La bio-quoi??? Introduction à la Bioinformatique. Propriétés et modèles? Propriétés et modèles? cycle cellulaire

Dimension: px
Commencer à balayer dès la page:

Download "La bio-quoi??? Introduction à la Bioinformatique. Propriétés et modèles? Propriétés et modèles? cycle cellulaire"

Transcription

1 Introduction à la Bioinformatique 1. Motivation et objectifs Définition simple: La bio-quoi??? La bioinformatique est l analyse des données biologiques pour : 1.l identification des propriétés intéressantes et 2.la construction des modèles biologiques en utilisant ses données. 1 2 Propriétés et modèles? Propriétés et modèles? Cancer l autisme alzheimer cycle cellulaire Cancer l autisme alzheimer cycle cellulaire Quelles sont les données importantes pour les biologistes?

2 Les données La structure des données ADN strings...ttgtacatctctatctacttatcgtctagcagcagc TACTGATCGTAGTCTCGTGATCCTAGTCATTCATGCTAC TATCGATGCAGTCGATCGTAATCGGCGTAGTAGCGCCGG GTGTCATATATAGCCTCTAGCGCTAGCAGCTGATCGATC TAGTCGTTCATGTCGATGCAGCTAGTCTAGTCGTATCTA TACTAGCGACGATGCTAGCGTACGTAGCTATATAGCTAC TCTGATATACTGCCGCTAGTACGTACTGCAGCAGCTGAC TGCTGACTGCTGACTGACGTAGCTGACATTCATGCTAGC TAGCTTACATCGCGATCGTAGCTAGCGATCGTACGTAGC GCCTAGCGGTACTTGCGATCGTAGCTGCTGTAGTCGATT GTGCGATAGTCACTGTGCAGTCAGTCGATCGATCGACTG ACTGACGTCGACTGATCGACTGACTGACTGACTGACTGC ATGTCGTCGACTGACTGACGCTGCAGCTGACTGCATGAC GTCGACTGATGACTGACTGCGCGTCAGCTGACTGACTGA CTGACTGACTGTCAGTGACTGACTGACTGACTGACG... Tous les organismes connus utilisent 2 types de données : 1. séquences de nucléotides 2. séquences d acides aminés séquences d acides nucléiques Et leurs structures 3D 4 5 La structure des données 2 La structure des données 3 Protéines strings l ADT Atome (x,y,z) Protéines EARSLTTGET GYIPSNYVAP VDSIQAEEWY FGKLGRKDAE RQLLSFGNPR GTFLIRESQT TKGAYSLSIR DWDDMKGDHV KHYKIRKLDN GGYYITTRAQ FETLQQLVQH YSERAAGLCC RLVVPCHKGM PRLTDLSVKT KDVWEIPRES LQLIKRLGNG QFGEVWLGTW NGNTKVAIKT séquences d acides aminés séquences de cordonnées d atomes 6 7

3 Explosion de données Uniprot/swissprot statistiques Release 174.0, oct 2009, paires de base et séquences Release 57.11, Novembre séquences Explosion de données 2 Nombre des structures de protéines RCSB protéine base de données version de 3 décembre Explosion de données 3 Explosion de données 4 ça ne termine pas... ExAC Rusch DB, Halpern AL, Sutton G, Heidelberg KB, Williamson S, et al. (2007) The Sorcerer II Global Ocean Sampling Expedition: Northwest Atlantic through Eastern Tropical Pacific. PLoS Biol 5(3): e77 10 Source: Source: ENCODE Project Consortium. "The ENCODE (ENCyclopedia of DNA elements) project." Science (2004): Lek M, et al. Analysis of protein-coding genetic variation in 60,706 humans. Nature. August 18, DOI: /

4 On a les données......ttgtacatctctatctacttatcgtctagcagcagc TACTGATCGTAGTCTCGTGATCCTAGTCATTCATGCTAC TATCGATGCAGTCGATCGTAATCGGCGTAGTAGCGCCGG GTGTCATATATAGCCTCTAGCGCTAGCAGCTGATCGATC TAGTCGTTCATGTCGATGCAGCTAGTCTAGTCGTATCTA TACTAGCGACGATGCTAGCGTACGTAGCTATATAGCTAC TCTGATATACTGCCGCTAGTACGTACTGCAGCAGCTGAC TGCTGACTGCTGACTGACGTAGCTGACATTCATGCTAGC TAGCTTACATCGCGATCGTAGCTAGCGATCGTACGTAGC GCCTAGCGGTACTTGCGATCGTAGCTGCTGTAGTCGATT GTGCGATAGTCACTGTGCAGTCAGTCGATCGATCGACTG ACTGACGTCGACTGATCGACTGACTGACTGACTGACTGC ATGTCGTCGACTGACTGACGCTGCAGCTGACTGCATGAC GTCGACTGATGACTGACTGCGCGTCAGCTGACTGACTGA CTGACTGACTGTCAGTGACTGACTGACTGACTGACG et maintenant?...ttgtacatctctatctacttatcgtctagcagcagc TACTGATCGTAGTCTCGTGATCCTAGTCATTCATGCTAC TATCGATGCAGTCGATCGTAATCGGCGTAGTAGCGCCGG GTGTCATATATAGCCTCTAGCGCTAGCAGCTGATCGATC TAGTCGTTCATGTCGATGCAGCTAGTCTAGTCGTATCTA TACTAGCGACGATGCTAGCGTACGTAGCTATATAGCTAC TCTGATATACTGCCGCTAGTACGTACTGCAGCAGCTGAC TGCTGACTGCTGACTGACGTAGCTGACATTCATGCTAGC TAGCTTACATCGCGATCGTAGCTAGCGATCGTACGTAGC GCCTAGCGGTACTTGCGATCGTAGCTGCTGTAGTCGATT GTGCGATAGTCACTGTGCAGTCAGTCGATCGATCGACTG ACTGACGTCGACTGATCGACTGACTGACTGACTGACTGC ATGTCGTCGACTGACTGACGCTGCAGCTGACTGCATGAC GTCGACTGATGACTGACTGCGCGTCAGCTGACTGACTGA CTGACTGACTGTCAGTGACTGACTGACTGACTGACG Le rôle joué par informatique Le rôle joué par l informatique Y a-t-il des protéines...ttgtacatctctatctacttatcgtctagcagcagcta Ou sont les gènes? CTGATCGTAGTCTCGTGATCCTAGTCATTCATGCTACTATC GATGCAGTCGATCGTAATCGGCGTAGTAGCGCCGGGTGTCA TATATAGCCTCTAGCGCTAGCAGCTGATCGATCTAGTCGTT CATGTCGATGCAGCTAGTCTAGTCGTATCTATACTAGCGAC Comment GATGCTAGCGTACGTAGCTATATAGCTACTCTGATATACTG l expression est-elle CCGCTAGTACGTACTGCAGCAGCTGACTGCTGACTGCTGAC Y a-t-il des gènes contrôlée? TGACGTAGCTGACATTCATGCT EWY FGKLGRKDAE RQLLSFGNPR GTFLIRESQT 19 TKGAYSLSIR DWDDMKGDHV KHYKIRKLDN 22 GGYYITTRAQ FETLQQLVQH YSERAAGLCC 14...TTGTACATCTCTATCTACTTATCGTCTAGCAGCAGCTA Ou sont les gènes? CTGATCGTAGTCTCGTGATCCTAGTCATTCATGCTACTATC GATGCAGTCGATCGTAATCGGCGTAGTAGCGCCGGGTGTCA TATATAGCCTCTAGCGCTAGCAGCTGATCGATCTAGTCGTT CATGTCGATGCAGCTAGTCTAGTCGTATCTATACTAGCGAC Comment GATGCTAGCGTACGTAGCTATATAGCTACTCTGATATACTG l expression est-elle CCGCTAGTACGTACTGCAGCAGCTGACTGCTGACTGCTGAC Y a-t-il des gènes contrôlée? TGACGTAGCTGACATTCATGCT... Quelles sont les protéines? EWY FGKLGRKDAE RQLLSFGNPR GTFLIRESQT TKGAYSLSIR DWDDMKGDHV KHYKIRKLDN GGYYITTRAQ FETLQQLVQH YSERAAGLCC RLVVP Quels sont les acides aminés importants? 15

