Alignement de séquences (2/2)

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimension: px
Commencer à balayer dès la page:

Download "Alignement de séquences (2/2)"

Transcription

1 Alignement de séquences (2/2) Observation à l aide de l outil graphique : le dotplot. Simple, visuel, Très informatif : Permet de repérer une similarité globale Permet de repérer des similarités locales Permet de repérer des répétitions Oui mais!!!! Pas de mesure quantitative de similarité D1

2 Alignement de séquences identité Insertion / Délétion substitution D2 Alignement : mise en correspondance de deux séquences Quantifier et localiser la similarité dans une paire de séquences Trouver la meilleure mise en correspondance des résidus qui conserve l ordre des séquences Utilisation de la méthode des scores Trouver le meilleur score

3 Alignement de séquences Calcul de score? Le score de l alignement est la somme des scores des événements élémentaires identité substitution Insertion / Délétion D3 Matrice de similarité Pénalités

4 Alignement de séquences Rappel sur les acides aminés. D4 B Aspartic Acid ou Glutamic Acid Z Glutamine ou Glutamic Acid X inconnu Proprités physico-chimiques diagramme Venn

5 Alignement de séquences Calcul de score : matrices de similarité Blosum 62 A R N D P W A G K M H C W A Total = 13 Matrices protéiques : BLOSUM (Henikoff & Henikoff, 1992) PAM (Dayhoff, 1969) Choix de la matrice? Il n existe pas de matrice idéale!!! Blosum62 semble être la plus générale. D5

6 Alignement des séquences Calcul de score : matrices de similarité Matrice d acides nucléiques : Matrice d ADN Mésappariement de 2 purines ou 2 pyrimidines D6

7 Alignement des séquences Calcul de score : matrices de similarité D7

8 Alignement de séquences Calcul de score : pénalité des indel Ouverture Extensions pénalités ouverture extension Ajustement des pénalités? augmenter le score en fonction de la longueur du «gap» : choisir une pénalité d ouverture > à la pénalité d extension, D8 faire en sorte de ne pas affecter le score en fonction de la longueur du «gap» : pénaliser juste l ouverture du «gap», très peu ou pas du tout l extension.

9 Alignement de séquences Calcul de score : exercices Calculer les scores pour chacun des alignements et selon les 2 matrices de similarité : BLOSUM62 et BLOSUM50 Blosum 62 D9 Blosum 50

10 Alignement de séquences On distingue différents types d alignements : L alignement par paires : alignement global, alignement sur la totalité de la longueur de deux séquences nécessité d ajout d indel dans l une des séquences Algorithme de Needleman-Wunsch alignement local, identification de régions de forte homologie alignement sur les régions conservées seulement Algorithme de Smith-Waterman D10 L alignement multiple Alignement global entre plus de 2 séquences.

11 Alignement de séquences Construire des alignements de séquence? Calcul informatique (1) : approche exhaustive (naïve) o les différentes solutions alternatives d alignement possibles sont proposées, o Les scores sont calculés pour chacune de ces alternatives, o Est conservé le meilleur alignement, càd celui qui a le score le plus élevé. D11 Simple, mais temps de calcul bien trop élevé Op. x n n!!!!! Estimation du temps de calcul : alignement de 2 séquences de longueur n=20, temps de calcul (1 itération Op.=0,1 s) 300 millions d années.

12 Alignement de séquences Construire des alignements de séquence? Calcul informatique (2) : approche dynamique o Optimiser le score pour chaque paire de résidus (m*n paires), o Le meilleur score est la somme des meilleurs scores de chaque paire. D12 Exact, rapide [temps de calcul Op. x(m*n)], mais gourmand en mémoire!!!!! Estimation du temps de calcul : alignement de 2 séquences de longueur n=20, temps de calcul (1 itération Op.=0,1ms) 40 s.

13 Alignement de séquences Construire des alignements de séquence? Programmation dynamique : Alignement global de Needlemann & Wunsch (1970) Etape 1 : Construction de la matrice de comparaison. Matrice(m,n) Etape 2 : Transformation de la matrice par addition des scores. D13

14 Alignement de séquences Construire des alignements de séquence? Programmation dynamique : Alignement global de Needlemann & Wunsch (1970) Matrice initiale : Avec : S(i,j) : score dans la case (i,j)de la matrice transformée. i j Etape 2 : Transformation de la matrice par addition des scores : o Initialisation de (m,0) et (0,n) o Addition des scores : Démonstration : construction de la matrice transformée D14 se(i,j) : score élémentaire de la case d indice i et j de la matrice initiale. + y x

15 Alignement de séquences Construire des alignements de séquence? Programmation dynamique : Alignement global de Needlemann & Wunsch (1970) Matrice initiale : Avec : S(i,j) : score dans la case (i,j)de la matrice transformée. i j Etape 2 : Transformation de la matrice par addition des scores : o Initialisation de (m,0) et (0,n) o Addition des scores : Démonstration : construction de la matrice transformée D15 se(i,j) : score élémentaire de la case d indice i et j de la matrice initiale. + y x

16 Alignement de séquences Construire des alignements de séquence? Programmation dynamique : Alignement global de Needlemann & Wunsch (1970) Etape 2 : Transformation de la matrice par addition des scores : o Initialisation de (m,0) et (0,n) o Addition des scores : Matrice transformée intermédiaire : Matrice transformée finale : D16 Processus ascendant

17 Alignement de séquences Construire des alignements de séquence? Programmation dynamique : Alignement global de Needlemann & Wunsch (1970) Etape 3 : Chemin des scores maxima i j D17 Processus descendant i j

18 Alignement de séquences Construire des alignements de séquence? Programmation dynamique : Alignement global de Needlemann & Wunsch (1970) Les deux séquences présentent une similarité que l alignement global ne révèle pas!!!!! Alignement local de Smith-Waterman (1981) D18

19 Alignement de séquences Construire des alignements de séquence? Programmation dynamique : Alignement local de Smith-Waterman (1981) Dans le cas de l alignement local : N importe quelle cellule de la matrice de comparaison peut être prise comme point de départ pour le calcul des scores sommes. Tout score somme qui devient négatif stoppe la progression du calcul. Cette nouvelle case peut être initialisée à 0 et constituer un nouveau point de départ. D19

20 Alignement de séquences Un outil d alignement : Align. Choix de la méthode : «needle» (global) Needleman-Wunsch «water» (local) Smith-Waterman D20

21 Alignement de séquences Un outil d alignement : Align. Etape 1 : Entrée des deux séquences à analyser D21 Etape 2 : Choix :. des penalités et. de la matrice de similarité. Etape 3 : Exécution.

