Informatique et biologie moléculaire

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimension: px
Commencer à balayer dès la page:

Download "Informatique et biologie moléculaire"

Transcription

1 UE09s Méthodes d étude et analyse du génome Techniques d analyse des gènes à grande échelle Bio-informatique PACES Dr Nicolas SEVENET Informatique et biologie moléculaire Avertissement Utilisation par le biologiste de l outil informatique Base de données/banque de données Définition Développement des outils informatiques (science de l information) Permettant d extraire une signification biologique de résultats expérimentaux (science du vivant) Paradoxe Avec le développement des techniques globales d analyse génétique, le biologiste n est plus capable d interpréter seul le résultat de ses expériences 1

2 Les 2 sites de bioinformatiqueles plus importants au monde EBI European Bioinformatics Institute WellcomeTrust GenomeCampus, Cambridge, UK NCBI National Center for Biotechnology Information, National Library of medicine, National Institutes of Health Bethesda, MD, USA Trier l information Masse de l information Retrouver des informations stockées en banque de données (interrogation (requête), soumission, maintenance) Dry lab(biologie sèche) Les banques de données en ligne les compilateurs de bases de données (méta-moteur; méta-banques de données) Entrez NCBI Genecards Genome Browser Le site de recherche bibliographique PubMed Les bases de données spécialisées Séquences des gènes (Refseq, GenBank) Variations polymorphes de l ADN (dbsnp) Séquences et fonctions des protéines (UniProt) 2

3 Listing des banques de données MÉTA-BANQUES DE DONNÉES GQUERY NCBI, UCSC, GENECARDS 3

4 Gène Le fil rouge du cours : RB1 RB1: RetinoBlastoma1 Code une protéine impliquée dans le contrôle du cycle cellulaire (entrée en phase S après la phase G1) Retrouvé muté dans les rétinoblastomes (tumeurs oculaires de l enfant) certains sarcomes Diapo 36 cours UE2 Sandrine Dabernat contrôle moléculaire du cycle cellulaire 4

5 Gquery Contenu Les banques de données universelles en génétique Génome Gène, localisation chromosomique, séquence génomique Transcrits Protéine description localisation Anticorps Fonctions, voies fonctionnelles, classification «ontologique» Dysfonction, pathologies Références bibliographiques 5

6 Genecards UCSC Genome Browser Outil de cartographie du génome Rentrer RB1 dans cette fenêtre 6

7 UCSC Genome Browser Fenêtre de localisation du gène demandé (RB1) Exons BIBLIOGRAPHIE PUBMED 7

8 PubMed Les publications sont classées en ordre décroissant de leur date de sortie (les plus récentes en premier (haut de liste)) 8

9 SITES SPÉCIALISÉS REFSEQ, GENATLAS, DBSNP, UNIPROT, GEO, ARRAYEXPRESS Nucléotides Banques de données primaires 3 dans le monde DDBJ (Japon) European Nucleotide Archive (Europe) GenBank(NCBI, USA) Banque de données spécialisées RefSeq(NCBI) fournir, à une position nucléotidique couverte par plusieurs séquences primaires, un identifiant unique Genatlas(France) structure intron-exon d un gène 9

10 European Nucleotide Archive dbsnp Banque de données de polymorphismes Polymorphisme définition Le polymorphisme correspond à une variation d une à quelques bases de l ADN sans retentissement sur la structure, la fonction ou l expression de la protéine Définit un allèle (version alternative d un gène) Cfcours Annie Bérard (Polymorphismes -UE1, dia 11), Didier Lacombe (UE1, dia 67) Polymorphisme simple de nucléotide (Single Nucleotide Polymorphism) Seul un nucléotide varie à une position donnée Exon 4 gène RB1 10

11 Rentrer RB1 dans cette fenêtre Résultats SNP RB1 11

12 Protéines - UniProt Rentrer RB1 dans cette fenêtre RB1 Uniprot 12

13 Quelle protéine de référence choisir? retour à genecards Genecards permet de choisir la bonne référence protéique 13

14 Fiche Uniprot RB1 Objectif : Banques de dépôt Déposer le résultat d expériences D autres équipes peuvent alors les télécharger et traiter avec leurs outils ce résultat partage Partage de données et comparaison validation in silico 2 bases essentiellement GEO (Gene Expression Omnibus) Array-express 14

15 Rentrer RB1 dans cette fenêtre Résultat requête RB1 La plateforme où a été faite l expérimentation (biopuce) Le code de la série expérimentale pour le sujet donné (biopuces) Les résultats de chaque manip d hybridation directement téléchargeables 15

16 APPLICATIONS PRATIQUES PRIMER3, ALAMUT, BLAST, COSMIC, OMIM, ORPHANET ADN Que faire? Trouver une séquence de référence RefSeq Connaître la structure intron-exon d un gène Genatlas Dessiner des amorces de PCR Primer 3 Pathologies Savoir si un gène est muté dans certaines pathologies COSMIC : Catalogue Of Somatic Mutation in Cancer OMIM : Online Mendelian Inheritance in Men Savoir qui, en France, peut prendre en charge une pathologie rare, ou le diagnostic mutationnel d un gène? Orphanet: portail des maladies orphelines 16

17 Trouver la séquence de référence d un gène? Etape 1 : RefSeq(NCBI) Etape 2 Search: NUCLEOTIDE et nom du gène 1404 résultats! Trouver la séquence de référence d un gène? Restreindre à - Homo Sapiens (198) - Refseq(503) - 70 séquences 17

18 Tri par défaut (ordre de sortie des résultats) RefSeq génomique RefSeq ARN messager Contigs : ensemble de séquences assemblées, localisées sur le chromosome, qui ont servir à déduire la RefSeq 18

19 Connaître l organisation intron/exon d un gène?? Geneatlas Puis Rentrer RB1 dans Symbol Name Cliquer sur seethe exons 19

20 Codage des RefSeqet longueur des fragments des RefSeq Intron-exons : L ADN introniqueest en bleu et minuscules, la séquence exoniqueen noir et majuscules (noir caractères gras = séquence codante) Trouver des amorces de PCR??? Objectif: cribler et/ou séquencer un gène (un exon) à la recherche de mutations ponctuelles délétères (diagnostic mutationnel/biologique) Rechercher des amorces déjà publiées PubMedavec comme mot d entrée, le nom du gène Créer de nouvelles amorces in silico Primer3 Les primers créés sont-ils spécifiques? Alignement de séquences (Blast) Permet de voir si les séquences retrouvées par Blast après alignement des primers sont réellement spécifiques 20