5 Le rôle joué par informatique Le rôle joué par informatique Y a-t-il des protéines...ttgtacatctctatctacttatcgtctagcagcagcta Ou sont les gènes? CTGATCGTAGTCTCGTGATCCTAGTCATTCATGCTACTATC GATGCAGTCGATCGTAATCGGCGTAGTAGCGCCGGGTGTCA TATATAGCCTCTAGCGCTAGCAGCTGATCGATCTAGTCGTT CATGTCGATGCAGCTAGTCTAGTCGTATCTATACTAGCGAC Comment GATGCTAGCGTACGTAGCTATATAGCTACTCTGATATACTG l expression est-elle CCGCTAGTACGTACTGCAGCAGCTGACTGCTGACTGCTGAC Y a-t-il des gènes contrôlée? TGACGTAGCTGACATTCATGCT... Quelles sont les protéines? EWY FGKLGRKDAE RQLLSFGNPR GTFLIRESQT TKGAYSLSIR DWDDMKGDHV KHYKIRKLDN GGYYITTRAQ FETLQQLVQH YSERAAGLCC RLVVP Quels sont les acides aminés importants? Y a-t-il des protéines...ttgtacatctctatctacttatcgtctagcagcagcta Ou sont les gènes? CTGATCGTAGTCTCGTGATCCTAGTCATTCATGCTACTATC GATGCAGTCGATCGTAATCGGCGTAGTAGCGCCGGGTGTCA TATATAGCCTCTAGCGCTAGCAGCTGATCGATCTAGTCGTT CATGTCGATGCAGCTAGTCTAGTCGTATCTATACTAGCGAC Comment GATGCTAGCGTACGTAGCTATATAGCTACTCTGATATACTG l expression est-elle CCGCTAGTACGTACTGCAGCAGCTGACTGCTGACTGCTGAC Y a-t-il de gènes contrôlée? TGACGTAGCTGACATTCATGCT... Ce qui est la structure d une protéine? Quelles sont les protéines? EWY FGKLGRKDAE RQLLSFGNPR GTFLIRESQT TKGAYSLSIR DWDDMKGDHV KHYKIRKLDN GGYYITTRAQ FETLQQLVQH YSERAAGLCC RLVVP Quels sont les acides aminés importants? Ce qui est la structure d une protéine? Quelles sont les partenaires d interaction? Ce qui sont les régularités? Ce qui sont les régularités? Est-ce que il existe une préférence? Est-ce que il existe une préférence? Est-ce que le gène est lié à une certaine maladie? Ce qui est la fonction d une protéine? Où peut une autre protéine être lier? 16 Objectifs du cours Où peut une autre protéine être lier? 17 Référence Part 1: Background Basics 1. The Nucleic Acid World 2. Protein Structure 3. Dealing with Databases Comprendre la vocabulaire biologique et bioinformatique les questions moléculaire et les techniques Comprendre bioinformatiques qui ont résolus ces questions. Part 2: Sequence Alignments 4. Producing and Analyzing Sequence Alignments 5. Pairwise Sequence Alignment and Database Searching 6. Patterns, Profiles, and Multiple Alignments Part 3: Evolutionary Processes 7. Recovering Evolutionary History 8. Building Phylogenetic Trees Être capable d expliquer et reproduire certaines algorithmes capable de choisir entre les algorithmes connus pour résoudre Être un problème moléculair Part 4: Genome Characteristics 9. Revealing Genome Features 10. Gene Detection and Genome Annotation Part 5: Secondary Structures 11. Obtaining Secondary Structure from Sequence 12. Predicting Secondary Structures Être capable de créer un nouveau algorithme qui peut résoudre Part 6: Tertiary Structures 13. Modeling Protein Structure 14. Analyzing Structure-Function Relationships une certaine question biomoléculaire Comprendre les publications dans le domaine. Augmentez votre intérêt pour des autres sciences et la Part 7: Cells and Organisms 15. Proteome and Gene Expression Analysis 16. Clustering Methods and Statistics 17. Systems Biology Appendices: Background Theory Appendix A. Probability, Information, and Bayesian Analysis Appendix B. Molecular Energy Functions Appendix C. Function Optimization recherche interdisciplinaire Site web: Marketa Zvelebil, Jeremy O. Baum. Understanding Bioinformatics August 2007 Paperback:

6 Cartes de compréhension Organigrammes L application montré ici est composé de 4 sujets les notions qui étaient expliquées dans les sections précédentes Une carte de la structure du chapitre: sujets et leurs relations les nouvelles notions qui sont expliquées dans la section suivante Chaque chapitre commence avec une carte de compréhension un outil pour visualiser et se rappeler les étapes qui sont nécessaire pour certaines applications. les flèches montrent comment les notions sont relatées Les sections dans chaque chapitre commence avec un organigramme. un outil pour visualiser et se rappeler les sujets couverts dans cette section Programme (provisoire) Date Description Portfolio Livre 19 septembre 2016 Pas de cours 26 septembre 2016 Introduction/Fondations moléculaire octobre 2016 Fondations moléculaire/alignement des séquences octobre 2016 alignement des séquences Jupyter+ P octobre 2016 Matrices de substitution P1+P octobre 2016 Trouver des séquences homologues P octobre novembre 2016 Date limite P1 et P2 14 novembre 2016 Alignement de groupes de séquences novembre 2016 Hidden markov models and Profiles P novembre 2016 Structures secondaires P3+P décembre 2016 Arbres phylogénétiques P décembre décembre 2016 Date limite P3 et P4 Organisation Chaque lundi entre 10h et 12h Local?? Réunions pour le portfolio: Dr. Catharina Olsen vendredi de 16h à 18h dans 2 NO4.008 Assistance pour les 4 mini projets 22 23

