AutoGRAPH Un serveur pour automatiser et visualiser la comparaison de génomes: Application à l identification de nouveaux gènes chez le chien.

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimension: px
Commencer à balayer dès la page:

Download "AutoGRAPH Un serveur pour automatiser et visualiser la comparaison de génomes: Application à l identification de nouveaux gènes chez le chien."

Transcription

1 AutoGRAPH Un serveur pour automatiser et visualiser la comparaison de génomes: Application à l identification de nouveaux gènes chez le chien. Thomas DERRIEN CNRS-UMR6061 Génétique et Développement Université de Rennes 1 3ème année de thèse sous la direction Catherine André et Christophe Hitte

2 Introduction à la cartographie comparée des génomes De plus en plus de génomes séquencés. Nécessité d annoter ces nouveaux génomes (séquences fonctionnelles codantes ou non) Comparer l organisation des génomes => Dynamique d évolution des chromosomes.

3 Définitions (1/2): Les ancres de comparaison Utilisation de points d ancrage entre les génomes: - Séquences d ADN conservées : gènes, éléments répétés... - Gènes orthologues -

4 Définitions (1/2): Les ancres de comparaison Utilisation de points d ancrage entre les génomes: - Séquences d ADN conservées : gènes, éléments répétés... - Gènes orthologues - Orthologues: gène A.1 et A.2 Génome ancestral gène A gène B SPECIATION = gènes homologues qui ont été séparés par un événement de spéciation mais qui dérivent du même gène ancestral commun Génome 1 gène A.1 gène B.1 Génome 2 gène A.2 gène B.2

5 Définitions (1/2): Les ancres de comparaison Utilisation de points d ancrage entre les génomes: - Séquences d ADN conservées : gènes, éléments répétés... - Gènes orthologues - Orthologues: gène A.1 et A.2 Génome ancestral gène A gène B SPECIATION = gènes homologues qui ont été séparés par un événement de spéciation mais qui dérivent du même gène ancestral commun Génome 1 gène A.1 gène B.1 DUPLICATION Génome moderne 1 gène A.1 gène B.1 gène B.1 Génome 2 gène A.2 gène B.2 Génome moderne 2 gène A.2 gène B.2 Paralogues: gène B.1 et B.1 =gènes homologues qui ont été séparés par des événements de duplication.

6 Définitions (2/2): Les segments conservés et rupture de synténie Chien: Référence Homme: Génome testé HSA 2 gène canin gène humain orthologue relation d orthologie entre les gènes des deux espèces (1:1) HSA 3 Chromosome 1 (CFA 1) Segments conservés humains synténiques du CFA 1 2 segments conservés (CS) entre le CFA 1 et le génome humain : HSA_2 et HSA_3. 2 segments conservés ordonnés (CSO) au sein du segment conservé CFA_1/HSA_2. Rupture de synténie entre les 2 segments conservés.

7 Définitions (2/2): Les segments conservés et rupture de synténie Chien: Référence Homme: Génome testé HSA 2 gène canin gène humain orthologue relation d orthologie entre les gènes des deux espèces (1:1) HSA 3 Chromosome 1 (CFA 1) Segments conservés humains synténiques du CFA 1 2 segments conservés (CS) entre le CFA 1 et le génome humain : HSA_2 et HSA_3. 2 segments conservés ordonnés (CSO) au sein du segment conservé CFA_1/HSA_2. Rupture de synténie entre les 2 segments conservés.

8 Définitions (2/2): Les segments conservés et rupture de synténie Chien: Référence Homme: Génome testé HSA 2 gène canin gène humain orthologue relation d orthologie entre les gènes des deux espèces (1:1) HSA 3 rupture de synténie (breakpoint) entre 2 CS. Chromosome 1 (CFA 1) Segments conservés humains synténiques du CFA 1 2 segments conservés (CS) entre le CFA 1 et le génome humain : HSA_2 et HSA_3. 2 segments conservés ordonnés (CSO) au sein du segment conservé CFA_1/HSA_2. Rupture de synténie entre les 2 segments conservés.