22 Alignement de séquences Un outil d alignement : Align. Des Résultats : Identité : Proportion des paires de résidus identiques entre les deux séquences alignées (exprimée en %) Similarité : Mesure de la ressemblance entre les deux séquences alignées. Le degré de similitude entre les deux séquences est quantifié par un score basé sur le % de similarité (% d identité + % de substitutions conservatives). Score : Somme des scores des événements élémentaires. D22

23 Recherche de similitudes dans une base de séquences (base de données)??? Pourquoi? Savoir si ma séquence ressemble à d autres séquences déjà connues, Trouver toutes les séquences d une même famille, Rechercher toutes les séquences qui contiennent un motif donné. D23

24 Recherche de similitudes dans une base de séquences (base de données)??? Méthodes? Recherche à grande échelle (bases de données contenant des 10zaines de milliers de séquences) pas raisonnable d utiliser des programmes classiques d alignement D24 Utilisation d heuristiques : BLAST & FASTA Basic Local Alignment Search Tool (Altschul et al, 1990) Méthodes approximatives basées sur une idée de filtrage.

25 D25 BLAST : Basic Local Aligment Search Tool : Recherche de régions de similarité locales. L algorithme BLAST : Étape 1 : création d une liste de tous les fragments (mots) de taille k (avec k petit: 11 pour les acides nucléiques, 2 ou 3 pour les protéines) trouvés dans la séquence requête et qui obtiennent un score > à un seuil donné. Etape 2 : construction d un automate fini déterministe pour retrouver les positions de tous les mots dans toutes les séquences de la banque de données. A partir de ces positions, BLAST essaie d étendre l alignement local tant que le score reste au dessus d un seuil donné. Toutes ces positions dans les séquences de la banque permettent ainsi de construire la liste des segments les plus similaires ou HSP (High Scoring Segment Pairs). Étape 3 : ordonner les alignements locaux, appelés MSP (Maximal-scoring Segment Pairs) en fonction de leur score maximun.

26 Étape 1 : Création d une liste de tous les fragments (mots) de taille k trouvés avec un score > seuil Etape 2 : Construction d un automate retrouver les positions dans séquences de la BD. Extension de l alignement local score reste au dessus d un seuil donné =>construction de la liste des HSP, D26 Etape 3 : Construction de la liste de MSP (HSP à score maximal)

27 BLAST : Basic Local Aligment Search Tool : Recherche de régions de similarité locales. Evaluer les résultats de BLAST : les indicateurs Le score brute : est la somme des scores des MSP qui composent cet alignement. Le score modifié : scores bruts convertis du logarithme (utilisés pour la création de la matrice de scores) au logarithme à base 2. Cela permet de comparer les scores obtenus entre différents alignements. La E-value : donne les informations sur la significativité d un alignement donné. La E-value d un alignement indique le nombre d alignements que l on s attendrait à trouver dans les banques avec un score supérieur ou égal au score qu obtiendrait la séquence requête contre une banque de données aléatoire (probabilité d'observer au hasard ce score à travers la banque de séquences considérée). Plus la E-value est faible, plus l'alignement est significatif. D27

28 BLAST : Basic Local Aligment Search Tool : Recherche de régions de similarité locales. Evaluer les résultats de BLAST : les indicateurs D28

29 Implémentation de l algorithme BLAST : NCBI BLAST & WU-BLAST? NCBI BLAST & WU-BLAST : Utilisables en tant que serveurs Web ou paquetage logiciel téléchargeable. NCBI BLAST : disponible sur le serveur du NCBI. Pour les versions les plus récentes : profit du développement de méthodes permettant de comparer les profils de séquences multiples. WU-BLAST : version alternative développée et maintenue à partir de la version NCBI Interrogation de bases de données protéines. D29

30 BLAST : Basic Local Aligment Search Tool : Recherche de régions de similarité locales. Les différents programmes BLAST : blastp : séquence requête protéique contre banque de données de séquences protéiques. blastn : séquence requête nucléique contre banque de données de séquences nucléiques. blastx : séquence requête nucléique traduite dans les six phases de lecture contre banque de données de séquences protéiques. tblastn : séquence requête protéique contre banque de données de séquences nucléiques dynamiquement traduite dans les six phases de lecture. tblastx : séquence requête nucléiques traduite dans les six phases de lecture contre banque de données de séquences nucléiques dynamiquement traduites suivant les six phases de lecture. D30

31 BLAST : Basic Local Aligment Search Tool : Recherche de régions de similarité locales. Les différents programmes BLAST : D31

32 Choisir l espèce étudiée : Choisir le programme : Choisir la base de données : D32

33 Entrer la séquence requête : Ajuster la sélection de la base de données : Optimisez les contraintes de sélection : D33

34 Réglez les paramètres de votre recherche : D34

35 Les résultats!! D35

36 D36

37 D37

38 D38

39 D39

40 D40

41 D41

42 D42

43 D43

44 D44

45 D45

46 D46

47 D47

48 D48

49 D49

50 Alignement multiple de séquences? CLUSTALL : Algorithme de type progressif. Composé de trois étapes : D50 Alignement par paires A B C D Calcul d un arbre de guidage Alignement progressif. A B C D A B C D Matrice de similarité B D Arbre de A guidage C similarité

51 Alignement multiple de séquences? CLUSTALL : Algorithme de type progressif. Composé de trois étapes : Calcul d un arbre de guidage Alignement progressif. B D Arbre de guidage A C similarité D51 B D Alignement des paires les plus similaires Gaps pour optimiser l alignement A C B D A C Nouveaux gaps pour optimiser L alignement (BD) avec (AC)

52 D52

53 D53

54 Merci de votre attention!!!!!!!! D54

Recherche par similarité dans les banques/bases de données La suite Blast (Basic Local Alignment Search Tool)

Recherche par similarité dans les banques/bases de données La suite Blast (Basic Local Alignment Search Tool) Recherche par similarité dans les banques/bases de données La suite Blast (Basic Local Alignment Search Tool) A A C T G G T A A C C G A G C T A C G G T C C G Algorithme de Blast (version 1) (Altschul et

Plus en détail

TD Bioinformatique : Sequence Alignment. Pourquoi faire une recherche par similarité?

TD Bioinformatique : Sequence Alignment. Pourquoi faire une recherche par similarité? TD Bioinformatique : Sequence lignment Pourquoi faire une recherche par similarité? - Savoir si ma séquence ressemble à d'autres déjà connues. - Trouver toutes les séquences d'une même famille. - Rechercher

Plus en détail

La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST.