7 Portfolio Chaque étudiant construira pendant l année un portfolio composé de 4 mini projets Un portfolio ou portefolio est un dossier personnel dans lequel les acquis de formation et les acquis de l'expérience d'une personne sont définis et démontrés en vue d'une reconnaissance par un établissement d'enseignement ou un employeur. Utilisant Jupyter notebooks (python) 50% du note final Portfolio Le portfolio sera composé de 4 mini projets 1.Une implémentation de l algorithme Needleman-Wunsch et l algorithme de Smith Waterman qui sera comparée avec le logiciel LALIGN, disponible en ligne (http://www.ch.embnet.org/software/lalign_form.html) 2.Une implémentation de l algorithme BLOSUM construite en utilisant des données liés à deux domaines protéiques differentes. 3.Un algorithme qui construit des PSSM pour des ensembles de séquences alignées et créez un Weblogo. 4.Une implémentation de l algorithme GOR IV pour prédire la structure secondaire des séquences Portfolios Date limite Partie 1; 7 Novembre 2016 Mini projet 1 et 2 Date Limite Partie 2; 19 Décembre 2016 Mini projet 3 et 4 IMPORTANT pour chaque projet vous construisez un jupyter notebook (python) Utilisez des examples pour illustrer votre code Ajoutez des explications: le but du projet, le traitement des données des figures 26 27

8 L examen Examen écrit 17 janvier2016 (9h30-12h) la théorie (transparents et livre) Un exemple est en ligne sur le site web 50% des points Continuation oral après l examen écrit +2 ou -2! Mes coordonnées Tom Lenaerts Bureau : 8ième étage, 2 NO téléphone ULB : 02/ courrier électronique:

Bibliographie. Introduction à la bioinformatique. Objectifs. Préambule: Les cellules. Alberts et al, The molecular biology of the cell

Bibliographie. Introduction à la bioinformatique. Objectifs. Préambule: Les cellules. Alberts et al, The molecular biology of the cell Introduction à la bioinformatique 2. Fondation moléculaire en 66 transparants et 2 vidéos Bibliographie Alberts et al, The molecular biology of the cell Zvelebil et Baum, Understanding bioinformatics (p3.

Plus en détail

AVL Liban La Bioinformatique. Bioinformatique

AVL Liban La Bioinformatique. Bioinformatique AVL Liban 2011 La Sami Khuri Department of Computer Science San José State University San José, California, USA sami.khuri@sjsu.edu www.cs.sjsu.edu/faculty/khuri Sami Khuri sami.khuri@sjsu.edu Qu est-ce

Plus en détail

Introduction à l Analyse des séquences biologiques.

Introduction à l Analyse des séquences biologiques. Introduction à l Analyse des séquences biologiques Christian.Fondrat@dsi.univ-paris5.fr Les outils d analyse de séquences C est QUOI? DES BASES DE DONNEES DES PROGRAMMES Utilitaires (consultation, acquisition

Plus en détail

Alignement de séquences (2/2)

Alignement de séquences (2/2) Alignement de séquences (2/2) Observation à l aide de l outil graphique : le dotplot. Simple, visuel, Très informatif : Permet de repérer une similarité globale Permet de repérer des similarités locales

Plus en détail

Initiation à la Bioinformatique

Initiation à la Bioinformatique Université d Alexandrie Initiation à la Bioinformatique Basic Local Alignment Search Tool BLAST Université d Alexandrie AUF Auteur(s): Mohamed GAD 2009/2010 Auteur(s) : Mohamed GAD Professeur à l institut

Plus en détail

Introduction à la bioinformatique

Introduction à la bioinformatique Faculté des Sciences - Rabat Laboratoire de Microbiologie et Biologie Moléculaire -------------------------------------- Université Mohamed V - Agdal Faculté des Sciences B.P. 1014 - Rabat - MAROC TD Biologie

Plus en détail

Alignement Multiple de séquences

Alignement Multiple de séquences Alignement Multiple de séquences Introduction Alignement multiple = Alignement simultané de plusieurs séquences (Nt ou Prot) Outil essentiel pour : Signatures protéiques Homologie avec une famille de protéines

Plus en détail

A BIOINFORMATIQUE FONCTIONNELLE

A BIOINFORMATIQUE FONCTIONNELLE Biologie moléculaire-2017 1 A BIOINFORMATIQUE FONCTIONNELLE PRÉDIRE LA FONCTION D UNE PROTÉINE INCONNUE Supposons que vous avez trouvé la séquence d'acides aminés d'une protéine inconnue et que vous souhaitez

Plus en détail

Introduction. La bioinformatique : Traitement des informations biologiques par des méthodes informatiques et/ou mathématiques.

Introduction. La bioinformatique : Traitement des informations biologiques par des méthodes informatiques et/ou mathématiques. Introduction La bioinformatique : Traitement des informations biologiques par des méthodes informatiques et/ou mathématiques. Interdisciplinaire par nature, la bioinformatique est fondée sur les acquis

Plus en détail

Master 1 IUP Génomique et Protéomique Examen de GP4 - Bioinformatique

Master 1 IUP Génomique et Protéomique Examen de GP4 - Bioinformatique Master 1 IUP Génomique et Protéomique Examen de GP4 - Bioinformatique Exercice 1 : banques de données. Durée de l épreuve : 2h Documents autorisés Q1) Le schéma ci-dessous représente le nombre d articles

Plus en détail

Plan. Comparaison de 2 séquences. Dotplot, alignement optimal Recherche de similarité. Alignement multiple. Phylogénie moléculaire

Plan. Comparaison de 2 séquences. Dotplot, alignement optimal Recherche de similarité. Alignement multiple. Phylogénie moléculaire Plan 1 Banques de données 2 Comparaison de 2 séquences Dotplot, alignement optimal Recherche de similarité 3 Alignement multiple l 4 Phylogénie moléculaire Recherche de similarité 1 séquence (Query) comparée

Plus en détail

Alignements de deux séquences

Alignements de deux séquences Alignements de deux séquences Informatique Génomique - Master 1 Guillaume Blin IGM-LabInfo UMR 8049, Bureau 4B066 Université de Marne La Vallée gblin@univ-mlv.fr http://igm.univ-mlv.fr/ gblin 2007-08 Plan

Plus en détail

Master en bioinformatique et modélisation, à finalité approfondie

Master en bioinformatique et modélisation, à finalité approfondie Master en bioinformatique et modélisation, à finalité approfondie NB : Ce master est réalisé en collaboration avec la Faculté des Sciences appliquées. (Bloc 0) [ ] Première année (Bloc 1) Le programme

Plus en détail

Alignement de séquences Principes et méthodes. Karim Mezhoud Ir. agronome PhD. Toxicologie, Protéomique, Bioinformatique

Alignement de séquences Principes et méthodes. Karim Mezhoud Ir. agronome PhD. Toxicologie, Protéomique, Bioinformatique lignement de séquences Principes et méthodes Karim Mezhoud Ir. agronome PhD. oxicologie, Protéomique, Bioinformatique entre national des Sciences et echnologies Nucléaires Sidi habet unis Pourquoi analyser