9 Définitions (2/2): Les segments conservés et rupture de synténie Chien: Référence Homme: Génome testé HSA 2 gène canin gène humain orthologue relation d orthologie entre les gènes des deux espèces (1:1) Chromosome 1 (CFA 1) Segments conservés humains synténiques du CFA 1 HSA 3 rupture de synténie (breakpoint) entre 2 CS. Segments Conservés Ordonnés 2 segments conservés (CS) entre le CFA 1 et le génome humain : HSA_2 et HSA_3. 2 segments conservés ordonnés (CSO) au sein du segment conservé CFA_1/HSA_2. Rupture de synténie entre les 2 segments conservés.

10 Définitions (2/2): Les segments conservés et rupture de synténie Chien: Référence Homme: Génome testé HSA 2 gène canin gène humain orthologue relation d orthologie entre les gènes des deux espèces (1:1) Chromosome 1 (CFA 1) Segments conservés humains synténiques du CFA 1 HSA 3 rupture de synténie (breakpoint) entre 2 CS. Segments Conservés Ordonnés point de cassure (breakpoint) entre 2 CSO. 2 segments conservés (CS) entre le CFA 1 et le génome humain : HSA_2 et HSA_3. 2 segments conservés ordonnés (CSO) au sein du segment conservé CFA_1/HSA_2. Rupture de synténie entre les 2 segments conservés.

11 c Application: Cartographie comparée Chien/Homme chr1 chr2 Cartographie de 10,000 gènes canins par la méthode des hybrides d irradiation. (Hitte C. et al, Nat. Rev. Genet. 2005) Canis familiaris : 38 autosomes + XY - But : Localiser et ordonner les gènes sur les chromosomes du génome du chien. - Chaque séquence de gène canin a été identifiée par rapport à l orthologue humain. => 10,000 ancres Chien/Hommes. Autre ressource: - Broad Institute. - Séquençage du génome du chien (Lindblad-Toh K. et al, Nature 2005) => carte RH : guider l'assemblage de la séquence.

12 AutoGRAPH: un serveur de cartographie comparée: Développer un outil capable de comparer: => comparaison intra-espèce. - plusieurs ressources (séquence, RH...) pour une même espèce, le chien. => comparaison inter-espèces - plusieurs espèces (Chien/Homme...) pour un même ressource. (identification des CS, CSO et rupture de synténie)

13 Exemple de la Comparaison inter-espèce: Méthodologie Identification des Segments Conservés (CS), Segments Conservés ordonnés (CSO) et rupture de synténie (breakpoints) Chr. Référence Testé Tri selon le génome de référence de chaque marqueur auquel on associe un entier 2- Identification des CS en fonction de l attribution chromosomique sur le génome testé

14 Exemple de la Comparaison inter-espèce: Méthodologie Identification des Segments Conservés (CS), Segments Conservés ordonnés (CSO) et rupture de synténie (breakpoints) Chr. Référence Testé Tri selon le génome de référence de chaque marqueur auquel on associe un entier 2- Identification des CS en fonction de l attribution chromosomique sur le génome testé

15 Exemple de la Comparaison inter-espèce: Méthodologie Identification des Segments Conservés (CS), Segments Conservés ordonnés (CSO) et rupture de synténie (breakpoints) Chr. Référence Testé Tri selon le génome de référence de chaque marqueur auquel on associe un entier 2- Identification des CS en fonction de l attribution chromosomique sur le génome testé

16 Exemple de la Comparaison inter-espèce: Méthodologie Identification des Segments Conservés (CS), Segments Conservés ordonnés (CSO) et rupture de synténie (breakpoints) Chr. Référence Testé Tri selon le génome de référence de chaque marqueur auquel on associe un entier 2- Identification des CS en fonction de l attribution chromosomique sur le génome testé 3- Déduction du bkpt CS