21 Matrice + Thermocycleur Départ 1 copie de l exon 1 du gène b Après 1 cycle copies (2 1 ) Après 2 cycles 4 copies (2 2 ) zone amplifiée Après 3 cycles Après n cycles 8 copies (2 3 ) 2 n copies 21

22 Exemple primer 3 On copie la séquence de l exon 4 avec les séquences introniques adjacentes Des symboles <> sont placés de part et d autre de la séquence exonique(en majuscule) pour interdire que les primerssoient dans cette zone (qu on voudra analyser après PCR) 22

23 Résultats primer 3 Primer forward La séquence qui avait été encadrée de <> est marquée de X symbolisant une zone d exclusion de choix de primers Primer reverse Alamut La représentation du gène dans sa totalité 23

24 La séquence nucléotidique avec le dénombrement des nucléotides depuis le A de l ATG (base numéro 1) RB1 exon 4 La traduction protéique avec le dénombrement des codons (AA) depuis le 1 er (ATG = Met) Les polymorphismes connus Les mutations délétères rapportées dans les bases de données La conservation phylogénétique Les séquences introniques encadrant l exon 4 de RB1 Intron 3 Intron 4 24

25 Blast Vérification Comparaison de séquences Principe Exemple d utilisation Aligner la séquence de chacun des primersafin de voir si la bonne séquence nucléotidique est retrouvée. Adresse du site internet On copie la séquence du primer forward dans la fenêtre de requête 25

26 Blast en cours Résultat 1 ère requête Blast Code couleur des scores d alignement Le classement se fait par ordre décroissant de similarité (score d alignement) 26

27 Suite résultats Blast Blast primer reverse 27

28 GenBank RB1 Primer forward Primer reverse Catalogue des mutations du gène RB1 /genetics/cgp/cosmic/ Rentrer RB1 dans cette fenêtre 28

29 Résultat requête RB1 Cliquer sur RB1 Résultat requête RB1 La répartition des mutations le long de la séquence codante de RB1 29

30 Répartition des mutations RB1 dans les cancers humains Quelles sont les mutations contenues dans l exon 4 de RB1? Comme on connaît les AA de l exon 4 fenêtre de recherche limitée aux AA 127 à 167 inclus 30

31 Pathologies liées à RB1 Online Mendelian Inheritance in Men (OMIM) Rentrer RB1 dans cette fenêtre Résultat requête RB1 Cliquer sur RB1 31

32 TEXT Cloning Gene structure Mapping Gene Function Evolution Molecular Genetics Retinoblastoma Small CellLung cancer Allelic variants (28) Rapporte certaines mutations remarquables References(80) Contributors Creation date Edit history (de la fiche!) Trouver une consultation en Europe concernant le rétinoblastome consor4.01/www/cgibin/index.php?lng=fr Rentrer RB1 dans cette fenêtre 32

33 Trouver une consultation en Europe concernant le rétinoblastome consor4.01/www/cgibin/index.php?lng=fr Rentrer Rétinoblastome dans cette fenêtre 33

34 Cliquer sur Rétinoblastome Cliquer sur «centres experts», sélectionner «France» puis «consultations et conseil génétique» 34

35 Aquitaine - rétinoblastome Pas de consultation spécialisée, mais 5 consultations de conseil génétique Que retenir du cours? Les grandes voies de recherche d information Bibliographie : PubMed Meta-banques : Entrez NCBI, Genecards ADN protéines : RefSeq, Blast, Genatlas, Uniprot, Gènes, pathologies, consultations : OMIM, Orphanet Ne pas retenir les détails Pour chaque site internet concernant la requête précise RB1 Les adresses internet! 35

Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013

Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013 Sélectionner les propositions exactes Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013 QCM 1 La plupart des techniques de biologie moléculaire repose sur le principe de complémentarité

Plus en détail

ALIGNEMENT PLUS RAPIDE

ALIGNEMENT PLUS RAPIDE ALIGNEMENT PLUS RAPIDE 1. méthodes heuristiques : hachage, arbres de suffixe, PD limitée (taille totale de trous bornée) 2. PD éparse (pour sous-séquence commune ou chaînage en alignement global heuristique)

Plus en détail

Séquençage massif en parallèle Défis technologiques et informatiques

Séquençage massif en parallèle Défis technologiques et informatiques Séquençage massif en parallèle Défis technologiques et informatiques Jean-Baptiste Rivière, PhD jean-baptiste.riviere@u-bourgogne.fr 10/09/2014 Séquençage massif en parallèle Défis technologiques de Sanger

Plus en détail

Corrigé du TD1. Exercice 1:

Corrigé du TD1. Exercice 1: Corrigé du TD1 Exercice 1: le but était d'aligner des séquences à la main et de compter les substitutions entre acides aminés observées. Le résultat se trouve à cette adresse: http://tagc.univ-mrs.fr/herrmann/bio6/displaymatrix.php

Plus en détail

La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST.

La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST. La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST. Gaël Le Mahec - p. 1/12 L algorithme BLAST. Basic Local Alignment Search Tool est un algorithme de recherche

Plus en détail

Bioinformatique. Ressources et banques de données internationales

Bioinformatique. Ressources et banques de données internationales Bioinformatique Ressources et banques de données internationales Frédéric Lecerf frederic.lecerf@agrocampus-ouest.fr UMR PEGASE Equipe Génétique & Génomique Bioinformatique Plan du module 1. Présentation

Plus en détail

Les microarrays: technologie pour interroger le génome

Les microarrays: technologie pour interroger le génome Les microarrays: technologie pour interroger le génome Patrick DESCOMBES patrick.descombes@frontiers-in-genetics.org Plate forme génomique NCCR Frontiers in Genetics Université de Genève http://genomics.frontiers-in-genetics.org

Plus en détail

La base de données MEDLINE

La base de données MEDLINE La base de données MEDLINE La base de données MEDLINE est produite par la National Library of Medicine (NLM) aux Etats-Unis. Elle couvre tous les domaines biomédicaux : médecine, biologie, toxicologie,