Plus en détail

BIN 1002: INTÉGRATION BIOSCIENCES/INFORMATIQUE

BIN 1002: INTÉGRATION BIOSCIENCES/INFORMATIQUE BIN 1002: INTÉGRATION BIOSCIENCES/INFORMATIQUE Plan de Cours Automne 2015 Professeurs: Sylvie Hamel, Département d Informatique et de Recherche Opérationnelle Guillaume Lettre, Institut de Cardiologie

Plus en détail

Alignements de séquences

Alignements de séquences de séquences Problématique Matrices de points Distance d édition + calcul d un alignement optimal Qu est-ce qu une distance Méthode naïve: énumération de tous les alignements possibles Programmation dynamique

Plus en détail

Alignement de séquences

Alignement de séquences Bioinformatique appliquée ours lignement de séquences principes un algorithme d'alignement: programmation dynamique alignement global, alignement local -- Les comparaisons de séquences DOPLO j'ai séquences,

Plus en détail

éléments répétés gènes des ARN stables (ARNr, ARNt) gènes protéiques Nb de gènes, taille du génome et complexité pseudogènes régions régulatrices

éléments répétés gènes des ARN stables (ARNr, ARNt) gènes protéiques Nb de gènes, taille du génome et complexité pseudogènes régions régulatrices Plan 3. Annotation des génomes a) Annotation structurale : localisation des éléments génétiques éléments répétés gènes des ARN stables (ARNr, ARNt) gènes protéiques Nb de gènes, taille du génome et complexité

Plus en détail

Bibliographie. Introduction à la bioinformatique. Quoi? Objectifs. Comment représenter des relations (évolutifs) entre des séquences?

Bibliographie. Introduction à la bioinformatique. Quoi? Objectifs. Comment représenter des relations (évolutifs) entre des séquences? Introduction à la bioinformatique La construction des arbres phylogénétiques Bibliographie Zvelebil et Baum, Understanding bioinformatics 1 2 Objectifs Quoi? Être capable d expliquer les types de différents

Plus en détail

Chapitre 4 : un regard sur l'évolution de l'homme Objectif : l'évolution de l'homme - B2I

Chapitre 4 : un regard sur l'évolution de l'homme Objectif : l'évolution de l'homme - B2I Objectif : l'évolution de l'homme - B2I Observation : l Homme (Homo sapiens) a une histoire évolutive qui s inscrit au sein d'autres espèces en particulier les Primates. Problème : comment placer l'homme

Plus en détail

Chapitre 3 : L expression de l information génétique. Activité 1 : Les deux étapes de l expression de l information génétique

Chapitre 3 : L expression de l information génétique. Activité 1 : Les deux étapes de l expression de l information génétique Connaissances L'ADN contient des unités d'information appelées gènes. Le génome est l ensemble du matériel génétique d un organisme. Chez les eucaryotes, la transcription a lieu dans le noyau, la traduction

Plus en détail

Génétique et physiologie recherche

Génétique et physiologie recherche Génétique et physiologie recherche Mention : Génétique et physiologie, bioinformatique Nature de la formation : Diplôme national de l'enseignement Supérieur Durée des études : 2ans Crédits ECTS : 120 Formation

Plus en détail

Introduction à la Bio-Informatique IFT3295- Aut Nadia El-Mabrouk DIRO, Université de Montréal

Introduction à la Bio-Informatique IFT3295- Aut Nadia El-Mabrouk DIRO, Université de Montréal Introduction à la Bio-Informatique IFT3295- Aut 2011 Nadia El-Mabrouk DIRO, Université de Montréal Plan Qu est-ce que la Bio-Informatique? Probématiques liées aux trois macro-molécules ADN Séquençage Annotation

Plus en détail

Bioinformatique BTV Alignement de Séquences

Bioinformatique BTV Alignement de Séquences 1 / 60 Bioinformatique BTV Alignement de Séquences Jean-Michel Richer jean-michel.richer@univ-angers.fr http://www.info.univ-angers.fr/pub/richer Juillet 2008 2 / 60 Plan Plan 1 Rappels 2 Alignement multiple

Plus en détail

Big data et sciences du Vivant L'exemple du séquençage haut débit

Big data et sciences du Vivant L'exemple du séquençage haut débit Big data et sciences du Vivant L'exemple du séquençage haut débit C. Gaspin, C. Hoede, C. Klopp, D. Laborie, J. Mariette, C. Noirot, MS. Trotard bioinfo@genopole.toulouse.inra.fr INRA - MIAT - Plate-forme

Plus en détail

0.1 Contenus des cours proposés en M1 dans BIM

0.1 Contenus des cours proposés en M1 dans BIM 0.1 Contenus des cours proposés en M1 dans BIM En première année, il existe quatre modules obligatoires (2 assurés aux premiers semestre et 2 au deuxième). Ces modules forment le coeur de la multidisciplinarité

Plus en détail

Initiation à la bioinformatique IFT1890 DESI Plan de cours

Initiation à la bioinformatique IFT1890 DESI Plan de cours Initiation à la bioinformatique IFT1890 DESI Plan de cours Paul Dallaire (p.dallaire@sympatico.ca) automne 2003 DESCRIPTION Activité de découverte et de survol de la bioinformatique. Outils et algorithmes

Plus en détail

Analyse et modélisation des données

Analyse et modélisation des données Analyse et modélisation des données Mention : Génétique et physiologie, bioinformatique Nature de la formation : Diplôme national de l'enseignement Supérieur Durée des études : 2ans Crédits ECTS : 120

Plus en détail

Manolo Gouy. Laboratoire de Biométrie & Biologie Evolutive CNRS / Université de Lyon

Manolo Gouy. Laboratoire de Biométrie & Biologie Evolutive CNRS / Université de Lyon Thermomètres moléculaires: reconstruire les séquences ancestrales pour comprendre l histoire de l adaptation à la température le long de l arbre de la vie Manolo Gouy Laboratoire de Biométrie & Biologie

Plus en détail

PARTIE V : Les logiciels

PARTIE V : Les logiciels PARTIE V : Les logiciels La liste de référence : la page web de Joe Felsenstein http://evolution.genetics.washington.edu/phylip/software.html En 2014 392 programmes fonctionnant sur toutes les plates-formes

Plus en détail

INTRODUCTION À LA GÉNOMIQUE

INTRODUCTION À LA GÉNOMIQUE 0 INTRODUCTION À LA GÉNOMIQUE Diversité des génomes à l échelle du vivant. I. Outils de la génomique Cours INSA AMIG - Février 2013 - Yann Lesecque - yann.lesecque@gmail.com 1 Plan Trois types d approches

Plus en détail

Introduction à l Algorithmique et la Programmation feuille de Projet Alignement de Séquences

Introduction à l Algorithmique et la Programmation feuille de Projet Alignement de Séquences Introduction à l Algorithmique et la Programmation feuille de Projet Alignement de Séquences Le thème de ce projet est l alignement de séquences. Il permet d illustrer comment les principes algorithmiques

Plus en détail

BIOINFORMATIQUE APPLIQUÉE - CHMI 3206 F. Professeur : Eric R. Gauthier. Test de mi-session. 31 octobre Votre nom :

BIOINFORMATIQUE APPLIQUÉE - CHMI 3206 F. Professeur : Eric R. Gauthier. Test de mi-session. 31 octobre Votre nom : BIOINFORMATIQUE APPLIQUÉE - CHMI 3206 F Professeur : Eric R. Gauthier Test de mi-session 31 octobre 2006 Votre nom : Consignes : 1) Durée : 85 min 2) 5 questions sur 5 pages, pour 80 points. Compte pour

Plus en détail

Les principales bases de données en bioinformatique

Les principales bases de données en bioinformatique Bases de données en bioinformatique Les principales bases de données en bioinformatique Nombreuses bases de données en bioinformatique Données issues d'expériences, de publications, d'analyses faites à

Plus en détail

N2 Nommer un trouble du système endocrinien à partir de certains symptômes.