17 Exemple de la Comparaison inter-espèce: Méthodologie Identification des Segments Conservés (CS), Segments Conservés ordonnés (CSO) et rupture de synténie (breakpoints) Chr. Référence Testé Fonction d'adjacence T(i) - T(i) Tri selon le génome de référence de chaque marqueur auquel on associe un entier 2- Identification des CS en fonction de l attribution chromosomique sur le génome testé 3- Déduction du bkpt CS 4- Fonction d adjacence

18 Exemple de la Comparaison inter-espèce: Méthodologie Identification des Segments Conservés (CS), Segments Conservés ordonnés (CSO) et rupture de synténie (breakpoints) Chr. Référence Testé Fonction d'adjacence T(i) - T(i) Tri selon le génome de référence de chaque marqueur auquel on associe un entier 2- Identification des CS en fonction de l attribution chromosomique sur le génome testé 3- Déduction du bkpt CS 4- Fonction d adjacence 5- Définition des CSO en fonction d une pénalité définie par l utilisateur.

19 AutoGRAPH: un serveur interactif 2 modules disponibles: Construction de cartes à partir des données (pré)insérées <=> 6 génomes. Construction de cartes à partir des données insérées par l utilisateur.

20 Comparaison intra-espèce: Exemple de l intégration de 2 ressources Comparaison de l'ordre des gènes donné selon la construction RH et selon la séquence Chromosome 11 canin : CFA_11 selon RH et Séquence. =>Insertion des données dans les champs textes correspondants => Format des données spécifiques RH data Sequence data

21 Méthode générale: Iden tifia Jeu de données de l utilisateur Chr omo Loc alisa Chr omo Loc alisa Chr omo Loc alisa GEN CFA 6.3 CFA 3039 HSA 2004 GEN CFA 14.9 CFA 3190 HSA 2002 GEN CFA 28.3 CFA 3258 HSA 2002 GEN CFA 51.6 CFA 3658 HSA 1997 GEN CFA 64.9 CFA 3873 HSA 1994 GEN CFA 72.3 CFA 3987 HSA 1992 GEN CFA 79.6 CFA 4072 HSA 1991 GEN CFA 84.4 CFA 4121 HSA 1991 GEN CFA CFA 4192 HSA 1990 GEN CFA CFA 4246 HSA 1989 GEN CFA CFA 4440 HSA 1987 GEN CFA CFA 4500 HSA 1986 GEN CFA CFA 4616 HSA 1985 GEN CFA CFA 4726 HSA 1984 Insertion

22 Méthode générale: Iden tifia Jeu de données de l utilisateur Chr omo Loc alisa Chr omo Loc alisa Chr omo Loc alisa GEN CFA 6.3 CFA 3039 HSA 2004 GEN CFA 14.9 CFA 3190 HSA 2002 GEN CFA 28.3 CFA 3258 HSA 2002 GEN CFA 51.6 CFA 3658 HSA 1997 GEN CFA 64.9 CFA 3873 HSA 1994 GEN CFA 72.3 CFA 3987 HSA 1992 GEN CFA 79.6 CFA 4072 HSA 1991 GEN CFA 84.4 CFA 4121 HSA 1991 GEN CFA CFA 4192 HSA 1990 GEN CFA CFA 4246 HSA 1989 GEN CFA CFA 4440 HSA 1987 GEN CFA CFA 4500 HSA 1986 GEN CFA CFA 4616 HSA 1985 GEN CFA CFA 4726 HSA 1984 Insertion Table temporaire MySQL

23 Méthode générale: Iden tifia Jeu de données de l utilisateur Chr omo Loc alisa Chr omo Loc alisa Chr omo Loc alisa GEN CFA 6.3 CFA 3039 HSA 2004 GEN CFA 14.9 CFA 3190 HSA 2002 GEN CFA 28.3 CFA 3258 HSA 2002 GEN CFA 51.6 CFA 3658 HSA 1997 GEN CFA 64.9 CFA 3873 HSA 1994 GEN CFA 72.3 CFA 3987 HSA 1992 GEN CFA 79.6 CFA 4072 HSA 1991 GEN CFA 84.4 CFA 4121 HSA 1991 GEN CFA CFA 4192 HSA 1990 GEN CFA CFA 4246 HSA 1989 GEN CFA CFA 4440 HSA 1987 GEN CFA CFA 4500 HSA 1986 GEN CFA CFA 4616 HSA 1985 GEN CFA CFA 4726 HSA 1984 Insertion Table temporaire MySQL Extraction (ordre) Extraction des données de la table - PHP - Librairie Graphique GD