Plus en détail

Base de données bibliographiques Pubmed-Medline

Base de données bibliographiques Pubmed-Medline Chapitre 1 ; Domaine 1 ; Documentation ; Champs référentiels 1.1.1, 1.1.2 et 1.1.3 Base de données bibliographiques Pubmed-Medline D r Patrick Deschamps,, 30 mai 2007 PLAN C2i métiers de la santé Introduction

Plus en détail

Quelques termes-clef de biologie moléculaire et leur définition

Quelques termes-clef de biologie moléculaire et leur définition Acide aminé (AA) Quelques termes-clef de biologie moléculaire et leur définition Isabelle Quinkal INRIA Rhône-Alpes Septembre 2003 Petite molécule dont l enchaînement compose les protéines - on dit qu

Plus en détail

La synthèse des protéines transcription code génétique traduction

La synthèse des protéines transcription code génétique traduction CEC André-Chavanne BIO 3 OS La synthèse des protéines transcription code génétique traduction I. La «Transcription» : de l ADN à l ARNm. L'adresse suivante permet d accéder à une ANIMATION sur la TRANSCRIPTION.

Plus en détail

Bases de données et outils bioinformatiques utiles en génétique

Bases de données et outils bioinformatiques utiles en génétique Bases de données et outils bioinformatiques utiles en génétique Collège National des Enseignants et Praticiens de Génétique Médicale C. Beroud Date de création du document 2010-2011 Table des matières

Plus en détail

Plateforme de Recherche de Mutations

Plateforme de Recherche de Mutations Plateforme de Recherche de Mutations Jean-Marc Aury contact: pfm@genoscope.cns.fr 29 janvier 2009 Introduction Présentation des données produites par le GSFLX : type, qualité, Méthodes de détection de

Plus en détail

Présentation et accès aux bases de données OMIM, GDB, EMBL/GenBank, SWISS PROT, PDB et au système d'information IMGT

Présentation et accès aux bases de données OMIM, GDB, EMBL/GenBank, SWISS PROT, PDB et au système d'information IMGT Présentation et accès aux bases de données OMIM, GDB, EMBL/GenBank, SWISS PROT, PDB et au système d'information IMGT Véronique Giudicelli LIGM, IGH, UPR CNRS 1142 141 rue de la Cardonille 34296 Montpellier

Plus en détail

TD5 : Prédiction de la structure tridimensionnelle d une protéine Modélisation moléculaire

TD5 : Prédiction de la structure tridimensionnelle d une protéine Modélisation moléculaire TD5 : Prédiction de la structure tridimensionnelle d une protéine Modélisation moléculaire Vous aurez besoin des programmes suivant : d un éditeur de séquence d un visualiseur de structure 3D (PyMOL) Avant-propos

Plus en détail

Temps d animation scientifique sur des compétences et des outils locaux dans le but de transmettre un savoir-faire sur le site bordelais

Temps d animation scientifique sur des compétences et des outils locaux dans le but de transmettre un savoir-faire sur le site bordelais Workshop 1 Temps d animation scientifique sur des compétences et des outils locaux dans le but de transmettre un savoir-faire sur le site bordelais Particularité des essais cliniques à l heure du screening

Plus en détail

La génomique. Etude des génomes et de l ensemble de leurs gènes. Nécessite des outils bioinformatiques. Plusieurs étapes :

La génomique. Etude des génomes et de l ensemble de leurs gènes. Nécessite des outils bioinformatiques. Plusieurs étapes : La génomique Etude des génomes et de l ensemble de leurs gènes La structure Le fonctionnement L évolution Le polymorphisme, Plusieurs étapes : Nécessite des outils bioinformatiques 1 Chronologie sur le

Plus en détail

Module Analyse de Génomes 2011-2012 Master 2 module FMBS 326 Immunoinformatique

Module Analyse de Génomes 2011-2012 Master 2 module FMBS 326 Immunoinformatique Module Analyse de Génomes 2011-2012 Master 2 module FMBS 326 Immunoinformatique Planning du Module : Date Heure Salle 12/12 9h-12h TD info TA1Z bat 25 13h-17h TD info TA1Z bat 25 13/12 9h-12h TD info TA1Z

Plus en détail

Obtention de données génétiques à grande échelle

Obtention de données génétiques à grande échelle Obtention de données génétiques à grande échelle Stéphanie FERREIRA Ph.D. Campus de l Institut Pasteur de Lille 1, rue du Professeur Calmette 59000 LILLE Tel : 03 20 87 71 53 Fax : 03 20 87 72 64 contact@genoscreen.fr

Plus en détail

Formation Galaxy 13 Novembre 2014. 1 Premiers Pas

Formation Galaxy 13 Novembre 2014. 1 Premiers Pas Formation Galaxy 13 Novembre 2014 1 1-1 Connexion 1 Premiers Pas Connectez-vous sur la plateforme Galaxy SouthGreen à l adresse suivante : http://gohelle.cirad.fr/galaxy/ Utiliser votre adresse email et

Plus en détail

Fida KHATER & Abdoulaziz MOUSSA 03 mars 2012 - Journée Portes Ouvertes à l'um2

Fida KHATER & Abdoulaziz MOUSSA 03 mars 2012 - Journée Portes Ouvertes à l'um2 DEVELOPPEMENT D UNE INTERFACE GRAPHIQUE : LOCAL WEB GUI FOR BLAST (LWBG), POUR LES TRAITEMENTS DE DONNEES BIOLOGIQUES Fida KHATER & Abdoulaziz MOUSSA 03 mars 2012 - Journée Portes Ouvertes à l'um2 Plan

Plus en détail

CATALOGUE DES PRESTATIONS DE LA

CATALOGUE DES PRESTATIONS DE LA 1/23 La plate-forme Biopuces et Séquençage de Strasbourg est équipée des technologies Affymetrix et Agilent pour l étude du transcriptome et du génome sur puces à ADN. SOMMAIRE ANALYSE TRANSCRIPTIONNELLE...