N2 Nommer un trouble du système endocrinien à partir de certains symptômes. Modules : 1 Le maintien de l équilibre dynamique 3 La continuité génétique 2 La reproduction et le développement 4 L évolution, le changement et la diversité PARTIE I : Choix multiples Valeur totale :

Plus en détail

Informatique et biologie moléculaire

Informatique et biologie moléculaire UE 1B-biomolécules, génome, bioénergétique, métabolisme, méthodes d étude et analyse du génome II-le génome : sa structure, son expression Organisation, évolution et fonction du génome humain Approches

Plus en détail

Projet MINT Les valises ADN et caeno

Projet MINT Les valises ADN et caeno Projet MINT Les valises ADN et caeno Dr. Marie-Pierre Chevron Faculté des lettres CERF Dr. Chantal Wicky Faculté des sciences Département de biologie Chinese scientists genetically modify human embryos

Plus en détail

BIOINFORMATIQUE APPLIQUEE (BI4U2) EXAMEN DE SECONDE SESSION JUIN 2013

BIOINFORMATIQUE APPLIQUEE (BI4U2) EXAMEN DE SECONDE SESSION JUIN 2013 Année universitaire 2012/2013 Site : X Luminy X St-Charles o St-Jérôme o Cht-Gombert o Aix-Montperrin o Aubagne-SATIS Sujet session de : o 1 er semestre - o 2 ème semestre - X Session 2 Examen de : X L1/L2/oL3

Plus en détail

Présentation succincte. Jean Cavarelli. Septembre 2014

Présentation succincte. Jean Cavarelli. Septembre 2014 Master Sciences du Vivant Spécialité Biologie structurale, bioinformatique et biotechnologies Parcours Biologie structurale intégrative et bio-informatique Présentation succincte. Jean Cavarelli Septembre

Plus en détail

MABioVis. Bio-informatique et la

MABioVis. Bio-informatique et la MABioVis Modèles et Algorithmes pour la Bio-informatique et la Visualisation Visite ENS Cachan 5 janvier 2011 MABioVis G GUY MELANÇON (PR UFR Maths Info / EPI GRAVITE) (là, maintenant) - MABioVis DAVID

Plus en détail

Une approche interdisciplinaire de la bioinformatique à l Institut Pasteur : conception participative et programmation par l utilisateur

Une approche interdisciplinaire de la bioinformatique à l Institut Pasteur : conception participative et programmation par l utilisateur Une approche interdisciplinaire de la bioinformatique à l Institut Pasteur : conception participative et programmation par l utilisateur Catherine Letondal letondal@pasteur.fr Institut Pasteur 4èmes Rencontres

Plus en détail

1. LES NIVEAUX D ORGANISATION DU VIVANT

1. LES NIVEAUX D ORGANISATION DU VIVANT 1. LES NIVEAUX D ORGANISATION DU VIVANT Un peu comme des poupées gigognes (russes) qui s emboîtent les unes dans les autres, le vivant peut être étudié à plusieurs niveaux. À chacun des niveaux, les éléments

Plus en détail

L Apport de la Bioinformatique et de la Biostatistique dans la compréhension des maladies complexes: Modèles; outils et méthodes

L Apport de la Bioinformatique et de la Biostatistique dans la compréhension des maladies complexes: Modèles; outils et méthodes L Apport de la Bioinformatique et de la Biostatistique dans la compréhension des maladies complexes: Modèles; outils et méthodes Dr. Najla kharrat Groupe de recherche: Microorganisme et Biomolecules Centre

Plus en détail

Information génétique vs régulation épigénétique :

Information génétique vs régulation épigénétique : Hélène Hagège 31 mars 2006 Information génétique vs régulation épigénétique : aux limites de la biologie moléculaire "Didactique et socialisation " Laboratoire Interdisciplinaire de Recherche en Didactique,

Plus en détail

Informations de l'unité d'enseignement

Informations de l'unité d'enseignement Année Académique 2016-2017 (Version définitive du : 13 Septembre 2016 ) Informations de l'unité d'enseignement Implantation Cursus de IPL Bachelier en chimie Biologie humaine C1070 Cycle 1 Bloc 1 Quadrimestre

Plus en détail

La recherche de lien de parentés parmi les Vertébrés. I. Tous les être vivants ont des caractéristiques communes

La recherche de lien de parentés parmi les Vertébrés. I. Tous les être vivants ont des caractéristiques communes Parenté entre les êtres vivants fossiles et actuels Phylogénèse Evolution La recherche de lien de parentés parmi les Vertébrés Voir feuille de révision. Introduction Le vivant : procaryotes (bactéries)+

Plus en détail

Bio-informatique et bio-analyse :

Bio-informatique et bio-analyse : Fiche 1 Bio-informatique et bio-analyse : Jean-Loup Risler La «bio-informatique». J entends ce mot depuis bien longtemps, mais je ne sais toujours pas ce qu il veut dire Je me souviens d une rencontre

Plus en détail

2. Construction de l objet (génie génétique, à la chimie de synthèse, à la microfluidique )

2. Construction de l objet (génie génétique, à la chimie de synthèse, à la microfluidique ) Biologie de Synthèse La biologie de synthèse (BS) a été définie par le consortium européen "Synbiology" comme «l ingénierie de composants et systèmes biologiques qui n existent pas dans la nature» Trois

Plus en détail

Bibliographie. Introduction à la bioinformatique. Objectifs. Préambule: Les cellules. Alberts et al, The molecular biology of the cell

Bibliographie. Introduction à la bioinformatique. Objectifs. Préambule: Les cellules. Alberts et al, The molecular biology of the cell Introduction à la bioinformatique 2. Fondations moléculaire en 66 slides et 2 video Bibliographie Alberts et al, The molecular biology of the cell Zvelebil et Baum, Understanding bioinformatics 1 2 Objectifs

Plus en détail

TD Bioinformatique : Sequence Alignment. Pourquoi faire une recherche par similarité?