La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST. La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST. Gaël Le Mahec - p. 1/12 L algorithme BLAST. Basic Local Alignment Search Tool est un algorithme de recherche

Plus en détail

Bioinformatique BTV Alignement de Séquences

Bioinformatique BTV Alignement de Séquences 1 / 60 Bioinformatique BTV Alignement de Séquences Jean-Michel Richer jean-michel.richer@univ-angers.fr http://www.info.univ-angers.fr/pub/richer Juillet 2008 2 / 60 Plan Plan 1 Rappels 2 Alignement multiple

Plus en détail

Initiation à la Bioinformatique Daniel Gautheret ESIL, Université de la Méditerranée

Initiation à la Bioinformatique Daniel Gautheret ESIL, Université de la Méditerranée Initiation à la Bioinformatique Daniel Gautheret ESIL, Université de la Méditerranée V.2004.4 http://www.esil.univ-mrs.fr/~dgaut/cours Bioinformatique Deux définitions possibles Applications de l informatique

Plus en détail

TD5 : Prédiction de la structure tridimensionnelle d une protéine Modélisation moléculaire

TD5 : Prédiction de la structure tridimensionnelle d une protéine Modélisation moléculaire TD5 : Prédiction de la structure tridimensionnelle d une protéine Modélisation moléculaire Vous aurez besoin des programmes suivant : d un éditeur de séquence d un visualiseur de structure 3D (PyMOL) Avant-propos

Plus en détail

Big data et sciences du Vivant L'exemple du séquençage haut débit

Big data et sciences du Vivant L'exemple du séquençage haut débit Big data et sciences du Vivant L'exemple du séquençage haut débit C. Gaspin, C. Hoede, C. Klopp, D. Laborie, J. Mariette, C. Noirot, MS. Trotard bioinfo@genopole.toulouse.inra.fr INRA - MIAT - Plate-forme

Plus en détail

Biologie «in silico» Adapté de Pierre Vincens

Biologie «in silico» Adapté de Pierre Vincens Biologie «in silico» Adapté de Pierre Vincens Bioinformatique Association de la biologie et de l'informatique Objectifs : Analyser, modéliser ou prédire les informations issues de données biologiques expérimentales

Plus en détail

Sujets de mini-projets

Sujets de mini-projets Sujets de mini-projets Sujet I: Décodage neuronal Assistant responsable: Samuel.Gmehlin@epfl.ch et Lukas.Rytz@epfl.ch Motivation Certains neurones du cerveau sont corrélés avec des stimuli complexes, par

Plus en détail

Optimisation des performances du programme mpiblast pour la parallélisation sur grille de calcul

Optimisation des performances du programme mpiblast pour la parallélisation sur grille de calcul Optimisation des performances du programme mpiblast pour la parallélisation sur grille de calcul Mohieddine MISSAOUI * Rapport de Recherche LIMOS/RR-06-10 20 novembre 2006 * Contact : missaoui@isima.fr

Plus en détail

Apprentissage d automates sur les protéines

Apprentissage d automates sur les protéines Apprentissage d automates sur les protéines Approche par fusion de fragments significativement similaires (Jobim 04) François Coste, Goulven Kerbellec, Boris Idmont, Daniel Fredouille Christian Delamarche

Plus en détail

Fida KHATER & Abdoulaziz MOUSSA 03 mars 2012 - Journée Portes Ouvertes à l'um2

Fida KHATER & Abdoulaziz MOUSSA 03 mars 2012 - Journée Portes Ouvertes à l'um2 DEVELOPPEMENT D UNE INTERFACE GRAPHIQUE : LOCAL WEB GUI FOR BLAST (LWBG), POUR LES TRAITEMENTS DE DONNEES BIOLOGIQUES Fida KHATER & Abdoulaziz MOUSSA 03 mars 2012 - Journée Portes Ouvertes à l'um2 Plan

Plus en détail

Sommaire. A) Méthode de contrôle manuel des résultats produits par GLADX

Sommaire. A) Méthode de contrôle manuel des résultats produits par GLADX Sommaire Définitions et abréviations Résumé Introduction I. Matériel II. Méthode A) Méthode de contrôle manuel des résultats produits par GLADX B) Comparaison des résultats de l outil GLADX avec les résultats

Plus en détail

IMMUNOLOGIE. La spécificité des immunoglobulines et des récepteurs T. Informations scientifiques

IMMUNOLOGIE. La spécificité des immunoglobulines et des récepteurs T. Informations scientifiques IMMUNOLOGIE La spécificité des immunoglobulines et des récepteurs T Informations scientifiques L infection par le VIH entraîne des réactions immunitaires de l organisme qui se traduisent par la production

Plus en détail

Variable Neighborhood Search

Variable Neighborhood Search Variable Neighborhood Search () Universite de Montreal 6 avril 2010 Plan Motivations 1 Motivations 2 3 skewed variable neighborhood search variable neighborhood decomposition search 4 Le probleme d optimisation.

Plus en détail

IC05 2004 Analyse de Réseaux Sociaux : perspective algorithmique

IC05 2004 Analyse de Réseaux Sociaux : perspective algorithmique IC05 2004 Analyse de Réseaux Sociaux : perspective algorithmique Eustache DIEMERT Université de Technologie de Compiègne - Réseaux, Territoires et Géographie de l Information 11 mai 2004 Réseaux Sociaux?

Plus en détail

Comment la Souris fait de la souris avec des graines?

Comment la Souris fait de la souris avec des graines? Comment la Souris fait de la souris avec des graines? d après «10 clés pour la Biologie» de J. Tavlitzki «[ ] La Souris, l Ecureuil, le Lapin mangent des graines. La Souris fait de la souris, l Ecureuil

Plus en détail

TP B43 Bio-Informatique 1. TP 1 : Les commandes LINUX et les instructions exécutables sous OCTAVE

TP B43 Bio-Informatique 1. TP 1 : Les commandes LINUX et les instructions exécutables sous OCTAVE TP B43 Bio-Informatique 1 TP 1 : Les commandes LINUX et les instructions exécutables sous OCTAVE 1) Quelques commandes LINUX - Ouvrir un terminal (menu Applications Accessoires Terminal) - Afficher la

Plus en détail

Christelle REYNES EA 2415 Epidémiologie, Biostatistique et Santé Publique Université Montpellier 1. 8 Juin 2012

Christelle REYNES EA 2415 Epidémiologie, Biostatistique et Santé Publique Université Montpellier 1. 8 Juin 2012 Extraction et analyse des mesures haut-débit pour l identification de biomarqueurs : problèmes méthodologiques liés à la dimension et solutions envisagées EA 2415 Epidémiologie, Biostatistique et Santé

Plus en détail

Introduction à l analyse statistique et bioinformatique des puces à ADN

Introduction à l analyse statistique et bioinformatique des puces à ADN Formation INSERM 10 février 2004 Introduction à l analyse statistique et bioinformatique des puces à ADN Gaëlle Lelandais lelandais@biologie.ens.fr 1 Première Partie Analyse d une puce à ADN : Le recherche

Plus en détail

Utilisation des diagrammes de Voronoï et des algorithmes génétiques pour l'étude des complexes protéine-protéine.