Plus en détail

Cours d introduction à la génétique de la souris Notion de Souche

Cours d introduction à la génétique de la souris Notion de Souche Cours d introduction à la génétique de la souris Notion de Souche Introduction: - Réponse d un animal à l expérimentation (diapo 1) Facteurs environnementaux et propres à l animal - Notion d animal standardisé

Plus en détail

Introduc)on à Ensembl/ Biomart : Par)e pra)que

Introduc)on à Ensembl/ Biomart : Par)e pra)que Introduc)on à Ensembl/ Biomart : Par)e pra)que Stéphanie Le Gras Jean Muller NAVIGUER DANS ENSEMBL : PARTIE PRATIQUE 2 Naviga)on dans Ensembl : Pra)que Exercice 1 1.a. Quelle est la version de l assemblage

Plus en détail

Marc DELPECH. CORATA La Rochelle le 21 mai 2008

Marc DELPECH. CORATA La Rochelle le 21 mai 2008 Marc DELPECH CORATA La Rochelle le 21 mai 2008 En 24 ans les progrès ont été considérables Premières utilisation des techniques de génétique moléculaire en diagnostic : 1984 Une palette de techniques très

Plus en détail

L intérêt du génome individuel

L intérêt du génome individuel L intérêt du génome individuel 28/11/2012 Nom: Vincent Bours Historique et grands projets 1953: structure de l ADN 1977: Fred Sanger, séquençage de l ADN Fin 1980s: Human Genome Project Projet Génome Humain

Plus en détail

Détection de mutations somatiques par NGS sur GAIIx

Détection de mutations somatiques par NGS sur GAIIx Détection de mutations somatiques par NGS sur GAIIx Aude Lamy Laboratoire de Génétique Somatique des Tumeurs CHU de Rouen Inserm U1079 Faculté de Médecine et Pharmacie de Rouen La médecine personalisée

Plus en détail

PRINCIPALES TECHNIQUES UTILISEES EN GENOMIQUE

PRINCIPALES TECHNIQUES UTILISEES EN GENOMIQUE PRINCIPALES TECHNIQUES UTILISEES EN GENOMIQUE Définitions généralités Quelques chiffres 46 chromosomes 22 paires d autosomes (n=44) 1 paire de gonosomes (n=2) : XX/F et XY/H 300 bandes cytogénétiques =

Plus en détail

GMIN206 Info. Biologique et Outils bioinformatiques. Elodie Cassan

GMIN206 Info. Biologique et Outils bioinformatiques. Elodie Cassan M Bioinformatique, Connaissances et Données Année 24-25 GMIN206 Info. Biologique et Outils bioinformatiques Banques de données biologiques (3h de Cours +,5h de TD + 4h de TP) Elodie Cassan Anne-Muriel

Plus en détail

Aujourd hui, il y a plus de consortium, ce qui permet des avancées plus rapides.

Aujourd hui, il y a plus de consortium, ce qui permet des avancées plus rapides. GFMOM 20/01/2012 Cours 2 partie 2 T. Bourgeron II. LA CYTOGENETIQUE Nous allons étudier les anomalies chromosomiques des plus grossières aux plus fines. Ces anomalies peuvent être retrouvées dans la population

Plus en détail

Institut de Génomique. olaso@cng.fr

Institut de Génomique. olaso@cng.fr Institut de Génomique PCR quantitative : état des lieux... (de la théorie à la pratique, MIQE, CQ et stratégie de normalisation) olaso@cng.fr Microarray data qpcr data? Règles générales pour la présentation

Plus en détail

Chapitre 10 L isolement et la manipulation de gènes. Injection d ADN étranger dans une cellule animale

Chapitre 10 L isolement et la manipulation de gènes. Injection d ADN étranger dans une cellule animale Chapitre 10 L isolement et la manipulation de gènes Injection d ADN étranger dans une cellule animale Comment amplifier un gène d intérêt? Amplification in vivo à l aide du clonage d ADN L ensemble formé

Plus en détail

TYPAGE HLA CROSSMATCH ANTICORPS ANTI-HLA

TYPAGE HLA CROSSMATCH ANTICORPS ANTI-HLA 16/11/12 TYPAGE HLA CROSSMATCH ANTICORPS ANTI-HLA Chantal GAUTREAU LABORATOIRE HLA S E R V I C E D I M M U N O L O G I E E T D H I S T O C O M PAT I B I L I T É, A P - H P, HÔPITAL SAINT LOUIS, PARIS,

Plus en détail

Les anticorps : un outil pour la biologie moléculaire

Les anticorps : un outil pour la biologie moléculaire Master 2-Biotechnologies Parcours Cytologie Moléculaire Appliquée UE Immunoinformatique-Immunotechnologies Les anticorps : un outil pour la biologie moléculaire Ounissa AÏT AHMED Institut de Génétique

Plus en détail

AutoGRAPH Un serveur pour automatiser et visualiser la comparaison de génomes: Application à l identification de nouveaux gènes chez le chien.

AutoGRAPH Un serveur pour automatiser et visualiser la comparaison de génomes: Application à l identification de nouveaux gènes chez le chien. AutoGRAPH Un serveur pour automatiser et visualiser la comparaison de génomes: Application à l identification de nouveaux gènes chez le chien. Thomas DERRIEN CNRS-UMR6061 Génétique et Développement Université

Plus en détail

POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA

POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA Amplification spécifique Détection spécifique Clonage dans des vecteurs Amplification in vitro PCR Hybridation moléculaire - hôte cellulaire

Plus en détail

THEME 1 A EXPRESSION, STABILITE ET VARIATION DU PATRIMOINE GENETIQUE

THEME 1 A EXPRESSION, STABILITE ET VARIATION DU PATRIMOINE GENETIQUE THEME 1 A EXPRESSION, STABILITE ET VARIATION DU PATRIMOINE GENETIQUE CHAPITRE 3 L EXPRESSION DU PATRIMOINE GENETIQUE I. LA RELATION GENES-PROTEINES Les protéines interviennent dans le fonctionnement d

Plus en détail

Cahier de texte de la classe 1 ère 4 - SVT

Cahier de texte de la classe 1 ère 4 - SVT Cahier de texte de la classe 1 ère 4 - SVT DATE SEQUENCE lundi 12 : revoir la fiche méthodologique «utiliser le microscope optique» (disponible sur le site du lycée) Lundi 12 1 er contact avec les élèves.