TD Bioinformatique : Sequence Alignment. Pourquoi faire une recherche par similarité? TD Bioinformatique : Sequence lignment Pourquoi faire une recherche par similarité? - Savoir si ma séquence ressemble à d'autres déjà connues. - Trouver toutes les séquences d'une même famille. - Rechercher

Plus en détail

Bioinformatique Appliquée Recherche de similitudes

Bioinformatique Appliquée Recherche de similitudes Besoin d'accélérer la recherche de similitude dans une banque Bioinformatique Appliquée Recherche de similitudes La recherche de similitude permet de comparer une séquence appelée requête (query) à une

Plus en détail

Signification biologique de. Meeting Netbio septembre 2015 Etienne Delannoy IPS2, Paris-Saclay

Signification biologique de. Meeting Netbio septembre 2015 Etienne Delannoy IPS2, Paris-Saclay Signification biologique de. Meeting Netbio 29-30 septembre 2015 Etienne Delannoy IPS2, Paris-Saclay 2ème meeting Netbio septembre 2011 (Evry) Modélisateurs Biologistes 2ème meeting Netbio septembre 2011

Plus en détail

Comparaison et alignement. de séquences LV348 -BI. Sophie Pasek

Comparaison et alignement. de séquences LV348 -BI. Sophie Pasek Comparaison et alignement de séquences LV348 -BI Sophie Pasek sophie.pasek@upmc.fr Comment comparer deux séquences? Le Dot-Plot Tableau indexé par les caractères des deux séquences Identité : Non Identité:

Plus en détail

Biologie Santé Environnement-BioMANE-BM

Biologie Santé Environnement-BioMANE-BM Université de Lorraine 1/3 Biologie Santé Environnement-BioMANE-BM L1 S1 Biochimie et Biologie cellulaire 6 L1 S1 Biologie 1 6 L1 S1 Chimie Générale 6 L1 S1 Introduction aux Géosciences 3 L1 S1 Mathématiques

Plus en détail

TD de Biologie Moléculaire : Etude de la régulation de la Transferrine

TD de Biologie Moléculaire : Etude de la régulation de la Transferrine UE BIO12 TD2 (Transferrine) Année 2008-2009 Corinne MAUREL-ZAFFRAN L2 SV TD de Biologie Moléculaire : Etude de la régulation de la Transferrine La figure 1 vous rappelle la régulation de l expression de

Plus en détail

Docking gros grain ADN - protéine

Docking gros grain ADN - protéine Docking gros grain ADN - protéine Pierre Poulain pierre.poulain@univ-paris-diderot.fr M2 BI 11/2011 À l exception des illustrations et images dont les crédits sont indiqués à la fin du document et dont

Plus en détail

Branches propédeutiques

Branches propédeutiques Plan d études pour les Branches propédeutiques et les Branches complémentaires offertes par la Faculté des sciences dans le cadre du Bachelor of Science ou d autres formations universitaires dans lesquelles

Plus en détail

Analyse des données de la Biologie Moléculaire Identifications de Biomarqueurs Associés au Diagnostic et au Pronostic des Maladies

Analyse des données de la Biologie Moléculaire Identifications de Biomarqueurs Associés au Diagnostic et au Pronostic des Maladies Analyse des données de la Biologie Moléculaire Identifications de Biomarqueurs Associés au Diagnostic et au Pronostic des Maladies Pr Roch Giorgi roch.giorgi@univ-amu.fr SESSTIM, Faculté de Médecine, Aix-Marseille

Plus en détail

MÉCANISMES MOLÉCULAIRES DE L EXPRESSION DES GÉNES : LA TRADUCTION OU BIOSYNTHÈSE DES PROTÉINES

MÉCANISMES MOLÉCULAIRES DE L EXPRESSION DES GÉNES : LA TRADUCTION OU BIOSYNTHÈSE DES PROTÉINES MÉCANISMES MOLÉCULAIRES DE L EXPRESSION DES GÉNES : LA TRADUCTION OU BIOSYNTHÈSE DES PROTÉINES Le sens de lecture L ARN polymérase lit le brin matrice dans la direction 3 vers 5 de façon à synthétiser

Plus en détail

Informatique et biologie moléculaire

Informatique et biologie moléculaire UE09s Méthodes d étude et analyse du génome Techniques d analyse des gènes à grande échelle Bio-informatique PACES 2013-2014 Dr Nicolas SEVENET Informatique et biologie moléculaire Avertissement Utilisation

Plus en détail

Concept, avantages. Imagerie MALDI: et limites. Workshop Protéomique et Maladies Rares 25 septembre Paris.

Concept, avantages. Imagerie MALDI: et limites. Workshop Protéomique et Maladies Rares 25 septembre Paris. Workshop Protéomique et Maladies Rares 25 septembre 2012 - Paris ITMO Génétique, génomique et bio-informatique Imagerie MALDI: Concept, avantages et limites charles.pineau@inserm.fr Imagerie par spectrométrie

Plus en détail

Lancer FASTA et BLAST en ligne de commande

Lancer FASTA et BLAST en ligne de commande Lancer FASTA et BLAST en ligne de commande V.2006.1 http://www.esil.univ-mrs.fr/~dgaut/cours Daniel Gautheret ESIL, Université de la Méditerranée Fasta Article original: Lipman and Pearson (1985) Science

Plus en détail

ORGANISATION MOLÉCULAIRE DES GÈNES ET RÉPLICATION DE L ADN

ORGANISATION MOLÉCULAIRE DES GÈNES ET RÉPLICATION DE L ADN ORGANISATION MOLÉCULAIRE DES GÈNES ET RÉPLICATION DE L ADN I- Définition moléculaire du gène Génos qui donne naissance Classe II (structure) Classe III Classe I Gène A Gène B Gène C mrna trna rrna Protéines

Plus en détail

Calcul de score d'alignements multiples de séquences

Calcul de score d'alignements multiples de séquences RAPPORT DE STAGE présentée par Sandrine PERRIN Dans le cadre de la Licence professionnelle de biotechnologie, option bioinformatique Calcul de score d'alignements multiples de séquences Encadrants: Joël

Plus en détail

Les bases de données biologiques. Sigrid Le Clerc Conservatoire Nationale des Arts et Métiers Chaire de Bioinformatique

Les bases de données biologiques. Sigrid Le Clerc Conservatoire Nationale des Arts et Métiers Chaire de Bioinformatique Les bases de données biologiques Sigrid Le Clerc Conservatoire Nationale des Arts et Métiers Chaire de Bioinformatique Sommaire 1. Introduction 2. Le système Entrez 2.1. Description du système Entrez 2.2.

Plus en détail

Quelle place pour la bioinformatique à l IN2P3? V. Breton Journées informatiques Cargèse 07/01

Quelle place pour la bioinformatique à l IN2P3? V. Breton Journées informatiques Cargèse 07/01 Quelle place pour la bioinformatique à l IN2P3? V. Breton Journées informatiques Cargèse 07/01 Définitions Bioinformatique : informatique d acquisition et d analyse des données issues de la génomique et

Plus en détail

Génie génétique et biotechnologie

Génie génétique et biotechnologie Génie génétique et biotechnologie Acides nucléiques (rappel) Transcription ADN ARNm Traduction protéines Nucléotides Acides aminés Acides nucléiques Nucléotides : Gr. Phosphate Campbell 2 e edition, fig.