Utilisation des diagrammes de Voronoï et des algorithmes génétiques pour l'étude des complexes protéine-protéine. Utilisation des diagrammes de Voronoï et des algorithmes génétiques pour l'étude des complexes protéine-protéine. Anne Poupon Biologie et Bioinformatique des Systèmes de Signalisation INRA - Nouzilly France

Plus en détail

Séquençage haut débit 5 mars 26 mars (14h) C. Gaspin, C. Klopp, J. Mariette & G. Salin

Séquençage haut débit 5 mars 26 mars (14h) C. Gaspin, C. Klopp, J. Mariette & G. Salin Séquençage haut débit 5 mars 26 mars (14h) C. Gaspin, C. Klopp, J. Mariette & G. Salin Plan de la session Bioinformatique & séquençage haut débit Date Intervenant (s) Libellé 05/03 G. Salin Introduction

Plus en détail

1. L ADN et l information génétique. l ADN l information génétique est contenue dans l ADN. traduction. comment fait-on une protéine?

1. L ADN et l information génétique. l ADN l information génétique est contenue dans l ADN. traduction. comment fait-on une protéine? 1. L ADN et l information génétique l ADN l information génétique est contenue dans l ADN (ADN) (ARN) 1 2 A G T C U comment fait-on une protéine? traduction l information génétique est organisée par triplets

Plus en détail

Data Mining : la classification non supervisée

Data Mining : la classification non supervisée Data Mining : la classification non supervisée Clustering : une affaire de distance. Etude préliminaire. Valeurs discrètes. Soient les deux individus suivants correspondant à des séquences ADN : X = AGGGTGGC

Plus en détail

Analyse d images, vision par ordinateur. Partie 6: Segmentation d images. Segmentation? Segmentation?

Analyse d images, vision par ordinateur. Partie 6: Segmentation d images. Segmentation? Segmentation? Analyse d images, vision par ordinateur Traitement d images Segmentation : partitionner l image en ses différentes parties. Reconnaissance : étiqueter les différentes parties Partie 6: Segmentation d images

Plus en détail

Objectifs. Clustering. Principe. Applications. Applications. Cartes de crédits. Remarques. Biologie, Génomique

Objectifs. Clustering. Principe. Applications. Applications. Cartes de crédits. Remarques. Biologie, Génomique Objectifs Clustering On ne sait pas ce qu on veut trouver : on laisse l algorithme nous proposer un modèle. On pense qu il existe des similarités entre les exemples. Qui se ressemble s assemble p. /55

Plus en détail

Optimisation Combinatoire (Méthodes approchées) VI. Algorithmes à Population (Les bases)

Optimisation Combinatoire (Méthodes approchées) VI. Algorithmes à Population (Les bases) Optimisation Combinatoire (Méthodes approchées) VI. Algorithmes à Population (Les bases) Algorithmes à Population Idée principale 'Amélioration' d'un ensemble de solutions Recombiner des solutions Orienté

Plus en détail

VI. Domaines protéiques

VI. Domaines protéiques Chapitre 1 Structure des protéines I. Rappels Définitions II. La Protein Data Bank (PDB) III. Angles dièdres et diagramme de ramachandran IV. Structures secondaires V. Structures supersecondaires VI. Domaines

Plus en détail

L ADN. Schématisez un nucléotide et un nucléoside en précisant sur quel carbone du sucre se font les différents assemblages :

L ADN. Schématisez un nucléotide et un nucléoside en précisant sur quel carbone du sucre se font les différents assemblages : L ADN. I. GENERALITES. A. Les caractéristiques de l ADN. Donnez les 6 caractéristiques de l ADN : B. Les nucléotides/nucléosides : Schématisez un nucléotide et un nucléoside en précisant sur quel carbone

Plus en détail

Perl Orienté Objet BioPerl There is more than one way to do it

Perl Orienté Objet BioPerl There is more than one way to do it Perl Orienté Objet BioPerl There is more than one way to do it Bérénice Batut, berenice.batut@udamail.fr DUT Génie Biologique Option Bioinformatique Année 2014-2015 Perl Orienté Objet - BioPerl Rappels

Plus en détail

ARN et bioinformatique: PDF processed with CutePDF evaluation edition www.cutepdf.com

ARN et bioinformatique: PDF processed with CutePDF evaluation edition www.cutepdf.com ARN et bioinformatique: Partie 1 PDF processed with CutePDF evaluation edition www.cutepdf.com Sommaire Principes biologiques : Transcription/traduction, types d ARN, formes primaires/secondaires. Zuker

Plus en détail

Corrigé du TD1. Exercice 1:

Corrigé du TD1. Exercice 1: Corrigé du TD1 Exercice 1: le but était d'aligner des séquences à la main et de compter les substitutions entre acides aminés observées. Le résultat se trouve à cette adresse: http://tagc.univ-mrs.fr/herrmann/bio6/displaymatrix.php

Plus en détail

PRINCIPALES TECHNIQUES UTILISEES EN GENOMIQUE

PRINCIPALES TECHNIQUES UTILISEES EN GENOMIQUE PRINCIPALES TECHNIQUES UTILISEES EN GENOMIQUE Définitions généralités Quelques chiffres 46 chromosomes 22 paires d autosomes (n=44) 1 paire de gonosomes (n=2) : XX/F et XY/H 300 bandes cytogénétiques =

Plus en détail

Influence du nombre de réplicats dans une analyse différentielle de données RNAseq

Influence du nombre de réplicats dans une analyse différentielle de données RNAseq Influence du nombre de réplicats dans une analyse différentielle de données RNAseq Statisticiens: Sophie Lamarre Steve Van Ginkel Sébastien Déjean - Magali San Cristobal Matthieu Vignes Biologistes: Stéphane

Plus en détail

Fiche sujet candidat 1/2

Fiche sujet candidat 1/2 Fiche sujet candidat 1/2 Mise en situation et recherche à mener Dans le cytoplasme, la synthèse de protéine constitue l expression de l information génétique contenue dans l ADN. Pour aboutir à cette synthèse

Plus en détail

Extraction des séquences inter-langues pour la Traduction Automatique

Extraction des séquences inter-langues pour la Traduction Automatique Extraction des séquences inter-langues pour la Traduction Automatique Cyrine Nasri LORIA MOSIC Dirigée par : Pr. Kamel Smaili, Pr. Yahya Slimani et Dr Chiraz Latiri 1/26 Cyrine Nasri Extraction des séquences

Plus en détail

AutoGRAPH Un serveur pour automatiser et visualiser la comparaison de génomes: Application à l identification de nouveaux gènes chez le chien.