Plus en détail

Influence du nombre de réplicats dans une analyse différentielle de données RNAseq

Influence du nombre de réplicats dans une analyse différentielle de données RNAseq Influence du nombre de réplicats dans une analyse différentielle de données RNAseq Statisticiens: Sophie Lamarre Steve Van Ginkel Sébastien Déjean - Magali San Cristobal Matthieu Vignes Biologistes: Stéphane

Plus en détail

Analyse des génomes. Module de Bioinformatique Appliquée. A. Les projets Génome : a) Qu est-ce qu un projet génome? Cours Analyse des génomes

Analyse des génomes. Module de Bioinformatique Appliquée. A. Les projets Génome : a) Qu est-ce qu un projet génome? Cours Analyse des génomes Module de Bioinformatique Appliquée GB3-2012 Cours Analyse des génomes 0 Analyse des génomes 1 Les objectifs des projets génomes sont : Assemblagedes cartes physiques et génétiques sur le génome de l organisme

Plus en détail

Vendredi 6 décembre 2013 Rouen

Vendredi 6 décembre 2013 Rouen Séminaire danimation d Animation de l Axe laxe 1 Vendredi 6 décembre 2013 Rouen «Le Séquençage de Nouvelle Génération dans le Cancéropôle Nord Ouest: Evolution, Résultats, projets» Diagnostic 0,5 2 Gb

Plus en détail

Sommaire. Première partie Les concepts de base

Sommaire. Première partie Les concepts de base Sommaire Préface à la troisième édition... Préface à la deuxième édition... Avant-propos à la troisième édition... Avant-propos à la deuxième édition... Avant-propos à la première édition... XV XVII XIX

Plus en détail

Comment la Souris fait de la souris avec des graines?

Comment la Souris fait de la souris avec des graines? Comment la Souris fait de la souris avec des graines? d après «10 clés pour la Biologie» de J. Tavlitzki «[ ] La Souris, l Ecureuil, le Lapin mangent des graines. La Souris fait de la souris, l Ecureuil

Plus en détail

Recherche et veille documentaire scientifique

Recherche et veille documentaire scientifique Recherche et veille documentaire scientifique Élodie Chattot BU Médecine Pharmacie juin 2006 Introduction Le but de cet atelier est de vous initier à la méthodologie de recherche documentaire scientifique,

Plus en détail

Tutoriel pour les enseignants de lycée. Rappel du contenu des programmes au lycée en classe de seconde

Tutoriel pour les enseignants de lycée. Rappel du contenu des programmes au lycée en classe de seconde Tutoriel pour les enseignants de lycée Ce document sert à l enseignant pour préparer différentes séquences pédagogiques afin d aborder : les questions de la génétique, des maladies génétiques, et les métiers

Plus en détail

GénoToul 2010, Hôtel de Région Midi Pyrénées, Toulouse, 10 décembre 2010

GénoToul 2010, Hôtel de Région Midi Pyrénées, Toulouse, 10 décembre 2010 GénoToul 2010, Hôtel de Région Midi Pyrénées, Toulouse, 10 décembre 2010 Analyse de la diversité moléculaire des régions génomiques de 30 gènes du développement méristématique dans une core collection

Plus en détail

Le séquençage haut-débit

Le séquençage haut-débit Nouveaux outils en biologie Le séquençage haut-débit DES d hématologie 16 janvier 2015 Paris Alice Marceau-Renaut Laboratoire d hématologie CHRU Lille NGS = Next-Generation Sequencing Whole-genome Whole-exome

Plus en détail

Plan du cours 29/03/2013. Schéma général transduction signal. Introduction Le cancer est une pathologie cellulaire

Plan du cours 29/03/2013. Schéma général transduction signal. Introduction Le cancer est une pathologie cellulaire UE09s Méthodes d étude et analyse du génome Applications des techniques du génie génétique à la thérapie des maladies acquises Exemples en cancérologie Thérapie ciblée Théranostique Plan du cours Introduction

Plus en détail

Dépistage Prénatal Non Invasif

Dépistage Prénatal Non Invasif Dépistage Prénatal Non Invasif Dr Mélanie JIMENEZ POCQUET Biologiste - Cytogéneticien L ABOcaryo+ L ABO+ - Chambray les Tours Les patientes connectées Les forums La presse Le presse DPNI : pourquoi

Plus en détail

Séquençage. Bérénice Batut, berenice.batut@udamail.fr. DUT Génie Biologique Option Bioinformatique Année 2014-2015

Séquençage. Bérénice Batut, berenice.batut@udamail.fr. DUT Génie Biologique Option Bioinformatique Année 2014-2015 Séquençage Bérénice Batut, berenice.batut@udamail.fr DUT Génie Biologique Option Bioinformatique Année 2014-2015 Séquençage Séquençage ADN Détermination de l ordre d enchainement des nucléotides d un fragment

Plus en détail

Outils de gestion des ressources biologiques

Outils de gestion des ressources biologiques Le Cahier des Techniques de l INRA 2015 (84) N 1 Outils de gestion des ressources biologiques Frédéric Sanchez 1 *, Tou Cheu Xiong 1 Résumé. Les recherches en biologie génèrent un grand nombre d échantillons

Plus en détail

Sommaire. A) Méthode de contrôle manuel des résultats produits par GLADX

Sommaire. A) Méthode de contrôle manuel des résultats produits par GLADX Sommaire Définitions et abréviations Résumé Introduction I. Matériel II. Méthode A) Méthode de contrôle manuel des résultats produits par GLADX B) Comparaison des résultats de l outil GLADX avec les résultats

Plus en détail

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq Présenté par Xi LIU ATCGCGCTAGCTGGTGTATCGCATCGCGCTAGCTGGTGTATCGCGCTAGCTGGTGTATCGCGCTAGCCTGGTGTATCGCCATCGCGCTAGCTGGCGCTAGCTGAATCGCGCATATG 17 Septembre 2013 Homéoallèles Génome Normalisation Analyse différentielle

Plus en détail

CERTIFICAT DE COMPÉTENCES EN BIO-INFORMATIQUE

CERTIFICAT DE COMPÉTENCES EN BIO-INFORMATIQUE CERTIFICAT DE COMPÉTENCES EN BIO-INFORMATIQUE Organisé par l équipe pédagogique : Statistique bioinformatique du département IMATH Responsable de la formation : Pr. Jean-François Zagury Coordinateur des