24 Méthode générale: Jeu de données de l utilisateur Table temporaire MySQL Iden Chr Loc Chr Loc Chr Loc tifia omo alisa omo alisa omo alisa GEN GEN GEN GEN GEN GEN GEN GEN GEN GEN GEN GEN GEN GEN CFA CFA CFA CFA CFA CFA CFA CFA CFA CFA CFA CFA CFA CFA CFA CFA CFA CFA CFA CFA CFA CFA CFA CFA CFA CFA CFA CFA HSA HSA HSA HSA HSA HSA HSA HSA HSA HSA HSA HSA HSA HSA Insertion Extraction (ordre) Représentation graphique des chromosomes. Visualisation Extraction des données de la table - PHP - Librairie Graphique GD

25 Comparaison intra-espèce: Exemple du CFA_11 Intégration Cartographie RH - Séquence du Broad pour le chromosome canin 11 (CFA 11) : - Colinéarité dans l ordre des marqueurs pour les 2 ressources. - Inversion dans la partie télomérique du CFA_11

26 Comparaison intra-espèce: Exemple du CFA_11 Intégration Cartographie RH - Séquence du Broad pour le chromosome canin 11 (CFA 11) : - Colinéarité dans l ordre des marqueurs pour les 2 ressources. - Inversion dans la partie télomérique du CFA_11 CFA11 - RH CFA11 - Séquence

27 Comparaison intra-espèce: Exemple du CFA_11 Intégration Cartographie RH - Séquence du Broad pour le chromosome canin 11 (CFA 11) : - Colinéarité dans l ordre des marqueurs pour les 2 ressources. - Inversion dans la partie télomérique du CFA_11 Nécessité de pouvoir comparer ces 2 jeux de données avec une 3ème ressource. CFA11 - RH CFA11 - Séquence Etendre AutoGRAPH pour la comparaison de 3 ressources.

28 Comparaison intra-espèce de 3 ressources: Intégration de 3 ressources : Cytogénétique - Cartographie RH - Séquence pour le chromosome canin 11 (CFA 11) : - Colinéarité RH / Cytogénétique. => Inversion observée peut-être imputée à un défaut d assemblage de la Séquence. CytoG RH Seq

29 Comparaison intra-espèce de 3 ressources: Intégration de 3 ressources : Cytogénétique - Cartographie RH - Séquence pour le chromosome canin 11 (CFA 11) : - Colinéarité RH / Cytogénétique. => Inversion observée peut-être imputée à un défaut d assemblage de la Séquence. => aboutit à un nouvel assemblage canfam 2 CytoG RH Seq (Lindblad-Toh K. et al, 2005)

30 Comparaison intra-espèce: Utilisation de données pré-insérées: Données issues d Ensembl v.39 : gène codant pour des protéines (protein coding genes). 6 génomes séquencés: Homme - Souris - Rat - Chien - Chimpanzé - Boeuf. => Exemple du CFA_34

31 Comparaison inter-espèces: Chien - Homme Organisation chromosomique des gènes communs entre 2 espèces : Exemple du CFA 34 avec le génome humain - le CFA 34 présente 2 segments conservés (CS) avec l homme: => HSA 5 => HSA 3 CFA HSA 3 : 2 Segments Conservés Ordonnés (CSO). - Visualisation des ruptures de synténie (2 ou 3) - > Forte conservation de l ordre des gènes au sein des CSO <- AutoGRAPH permet de représenter graphiquement les CS, les CSO, les ruptures de synténie et la forte colinéarité (ou non) entre les gènes de 2 génomes.

