La bio-quoi??? Introduction à la Bioinformatique. Propriétés et modèles? Propriétés et modèles? cycle cellulaire

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimension: px
Commencer à balayer dès la page:

Download "La bio-quoi??? Introduction à la Bioinformatique. Propriétés et modèles? Propriétés et modèles? cycle cellulaire"

Transcription

1 Introduction à la Bioinformatique 1. Motivation et objectifs Définition simple: La bio-quoi??? La bioinformatique est l analyse des données biologiques pour : 1.l identification des propriétés intéressantes et 2.la construction des modèles biologiques en utilisant ses données. 1 2 Propriétés et modèles? Propriétés et modèles? Cancer l autisme alzheimer cycle cellulaire Cancer l autisme alzheimer cycle cellulaire Quelles sont les données importantes pour les biologistes?

2 Les données La structure des données ADN strings...ttgtacatctctatctacttatcgtctagcagcagc TACTGATCGTAGTCTCGTGATCCTAGTCATTCATGCTAC TATCGATGCAGTCGATCGTAATCGGCGTAGTAGCGCCGG GTGTCATATATAGCCTCTAGCGCTAGCAGCTGATCGATC TAGTCGTTCATGTCGATGCAGCTAGTCTAGTCGTATCTA TACTAGCGACGATGCTAGCGTACGTAGCTATATAGCTAC TCTGATATACTGCCGCTAGTACGTACTGCAGCAGCTGAC TGCTGACTGCTGACTGACGTAGCTGACATTCATGCTAGC TAGCTTACATCGCGATCGTAGCTAGCGATCGTACGTAGC GCCTAGCGGTACTTGCGATCGTAGCTGCTGTAGTCGATT GTGCGATAGTCACTGTGCAGTCAGTCGATCGATCGACTG ACTGACGTCGACTGATCGACTGACTGACTGACTGACTGC ATGTCGTCGACTGACTGACGCTGCAGCTGACTGCATGAC GTCGACTGATGACTGACTGCGCGTCAGCTGACTGACTGA CTGACTGACTGTCAGTGACTGACTGACTGACTGACG... Tous les organismes connus utilisent 2 types de données : 1. séquences de nucléotides 2. séquences d acides aminés séquences d acides nucléiques Et leurs structures 3D 4 5 La structure des données 2 La structure des données 3 Protéines strings l ADT Atome (x,y,z) Protéines EARSLTTGET GYIPSNYVAP VDSIQAEEWY FGKLGRKDAE RQLLSFGNPR GTFLIRESQT TKGAYSLSIR DWDDMKGDHV KHYKIRKLDN GGYYITTRAQ FETLQQLVQH YSERAAGLCC RLVVPCHKGM PRLTDLSVKT KDVWEIPRES LQLIKRLGNG QFGEVWLGTW NGNTKVAIKT séquences d acides aminés séquences de cordonnées d atomes 6 7

3 Explosion de données Uniprot/swissprot statistiques Release 174.0, oct 2009, paires de base et séquences Release 57.11, Novembre séquences Explosion de données 2 Nombre des structures de protéines RCSB protéine base de données version de 3 décembre Explosion de données 3 Explosion de données 4 ça ne termine pas... ExAC Rusch DB, Halpern AL, Sutton G, Heidelberg KB, Williamson S, et al. (2007) The Sorcerer II Global Ocean Sampling Expedition: Northwest Atlantic through Eastern Tropical Pacific. PLoS Biol 5(3): e77 10 Source: Source: ENCODE Project Consortium. "The ENCODE (ENCyclopedia of DNA elements) project." Science (2004): Lek M, et al. Analysis of protein-coding genetic variation in 60,706 humans. Nature. August 18, DOI: /

4 On a les données......ttgtacatctctatctacttatcgtctagcagcagc TACTGATCGTAGTCTCGTGATCCTAGTCATTCATGCTAC TATCGATGCAGTCGATCGTAATCGGCGTAGTAGCGCCGG GTGTCATATATAGCCTCTAGCGCTAGCAGCTGATCGATC TAGTCGTTCATGTCGATGCAGCTAGTCTAGTCGTATCTA TACTAGCGACGATGCTAGCGTACGTAGCTATATAGCTAC TCTGATATACTGCCGCTAGTACGTACTGCAGCAGCTGAC TGCTGACTGCTGACTGACGTAGCTGACATTCATGCTAGC TAGCTTACATCGCGATCGTAGCTAGCGATCGTACGTAGC GCCTAGCGGTACTTGCGATCGTAGCTGCTGTAGTCGATT GTGCGATAGTCACTGTGCAGTCAGTCGATCGATCGACTG ACTGACGTCGACTGATCGACTGACTGACTGACTGACTGC ATGTCGTCGACTGACTGACGCTGCAGCTGACTGCATGAC GTCGACTGATGACTGACTGCGCGTCAGCTGACTGACTGA CTGACTGACTGTCAGTGACTGACTGACTGACTGACG et maintenant?...ttgtacatctctatctacttatcgtctagcagcagc TACTGATCGTAGTCTCGTGATCCTAGTCATTCATGCTAC TATCGATGCAGTCGATCGTAATCGGCGTAGTAGCGCCGG GTGTCATATATAGCCTCTAGCGCTAGCAGCTGATCGATC TAGTCGTTCATGTCGATGCAGCTAGTCTAGTCGTATCTA TACTAGCGACGATGCTAGCGTACGTAGCTATATAGCTAC TCTGATATACTGCCGCTAGTACGTACTGCAGCAGCTGAC TGCTGACTGCTGACTGACGTAGCTGACATTCATGCTAGC TAGCTTACATCGCGATCGTAGCTAGCGATCGTACGTAGC GCCTAGCGGTACTTGCGATCGTAGCTGCTGTAGTCGATT GTGCGATAGTCACTGTGCAGTCAGTCGATCGATCGACTG ACTGACGTCGACTGATCGACTGACTGACTGACTGACTGC ATGTCGTCGACTGACTGACGCTGCAGCTGACTGCATGAC GTCGACTGATGACTGACTGCGCGTCAGCTGACTGACTGA CTGACTGACTGTCAGTGACTGACTGACTGACTGACG Le rôle joué par informatique Le rôle joué par l informatique Y a-t-il des protéines...ttgtacatctctatctacttatcgtctagcagcagcta Ou sont les gènes? CTGATCGTAGTCTCGTGATCCTAGTCATTCATGCTACTATC GATGCAGTCGATCGTAATCGGCGTAGTAGCGCCGGGTGTCA TATATAGCCTCTAGCGCTAGCAGCTGATCGATCTAGTCGTT CATGTCGATGCAGCTAGTCTAGTCGTATCTATACTAGCGAC Comment GATGCTAGCGTACGTAGCTATATAGCTACTCTGATATACTG l expression est-elle CCGCTAGTACGTACTGCAGCAGCTGACTGCTGACTGCTGAC Y a-t-il des gènes contrôlée? TGACGTAGCTGACATTCATGCT EWY FGKLGRKDAE RQLLSFGNPR GTFLIRESQT 19 TKGAYSLSIR DWDDMKGDHV KHYKIRKLDN 22 GGYYITTRAQ FETLQQLVQH YSERAAGLCC 14...TTGTACATCTCTATCTACTTATCGTCTAGCAGCAGCTA Ou sont les gènes? CTGATCGTAGTCTCGTGATCCTAGTCATTCATGCTACTATC GATGCAGTCGATCGTAATCGGCGTAGTAGCGCCGGGTGTCA TATATAGCCTCTAGCGCTAGCAGCTGATCGATCTAGTCGTT CATGTCGATGCAGCTAGTCTAGTCGTATCTATACTAGCGAC Comment GATGCTAGCGTACGTAGCTATATAGCTACTCTGATATACTG l expression est-elle CCGCTAGTACGTACTGCAGCAGCTGACTGCTGACTGCTGAC Y a-t-il des gènes contrôlée? TGACGTAGCTGACATTCATGCT... Quelles sont les protéines? EWY FGKLGRKDAE RQLLSFGNPR GTFLIRESQT TKGAYSLSIR DWDDMKGDHV KHYKIRKLDN GGYYITTRAQ FETLQQLVQH YSERAAGLCC RLVVP Quels sont les acides aminés importants? 15