Plus en détail

Quelques notions de génomique fonctionnelle: l exemple des puces à ADN

Quelques notions de génomique fonctionnelle: l exemple des puces à ADN Quelques notions de génomique fonctionnelle: l exemple des puces à ADN Frédéric Devaux Laboratoire de génétique moléculaire Ecole Normale Supérieure Le «dogme central» de la biologie moléculaire Transcription

Plus en détail

Eléments primordiaux de biologie moléculaire

Eléments primordiaux de biologie moléculaire Eléments primordiaux de biologie moléculaire Pourquoi s intéresser au matériel génétique? Base de l information génétique Tissu Cellule Noyau Organisme entier Lieu où est localisé l ADN Mol d ADN qui est

Plus en détail

Formation Génomique et élevage. Glossaire de génétique moléculaire (animale)

Formation Génomique et élevage. Glossaire de génétique moléculaire (animale) Formation Génomique et élevage Rennes 21-23 novembre 2005 Glossaire de génétique moléculaire (animale) Version 1.1 Français (anglais) Les mots soulignés sont des entrées de ce glossaire ADN (DNA) : acide

Plus en détail

MUTATIONS et : Pandémies virales, évolution, génétique, environnement et cancer

MUTATIONS et : Pandémies virales, évolution, génétique, environnement et cancer MUTATIONS et : Pandémies virales, évolution, génétique, environnement et cancer évolution moléculaire ELEMENTS D UN ARBRE PHYLOGENETIQUE RECONSTRUCTION DE L HISTOIRE PAR COMPARAISON DE SEQUENCES (phylogénie

Plus en détail

1. L ADN et l information génétique. l ADN l information génétique est contenue dans l ADN. traduction. comment fait-on une protéine?

1. L ADN et l information génétique. l ADN l information génétique est contenue dans l ADN. traduction. comment fait-on une protéine? 1. L ADN et l information génétique l ADN l information génétique est contenue dans l ADN (ADN) (ARN) 1 2 A G T C U comment fait-on une protéine? traduction l information génétique est organisée par triplets

Plus en détail

Réplication de l ADN. Dr Annie M. Bérard Dr Nicolas Sévenet. Avertissement

Réplication de l ADN. Dr Annie M. Bérard Dr Nicolas Sévenet. Avertissement Année 2013-2014 UE 1 Atomes, biomolécules, génome, bioénergétique, métabolisme III-le génome : sa structure, son expression Organisation, évolution et fonction du génome humain Réplication de l ADN Dr

Plus en détail

Techniques de biologie moléculaire utilisées dans un cadre diagnostique. A. CALENDER 7.11 couvrant l ensemble des techniques

Techniques de biologie moléculaire utilisées dans un cadre diagnostique. A. CALENDER 7.11 couvrant l ensemble des techniques Techniques de biologie moléculaire utilisées dans un cadre diagnostique A. CALENDER 7.11 couvrant l ensemble des techniques Introduction Diagnostic clinique Confirmation par l analyse génétique Traitement

Plus en détail

Barcoding environnemental par séquençage haut débit

Barcoding environnemental par séquençage haut débit Barcoding environnemental par séquençage haut débit Potentiel et limites Jean-François Martin Échantillonnage Spécificités du barcoding environnemental Amplification (PCR) de marqueurs choisis Séquençage

Plus en détail

Lettres: A, T, G, C. Mots: à 3 lettres (codons) Phrase: gène (information pour synthétiser une protéine). Ponctuation

Lettres: A, T, G, C. Mots: à 3 lettres (codons) Phrase: gène (information pour synthétiser une protéine). Ponctuation 2- Les molécules d ADN constituent le génome 2-1 La séquence d ADN représente l information génétique Lettres: A, T, G, C Mots: à 3 lettres (codons) Phrase: gène (information pour synthétiser une protéine).

Plus en détail

Les Evolutions techniques. Marc Delpech Laboratoire de Génétique et Biologie moléculaires de l hôpital Cochin

Les Evolutions techniques. Marc Delpech Laboratoire de Génétique et Biologie moléculaires de l hôpital Cochin Les Evolutions techniques Marc Delpech Laboratoire de Génétique et Biologie moléculaires de l hôpital Cochin 1 Les principales étapes de l évolution technologique 1975 Southern blot 1977 Séquençage Sanger

Plus en détail

Mise en place d une plateforme de gestion de matériels biologiques : quels avantages pour les chercheurs?

Mise en place d une plateforme de gestion de matériels biologiques : quels avantages pour les chercheurs? Mise en place d une plateforme de gestion de matériels biologiques : quels avantages pour les chercheurs? Dr Xavier Manival, Laboratoire IMoPA, CR, CNRS Françoise Tisserand-Bedri, Documentaliste, Inist-CNRS

Plus en détail

Génétique et génomique Pierre Martin

Génétique et génomique Pierre Martin Génétique et génomique Pierre Martin Principe de la sélections Repérage des animaux intéressants X Accouplements Programmés Sélection des meilleurs mâles pour la diffusion Index diffusés Indexation simultanée

Plus en détail

Biologie «in silico» Adapté de Pierre Vincens

Biologie «in silico» Adapté de Pierre Vincens Biologie «in silico» Adapté de Pierre Vincens Bioinformatique Association de la biologie et de l'informatique Objectifs : Analyser, modéliser ou prédire les informations issues de données biologiques expérimentales

Plus en détail

Analyse Chromosomique sur Puce à ADN Applications en Prénatal

Analyse Chromosomique sur Puce à ADN Applications en Prénatal Analyse Chromosomique sur Puce à ADN Applications en Prénatal Véronique Satre, Charles Coutton, Gaëlle Vieville, Françoise Devillard et Florence Amblard Maladies génétiques Anomalies chromosomiques Cytogénétique

Plus en détail

Le point de vue du biologiste : L activité des plateformes de génétique moléculaire

Le point de vue du biologiste : L activité des plateformes de génétique moléculaire Le point de vue du biologiste : L activité des plateformes de génétique moléculaire Institut de Cancérologie de Lorraine Service de Biopathologie CNRS UMR7039 CRAN Université de Lorraine Jean-Louis Merlin

Plus en détail

Éditeur Elsevier Langue(s) Multilingue

Éditeur Elsevier Langue(s) Multilingue Science Direct Type Périmètre d'abonnement Articles en ligne, Livres électroniques Freedom Collection, intégralité des archives des revues, série de livres électroniques en génétique Domaine Public Pluridisciplinaire