Plus en détail

Mise en situation et recherche à mener

Mise en situation et recherche à mener Fiche sujet candidat (1/2) Mise en situation et recherche à mener Les liens de parenté au sein des grands primates (Homme, Gibbon, Gorille, Chimpanzé, Orang-outan) ont longtemps été discutés par la communauté

Plus en détail

Recherche de motifs dans les arbres phylogénétiques

Recherche de motifs dans les arbres phylogénétiques Séminaire du club génome Octobre 2002 Recherche de motifs dans les arbres phylogénétiques Jean-François ufayard Sous la direction de Laurent uret, Guy Perrière et François Rechenmann UMR 5558 Biométrie,

Plus en détail

Le phénotype cellulaire : observation microscopique d un frottis de sang drépanocytaire

Le phénotype cellulaire : observation microscopique d un frottis de sang drépanocytaire Caractérisation d un phénotype à différentes échelles : l exemple de la drépanocytose Place dans la démarche explicative Cette activité constat permet de découvrir le phénotype drépanocytaire à différentes

Plus en détail

Introduction à la phylogénie*

Introduction à la phylogénie* Introduction à la phylogénie* Tree of Life web project: http://tolweb.org/tree/phylogeny.html * Notes basées en partie sur les notes de cours de Nadia El-Mabrouk * * * 1. Théorie de l évolution 2. Arbres

Plus en détail

LICENCE PROFESSIONNELLE BIOTECHNOLOGIE OPTION BIOINFORMATIQUE

LICENCE PROFESSIONNELLE BIOTECHNOLOGIE OPTION BIOINFORMATIQUE LICENCE PROFESSIONNELLE BIOTECHNOLOGIE OPTION BIOINFORMATIQUE Organisé par la CHAIRE DE BIOINFORMATIQUE (en collaboration avec les chaires de biologie, d informatique, et de statistiques) Responsable de

Plus en détail

INTRODUCTION À LA BIO-INFORMATIQUE

INTRODUCTION À LA BIO-INFORMATIQUE Biologie moléculaire-2016 1 INTRODUCTION À LA BIO-INFORMATIQUE Dans cette section, on désire vous donner une introduction sur l utilisation du site web du National Center for Biotechnology Information

Plus en détail

De la Bioinformatique à la Biologie des Systèmes

De la Bioinformatique à la Biologie des Systèmes De la Bioinformatique à la Biologie des Systèmes Plan Définitions Bioinformatique Biologie des systèmes Discussion Denis Thieffry TAGC - INSERM ERM206 Université de la Méditerranée Marseille, France Qu'est-ce

Plus en détail

Modélisation de la structure 3D des protéines

Modélisation de la structure 3D des protéines Modélisation de la structure 3D des protéines We are drowning in data and starving for knowledge -R.D. Roger Unité Mathématique Informatique et Génome Séminaire AGENAE, Seignosse-le-Pénon, 20-21 mai 2003

Plus en détail

Etude de cas Université Pierre et marie Curie, partenaire N 9

Etude de cas Université Pierre et marie Curie, partenaire N 9 Etude de cas Université Pierre et marie Curie, partenaire N 9 1. Motivation 1.1 Contexte 1.1.1 En France : La formation continue est une activité qui se développe dans un contexte de concurrence. Le marché

Plus en détail

Qu est ce qu apporte la connaissance des génomes?

Qu est ce qu apporte la connaissance des génomes? Qu est ce qu apporte la connaissance des génomes? 1. L informa:on géné:que 2. Le génome humain 3. Variabilité individuelle et médecine 4. La place de l homme dans les espèces 1 1. L information génétique

Plus en détail

Branches propédeutiques

Branches propédeutiques Extrait du plan d études pour les Branches propédeutiques et les Branches complémentaires offertes par la Faculté des sciences dans le cadre du Bachelor of Science ou d autres formations universitaires

Plus en détail

Branches complémentaires en biochimie

Branches complémentaires en biochimie UNIVERSITÉ DE FRIBOURG SUISSE FACULTÉ DES SCIENCES UNIVERSITÄT FREIBURG SCHWEIZ MATHEMATISCH-NATURWISSENSCHAFTLICHE FAKULTÄT Extrait du plan d'études pour les branches propédeutiques et les branches complémentaires

Plus en détail

DESCRIPTION DU COURS

DESCRIPTION DU COURS DESCRIPTION DU COURS BIOLOGIE 11 M. Marc Deveau École secondaire de Clare (902)769-5400 dmarc@scolaire.ednet.ns.ca 1. Description du cours a. Le but : Le cours BIO 11 est un cours académique conçu et développé

Plus en détail

II/ La Terre une planète habitée. PB Comment définir la vie. 1/ la composition chimique des êtres vivants

II/ La Terre une planète habitée. PB Comment définir la vie. 1/ la composition chimique des êtres vivants II/ La Terre une planète habitée PB Comment définir la vie 1/ la composition chimique des êtres vivants Si on réalise une analyse chimique de la matière constituant les êtres vivants, on observe que celle-ci

Plus en détail

Plate-forme Bio-informatique. Laboratoire de Bio-informatique et de Génomique intégratives. Utilisateurs (public, privé )

Plate-forme Bio-informatique. Laboratoire de Bio-informatique et de Génomique intégratives. Utilisateurs (public, privé ) Plate-forme Bio-informatique Valorisation et soutien Laboratoire de Bio-informatique et de Génomique intégratives Recherche et développement collaboration Utilisateurs (public, privé ) Proposer des solutions

Plus en détail

DOSSIER DE CANDIDATURE. MASTER 1ère ANNEE Mention GENETIQUE ET PHYSIOLOGIE

DOSSIER DE CANDIDATURE. MASTER 1ère ANNEE Mention GENETIQUE ET PHYSIOLOGIE UFR Sciences et Technologies UFR SCIENCES ET TECHNOLOGIES 24 avenue des Landais BP 80026 63171 AUBIERE Cedex Tél. 04.73.40.70.13 Fax. 04.73.40.70.12 Courriel : ScolaMaster.sciences@univ-bpclermont.fr DOSSIER

Plus en détail

OFFRE DE FORMATION L.M.D.

OFFRE DE FORMATION L.M.D. REPUBLIQUE ALGERIENNE DEMOCRATIQUE ET POPULAIRE MINISTERE DE L ENSEIGNEMENT SUPERIEUR ET DE LA RECHERCHE SCIENTIFIQUE OFFRE DE FORMATION L.M.D. MASTER ACADEMIQUE Etablissement Faculté / Institut Département

Plus en détail

Qu'est-ce que l'adn?