5 Le rôle joué par informatique Le rôle joué par informatique Y a-t-il des protéines...ttgtacatctctatctacttatcgtctagcagcagcta Ou sont les gènes? CTGATCGTAGTCTCGTGATCCTAGTCATTCATGCTACTATC GATGCAGTCGATCGTAATCGGCGTAGTAGCGCCGGGTGTCA TATATAGCCTCTAGCGCTAGCAGCTGATCGATCTAGTCGTT CATGTCGATGCAGCTAGTCTAGTCGTATCTATACTAGCGAC Comment GATGCTAGCGTACGTAGCTATATAGCTACTCTGATATACTG l expression est-elle CCGCTAGTACGTACTGCAGCAGCTGACTGCTGACTGCTGAC Y a-t-il des gènes contrôlée? TGACGTAGCTGACATTCATGCT... Quelles sont les protéines? EWY FGKLGRKDAE RQLLSFGNPR GTFLIRESQT TKGAYSLSIR DWDDMKGDHV KHYKIRKLDN GGYYITTRAQ FETLQQLVQH YSERAAGLCC RLVVP Quels sont les acides aminés importants? Y a-t-il des protéines...ttgtacatctctatctacttatcgtctagcagcagcta Ou sont les gènes? CTGATCGTAGTCTCGTGATCCTAGTCATTCATGCTACTATC GATGCAGTCGATCGTAATCGGCGTAGTAGCGCCGGGTGTCA TATATAGCCTCTAGCGCTAGCAGCTGATCGATCTAGTCGTT CATGTCGATGCAGCTAGTCTAGTCGTATCTATACTAGCGAC Comment GATGCTAGCGTACGTAGCTATATAGCTACTCTGATATACTG l expression est-elle CCGCTAGTACGTACTGCAGCAGCTGACTGCTGACTGCTGAC Y a-t-il de gènes contrôlée? TGACGTAGCTGACATTCATGCT... Ce qui est la structure d une protéine? Quelles sont les protéines? EWY FGKLGRKDAE RQLLSFGNPR GTFLIRESQT TKGAYSLSIR DWDDMKGDHV KHYKIRKLDN GGYYITTRAQ FETLQQLVQH YSERAAGLCC RLVVP Quels sont les acides aminés importants? Ce qui est la structure d une protéine? Quelles sont les partenaires d interaction? Ce qui sont les régularités? Ce qui sont les régularités? Est-ce que il existe une préférence? Est-ce que il existe une préférence? Est-ce que le gène est lié à une certaine maladie? Ce qui est la fonction d une protéine? Où peut une autre protéine être lier? 16 Objectifs du cours Où peut une autre protéine être lier? 17 Référence Part 1: Background Basics 1. The Nucleic Acid World 2. Protein Structure 3. Dealing with Databases Comprendre la vocabulaire biologique et bioinformatique les questions moléculaire et les techniques Comprendre bioinformatiques qui ont résolus ces questions. Part 2: Sequence Alignments 4. Producing and Analyzing Sequence Alignments 5. Pairwise Sequence Alignment and Database Searching 6. Patterns, Profiles, and Multiple Alignments Part 3: Evolutionary Processes 7. Recovering Evolutionary History 8. Building Phylogenetic Trees Être capable d expliquer et reproduire certaines algorithmes capable de choisir entre les algorithmes connus pour résoudre Être un problème moléculair Part 4: Genome Characteristics 9. Revealing Genome Features 10. Gene Detection and Genome Annotation Part 5: Secondary Structures 11. Obtaining Secondary Structure from Sequence 12. Predicting Secondary Structures Être capable de créer un nouveau algorithme qui peut résoudre Part 6: Tertiary Structures 13. Modeling Protein Structure 14. Analyzing Structure-Function Relationships une certaine question biomoléculaire Comprendre les publications dans le domaine. Augmentez votre intérêt pour des autres sciences et la Part 7: Cells and Organisms 15. Proteome and Gene Expression Analysis 16. Clustering Methods and Statistics 17. Systems Biology Appendices: Background Theory Appendix A. Probability, Information, and Bayesian Analysis Appendix B. Molecular Energy Functions Appendix C. Function Optimization recherche interdisciplinaire Site web: Marketa Zvelebil, Jeremy O. Baum. Understanding Bioinformatics August 2007 Paperback:

6 Cartes de compréhension Organigrammes L application montré ici est composé de 4 sujets les notions qui étaient expliquées dans les sections précédentes Une carte de la structure du chapitre: sujets et leurs relations les nouvelles notions qui sont expliquées dans la section suivante Chaque chapitre commence avec une carte de compréhension un outil pour visualiser et se rappeler les étapes qui sont nécessaire pour certaines applications. les flèches montrent comment les notions sont relatées Les sections dans chaque chapitre commence avec un organigramme. un outil pour visualiser et se rappeler les sujets couverts dans cette section Programme (provisoire) Date Description Portfolio Livre 19 septembre 2016 Pas de cours 26 septembre 2016 Introduction/Fondations moléculaire octobre 2016 Fondations moléculaire/alignement des séquences octobre 2016 alignement des séquences Jupyter+ P octobre 2016 Matrices de substitution P1+P octobre 2016 Trouver des séquences homologues P octobre novembre 2016 Date limite P1 et P2 14 novembre 2016 Alignement de groupes de séquences novembre 2016 Hidden markov models and Profiles P novembre 2016 Structures secondaires P3+P décembre 2016 Arbres phylogénétiques P décembre décembre 2016 Date limite P3 et P4 Organisation Chaque lundi entre 10h et 12h Local?? Réunions pour le portfolio: Dr. Catharina Olsen vendredi de 16h à 18h dans 2 NO4.008 Assistance pour les 4 mini projets 22 23