32 Comparaison inter-espèces: Chien - Homme Organisation chromosomique des gènes HSA 5 communs entre 2 espèces : Exemple du CFA 34 avec le génome humain - le CFA 34 présente 2 segments conservés (CS) avec l homme: => HSA 5 => HSA 3 CFA HSA 3 : 2 Segments Conservés Ordonnés (CSO). - Visualisation des ruptures de synténie (2 ou 3) HSA 3 - > Forte conservation de l ordre des gènes au sein des CSO <- AutoGRAPH permet de représenter graphiquement les CS, les CSO, les ruptures de synténie et la forte colinéarité (ou non) entre les gènes de 2 génomes.

33 Comparaison inter-espèces: Chien - Homme Organisation chromosomique des gènes HSA 5 communs entre 2 espèces : Exemple du CFA 34 avec le génome humain - le CFA 34 présente 2 segments conservés (CS) avec l homme: => HSA 5 => HSA 3 CFA HSA 3 : 2 Segments Conservés Ordonnés (CSO). - Visualisation des ruptures de synténie (2 ou 3) HSA 3 - > Forte conservation de l ordre des gènes au sein des CSO <- AutoGRAPH permet de représenter graphiquement les CS, les CSO, les ruptures de synténie et la forte colinéarité (ou non) entre les gènes de 2 génomes.

34 Comparaison inter-espèces: Chien - Homme Organisation chromosomique des gènes HSA 5 communs entre 2 espèces : Exemple du CFA 34 avec le génome humain - le CFA 34 présente 2 segments conservés (CS) avec l homme: => HSA 5 => HSA 3 CFA HSA 3 : 2 Segments Conservés Ordonnés (CSO). - Visualisation des ruptures de synténie (2 ou 3) HSA 3 - > Forte conservation de l ordre des gènes au sein des CSO <- AutoGRAPH permet de représenter graphiquement les CS, les CSO, les ruptures de synténie et la forte colinéarité (ou non) entre les gènes de 2 génomes.

35 Comparaison inter-espèces: Chien - Homme - Souris Organisation chromosomique des gènes communs entre 3 espèces : HSA 5 Exemple du CFA 34 avec le génome humain et le génome souris - 5 CS avec la souris: => MMU 15 => MMU 13 => MMU 16 => 2x MMU 3 (=> 4 CSO) - Ruptures de synténie spécifiques ou partagées entre les espèces. HSA 3 - > Forte conservation de l ordre des gènes au sein des CSO <- AutoGRAPH permet de représenter graphiquement les CS, les CSO, les ruptures de synténie et la forte colinéarité au sein des CSO entre les gènes de 3 génomes. Souris CFA - 34 Homme

36 Comparaison inter-espèces: Chien - Homme - Souris Organisation chromosomique des gènes MMU_15 communs entre 3 espèces : MMU_13 HSA 5 Exemple du CFA 34 avec le génome humain et le génome souris - 5 CS avec la souris: => MMU 15 => MMU 13 => MMU 16 => 2x MMU 3 (=> 4 CSO) MMU_16 - Ruptures de synténie spécifiques ou partagées entre les espèces. HSA 3 - > Forte conservation de l ordre des gènes au sein des CSO <- MMU_3 AutoGRAPH permet de représenter graphiquement les CS, les CSO, les ruptures de synténie et la forte colinéarité au sein des CSO entre les gènes de 3 génomes. Souris CFA - 34 Homme

37 Comparaison inter-espèces: Chien - Homme - Souris Organisation chromosomique des gènes MMU_15 communs entre 3 espèces : MMU_13 HSA 5 Exemple du CFA 34 avec le génome humain et le génome souris - 5 CS avec la souris: => MMU 15 => MMU 13 => MMU 16 => 2x MMU 3 (=> 4 CSO) MMU_16 - Ruptures de synténie spécifiques ou partagées entre les espèces. HSA 3 - > Forte conservation de l ordre des gènes au sein des CSO <- MMU_3 AutoGRAPH permet de représenter graphiquement les CS, les CSO, les ruptures de synténie et la forte colinéarité au sein des CSO entre les gènes de 3 génomes. Souris CFA - 34 Homme