AutoGRAPH Un serveur pour automatiser et visualiser la comparaison de génomes: Application à l identification de nouveaux gènes chez le chien. AutoGRAPH Un serveur pour automatiser et visualiser la comparaison de génomes: Application à l identification de nouveaux gènes chez le chien. Thomas DERRIEN CNRS-UMR6061 Génétique et Développement Université

Plus en détail

Méthodes d apprentissage :

Méthodes d apprentissage : Méthodes d apprentissage : application au tri de complexes protéines-protéines Jérôme Azé Apprentissage: tâches Apprentissage non supervisé (Eisen, ) Apprentissage supervisé (arbres de décision, k-ppv,

Plus en détail

Plus courts chemins, programmation dynamique

Plus courts chemins, programmation dynamique 1 Plus courts chemins, programmation dynamique 1. Plus courts chemins à partir d un sommet 2. Plus courts chemins entre tous les sommets 3. Semi-anneau 4. Programmation dynamique 5. Applications à la bio-informatique

Plus en détail

THEME 1 A EXPRESSION, STABILITE ET VARIATION DU PATRIMOINE GENETIQUE

THEME 1 A EXPRESSION, STABILITE ET VARIATION DU PATRIMOINE GENETIQUE THEME 1 A EXPRESSION, STABILITE ET VARIATION DU PATRIMOINE GENETIQUE CHAPITRE 3 L EXPRESSION DU PATRIMOINE GENETIQUE I. LA RELATION GENES-PROTEINES Les protéines interviennent dans le fonctionnement d

Plus en détail

La synthèse des protéines transcription code génétique traduction

La synthèse des protéines transcription code génétique traduction CEC André-Chavanne BIO 3 OS La synthèse des protéines transcription code génétique traduction I. La «Transcription» : de l ADN à l ARNm. L'adresse suivante permet d accéder à une ANIMATION sur la TRANSCRIPTION.

Plus en détail

Conception assistée par ordinateur de molécules thérapeutiques

Conception assistée par ordinateur de molécules thérapeutiques Conception assistée par ordinateur de molécules thérapeutiques D. Gilis Bioinformatique génomique et structurale Faculté des sciences appliquées Université Libre de Bruxelles Objectif: illustrer en quoi

Plus en détail

Projet informatique «Voyageur de commerce» Résolution approchée par algorithme génétique du problème du voyageur de commerce

Projet informatique «Voyageur de commerce» Résolution approchée par algorithme génétique du problème du voyageur de commerce Année 2007-2008 Projet informatique «Voyageur de commerce» Résolution approchée par algorithme génétique du problème du voyageur de commerce B. Monsuez Projet informatique «Voyageur de commerce» Résolution

Plus en détail

Séquençage. Bérénice Batut, berenice.batut@udamail.fr. DUT Génie Biologique Option Bioinformatique Année 2014-2015

Séquençage. Bérénice Batut, berenice.batut@udamail.fr. DUT Génie Biologique Option Bioinformatique Année 2014-2015 Séquençage Bérénice Batut, berenice.batut@udamail.fr DUT Génie Biologique Option Bioinformatique Année 2014-2015 Séquençage Séquençage ADN Détermination de l ordre d enchainement des nucléotides d un fragment

Plus en détail

Langages de spécification cours 4

Langages de spécification cours 4 Langages de spécification cours 4 Diagrammes de décision binaire(bdd) Catalin Dima Arbres de décision binaire Étant donnée une formule logique, on peut lui associer un arbre qui permet d évaluer la valeur

Plus en détail

Recherche de parenté entre les vertébrés

Recherche de parenté entre les vertébrés 1 CHAPITRE A Recherche de parenté entre les vertébrés 2 Chapitre A : Recherche de parentés entre les êtres vivants Tous les êtres vivants présentent des structures cellulaires et un fonctionnement commun

Plus en détail

Resolution limit in community detection

Resolution limit in community detection Introduction Plan 2006 Introduction Plan Introduction Introduction Plan Introduction Point de départ : un graphe et des sous-graphes. But : quantifier le fait que les sous-graphes choisis sont des modules.

Plus en détail

Théorie des graphes. Introduction. Programme de Terminale ES Spécialité. Résolution de problèmes à l aide de graphes. Préparation CAPES UCBL

Théorie des graphes. Introduction. Programme de Terminale ES Spécialité. Résolution de problèmes à l aide de graphes. Préparation CAPES UCBL Introduction Ces quelques pages ont pour objectif de vous initier aux notions de théorie des graphes enseignées en Terminale ES. Le programme de Terminale (voir ci-après) est construit sur la résolution

Plus en détail

Module Analyse de Génomes 2011-2012 Master 2 module FMBS 326 Immunoinformatique

Module Analyse de Génomes 2011-2012 Master 2 module FMBS 326 Immunoinformatique Module Analyse de Génomes 2011-2012 Master 2 module FMBS 326 Immunoinformatique Planning du Module : Date Heure Salle 12/12 9h-12h TD info TA1Z bat 25 13h-17h TD info TA1Z bat 25 13/12 9h-12h TD info TA1Z

Plus en détail

Quelques termes-clef de biologie moléculaire et leur définition

Quelques termes-clef de biologie moléculaire et leur définition Acide aminé (AA) Quelques termes-clef de biologie moléculaire et leur définition Isabelle Quinkal INRIA Rhône-Alpes Septembre 2003 Petite molécule dont l enchaînement compose les protéines - on dit qu

Plus en détail

Évaluer les liens entre codage et les données structurées (variables) Introduction au gestionnaire de rapport et au journal de commandes

Évaluer les liens entre codage et les données structurées (variables) Introduction au gestionnaire de rapport et au journal de commandes Trois approches en analyse de texte L'Analyse Qualitative L'analyse de Contenu Quantitative (par dictionnaires) Le forage de texte ("Text Mining") Introduction aux logiciels de Provalis Research QDA Miner

Plus en détail

Transformée de Burrows-Wheeler et mapping de données RNA-seq

Transformée de Burrows-Wheeler et mapping de données RNA-seq Transformée de Burrows-Wheeler et mapping de données RNA-seq MAPPI, journée indexation 6 juin 2011 Introduction Indexation But : Recherche rapide d'une information dans de grands volumes de données Indexation

Plus en détail

Enjeux des données de la recherche pour l'inra

Enjeux des données de la recherche pour l'inra Enjeux des données de la recherche pour l'inra C. Gaspin1 & O. Hologne2 1 Département de Mathématique et Informatique Appliques INRA Toulouse 2 Délégation Information Scientifique et Technique INRA Versailles

Plus en détail

Chapitre 2. La synthèse protéique : la relation entre le génotype et le phénotype.