7 Portfolio Chaque étudiant construira pendant l année un portfolio composé de 4 mini projets Un portfolio ou portefolio est un dossier personnel dans lequel les acquis de formation et les acquis de l'expérience d'une personne sont définis et démontrés en vue d'une reconnaissance par un établissement d'enseignement ou un employeur. Utilisant Jupyter notebooks (python) 50% du note final Portfolio Le portfolio sera composé de 4 mini projets 1.Une implémentation de l algorithme Needleman-Wunsch et l algorithme de Smith Waterman qui sera comparée avec le logiciel LALIGN, disponible en ligne ( 2.Une implémentation de l algorithme BLOSUM construite en utilisant des données liés à deux domaines protéiques differentes. 3.Un algorithme qui construit des PSSM pour des ensembles de séquences alignées et créez un Weblogo. 4.Une implémentation de l algorithme GOR IV pour prédire la structure secondaire des séquences Portfolios Date limite Partie 1; 7 Novembre 2016 Mini projet 1 et 2 Date Limite Partie 2; 19 Décembre 2016 Mini projet 3 et 4 IMPORTANT pour chaque projet vous construisez un jupyter notebook (python) Utilisez des examples pour illustrer votre code Ajoutez des explications: le but du projet, le traitement des données des figures 26 27

8 L examen Examen écrit 17 janvier2016 (9h30-12h) la théorie (transparents et livre) Un exemple est en ligne sur le site web 50% des points Continuation oral après l examen écrit +2 ou -2! Mes coordonnées Tom Lenaerts Bureau : 8ième étage, 2 NO téléphone ULB : 02/ courrier électronique:

Big data et sciences du Vivant L'exemple du séquençage haut débit

Big data et sciences du Vivant L'exemple du séquençage haut débit Big data et sciences du Vivant L'exemple du séquençage haut débit C. Gaspin, C. Hoede, C. Klopp, D. Laborie, J. Mariette, C. Noirot, MS. Trotard bioinfo@genopole.toulouse.inra.fr INRA - MIAT - Plate-forme

Plus en détail

Bioinformatique BTV Alignement de Séquences

Bioinformatique BTV Alignement de Séquences 1 / 60 Bioinformatique BTV Alignement de Séquences Jean-Michel Richer jean-michel.richer@univ-angers.fr http://www.info.univ-angers.fr/pub/richer Juillet 2008 2 / 60 Plan Plan 1 Rappels 2 Alignement multiple

Plus en détail

TD Bioinformatique : Sequence Alignment. Pourquoi faire une recherche par similarité?

TD Bioinformatique : Sequence Alignment. Pourquoi faire une recherche par similarité? TD Bioinformatique : Sequence lignment Pourquoi faire une recherche par similarité? - Savoir si ma séquence ressemble à d'autres déjà connues. - Trouver toutes les séquences d'une même famille. - Rechercher

Plus en détail

La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST.

La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST. La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST. Gaël Le Mahec - p. 1/12 L algorithme BLAST. Basic Local Alignment Search Tool est un algorithme de recherche

Plus en détail

MABioVis. Bio-informatique et la

MABioVis. Bio-informatique et la MABioVis Modèles et Algorithmes pour la Bio-informatique et la Visualisation Visite ENS Cachan 5 janvier 2011 MABioVis G GUY MELANÇON (PR UFR Maths Info / EPI GRAVITE) (là, maintenant) - MABioVis DAVID

Plus en détail

Conception assistée par ordinateur de molécules thérapeutiques

Conception assistée par ordinateur de molécules thérapeutiques Conception assistée par ordinateur de molécules thérapeutiques D. Gilis Bioinformatique génomique et structurale Faculté des sciences appliquées Université Libre de Bruxelles Objectif: illustrer en quoi

Plus en détail

Comment reproduire les résultats de l article : POP-Java : Parallélisme et distribution orienté objet

Comment reproduire les résultats de l article : POP-Java : Parallélisme et distribution orienté objet Comment reproduire les résultats de l article : POP-Java : Parallélisme et distribution orienté objet Beat Wolf 1, Pierre Kuonen 1, Thomas Dandekar 2 1 icosys, Haute École Spécialisée de Suisse occidentale,

Plus en détail

Introduction aux bases de données: application en biologie

Introduction aux bases de données: application en biologie Introduction aux bases de données: application en biologie D. Puthier 1 1 ERM206/Technologies Avancées pour le Génome et la Clinique, http://tagc.univ-mrs.fr/staff/puthier, puthier@tagc.univ-mrs.fr ESIL,

Plus en détail

L intérêt du génome individuel

L intérêt du génome individuel L intérêt du génome individuel 28/11/2012 Nom: Vincent Bours Historique et grands projets 1953: structure de l ADN 1977: Fred Sanger, séquençage de l ADN Fin 1980s: Human Genome Project Projet Génome Humain

Plus en détail

ARN et bioinformatique: PDF processed with CutePDF evaluation edition www.cutepdf.com

ARN et bioinformatique: PDF processed with CutePDF evaluation edition www.cutepdf.com ARN et bioinformatique: Partie 1 PDF processed with CutePDF evaluation edition www.cutepdf.com Sommaire Principes biologiques : Transcription/traduction, types d ARN, formes primaires/secondaires. Zuker

Plus en détail

Soutenance de mi-stage

Soutenance de mi-stage Supervisée par : Mireille RÉGNIER & Yann PONTY 30 juin 2015 1/29 1 Structure 3D de l ARN et objectifs Notions sur la structure 3D de l ARN Intérêts de la comparaison de structures 3D Qu est ce que la comparaison

Plus en détail

Utilisation des diagrammes de Voronoï et des algorithmes génétiques pour l'étude des complexes protéine-protéine.

Utilisation des diagrammes de Voronoï et des algorithmes génétiques pour l'étude des complexes protéine-protéine. Utilisation des diagrammes de Voronoï et des algorithmes génétiques pour l'étude des complexes protéine-protéine. Anne Poupon Biologie et Bioinformatique des Systèmes de Signalisation INRA - Nouzilly France

Plus en détail

Structure secondaire d une molécule d ARNt. Groupe de travail : BATUT Bérénice, BLEIN Sophie, CHEVALIER Manuel, PARISOT Nicolas et VERNISSE Léa

Structure secondaire d une molécule d ARNt. Groupe de travail : BATUT Bérénice, BLEIN Sophie, CHEVALIER Manuel, PARISOT Nicolas et VERNISSE Léa Structure secondaire d une molécule d ARNt Groupe de travail : BATUT Bérénice, BLEIN Sophie, CHEVALIER Manuel, PARISOT Nicolas et VERNISSE Léa Plan Généralités sur l ARN Moyens de prédiction des structures

Plus en détail

Enjeux de la biologie haut débit en oncologie

Enjeux de la biologie haut débit en oncologie Enjeux de la biologie haut débit en oncologie Pascal BARBRY, CNRS, Sophia Antipolis o Les technologies haut-débit ont enrichi considérablement nos approches quantitatives en biologie. o Des applications

Plus en détail

Les Biolangages. Thierry Lecroq. Université de Rouen FRANCE. university-logo. Thierry Lecroq (Univ. Rouen) MB2 2008 2009 1 / 16

Les Biolangages. Thierry Lecroq. Université de Rouen FRANCE. university-logo. Thierry Lecroq (Univ. Rouen) MB2 2008 2009 1 / 16 Les Biolangages Thierry Lecroq Université de Rouen FRANCE 2008 2009 Thierry Lecroq (Univ. Rouen) MB2 2008 2009 1 / 16 BioPerl Ensemble de modules Perl Utilise la programmation objet L objectif est de mettre

Plus en détail

Recherche par similarité dans les banques/bases de données La suite Blast (Basic Local Alignment Search Tool)

