomique Fonctionnelle M2 BBSG (Mastères Recherche et Pro) 2 février 2006 Durée 3h. Partie1. Génomique fonctionnelle

Examen de Génomique et Protéomique Fonctionnelle M2 BBSG (Mastères Recherche et Pro) 2 février 2006 Durée 3h. Partie1. Génomique fonctionnelle Examen de Génomique et Protéomique Fonctionnelle M2 BBSG (Mastères Recherche et Pro) 2 février 2006 Durée 3h L examen comporte deux parties, l une axée sur la génomique fonctionnelle et l autre sur la

Plus en détail

Vers l assignation de parenté par SNP

Vers l assignation de parenté par SNP Vers l assignation de parenté par SNP Journée Génomique Sysaaf 3 juin 2015, Rennes Marc VANDEPUTTE INRA UMR Génétique Animale et Biologie Intégrative Ifremer Laboratoire 3AS L assignation de parenté Pour

Plus en détail

ATELIER EPIGENETIQUE

ATELIER EPIGENETIQUE Juin 2012 ATELIER EPIGENETIQUE Utilisation de la Q-PCR pour analyser des données de ChIP ou de MeDIP Emmanuèle Mouchel-Vielh I. La PCR quantitative: principe et généralités II. Interprétation des résultats

Plus en détail

Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013

Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013 Sélectionner les propositions exactes Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013 QCM 1 La plupart des techniques de biologie moléculaire repose sur le principe de complémentarité

Plus en détail

Utilisation de la métagénomique 16S pour la surveillance de l émergence de zoonoses bactériennes dans les populations animales

Utilisation de la métagénomique 16S pour la surveillance de l émergence de zoonoses bactériennes dans les populations animales Utilisation de la métagénomique 16S pour la surveillance de l émergence de zoonoses bactériennes dans les populations animales Réunion Rongeur 2014 CBGP Maxime Galan Métagénomique 16S: Pourquoi? Identification

Plus en détail

Chromosome et caryotype

Chromosome et caryotype Chromosome et caryotype Définition et généralités L étude du caryotype «classique» humain est l étude des chromosomes à un stade maximum de condensation (chromosomes mitotiques en métaphase). Caryotype

Plus en détail