Plus en détail

Chapitre 14: La génétique

Chapitre 14: La génétique Chapitre 14: La génétique A) Les gènes et les protéines, ça te gêne? 1) a) Quel est l élément de base des vivants? Les cellules b) Qu a-t-elle en son centre? Un noyau c) Qu y retrouve-t-on sous forme de

Plus en détail

Bioinformatique et données biologiques

Bioinformatique et données biologiques Bioinformatique et données biologiques QUELQUES MOTS SUR LA BIOINFO Cours d'introduction à la bioinformatique et de présentation des banques de séquences. Connaissances 1 ère partie Equipe Bonsai (2014)

Plus en détail

Bioinformatique et données biologiques

Bioinformatique et données biologiques Bioinformatique et données biologiques Cours d'introduction à la bioinformatique et de présentation des banques de séquences. 1 ère partie Equipe Bonsai (2014) QUELQUES MOTS SUR LA BIOINFO Connaissances

Plus en détail

L épissage alternatif : un gène, combien de protéines?

L épissage alternatif : un gène, combien de protéines? L épissage alternatif : un gène, combien de protéines? Avant la publication de la séquence complète de l ADN du génome humain, au début des années 2000, on estimait le nombre de gènes à environ 300.000.

Plus en détail

Institut Français de Bioinformatique (IFB) : mettre en place une infrastructure informatique dédiée aux sciences de la vie

Institut Français de Bioinformatique (IFB) : mettre en place une infrastructure informatique dédiée aux sciences de la vie 1 / 1 Institut Français de Bioinformatique (IFB) : mettre en place une infrastructure informatique dédiée aux sciences de la vie J-F. Gibrat Unité Mathématique, Informatique et Génome, INRA, Jouy-en-Josas

Plus en détail

Les besoins de la communauté des sciences de la vie en termes d infrastructure informatique

Les besoins de la communauté des sciences de la vie en termes d infrastructure informatique 1 / 31 Les besoins de la communauté des sciences de la vie en termes d infrastructure informatique J-F. Gibrat Unité Mathématique, Informatique et Génome, INRA, Jouy-en-Josas Séminaire IDRIS, Orsay, 14

Plus en détail

La biologie synthétique: enjeux et défis

La biologie synthétique: enjeux et défis Buts de la biologie synthétique La biologie synthétique: enjeux et défis - Créer des microorganismes de synthèse: châssis vivant, de comportement connu (modélisable), modifiable à façon pour des tâches

Plus en détail

Professeur Joël LUNARDI

Professeur Joël LUNARDI Biochimie - Biologie moléculaire Chapitre 3 : La réplication du matériel génétique Professeur Joël LUNARDI MED@TICE PCEM1 - Année 2006/2007 Faculté de Médecine de Grenoble - Tous droits réservés. Chapitre

Plus en détail

exemple de végétaux exposés au benzène atmosphérique Sylvain Dumez sylvain.dumez@univ-lille2.fr

exemple de végétaux exposés au benzène atmosphérique Sylvain Dumez sylvain.dumez@univ-lille2.fr Approches écotoxicogénomiques et application à la biosurveillance exemple de végétaux exposés au benzène atmosphérique Sylvain Dumez sylvain.dumez@univ-lille2.fr Laboratoire des Sciences végétales et fongiques,

Plus en détail

Bioinformatique BTV Alignement de Séquences

Bioinformatique BTV Alignement de Séquences 1 / 60 Bioinformatique BTV Alignement de Séquences Jean-Michel Richer jean-michel.richer@univ-angers.fr http://www.info.univ-angers.fr/pub/richer Juillet 2008 2 / 60 Plan Plan 1 Rappels 2 Alignement multiple

Plus en détail

Comment reproduire les résultats de l article : POP-Java : Parallélisme et distribution orienté objet

Comment reproduire les résultats de l article : POP-Java : Parallélisme et distribution orienté objet Comment reproduire les résultats de l article : POP-Java : Parallélisme et distribution orienté objet Beat Wolf 1, Pierre Kuonen 1, Thomas Dandekar 2 1 icosys, Haute École Spécialisée de Suisse occidentale,

Plus en détail

THÈME 3 : DU GÉNOTYPE AU PHÉNOTYPE. CHAPITRE 1 : la relation entre ADN et protéines

THÈME 3 : DU GÉNOTYPE AU PHÉNOTYPE. CHAPITRE 1 : la relation entre ADN et protéines THÈME 3 : DU GÉNOTYPE AU PHÉNOTYPE CHAPITRE 1 : la relation entre ADN et protéines Les caractères d un individu dépendent de plusieurs facteurs : certains dépendent des caractères présents dans la famille

Plus en détail

Soumission de données brutes de séquences à SRA. Novembre 2013

Soumission de données brutes de séquences à SRA. Novembre 2013 Soumission de données brutes de séquences à SRA Novembre 2013 1 Objectif Soumettre les données brutes issues du séquençage haut débit aux banques publiques d archivage Données : séquences brutes (reads)

Plus en détail

Biomarqueurs en Cancérologie

Biomarqueurs en Cancérologie Biomarqueurs en Cancérologie Définition, détermination, usage Biomarqueurs et Cancer: définition Anomalie(s) quantitative(s) ou qualitative(s) Indicative(s) ou caractéristique(s) d un cancer ou de certaines

Plus en détail

Guide d utilisation du navigateur web OECD.Stat

Guide d utilisation du navigateur web OECD.Stat OECD.Stat 2008 2 / 39 Table des matières : Introduction... 4 Concepts liés à OECD.Stat... 4 Organisation des données... 4 Séries de référence... 5 Recherche... 5 Le navigateur web OECD.Stat... 5 Guide

Plus en détail

MEDLINE BANQUE DE DONNÉES EN MÉDECINE INTERFACE PUBMED INITIATION

MEDLINE BANQUE DE DONNÉES EN MÉDECINE INTERFACE PUBMED INITIATION MEDLINE BANQUE DE DONNÉES EN MÉDECINE INTERFACE PUBMED INITIATION document préparé par : CSSS-IUGS SERVICE DE BIBLIOTHÈQUE Janvier 2008 INTRODUCTION Medline est une banque de données bibliographique produite