Recherche par similarité dans les banques/bases de données La suite Blast (Basic Local Alignment Search Tool) Recherche par similarité dans les banques/bases de données La suite Blast (Basic Local Alignment Search Tool) A A C T G G T A A C C G A G C T A C G G T C C G Algorithme de Blast (version 1) (Altschul et

Plus en détail

UTILISATION DE LA PLATEFORME WEB D ANALYSE DE DONNÉES GALAXY

UTILISATION DE LA PLATEFORME WEB D ANALYSE DE DONNÉES GALAXY UTILISATION DE LA PLATEFORME WEB D ANALYSE DE DONNÉES GALAXY Yvan Le Bras yvan.le_bras@irisa.fr Cyril Monjeaud, Mathieu Bahin, Claudia Hériveau, Olivier Quenez, Olivier Sallou, Aurélien Roult, Olivier

Plus en détail

Méthodes d apprentissage :

Méthodes d apprentissage : Méthodes d apprentissage : application au tri de complexes protéines-protéines Jérôme Azé Apprentissage: tâches Apprentissage non supervisé (Eisen, ) Apprentissage supervisé (arbres de décision, k-ppv,

Plus en détail

Les NGS en pratique. Quelques slides sur les NGS et leur utilisation... Laurent (travail avec Marta, toujours en cours...)

Les NGS en pratique. Quelques slides sur les NGS et leur utilisation... Laurent (travail avec Marta, toujours en cours...) Quelques slides sur les NGS et leur utilisation... LIFL, Université Lille 1 - INRIA Journées au vert 31 mai - 1er juin 2010 - NEWS FEATURE HUMAN GENOME AT TEN NATURE Vol 464 1 April 2010 NATURE Vol 464

Plus en détail

TD5 : Prédiction de la structure tridimensionnelle d une protéine Modélisation moléculaire

TD5 : Prédiction de la structure tridimensionnelle d une protéine Modélisation moléculaire TD5 : Prédiction de la structure tridimensionnelle d une protéine Modélisation moléculaire Vous aurez besoin des programmes suivant : d un éditeur de séquence d un visualiseur de structure 3D (PyMOL) Avant-propos

Plus en détail

Dans la peau d'un Biologiste Computationnel?

Dans la peau d'un Biologiste Computationnel? Dans la peau d'un Biologiste Computationnel? Plusieurs casquettes : (Nature Biotechnology, Vol. 31, Number 11, Nov. 2013) «- data analyst - data curator - database developer - statistician - mathematical

Plus en détail

Vos traitements bioinformatiques avec GALAXY. Sarah Maman Maria Bernard École Bioinformatique AVIESAN 2015

Vos traitements bioinformatiques avec GALAXY. Sarah Maman Maria Bernard École Bioinformatique AVIESAN 2015 Vos traitements bioinformatiques avec GALAXY Sarah Maman Maria Bernard École Bioinformatique AVIESAN 2015 Galaxy Project Equipe Galaxy project : Le Center for Comparative Genomics and Bioinformatics -

Plus en détail

PRÉSENTATION TRAVAIL EN COURS - APPRENTISSAGE INTERACTIF. Ianis Lallemand, 21 janvier 2013

PRÉSENTATION TRAVAIL EN COURS - APPRENTISSAGE INTERACTIF. Ianis Lallemand, 21 janvier 2013 PRÉSENTATION TRAVAIL EN COURS - APPRENTISSAGE INTERACTIF Ianis Lallemand, 21 janvier 2013 APPRENTISSAGE INTERACTIF definition Contours encore assez flous dans le champ de l apprentissage automatique. Néanmoins,

Plus en détail

Séquençage. Bérénice Batut, berenice.batut@udamail.fr. DUT Génie Biologique Option Bioinformatique Année 2014-2015

Séquençage. Bérénice Batut, berenice.batut@udamail.fr. DUT Génie Biologique Option Bioinformatique Année 2014-2015 Séquençage Bérénice Batut, berenice.batut@udamail.fr DUT Génie Biologique Option Bioinformatique Année 2014-2015 Séquençage Séquençage ADN Détermination de l ordre d enchainement des nucléotides d un fragment

Plus en détail

Bibliographie Introduction à la bioinformatique

Bibliographie Introduction à la bioinformatique Bibliographie Introduction à la bioinformatique 5. Les bases de données biologiques, SQL et la programmation Python/C++ Zvelebil et Baum, Understanding bioinformatics Beighley, Head First SQL Chari, A

Plus en détail

L'analyse protéomique et les sciences -omiques: des données massives à interpréter et sauvegarder

L'analyse protéomique et les sciences -omiques: des données massives à interpréter et sauvegarder L'analyse protéomique et les sciences -omiques: des données massives à interpréter et sauvegarder Christine CARAPITO, Alexandre BUREL, Patrick GUTERL, Alexandre WALTER, Jérôme PANSANEL, Fabrice VARRIER,

Plus en détail

La synthèse des protéines transcription code génétique traduction

La synthèse des protéines transcription code génétique traduction CEC André-Chavanne BIO 3 OS La synthèse des protéines transcription code génétique traduction I. La «Transcription» : de l ADN à l ARNm. L'adresse suivante permet d accéder à une ANIMATION sur la TRANSCRIPTION.

Plus en détail

L exemple de la détermination de la structure cristallographique de la nucléocapside du bluetongue virus

L exemple de la détermination de la structure cristallographique de la nucléocapside du bluetongue virus J. Phys. IV France 130 (2005) 203 207 C EDP Sciences, Les Ulis DOI: 10.1051/jp4:2005130014 L exemple de la détermination de la structure cristallographique de la nucléocapside du bluetongue virus P. Gouet

Plus en détail

MUTATIONS et : Pandémies virales, évolution, génétique, environnement et cancer

MUTATIONS et : Pandémies virales, évolution, génétique, environnement et cancer MUTATIONS et : Pandémies virales, évolution, génétique, environnement et cancer évolution moléculaire ELEMENTS D UN ARBRE PHYLOGENETIQUE RECONSTRUCTION DE L HISTOIRE PAR COMPARAISON DE SEQUENCES (phylogénie

Plus en détail

Quelques termes-clef de biologie moléculaire et leur définition

Quelques termes-clef de biologie moléculaire et leur définition Acide aminé (AA) Quelques termes-clef de biologie moléculaire et leur définition Isabelle Quinkal INRIA Rhône-Alpes Septembre 2003 Petite molécule dont l enchaînement compose les protéines - on dit qu

Plus en détail

La biologie synthétique: enjeux et défis

La biologie synthétique: enjeux et défis Buts de la biologie synthétique La biologie synthétique: enjeux et défis - Créer des microorganismes de synthèse: châssis vivant, de comportement connu (modélisable), modifiable à façon pour des tâches

Plus en détail

Initiation à la Bioinformatique Daniel Gautheret ESIL, Université de la Méditerranée

Initiation à la Bioinformatique Daniel Gautheret ESIL, Université de la Méditerranée Initiation à la Bioinformatique Daniel Gautheret ESIL, Université de la Méditerranée V.2004.4 http://www.esil.univ-mrs.fr/~dgaut/cours Bioinformatique Deux définitions possibles Applications de l informatique