Chapitre 2. La synthèse protéique : la relation entre le génotype et le phénotype. Chapitre 2. La synthèse protéique : la relation entre le génotype et le phénotype. Les maladies génétiques comme la drépanocytose ou l'albinisme sont liées à des modifications du génotype des individus

Plus en détail

SESSION 2014 MATHÉMATIQUES. Série : SCIENCES ET TECHNOLOGIES DU MANAGEMENT ET DE LA GESTION STMG. DURÉE DE L ÉPREUVE : 3 heures COEFFICIENT : 3

SESSION 2014 MATHÉMATIQUES. Série : SCIENCES ET TECHNOLOGIES DU MANAGEMENT ET DE LA GESTION STMG. DURÉE DE L ÉPREUVE : 3 heures COEFFICIENT : 3 BACCALAURÉAT TECHNOLOGIQUE SESSION 2014 MATHÉMATIQUES Série : SCIENCES ET TECHNOLOGIES DU MANAGEMENT ET DE LA GESTION STMG DURÉE DE L ÉPREUVE : 3 heures COEFFICIENT : 3 Calculatrice autorisée, conformément

Plus en détail

CHAPITRE 3 LA SYNTHESE DES PROTEINES

CHAPITRE 3 LA SYNTHESE DES PROTEINES CHAITRE 3 LA SYNTHESE DES ROTEINES On sait qu un gène détient dans sa séquence nucléotidique, l information permettant la synthèse d un polypeptide. Ce dernier caractérisé par sa séquence d acides aminés

Plus en détail

Formavie 2010. 2 Différentes versions du format PDB...3. 3 Les champs dans les fichiers PDB...4. 4 Le champ «ATOM»...5. 6 Limites du format PDB...

Formavie 2010. 2 Différentes versions du format PDB...3. 3 Les champs dans les fichiers PDB...4. 4 Le champ «ATOM»...5. 6 Limites du format PDB... Formavie 2010 Les fichiers PDB Les fichiers PDB contiennent les informations qui vont permettre à des logiciels de visualisation moléculaire (ex : RasTop ou Jmol) d afficher les molécules. Un fichier au

Plus en détail

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq Présenté par Xi LIU ATCGCGCTAGCTGGTGTATCGCATCGCGCTAGCTGGTGTATCGCGCTAGCTGGTGTATCGCGCTAGCCTGGTGTATCGCCATCGCGCTAGCTGGCGCTAGCTGAATCGCGCATATG 17 Septembre 2013 Homéoallèles Génome Normalisation Analyse différentielle

Plus en détail

Introduc)on à Ensembl/ Biomart : Par)e pra)que

Introduc)on à Ensembl/ Biomart : Par)e pra)que Introduc)on à Ensembl/ Biomart : Par)e pra)que Stéphanie Le Gras Jean Muller NAVIGUER DANS ENSEMBL : PARTIE PRATIQUE 2 Naviga)on dans Ensembl : Pra)que Exercice 1 1.a. Quelle est la version de l assemblage

Plus en détail

ALIGNEMENT PLUS RAPIDE

ALIGNEMENT PLUS RAPIDE ALIGNEMENT PLUS RAPIDE 1. méthodes heuristiques : hachage, arbres de suffixe, PD limitée (taille totale de trous bornée) 2. PD éparse (pour sous-séquence commune ou chaînage en alignement global heuristique)

Plus en détail

www.habefast.ch contact@habefast.ch Agence web en Suisse romande CH-1260 Nyon 022 362 25 70

www.habefast.ch contact@habefast.ch Agence web en Suisse romande CH-1260 Nyon 022 362 25 70 1 By Agence web en Suisse romande 2 Qu est ce qu est le SEO? Le référencement naturel ou SEO (Search Engine Optimisation) est une pratique qui, comme son nom l indique, permet d optimiser un site web pour

Plus en détail

«Défaire» un nombre entier pour en faire une liste dont les éléments sont les chiffres de ce nombre. Deux applications.

«Défaire» un nombre entier pour en faire une liste dont les éléments sont les chiffres de ce nombre. Deux applications. «Défaire» un nombre entier pour en faire une liste dont les éléments sont les chiffres de ce nombre. Deux applications. En fait, ce sont les applications en question qui posent le problème du titre : Première

Plus en détail

Le Data Mining au service du Scoring ou notation statistique des emprunteurs!

Le Data Mining au service du Scoring ou notation statistique des emprunteurs! France Le Data Mining au service du Scoring ou notation statistique des emprunteurs! Comme le rappelle la CNIL dans sa délibération n 88-083 du 5 Juillet 1988 portant adoption d une recommandation relative

Plus en détail

Formation Galaxy 13 Novembre 2014. 1 Premiers Pas

Formation Galaxy 13 Novembre 2014. 1 Premiers Pas Formation Galaxy 13 Novembre 2014 1 1-1 Connexion 1 Premiers Pas Connectez-vous sur la plateforme Galaxy SouthGreen à l adresse suivante : http://gohelle.cirad.fr/galaxy/ Utiliser votre adresse email et

Plus en détail

Introduction à l Algorithmique

Introduction à l Algorithmique Introduction à l Algorithmique N. Jacon 1 Définition et exemples Un algorithme est une procédure de calcul qui prend en entier une valeur ou un ensemble de valeurs et qui donne en sortie une valeur ou

Plus en détail

Identification de nouveaux membres dans des familles d'interleukines

Identification de nouveaux membres dans des familles d'interleukines Identification de nouveaux membres dans des familles d'interleukines Nicolas Beaume Jérôme Mickolajczak Gérard Ramstein Yannick Jacques 1ère partie : Définition de la problématique Les familles de gènes