38 Comparaison inter-espèces: Chien - Homme - Souris Organisation chromosomique des gènes MMU_15 communs entre 3 espèces : MMU_13 HSA 5 Exemple du CFA 34 avec le génome humain et le génome souris - 5 CS avec la souris: => MMU 15 => MMU 13 => MMU 16 => 2x MMU 3 (=> 4 CSO) MMU_16 - Ruptures de synténie spécifiques ou partagées entre les espèces. HSA 3 - > Forte conservation de l ordre des gènes au sein des CSO <- MMU_3 AutoGRAPH permet de représenter graphiquement les CS, les CSO, les ruptures de synténie et la forte colinéarité au sein des CSO entre les gènes de 3 génomes. Souris CFA - 34 Homme

39 AutoGRAPH : Résultats: L'identification et la caractérisation des CS, CSO et rupture de synténie sont : - illustrés par la figure de cartographie comparée. - listés sous forme d'un tableau récapitulatif (format texte).

40 AutoGRAPH : Résultats: L'identification et la caractérisation des CS, CSO et rupture de synténie sont : - illustrés par la figure de cartographie comparée. - listés sous forme d'un tableau récapitulatif (format texte). CS - CSO Id (nombre de gènes) Localisation sur le chromosome référence CS - CSO : Taille (pb) Localisation sur le chromosome testé

41 AutoGRAPH : Résultats: L'identification et la caractérisation des CS, CSO et rupture de synténie sont : - illustrés par la figure de cartographie comparée. - listés sous forme d'un tableau récapitulatif (format texte). CS - CSO Id (nombre de gènes) Localisation sur le chromosome référence CS - CSO : Taille (pb) Densité Localisation sur le chromosome testé Densité au niveau des régions de rupture de synténie

42 AutoGRAPH : Options d'affichage: Possibilité de modifier les options d'affichage Le nombre minimum de marqueur(s)/gène(s) pour définir un CS La pénalité appliquée dans la colinéarité des marqueurs/gènes pour définir un CS. L'orientation des CS de (ou des) espèce(s) testée(s).

43 AutoGRAPH : Options d'affichage: Possibilité de modifier les options d'affichage Le nombre minimum de marqueur(s)/gène(s) pour définir un CS La pénalité appliquée dans la colinéarité des marqueurs/gènes pour définir un CS. L'orientation des CS de (ou des) espèce(s) testée(s). Les type de relation d'orthologie à afficher.

44 Les relations d'orthologie de type 1:0

45 Les relations d'orthologie de type 1:0 Les relations 1:0 sont identifiées par (*) sur le génome de référence

46 Les relations d'orthologie de type 1:0 Les relations 1:0 sont identifiées par (*) sur le génome de référence Possibilité de prédire un environnement synténique attendu sur le génome testé selon la colinéartié à l'intérieur des CS(O)

47 La cartographie comparée comme aide à l annotation des gènes 1ère observation : Annotation Ensembl sur le contenu en gènes humains/canins: Homme Chien 2ème observation : 5329 gènes humains (codant pour des protéines) n ont pas d orthologues canins annotés! (notion de gènes orphelins)

48 La cartographie comparée comme aide à l annotation des gènes 1ère observation : Annotation Ensembl sur le contenu en gènes humains/canins: Homme Chien 2ème observation : 5329 gènes humains (codant pour des protéines) n ont pas d orthologues canins annotés! (notion de gènes orphelins)

49 La cartographie comparée comme aide à l'annotation Méthodologie : BLAST réciproque (ou Mutual BLAST) des séquences de gènes humains sur le chien. Définition de l environnement synténique attendu.