Plus en détail

Optimisation des performances du programme mpiblast pour la parallélisation sur grille de calcul

Optimisation des performances du programme mpiblast pour la parallélisation sur grille de calcul Optimisation des performances du programme mpiblast pour la parallélisation sur grille de calcul Mohieddine MISSAOUI * Rapport de Recherche LIMOS/RR-06-10 20 novembre 2006 * Contact : missaoui@isima.fr

Plus en détail

Calcul intensif pour la biologie

Calcul intensif pour la biologie Calcul intensif pour la biologie PPF Bio-informatique et PPF Calcul intensif 14 juin 2011 Calcul intensif... Cluster : ensemble de machines homogènes et localisées, organisées en grappe Grille : infrastructure

Plus en détail

MARINE GENOMICS BIOLOGY

MARINE GENOMICS BIOLOGY Marine Genomics Réseau d Excellence MARINE GENOMICS BIOLOGY Historique Parmi les indicateurs d évaluation de Génopole Ouest (2004), le volet «génomique marine» devait avoir intégré le PCRD6 Initiative

Plus en détail

Groupe Sarcome Français Génétique et Biologie des Sarcomes U916 Institut Bergonié

Groupe Sarcome Français Génétique et Biologie des Sarcomes U916 Institut Bergonié Groupe Sarcome Français Génétique et Biologie des Sarcomes U916 Institut Bergonié Next Generation Sequencing Bioinformatics - Biology ! Initié en 2008, le programme international ICGC a pour objectif de

Plus en détail

Les microarrays: technologie pour interroger le génome

Les microarrays: technologie pour interroger le génome Les microarrays: technologie pour interroger le génome Patrick DESCOMBES patrick.descombes@frontiers-in-genetics.org Plate forme génomique NCCR Frontiers in Genetics Université de Genève http://genomics.frontiers-in-genetics.org

Plus en détail

L ARN : de la Séquence à la Structure

L ARN : de la Séquence à la Structure Projet Soutenu en 2003 L ARN : de la Séquence à la Structure LE CONTEXTE SCIENTIFIQUE Les grands projets de décryptage des génomes, ainsi que les premières années qui ont vu l'exploitation des données,

Plus en détail

Recherche de parenté entre les vertébrés

Recherche de parenté entre les vertébrés 1 CHAPITRE A Recherche de parenté entre les vertébrés 2 Chapitre A : Recherche de parentés entre les êtres vivants Tous les êtres vivants présentent des structures cellulaires et un fonctionnement commun

Plus en détail

Possédant une double compétence génétique-informatique je recherche un poste de chef de projet en R&D

Possédant une double compétence génétique-informatique je recherche un poste de chef de projet en R&D Philippe MARC Harvard Medical School 200, Longwood avenue, Univ mail 513b Boston MA02115, USA (+001) 617-432-4136 pmarc@genetics.med.harvard.edu http://genetics.med.harvard.edu/~pmarc/ 28 ans, célibataire

Plus en détail

Enjeux des données de la recherche pour l'inra

Enjeux des données de la recherche pour l'inra Enjeux des données de la recherche pour l'inra C. Gaspin1 & O. Hologne2 1 Département de Mathématique et Informatique Appliques INRA Toulouse 2 Délégation Information Scientifique et Technique INRA Versailles

Plus en détail

PRÉSENTATION DE LA BIOINFORMATIQUE

PRÉSENTATION DE LA BIOINFORMATIQUE PRÉSENTATION DE LA BIOINFORMATIQUE O. Collin CNRS IRISA GenOuest 7 octobre 2013 Warming session Poser le décor pour les 3 jours Mise en évidence et mise en relation des éléments clés Réflexions sur quelques

Plus en détail

Présentation ADN Fishbase. Jolien Bamps

Présentation ADN Fishbase. Jolien Bamps Présentation ADN Fishbase Jolien Bamps Les lois de Mendel et la transmission de l hérédité Gregor Mendel Moine et botaniste hongrois (1822-1884), en charge de maintenir le potager de son monastère Considéré

Plus en détail

Corrigé du TD1. Exercice 1:

Corrigé du TD1. Exercice 1: Corrigé du TD1 Exercice 1: le but était d'aligner des séquences à la main et de compter les substitutions entre acides aminés observées. Le résultat se trouve à cette adresse: http://tagc.univ-mrs.fr/herrmann/bio6/displaymatrix.php

Plus en détail

Fida KHATER & Abdoulaziz MOUSSA 03 mars 2012 - Journée Portes Ouvertes à l'um2

Fida KHATER & Abdoulaziz MOUSSA 03 mars 2012 - Journée Portes Ouvertes à l'um2 DEVELOPPEMENT D UNE INTERFACE GRAPHIQUE : LOCAL WEB GUI FOR BLAST (LWBG), POUR LES TRAITEMENTS DE DONNEES BIOLOGIQUES Fida KHATER & Abdoulaziz MOUSSA 03 mars 2012 - Journée Portes Ouvertes à l'um2 Plan

Plus en détail

Etude de la lysine acetyl transferase PCAF dans le développement du diabète et de l'obésité.

Etude de la lysine acetyl transferase PCAF dans le développement du diabète et de l'obésité. Etude de la lysine acetyl transferase PCAF dans le développement du diabète et de l'obésité. Tuteur : Jean-Sébastien Annicotte EGID CNRS UMR8199 Faculté de Médecine-Pôle Recherche, 2eme étage Bd J. Leclercq

Plus en détail

Gènes Diffusion - EPIC 2010

Gènes Diffusion - EPIC 2010 Gènes Diffusion - EPIC 2010 1. Contexte. 2. Notion de génétique animale. 3. Profil de l équipe plateforme. 4. Type et gestion des données biologiques. 5. Environnement Matériel et Logiciel. 6. Analyses

Plus en détail

Obtention de données génétiques à grande échelle

Obtention de données génétiques à grande échelle Obtention de données génétiques à grande échelle Stéphanie FERREIRA Ph.D. Campus de l Institut Pasteur de Lille 1, rue du Professeur Calmette 59000 LILLE Tel : 03 20 87 71 53 Fax : 03 20 87 72 64 contact@genoscreen.fr

Plus en détail

Examen MIS M1 BMC 2012-2013. Rechercher l information : Méthodes de recherche : 3 questions. Jubil : 4 questions

Examen MIS M1 BMC 2012-2013. Rechercher l information : Méthodes de recherche : 3 questions. Jubil : 4 questions Examen MIS M1 BMC 2012-2013 25 questions à 0,8 point chacune. NB : Les réponses sont exactes au mois de décembre 2012. Le nombre de résultats dans les bases de données bibliographiques est susceptible

Plus en détail

La métaphore de l ordinateur estelle appropriée pour décrire les organismes vivants?