Qu'est-ce que l'adn? Structure Physico-chimique de l'adn Qu'est-ce que l'adn? L'ADN (acide désoxyribonucléique) est une macromolécule biologique formée par deux chaînes complémentaires qui s'emboîtent tout en s'enroulant l'une

Plus en détail

AVL Liban 2011 Biologie Moléculaire et Organismes Modèles

AVL Liban 2011 Biologie Moléculaire et Organismes Modèles AVL Liban 2011 Biologie Moléculaire et Organismes Modèles Sami Khuri Department of omputer Science San José State University San José, alifornia, USA sami.khuri@sjsu.edu www.cs.sjsu.edu/faculty/khuri Plan

Plus en détail

1er Semestre. Macroéconomie * 30h CM et 15h TD 5. Applied Econometrics 15h CM 3. R Programing 15h CM et 6h TP 3

1er Semestre. Macroéconomie * 30h CM et 15h TD 5. Applied Econometrics 15h CM 3. R Programing 15h CM et 6h TP 3 Programme Master 1 Les 2 Masters 1 proposés : Economie et Economie et Statistique, ont pour finalité de donner aux étudiants une solide formation dans les domaines concernés via des parcours différents

Plus en détail

Soutenance de mi-stage

Soutenance de mi-stage Supervisée par : Mireille RÉGNIER & Yann PONTY 30 juin 2015 1/29 1 Structure 3D de l ARN et objectifs Notions sur la structure 3D de l ARN Intérêts de la comparaison de structures 3D Qu est ce que la comparaison

Plus en détail

Biologie Santé, Sciences du Médicament (BSSM) Parcours Génie Cellulaire et Physiologique

Biologie Santé, Sciences du Médicament (BSSM) Parcours Génie Cellulaire et Physiologique Université de POITIERS 1/4 L1 S1 Chimie générale I (6 ECTS, 6 L1 S1 Crises et ressources de la terre (6 ECTS, 6 L1 S1 Des biomolécules aux organismes (6 ECTS, 6 L1 S1 Diversité du vivant 1 (6 ECTS, 6 L1

Plus en détail

Xylok : un outil d analyse et de prédiction des séquences d ADN formant un nucléosome

Xylok : un outil d analyse et de prédiction des séquences d ADN formant un nucléosome Xylok : un outil d analyse et de prédiction des séquences d ADN formant un nucléosome Soutenance du projet d Informatique Théorique et Programmation Python 17 décembre 2014 Plan 1 Introduction 2 Problème

Plus en détail

Analyse bibliométrique du contenus d archives ouvertes : un service de la bibliothèque pour l évaluation de la recherche

Analyse bibliométrique du contenus d archives ouvertes : un service de la bibliothèque pour l évaluation de la recherche Analyse bibliométrique du contenus d archives ouvertes : un service de la bibliothèque pour l évaluation de la recherche Marco van Veller Wageningen UR Library Wageningen UR Organisme hybride Wageningen

Plus en détail

Retrouvez toute l offre de formation. MASTER MENTION BIOLOGIE SPECIALITE BIOCHIMIE ET BIOLOGIE STRUCTURALE (R ET P)

Retrouvez toute l offre de formation.  MASTER MENTION BIOLOGIE SPECIALITE BIOCHIMIE ET BIOLOGIE STRUCTURALE (R ET P) SPECIALITE BIOCHIMIE ET BIOLOGIE STRUCTURALE (R ET P) Former les étudiants aux méthodes d analyse structurale des macromolécules biologiques et aux méthodes d analyse biophysiques des interactions et des

Plus en détail

Campagne d emplois 2016 Enseignants-Chercheurs/Enseignants

Campagne d emplois 2016 Enseignants-Chercheurs/Enseignants Campagne d emplois 2016 Enseignants-Chercheurs/Enseignants Date prévisionnelle de prise de fonction : 01/09/2016 Implantation de l emploi demandé : X Université d'évry Val d'essonne IUT (localisation géographique,

Plus en détail

DM N 1 : Parentés entre les êtres vivants actuels et fossiles Phylogenèse - Evolution Chapitre 1

DM N 1 : Parentés entre les êtres vivants actuels et fossiles Phylogenèse - Evolution Chapitre 1 DM N 1 : Parentés entre les êtres vivants actuels et fossiles Phylogenèse - Evolution Chapitre 1 Partie I Restitution organisée de connaissances La diversité du monde vivant a amené les biologistes à proposer

Plus en détail

Analyse in-silico de séquences biologiques

Analyse in-silico de séquences biologiques Analyse in-silico de séquences biologiques Carl Herrmann IBDML Université de la Méditerranée herrmann@ibdm.univ-mrs.fr année 2006-2007 1 Génomique "traditionnelle" organisme à séquencer séquençage "contigs"

Plus en détail

Examen de Biologie moléculaire 2011(1, 2), Faculté des Sciences-Semlalia, Université Cadi Ayyad, Marrakech, Maroc. Durée 1 heure

Examen de Biologie moléculaire 2011(1, 2), Faculté des Sciences-Semlalia, Université Cadi Ayyad, Marrakech, Maroc. Durée 1 heure Examen de Biologie moléculaire 2011(1, 2), Faculté des Sciences-Semlalia, Université Cadi Ayyad, Marrakech, Maroc. Durée 1 heure Examen 1 (Corrections 1) -- Examen 2 (Corrections 2) -- Examen 1 - Partie

Plus en détail

[CAHIER MODULE GENETIQUE ] FACULTE DE MEDECINE D ALGER.DEPARTEMENT DE MEDECINE.CYCLE GRADUE COMITE PEDAGOGIQUE GENETIQUE

[CAHIER MODULE GENETIQUE ] FACULTE DE MEDECINE D ALGER.DEPARTEMENT DE MEDECINE.CYCLE GRADUE COMITE PEDAGOGIQUE GENETIQUE 1ére ANNEE FACULTE DE MEDECINE D ALGER.DEPARTEMENT DE MEDECINE.CYCLE GRADUE COMITE PEDAGOGIQUE GENETIQUE [CAHIER MODULE GENETIQUE ] Dans ce cahier vous trouverez les informations relatives au module :

Plus en détail

Le DUT Génie Biologique option Bioinformatique une formation à BAC+2 unique en France. Valérie Polonais

Le DUT Génie Biologique option Bioinformatique une formation à BAC+2 unique en France. Valérie Polonais Le DUT Génie Biologique option Bioinformatique une formation à BAC+2 unique en France Valérie Polonais Le DUT : Diplôme Universitaire de Technologie - Diplôme à Bac+2 - Seul diplôme universitaire dont

Plus en détail

Appel à candidature / Chef de projet en transformation pédagogique (H/F)

Appel à candidature / Chef de projet en transformation pédagogique (H/F) Appel à candidature / Chef de projet en transformation pédagogique (H/F) Intitulé de poste Chef de projet en transformation pédagogique (H/F) Poste ouvert aux personnes bénéficiaire de l'obligation d'emploi

Plus en détail

Alignements multiples

Alignements multiples Alignements multiples Celine Brochier celine.brochier@up.univ-mrs.fr http://194.57.197.233:800/ 04.91.10.64.75 Intérêt des alignements multiples Caractérisation des familles multigéniques Démontrer l homologie

Plus en détail