50 La cartographie comparée comme aide à l'annotation Méthodologie : BLAST réciproque (ou Mutual BLAST) des séquences de gènes humains sur le chien. Définition de l environnement synténique attendu. Intégration des 2 résultats : Localisation du résultat du BLAST sur le génome canin en accord (ou pas) avec l environnement synténique canin défini.

51 La cartographie comparée comme aide à l'annotation Méthodologie : BLAST réciproque (ou Mutual BLAST) des séquences de gènes humains sur le chien. Définition de l environnement synténique attendu. Intégration des 2 résultats : Localisation du résultat du BLAST sur le génome canin en accord (ou pas) avec l environnement synténique canin défini. Recherche l existence des exons humains sur le génome canin.

52 Combiner plusieurs informations: 5080 gènes humains de départ : Chien 1. Blast réciproque sur le génome canin = BDRH (Bi- Directional Best Hit) BLAST [ paramètres : p-value 10-1] ----> 2349 (47 %) Homme 2. Intégration de la localisation du résultat du BLAST avec la localisation de l'environnement synténique canin attendu ----> 1496 (30 %) 3. Analyse de la conservation du nombre et de l'ordre des exons le long du génome canin. => 594 nouveaux gènes canins potentiels.

53 Résultats - Interprétation 594 / 5080 gènes humains de départ: - 11% des gènes de départ (52%) sont mono exonique. Plusieurs hypothèses concernant les gènes non retrouvés: - Gènes spécifiques de l'homme (Ponting C. et al,2006 : 3 fois + de gènes dupliqués chez l'homme) - Gènes intervenant dans des fonctions spécifiques. - Gènes correspondant à des faux-positifs...

54 Conclusions Conclusions - Perspectives: AutoGRAPH: un serveur de comparaison de données personnelles et données publiques. Méthode combinant : - une approche d analyses de séquences entre l homme et le chien (Génome- Exon). - une approche de cartographie comparée Homme/Chien pour exploiter l information de synténie. Perspectives Combiner l utilisation de plusieurs génomes de références pour: - mieux définir les environnements synténiques. - permettre des alignements multiples de séquences. Mieux définir les relations d'orthlogie: => les relations 1 to many (1:n) voire many to many (n:n)

55 Questions

56

57 Exemple de la Comparaison inter-espèce: Méthodologie Identification des Segments Conservés (CS), Segments Conservés ordonnés (CSO) et rupture de synténie (breakpoints) Human Dog CSO CSO CSO CSO CSO CSO Bkpt Bkpt Bkpt Bkpt Bkpt Algorithmic formalization = adjacency test : (n) - (n) Human Dog

AutoGRAPH: Serveur de génomique comparative

AutoGRAPH: Serveur de génomique comparative AutoGRAPH: Serveur de génomique comparative Objectifs: 1- Construire des cartes comparées entre 2 et/ou 3 espèces. 2- Représentation graphique des chromosomes et des segments conservés entre espèces. 3-

Plus en détail

PERCIMAP. Oreochromis niloticus. Construction d une carte RH à haute densité du génome de Tilapia CNRS UMR 6061

PERCIMAP. Oreochromis niloticus. Construction d une carte RH à haute densité du génome de Tilapia CNRS UMR 6061 PERCIMAP Construction d une carte RH à haute densité du génome de Tilapia Oreochromis niloticus CIRAD UPR20 Aquaculture et gestion des ressources aquatiques, Montpellier H. D Cotta E. Pepey J.F. Baroiller

Plus en détail

Comparaison et alignement de séquences 2

Comparaison et alignement de séquences 2 Comparaison et alignement de séquences 2 LV348 -BI Sophie Pasek sophie.pasek@upmc.fr Comment comparer une séquence contre une banque? Comparaison séquence/banque Pourquoi? : Réunir un échantillon taxonomique

Plus en détail

Comparaison et alignement. de séquences 2 LV348 -BI. sophie.pasek@upmc.fr. Sophie Pasek