La métaphore de l ordinateur estelle appropriée pour décrire les organismes vivants? La métaphore de l ordinateur estelle appropriée pour décrire les organismes vivants? (Stabilisation fonctionnelle sélective) Originalité de la vie Physique: matière, énergie, temps Biologie: Physique +

Plus en détail

Semestre 2 Spécialité «Analyse in silico des complexes macromolécules biologiques-médicaments»

Semestre 2 Spécialité «Analyse in silico des complexes macromolécules biologiques-médicaments» Master In silico Drug Design Semestre 2 Spécialité «Analyse in silico des complexes macromolécules biologiques-médicaments» 30NU01IS INITIATION A LA PROGRAMMATION (6 ECTS) Responsables : D. MESTIVIER,

Plus en détail

IMAGERIE GÉNÉTIQUE : DÉFIS COMPUTATIONNELS ET IMPLÉMENTATION GROS GRAINS SUR CLUSTER

IMAGERIE GÉNÉTIQUE : DÉFIS COMPUTATIONNELS ET IMPLÉMENTATION GROS GRAINS SUR CLUSTER IMAGERIE GÉNÉTIQUE : DÉFIS COMPUTATIONNELS ET IMPLÉMENTATION GROS GRAINS SUR CLUSTER Forum TERATEC Vincent Frouin Déluge de données S Laguitton (CATI-CEA) B damota (INRIA-CEA) 28 JUIN 202 28 JUIN 202 CEA

Plus en détail

AMADEUS PLATE FORME DE SERVICES EN A N N O T A T I O N E X P E R T E D E S GENES ET GENOMES

AMADEUS PLATE FORME DE SERVICES EN A N N O T A T I O N E X P E R T E D E S GENES ET GENOMES EN A N N O T A T I O N E X P E R T E D E S GENES ET GENOMES L annotation des gènes et génomes : une révolution en mouvement... L annotation est une étape essentielle dans la découverte des connaissances

Plus en détail

Cumulo Numbio 2015. La révolution next-generation sequencing et les enjeux de l'expansion de la bioinformatique pour les biologistes.

Cumulo Numbio 2015. La révolution next-generation sequencing et les enjeux de l'expansion de la bioinformatique pour les biologistes. Cumulo Numbio 2015 La révolution next-generation sequencing et les enjeux de l'expansion de la bioinformatique pour les biologistes. Human genome sequence June 26th 2000: official announcement of the completion

Plus en détail

Les technologies de séquençage à haut débit. Patrick Wincker, Genoscope, Institut de Génomique du CEA

Les technologies de séquençage à haut débit. Patrick Wincker, Genoscope, Institut de Génomique du CEA Les technologies de séquençage à haut débit Patrick Wincker, Genoscope, Institut de Génomique du CEA CNG, 12.05.2009 Séquençage Sanger (méthode des dididéoxy terminateurs) : a permis les progrès de la

Plus en détail

Statistique en grande dimension pour la génomique Projets 2014-2015 L. Jacob, F. Picard, N. Pustelnik, V. Viallon

Statistique en grande dimension pour la génomique Projets 2014-2015 L. Jacob, F. Picard, N. Pustelnik, V. Viallon Statistique en grande dimension pour la génomique Projets 2014-2015 L. Jacob, F. Picard, N. Pustelnik, V. Viallon Table des matières 1 Graph Kernels for Molecular Structure-Activity Relationship Analysis

Plus en détail

Statistiques Multivariées pour la Bioinformatique. Susan Holmes, Stanford, susan@stat.stanford.edu

Statistiques Multivariées pour la Bioinformatique. Susan Holmes, Stanford, susan@stat.stanford.edu BMM 1 Presentation Statistiques Multivariées pour la Bioinformatique Susan Holmes, Stanford, susan@stat.stanford.edu Specificités de cette classe Les données genetiques sont discretes: comptage. En general

Plus en détail

Institut de Génomique. olaso@cng.fr

Institut de Génomique. olaso@cng.fr Institut de Génomique PCR quantitative : état des lieux... (de la théorie à la pratique, MIQE, CQ et stratégie de normalisation) olaso@cng.fr Microarray data qpcr data? Règles générales pour la présentation

Plus en détail

Base de données bibliographiques Pubmed-Medline

Base de données bibliographiques Pubmed-Medline Chapitre 1 ; Domaine 1 ; Documentation ; Champs référentiels 1.1.1, 1.1.2 et 1.1.3 Base de données bibliographiques Pubmed-Medline D r Patrick Deschamps,, 30 mai 2007 PLAN C2i métiers de la santé Introduction

Plus en détail

NOTICE-OF-INTENT TO APPLY FOR A CLINICAL RESEARCH GRANT (October 2014) / PRÉAVIS DEMANDE DE SUBVENTION DE RECHERCHE CLINIQUE (octobre 2014)

NOTICE-OF-INTENT TO APPLY FOR A CLINICAL RESEARCH GRANT (October 2014) / PRÉAVIS DEMANDE DE SUBVENTION DE RECHERCHE CLINIQUE (octobre 2014) NOTICE-OF-INTENT TO APPLY FOR A CLINICAL RESEARCH GRANT (October 2014) / PRÉAVIS DEMANDE DE SUBVENTION DE RECHERCHE CLINIQUE (octobre 2014) The deadline for receipt of a notice-of-intent to apply is Monday,

Plus en détail

ALIGNEMENT PLUS RAPIDE

ALIGNEMENT PLUS RAPIDE ALIGNEMENT PLUS RAPIDE 1. méthodes heuristiques : hachage, arbres de suffixe, PD limitée (taille totale de trous bornée) 2. PD éparse (pour sous-séquence commune ou chaînage en alignement global heuristique)

Plus en détail

Introduction à l analyse statistique et bioinformatique des puces à ADN

Introduction à l analyse statistique et bioinformatique des puces à ADN Formation INSERM 10 février 2004 Introduction à l analyse statistique et bioinformatique des puces à ADN Gaëlle Lelandais lelandais@biologie.ens.fr 1 Première Partie Analyse d une puce à ADN : Le recherche

Plus en détail

connaissances «intéressantes» ou des motifs (patterns) à partir d une grande quantité de données.

connaissances «intéressantes» ou des motifs (patterns) à partir d une grande quantité de données. Data Mining = Knowledge Discovery in Databases (KDD) = Fouille de données 1 Définition : Processus ou méthode qui extrait des connaissances «intéressantes» ou des motifs (patterns) à partir d une grande

Plus en détail

On Optimal Bidding Strategy Modeling in the Context of a Liberalized Electricity Market

On Optimal Bidding Strategy Modeling in the Context of a Liberalized Electricity Market On Optimal Bidding Strategy Modeling in the Context of a Liberalized Electricity Market THÈSE N O 3948 (2007) PRÉSENTÉE le 30 novembre 2007 À LA FACULTÉ DES SCIENCES ET TECHNIQUES DE L'INGÉNIEUR Laboratoire

Plus en détail

Registryof Hematological Malignanciesof the Côte d Or area : Pr Marc Maynadié

Registryof Hematological Malignanciesof the Côte d Or area : Pr Marc Maynadié Registryof Hematological Malignanciesof the Côte d Or area : aspecializedregistry Pr Marc Maynadié Côte d Or department ~530 000 inhabitants 70% urban pop 30% rural pop 6342 cases registered Period covered:

Plus en détail

Intégration de données multiples générées

Intégration de données multiples générées Intégration de données multiples générées par les techniques à haut débit (séquençage, CGH, SNP, transcriptome ) Pascal Roy 1 MD-PhD, Caroline Truntzer PhD 2, Delphine Maucort-Boulch 1 MD-PhD 1 Equipe