Plus en détail

Guide de référence du logiciel MiSeq Reporter pour les tests IVD

Guide de référence du logiciel MiSeq Reporter pour les tests IVD Guide de référence du logiciel MiSeq Reporter pour les tests IVD DESTINÉ AU DIAGNOSTIC IN VITRO UNIQUEMENT EXCLUSIF À ILLUMINA Nº 15038356 Rév. A FRA Mars 2014 Ce document et son contenu sont exclusifs

Plus en détail

L'hybridation fluorescente (FISH)

L'hybridation fluorescente (FISH) L'hybridation fluorescente (FISH) fluorescent in situ hybridization DR Thierry PALUKU THEY-THEY LABO GENETIQUE ET PATHO MOLECULAIRE JUIN 2007 Définition repérer la présence d'anomalies chromosomiques par

Plus en détail

Modèle Cellulaire pour les Cancers de l Oropharynx VPH Induits

Modèle Cellulaire pour les Cancers de l Oropharynx VPH Induits Congrès de l AORLQ - Octobre 2012 Modèle Cellulaire pour les Cancers de l Oropharynx VPH Induits Monika Knapik MD Guillaume Cardin M.Sc Francis Rodier Ph.D Apostolos Christopoulos MD, FRCSC Division d

Plus en détail

Utiliser un logiciel libre de gestion bibliographique: Zotero

Utiliser un logiciel libre de gestion bibliographique: Zotero Utiliser un logiciel libre de gestion bibliographique: Zotero David Vivarès URFIST Strasbourg 03/11/2008 1 1. Définition Les logiciels de gestion bibliographiques sont des outils spécialisés permettant

Plus en détail

BILAN DE LA SANTÉ DES FORÊTS EN 2015

BILAN DE LA SANTÉ DES FORÊTS EN 2015 Département de la santé des forêts février 2015 BILAN DE LA SANTÉ DES FORÊTS EN 2015 LA BIOLOGIE MOLÉCULAIRE AU SERVICE DU DIAGNOSTIC POUR LA SANTÉ DES FORÊTS Marie-Laure Desprez-Loustau (INRA-Univ Bordeaux

Plus en détail

BL01 : Environnement agro-industriel et cancer

BL01 : Environnement agro-industriel et cancer Note : ce document n est qu une prise de note rédigée pendant le cours de BL01. Il ne peut donc se substituer au cours d autant plus qu il est souvent incomplet (la 2 ème heure était souvent celle de la

Plus en détail

I. Obtenir les exons d'un chromosome humain possédant la plus forte densité en SNP. 1. Récupérer les exons codant du chromosome 22 humain

I. Obtenir les exons d'un chromosome humain possédant la plus forte densité en SNP. 1. Récupérer les exons codant du chromosome 22 humain Exemples d'analyse sous Galaxy : Adaptation des exercices "Using Galaxy" proposés par la team Galaxy Exercices proposés par la plateforme rennaise GenOuest Jennifer Hillman-Jackson, 1 Dave Clements, 2

Plus en détail

Recherche documentaire et autoformation. Lecture critique d un article médical. Recommandations pour la pratique. Les maladies orphelines

Recherche documentaire et autoformation. Lecture critique d un article médical. Recommandations pour la pratique. Les maladies orphelines 18. Recherche documentaire et autoformation. Lecture critique d un article médical. Recommandations pour la pratique. Les maladies orphelines KARILA LAURENT - APPRENTISSAGE DE L EXERCICE MÉDICAL + Objectifs

Plus en détail

PLAN. Atelier Puces à ADN IRB Hôpiital St Eloi Mardi 27 mars 2007 En collaboration avec la Génopole de Montpellier

PLAN. Atelier Puces à ADN IRB Hôpiital St Eloi Mardi 27 mars 2007 En collaboration avec la Génopole de Montpellier PLAN Atelier Puces à ADN IRB Hôpiital St Eloi Mardi 27 mars 2007 En collaboration avec la Génopole de Montpellier 8h45 Accueil des participants - café 9h00-9h45 John DE VOS : Introduction à la journée

Plus en détail

Université du Québec à Montréal

Université du Québec à Montréal RECUEIL D EXERCICES DE BICHIMIE 6. Les acides nucléiques 6.2. Réplication, transcription et traduction P P P CH 2 H N H N N NH NH 2 Université du Québec à Montréal 6.2. Réplication, transcription et traduction

Plus en détail

Licence d Informatique Année 2001-2002 Option: Introduction à la biologie moléculaire. LA P.C.R. Polymerase Chain Reaction

Licence d Informatique Année 2001-2002 Option: Introduction à la biologie moléculaire. LA P.C.R. Polymerase Chain Reaction Licence d Informatique Année 2001-2002 Option: Introduction à la biologie moléculaire LA P.C.R. Polymerase Chain Reaction "chercher une aiguille dans une meule de foin"? Chercher à repérer un gène particulier

Plus en détail

CHAPITRE 3 LA SYNTHESE DES PROTEINES

CHAPITRE 3 LA SYNTHESE DES PROTEINES CHAITRE 3 LA SYNTHESE DES ROTEINES On sait qu un gène détient dans sa séquence nucléotidique, l information permettant la synthèse d un polypeptide. Ce dernier caractérisé par sa séquence d acides aminés

Plus en détail

Introduction à l analyse statistique et bioinformatique des puces à ADN

Introduction à l analyse statistique et bioinformatique des puces à ADN Formation INSERM 10 février 2004 Introduction à l analyse statistique et bioinformatique des puces à ADN Gaëlle Lelandais lelandais@biologie.ens.fr 1 Première Partie Analyse d une puce à ADN : Le recherche

Plus en détail

Analyse de Séquences M1 BIBS. 2 e partie. http://rna.igmors.u-psud.fr/gautheret/cours/ V. 2012.1

Analyse de Séquences M1 BIBS. 2 e partie. http://rna.igmors.u-psud.fr/gautheret/cours/ V. 2012.1 Analyse de Séquences M1 BIBS 2 e partie http://rna.igmors.u-psud.fr/gautheret/cours/ V. 2012.1 1 Les programmes Génome 2 Les programmes Génome Préhistoire Séquençage de Sanger Avant le séquençage d organismes:

Plus en détail