Plus en détail

PRÉSENTATION DE LA BIOINFORMATIQUE

PRÉSENTATION DE LA BIOINFORMATIQUE PRÉSENTATION DE LA BIOINFORMATIQUE O. Collin CNRS IRISA GenOuest 7 octobre 2013 Warming session Poser le décor pour les 3 jours Mise en évidence et mise en relation des éléments clés Réflexions sur quelques

Plus en détail

Big Data et Graphes : Quelques pistes de recherche

Big Data et Graphes : Quelques pistes de recherche Big Data et Graphes : Quelques pistes de recherche Hamamache Kheddouci http://liris.cnrs.fr/hamamache.kheddouci Laboratoire d'informatique en Image et Systèmes d'information LIRIS UMR 5205 CNRS/INSA de

Plus en détail

WEBANALYTICS Sur le chemin de l excellence

WEBANALYTICS Sur le chemin de l excellence WEBANALYTICS Sur le chemin de l excellence Une démarche centrée sur l évaluation de sa propre performance! 2004-2008 Philippe FLOC H Strategic Consulting Tous droits réservés Reproduction interdite WEBMETRICS

Plus en détail

Julien MATHEVET Alexandre BOISSY GSID 4. Rapport RE09. Load Balancing et migration

Julien MATHEVET Alexandre BOISSY GSID 4. Rapport RE09. Load Balancing et migration Julien MATHEVET Alexandre BOISSY GSID 4 Rapport Load Balancing et migration Printemps 2001 SOMMAIRE INTRODUCTION... 3 SYNTHESE CONCERNANT LE LOAD BALANCING ET LA MIGRATION... 4 POURQUOI FAIRE DU LOAD BALANCING?...

Plus en détail

S541 S851 LA GESTION DE PROJET

S541 S851 LA GESTION DE PROJET S541 S851 LA GESTION DE PROJET On appelle projet l'ensemble des actions à entreprendre afin de répondre à un besoin défini dans des délais fixés. Ainsi un projet étant une action temporaire avec un début

Plus en détail

makeblastdb in genome.fasta dbtype nucl title nom_genome out nom_genome_blastdb

makeblastdb in genome.fasta dbtype nucl title nom_genome out nom_genome_blastdb Note du 19 mai 2011 La version de BLAST utilisée dans ce document de mars 2010 est obsolète. Les nouveaux utilisateurs de BLAST devraient directement apprendre et utiliser les commandes BLAST+. L'intégralité

Plus en détail

Cours d introduction à la génétique de la souris Notion de Souche

Cours d introduction à la génétique de la souris Notion de Souche Cours d introduction à la génétique de la souris Notion de Souche Introduction: - Réponse d un animal à l expérimentation (diapo 1) Facteurs environnementaux et propres à l animal - Notion d animal standardisé

Plus en détail

Exercices théoriques

Exercices théoriques École normale supérieure 2008-2009 Département d informatique Algorithmique et Programmation TD n 9 : Programmation Linéaire Avec Solutions Exercices théoriques Rappel : Dual d un programme linéaire cf.

Plus en détail

Analyse et contrôle de la qualité des données utilisées lors des expertises de barrages

Analyse et contrôle de la qualité des données utilisées lors des expertises de barrages Analyse et contrôle de la qualité des données utilisées lors des expertises de barrages Corinne Curt et Aurélie Talon JFMS10 24-26/03/2010 - Toulouse Evaluation de la fiabilité et de la sécurité des barrages

Plus en détail

Recherche et analyse de polymorphismes SNP

Recherche et analyse de polymorphismes SNP Recherche et analyse de polymorphismes SNP 1- Tablet : Détection visuelle de SNP avec Tablet Tablet est un outil graphique de visualisation d assemblage et d alignement de séquences issues de NGS (Next

Plus en détail

Equilibre de charge. Equilibre de charge statique Equilibre de charge dynamique

Equilibre de charge. Equilibre de charge statique Equilibre de charge dynamique Equilibre de charge Equilibre de charge statique Equilibre de charge dynamique Approches centralisées Approches distribuées Approches semi-distribuées Jaillet Info53 - L3 Informatique - 2006 1 Equilibre

Plus en détail

Quantification Scalaire et Prédictive

Quantification Scalaire et Prédictive Quantification Scalaire et Prédictive Marco Cagnazzo Département Traitement du Signal et des Images TELECOM ParisTech 7 Décembre 2012 M. Cagnazzo Quantification Scalaire et Prédictive 1/64 Plan Introduction

Plus en détail

Algorithmique P2. HeapSort et files de priorité Ulg, 2009-2010 Renaud Dumont

Algorithmique P2. HeapSort et files de priorité Ulg, 2009-2010 Renaud Dumont Algorithmique P2 HeapSort et files de priorité Ulg, 2009-2010 Renaud Dumont Structure de tas - arbre Un tas est une structure de données qui Permet un nouveau type de tri (Tri par tas) Permet l'implémentation

Plus en détail

CERTIFICAT DE COMPÉTENCES EN BIO-INFORMATIQUE

CERTIFICAT DE COMPÉTENCES EN BIO-INFORMATIQUE CERTIFICAT DE COMPÉTENCES EN BIO-INFORMATIQUE Organisé par l équipe pédagogique : Statistique bioinformatique du département IMATH Responsable de la formation : Pr. Jean-François Zagury Coordinateur des

Plus en détail

Les algorithmes de base du graphisme

Les algorithmes de base du graphisme Les algorithmes de base du graphisme Table des matières 1 Traçage 2 1.1 Segments de droites......................... 2 1.1.1 Algorithmes simples.................... 3 1.1.2 Algorithmes de Bresenham (1965).............

Plus en détail

ZIMINA-POIROT Maria (SYLED - ILPGA, Sorbonne nouvelle Paris 3) zimina@msh-paris.fr

ZIMINA-POIROT Maria (SYLED - ILPGA, Sorbonne nouvelle Paris 3) zimina@msh-paris.fr Thème : Corpus multilingues et alignements textométriques TP «Analyse de corpus de textes juridiques (français/anglais) à l aide d outils de statistique textuelle Lexico3». Ressources : le corpus TRAD_JUR

Plus en détail

Machine Learning et Scoring à valeurs

Machine Learning et Scoring à valeurs Machine Learning et Scoring à valeurs discrètes Félix Baschenis 23 Juin 2010 Table des matières 1 Introduction 1 1.1 Le Challenge Netflix....................... 2 1.2 Formalisation du problème....................