Plus en détail

D. Locker Professeur émérite Université d Orléans

D. Locker Professeur émérite Université d Orléans Le séquençage du génome Humain : Comment a-t-il été séquencé? Que nous apprend la séquence? Et après? D. Locker Professeur émérite Université d Orléans Résumé L ADN contenu dans nos 23 paires de chromosomes

Plus en détail

Institut Français de Bioinformatique (IFB) : mettre en place une infrastructure informatique dédiée aux sciences de la vie

Institut Français de Bioinformatique (IFB) : mettre en place une infrastructure informatique dédiée aux sciences de la vie 1 / 1 Institut Français de Bioinformatique (IFB) : mettre en place une infrastructure informatique dédiée aux sciences de la vie J-F. Gibrat Unité Mathématique, Informatique et Génome, INRA, Jouy-en-Josas

Plus en détail

Les besoins de la communauté des sciences de la vie en termes d infrastructure informatique

Les besoins de la communauté des sciences de la vie en termes d infrastructure informatique 1 / 31 Les besoins de la communauté des sciences de la vie en termes d infrastructure informatique J-F. Gibrat Unité Mathématique, Informatique et Génome, INRA, Jouy-en-Josas Séminaire IDRIS, Orsay, 14

Plus en détail

Virginie Bernard. Site professionnel http://v.bernard.bioinfo.free.fr

Virginie Bernard. Site professionnel http://v.bernard.bioinfo.free.fr CMMT - Room 3109 950 West 28 th Avenue Vancouver V5Z 4H4 CANADA Virginie Bernard Site professionnel http://v.bernard.bioinfo.free.fr Email v.bernard.bioinfo@gmail.com Chercheur en Bioinformatique Objectifs:

Plus en détail

Galaxy Training days. Liste des sessions disponibles : http://bioinfo.genotoul.fr. Les formateurs :

Galaxy Training days. Liste des sessions disponibles : http://bioinfo.genotoul.fr. Les formateurs : -- 1 -- Galaxy Training days Durée / Programme : 3 journées. Galaxy : First step. Galaxy : Reads alignment and SNP calling. Galaxy : RNAseq alignment and transcripts assemblies. Public : Personnes souhaitant

Plus en détail

Séquençage haut débit 5 mars 26 mars (14h) C. Gaspin, C. Klopp, J. Mariette & G. Salin

Séquençage haut débit 5 mars 26 mars (14h) C. Gaspin, C. Klopp, J. Mariette & G. Salin Séquençage haut débit 5 mars 26 mars (14h) C. Gaspin, C. Klopp, J. Mariette & G. Salin Plan de la session Bioinformatique & séquençage haut débit Date Intervenant (s) Libellé 05/03 G. Salin Introduction

Plus en détail

Progenesis LC-MS and Phenyx

Progenesis LC-MS and Phenyx Progenesis LC-MS and Phenyx Une combinaison unique d un logiciel d analyse différentielle en LC-MS et d une plateforme d identification et de caractérisation de protéines et peptides à partir de données

Plus en détail

THÈME 3 : DU GÉNOTYPE AU PHÉNOTYPE. CHAPITRE 1 : la relation entre ADN et protéines

THÈME 3 : DU GÉNOTYPE AU PHÉNOTYPE. CHAPITRE 1 : la relation entre ADN et protéines THÈME 3 : DU GÉNOTYPE AU PHÉNOTYPE CHAPITRE 1 : la relation entre ADN et protéines Les caractères d un individu dépendent de plusieurs facteurs : certains dépendent des caractères présents dans la famille

Plus en détail

Silene latifolia (Caryophyllaceae) sex chromosome evolution

Silene latifolia (Caryophyllaceae) sex chromosome evolution Diss. ETH N 20391 Silene latifolia (Caryophyllaceae) sex chromosome evolution A dissertation submitted to ETH ZURICH for the degree of DOCTOR OF SCIENCES presented by Nicolas Blavet Master of Science in

Plus en détail

CHAPITRE 4 - LA COMPLEXITÉ DES RELATIONS ENRE GÈNES, PHÉNOTYPES ET ENVIRONNEMENT

CHAPITRE 4 - LA COMPLEXITÉ DES RELATIONS ENRE GÈNES, PHÉNOTYPES ET ENVIRONNEMENT CHAPITRE 4 - LA COMPLEXITÉ DES RELATIONS ENRE GÈNES, PHÉNOTYPES ET ENVIRONNEMENT Introduction Tous les individus de la même espèce possèdent le même patrimoine génétique, cependant chaque individu est

Plus en détail

Modélisation coalescente pour la détection précoce d un cancer

Modélisation coalescente pour la détection précoce d un cancer Modélisation coalescente pour la détection précoce d un cancer Mathieu Emily 27 Novembre 2007 Bioinformatics Research Center - Université d Aarhus Danemark Mathieu Emily Coalescence et cancer 1 Introduction

Plus en détail

La nutrigénomique: l avenir en nutrition animale

La nutrigénomique: l avenir en nutrition animale La nutrigénomique: l avenir en nutrition animale Yves Tarte, dmv Vétérinaire chargé du développement vétérinaire Hill s Pet Nutrition Canada Inc A.T.S.A.Q. Février 2009 La nutrigénomique Science toute

Plus en détail

! Séquence et structure des macromolécules. " Séquences protéiques (UniProt) " Séquences nucléotidiques (EMBL / ENA, Genbank, DDBJ)

! Séquence et structure des macromolécules.  Séquences protéiques (UniProt)  Séquences nucléotidiques (EMBL / ENA, Genbank, DDBJ) Introduction à la Bioinformatique Introduction! Les bases de données jouent un rôle crucial dans l organisation des connaissances biologiques.! Nous proposons ici un tour rapide des principales bases de

Plus en détail

Études par diffraction de fibres de l ADN double brin

Études par diffraction de fibres de l ADN double brin J. Phys. IV France 130 (2005) 63 74 C EDP Sciences, Les Ulis DOI: 10.1051/jp4:2005130004 Études par diffraction de fibres de l ADN double brin V.T. Forsyth 1,2 et I.M. Parrot 1,2 1 Institut Laue Langevin,

Plus en détail

Cartographie génomique comparée chez les mammifères Gisèle Bronner, Bruno Spataro, Christian Gautier

Cartographie génomique comparée chez les mammifères Gisèle Bronner, Bruno Spataro, Christian Gautier MEDECINE/SCIENCES 2002 ; 18 : 767-74 > La cartographie comparée est une analyse comparative de l organisation chromosomique des génomes, qui repose sur l exploitation de la biodiversité dans le double

Plus en détail

VI. Domaines protéiques

VI. Domaines protéiques Chapitre 1 Structure des protéines I. Rappels Définitions II. La Protein Data Bank (PDB) III. Angles dièdres et diagramme de ramachandran IV. Structures secondaires V. Structures supersecondaires VI. Domaines

Plus en détail

Lettres: A, T, G, C. Mots: à 3 lettres (codons) Phrase: gène (information pour synthétiser une protéine). Ponctuation

Lettres: A, T, G, C. Mots: à 3 lettres (codons) Phrase: gène (information pour synthétiser une protéine). Ponctuation 2- Les molécules d ADN constituent le génome 2-1 La séquence d ADN représente l information génétique Lettres: A, T, G, C Mots: à 3 lettres (codons) Phrase: gène (information pour synthétiser une protéine).

Plus en détail

Simon Lacoste-Julien Chercheur CR Équipe-Projet SIERRA, INRIA - École Normale Supérieure

Simon Lacoste-Julien Chercheur CR Équipe-Projet SIERRA, INRIA - École Normale Supérieure Simon Lacoste-Julien Chercheur CR Équipe-Projet SIERRA, INRIA - École Normale Supérieure Keyrus 11 septembre 2014 Mot tendance pour décrire *beaucoup* de données! Buzz: Google Trends search terms volume

Plus en détail

Anaïs BARDET. Inférence d'un réseau de régulation génétique par la méthode des réseaux bayésiens

Anaïs BARDET. Inférence d'un réseau de régulation génétique par la méthode des réseaux bayésiens Master 1 Biologie Informatique Université Paris 7 - Denis Diderot Rapport de stage de Master 1 par : Anaïs BARDET Inférence d'un réseau de régulation génétique par la méthode des réseaux bayésiens Stage

Plus en détail

L ANALYSE DE DONNÉES AU SERVICE DES UTILISATEURS. Lorène Allano 16 Avril 2013

L ANALYSE DE DONNÉES AU SERVICE DES UTILISATEURS. Lorène Allano 16 Avril 2013 L ANALYSE DE DONNÉES AU SERVICE DES UTILISATEURS Lorène Allano 16 Avril 2013 Question? Expert Aide à la décision Expériences Digitalisation Analyse automatique Visualisation Outils adapté Données numériques

Plus en détail

Protéines, hétéropolymères et systèmes désordonnés

Protéines, hétéropolymères et systèmes désordonnés Protéines, hétéropolymères et systèmes désordonnés Thomas Guérin Master M2 SDSMC Systèmes Dynamiques et statistiques de la matière complexe Parcours PTSC Physique théorique des systèmes complexes Cours

Plus en détail

Laurie Casalot. Bacteria Archaea

Laurie Casalot. Bacteria Archaea Analyses des populations bactériennes à l aide des techniques moléculaires Bacteria Archaea Laurie Casalot Institut Méditerranéen d Océanologie (MIO) Laboratoire de Microbiologie Environnementale et Biotechnologie

Plus en détail

Module Analyse de Génomes 2011-2012 Master 2 module FMBS 326 Immunoinformatique

Module Analyse de Génomes 2011-2012 Master 2 module FMBS 326 Immunoinformatique Module Analyse de Génomes 2011-2012 Master 2 module FMBS 326 Immunoinformatique Planning du Module : Date Heure Salle 12/12 9h-12h TD info TA1Z bat 25 13h-17h TD info TA1Z bat 25 13/12 9h-12h TD info TA1Z

Plus en détail

Du microscope. aux microarrays. le "saut de puce" de la cytogénétique

Du microscope. aux microarrays. le saut de puce de la cytogénétique Du microscope le "saut de puce" aux microarrays de la cytogénétique ARL 13 mars 2008 Dr Danielle Martinet Spéc. FAMH en analyses de génétique médicale Laboratoire de cytogénétique constitutionnelle Service

Plus en détail

TD 1 Biais de codons

TD 1 Biais de codons Module LV348 Version enseignant TD 1 page 1/7 TD 1 Biais de codons Revu dernièrement par Mathilde Carpentier, Cyril Gallut et Joël Pothier Version du 15 janvier 2014 L objectif de ce TP est de prendre

Plus en détail

PANDORA database: a compilation of indoor air pollutant emissions

PANDORA database: a compilation of indoor air pollutant emissions PANDORA database: a compilation of indoor air pollutant emissions Marc O. Abadie and Patrice Blondeau LEPTIAB University of La Rochelle, France Corresponding email: mabadie@univ-lr.fr 1 Scope Context Modeling

Plus en détail

Master de Bioinformatique et Biologie des Systèmes Toulouse http://m2pbioinfo.biotoul.fr Responsable : Pr. Gwennaele Fichant

Master de Bioinformatique et Biologie des Systèmes Toulouse http://m2pbioinfo.biotoul.fr Responsable : Pr. Gwennaele Fichant Master de Bioinformatique et Biologie des Systèmes Toulouse http://m2pbioinfo.biotoul.fr Responsable : Pr. Gwennaele Fichant Parcours: Master 1 : Bioinformatique et biologie des Systèmes dans le Master

Plus en détail

HapMap. sur HapMap. Le projet international

HapMap. sur HapMap. Le projet international Nouvelles sur HapMap Une Publication du Coriell Institute for Medical Research, Volume 1, 2004 Le projet international HapMap Le développement d une nouvelle ressource appelée la carte haplotype ou HapMap

Plus en détail

Ekaterina VOLTCHKOVA

Ekaterina VOLTCHKOVA Ekaterina VOLTCHKOVA Née le 27 avril 1978, nationalité française et russe, mariée, 2 enfants Adresse professionnelle : GREMAQ, 21, allée de Brienne, 31000 Toulouse, France Tél. : +33.5.61.12.85.67 E-mail

Plus en détail

http://sigenae-workbench.toulouse.inra.fr

http://sigenae-workbench.toulouse.inra.fr -- 1 -- Vos traitements bioinformatiques avec GALAXY DOKEOS http://sigenae-workbench.toulouse.inra.fr -- 2 -- Galaxy pour vos traitements (bio)informatiques Vidéo disponible sur «sig-learning» Présentation

Plus en détail

STATION 1A Plateforme de séquençage de nouvelle génération

STATION 1A Plateforme de séquençage de nouvelle génération STATION 1A Plateforme de séquençage de nouvelle génération Dr JACQUES SIMARD Le mandat de cette plateforme est d offrir l expertise à la fine pointe de la technologie afin de générer des données de séquence

Plus en détail

e-biogenouest CNRS UMR 6074 IRISA-INRIA / Plateforme de Bioinformatique GenOuest yvan.le_bras@irisa.fr Programme fédérateur Biogenouest co-financé

e-biogenouest CNRS UMR 6074 IRISA-INRIA / Plateforme de Bioinformatique GenOuest yvan.le_bras@irisa.fr Programme fédérateur Biogenouest co-financé e-biogenouest Coordinateur : Olivier Collin Animateur : Yvan Le Bras CNRS UMR 6074 IRISA-INRIA / Plateforme de Bioinformatique GenOuest yvan.le_bras@irisa.fr Programme fédérateur Biogenouest co-financé

Plus en détail

CERTIFICAT DE COMPÉTENCES EN BIO-INFORMATIQUE

CERTIFICAT DE COMPÉTENCES EN BIO-INFORMATIQUE CERTIFICAT DE COMPÉTENCES EN BIO-INFORMATIQUE Organisé par l équipe pédagogique : Statistique bioinformatique du département IMATH Responsable de la formation : Pr. Jean-François Zagury Coordinateur des

Plus en détail

Data Mining. Rapport de Projet

Data Mining. Rapport de Projet Université Bordeaux I 2011 Nicolas FONTAINE Florence MAURIER Jonathan MERCIER Data Mining Rapport de Projet M2 Bioinformatique Responsable : P. Desbarat Table des matières Introduction 1 1 Choix des données

Plus en détail