Plus en détail

Quelques points de traitement du signal

Quelques points de traitement du signal Quelques points de traitement du signal Introduction: de la mesure au traitement Source(s) BRUIT BRUIT Système d acquisition Amplitude (Pa) Temps (s) Amplitude (Pa) Mesure Opérations mathématiques appliquées

Plus en détail

Clermont Ferrand - Janvier 2003

Clermont Ferrand - Janvier 2003 DISDAMIN: Algorithmes de Data Mining Distribués Valerie FIOLET (1,2) - Bernard TOURSEL (1) 1 Equipe PALOMA - LIFL - USTL - LILLE (FRANCE) 2 Service Informatique - UMH - MONS (BELGIUM) Clermont Ferrand

Plus en détail

THÈME 3 : DU GÉNOTYPE AU PHÉNOTYPE. CHAPITRE 1 : la relation entre ADN et protéines

THÈME 3 : DU GÉNOTYPE AU PHÉNOTYPE. CHAPITRE 1 : la relation entre ADN et protéines THÈME 3 : DU GÉNOTYPE AU PHÉNOTYPE CHAPITRE 1 : la relation entre ADN et protéines Les caractères d un individu dépendent de plusieurs facteurs : certains dépendent des caractères présents dans la famille

Plus en détail

Bases d algorithmique

Bases d algorithmique Bases d algorithmique Christophe ROSSIGNOL Année scolaire 2015/2016 Table des matières 1 Un peu de vocabulaire 2 1.1 Qu est-ce qu un algorithme?....................................... 2 1.2 Variable, affectation...........................................

Plus en détail

SemWeb : Interrogation sémantique du web avec XQuery. Les membres du projet SemWeb

SemWeb : Interrogation sémantique du web avec XQuery. Les membres du projet SemWeb SemWeb : Interrogation sémantique du web avec XQuery Les membres du projet SemWeb Contexte et objectifs Le projet SemWeb s inscrit dans les efforts de recherche et de développement actuels pour construire

Plus en détail

Vision par Ordinateur

Vision par Ordinateur Vision par Ordinateur James L. Crowley DEA IVR Premier Bimestre 2005/2006 Séance 6 23 novembre 2005 Détection et Description de Contraste Plan de la Séance : Description de Contraste...2 Le Détecteur de

Plus en détail

Sauvegarde collaborative entre pairs Ludovic Courtès LAAS-CNRS

Sauvegarde collaborative entre pairs Ludovic Courtès LAAS-CNRS Sauvegarde collaborative entre pairs 1 Sauvegarde collaborative entre pairs Ludovic Courtès LAAS-CNRS Sauvegarde collaborative entre pairs 2 Introduction Pourquoi pair à pair? Utilisation de ressources

Plus en détail

à moyen Risque moyen Risq à élevé Risque élevé Risq e Risque faible à moyen Risq Risque moyen à élevé Risq

à moyen Risque moyen Risq à élevé Risque élevé Risq e Risque faible à moyen Risq Risque moyen à élevé Risq e élevé Risque faible Risq à moyen Risque moyen Risq à élevé Risque élevé Risq e Risque faible à moyen Risq Risque moyen à élevé Risq L e s I n d i c e s F u n d a t a é Risque Les Indices de faible risque

Plus en détail

Les logiciels Ucinet et Netdraw

Les logiciels Ucinet et Netdraw École d été Web intelligence 6 au 10 juillet 2009 Les graphes et leurs différentes formes Des données à la construction du graphe Une forme plus avancée de représentation Densité d un graphe Graphe connexe

Plus en détail

Analyses de Variance à un ou plusieurs facteurs Régressions Analyse de Covariance Modèles Linéaires Généralisés

Analyses de Variance à un ou plusieurs facteurs Régressions Analyse de Covariance Modèles Linéaires Généralisés Analyses de Variance à un ou plusieurs facteurs Régressions Analyse de Covariance Modèles Linéaires Généralisés Professeur Patrice Francour francour@unice.fr Une grande partie des illustrations viennent

Plus en détail

Mieux comprendre les certificats SSL THAWTE EST L UN DES PRINCIPAUX FOURNISSEURS DE CERTIFICATS SSL DANS LE MONDE

Mieux comprendre les certificats SSL THAWTE EST L UN DES PRINCIPAUX FOURNISSEURS DE CERTIFICATS SSL DANS LE MONDE Mieux comprendre les certificats SSL THAWTE EST L UN DES PRINCIPAUX FOURNISSEURS DE CERTIFICATS SSL DANS LE MONDE sommaire MIEUX COMPRENDRE LES CERTIFICATS SSL...1 SSL et certificats SSL : définition...1

Plus en détail

DB Main Bien débuter.

DB Main Bien débuter. DB Main Bien débuter. Downloader depuis http://www.info.fundp.ac.be/~dbm/ L élaboration d une base de données se fait en 4 étapes : 1. L analyse conceptionnelle 2. Le MCD modèle conceptuel de données.

Plus en détail

Algorithmique dans les nouveaux programmes de Première

Algorithmique dans les nouveaux programmes de Première Algorithmique dans les nouveaux programmes de Première Journée de présentation des nouveaux programmes de Première académie de Nice Les nouveaux programmes de Première 2011 1 I. Introduction 1. Acquis

Plus en détail

Arbres de décisions et forêts aléatoires.

Arbres de décisions et forêts aléatoires. Arbres de décisions et forêts aléatoires. Pierre Gaillard 7 janvier 2014 1 Plan 1 Arbre de décision 2 Les méthodes d ensembles et les forêts aléatoires 2 Introduction 3 Introduction Jeu de données (ex

Plus en détail

PROPOSITION D UNE APPROCHE DE SEGMENTATION D IMAGES HYPERSPECTRALES

PROPOSITION D UNE APPROCHE DE SEGMENTATION D IMAGES HYPERSPECTRALES PROPOSITION D UNE APPROCHE DE SEGMENTATION D IMAGES HYPERSPECTRALES Nathalie GORRETTA MONTEIRO 1 1 UMR Information et Technologies pour les Agro-Procédés, Cemagref Montpellier, France Présentée le 25 Février

Plus en détail

Manuel des bonnes pratiques avec CATIA V.5

Manuel des bonnes pratiques avec CATIA V.5 2009 Manuel des bonnes pratiques avec CATIA V.5 Pour aller plus loin dans la maîtrise de l outil CAO Ce document a pour objectif de donner des méthodologies et règles de travail qui permettent de mener

Plus en détail

ParMat : Parallélisation pour la simulation des Matériaux.

ParMat : Parallélisation pour la simulation des Matériaux. : Parallélisation pour la simulation des Matériaux. G. Bencteux (EDF) 3 septembre 2008 Outline 1 2 Un algorithme d ordre N pour les calculs ab initio (DFT/HF) 3 Simulation du dommage d irradiation par

Plus en détail