Comparaison et alignement. de séquences 2 LV348 -BI. sophie.pasek@upmc.fr. Sophie Pasek Comparaison et alignement de séquences 2 LV348 -BI Sophie Pasek sophie.pasek@upmc.fr Comment comparer une séquence contre une banque? Comparaison séquence/banque Pourquoi? : Réunir un échantillon taxonomique

Plus en détail

Analyse in silico de génomes, protéomes et transcriptomes. «Génomique comparative» V.2012.1. Protocole TD

Analyse in silico de génomes, protéomes et transcriptomes. «Génomique comparative» V.2012.1. Protocole TD Magistère Biotechnologies Analyse in silico de génomes, protéomes et transcriptomes «Génomique comparative» V.2012.1 Protocole TD Notes : Scripts et données sur : http://rna.igmors.u-psud.fr/gautheret/cours/analinsilico

Plus en détail

Plan. Comparaison de 2 séquences. Dotplot, alignement optimal Recherche de similarité. Alignement multiple. Phylogénie moléculaire

Plan. Comparaison de 2 séquences. Dotplot, alignement optimal Recherche de similarité. Alignement multiple. Phylogénie moléculaire Plan 1 Banques de données 2 Comparaison de 2 séquences Dotplot, alignement optimal Recherche de similarité 3 Alignement multiple l 4 Phylogénie moléculaire Recherche de similarité 1 séquence (Query) comparée

Plus en détail

Recherche des causes génétiques de génodermatoses chez le chien. Catherine André. Heuzé. Catherine André CNRS Rennes Mars 2007.

Recherche des causes génétiques de génodermatoses chez le chien. Catherine André. Heuzé. Catherine André CNRS Rennes Mars 2007. Recherche des causes génétiques de génodermatoses chez le chien Catherine André CNRS André Eric Guaguere Lille Emmanuel Bensignor Rennes Mathieu Heuzé Thè Heuzé Thèse vé vétérinaire Guillaume Queney, Queney,

Plus en détail

L analyse comparee des genomes : applications à l identification de nouveaux gènes canins

L analyse comparee des genomes : applications à l identification de nouveaux gènes canins L analyse comparee des genomes : applications à l identification de nouveaux gènes canins Thomas Derrien To cite this version: Thomas Derrien. L analyse comparee des genomes : applications à l identification

Plus en détail

PRINCIPALES TECHNIQUES UTILISEES EN GENOMIQUE

PRINCIPALES TECHNIQUES UTILISEES EN GENOMIQUE PRINCIPALES TECHNIQUES UTILISEES EN GENOMIQUE Définitions généralités Quelques chiffres 46 chromosomes 22 paires d autosomes (n=44) 1 paire de gonosomes (n=2) : XX/F et XY/H 300 bandes cytogénétiques =

Plus en détail

Familles de gènes. Nadia El-Mabrouk

Familles de gènes. Nadia El-Mabrouk Familles de gènes Nadia El-Mabrouk Les gènes Parties codantes de l ADN Unités de base de l héridité. Une fois les gènes identifiés, ils doivent être annotés pour leur fonction. Familles de gènes Des gènes

Plus en détail

MABioVis. Bio-informatique et la

MABioVis. Bio-informatique et la MABioVis Modèles et Algorithmes pour la Bio-informatique et la Visualisation Visite ENS Cachan 5 janvier 2011 MABioVis G GUY MELANÇON (PR UFR Maths Info / EPI GRAVITE) (là, maintenant) - MABioVis DAVID

Plus en détail

I. TOUITOU (Mise ligne 15/10/08 LIPCOM-RM) Faculté de Médecine Montpellier-Nîmes

I. TOUITOU (Mise ligne 15/10/08 LIPCOM-RM) Faculté de Médecine Montpellier-Nîmes er cycle PCEM MI5 Génétique moléculaire et clinique Année Universitaire 008-009 Comment apprécier la composante héréditaire des maladies?. Excès de cas familiaux - Les études familiales - - La plupart

Plus en détail

Plateforme de Recherche de Mutations

Plateforme de Recherche de Mutations Plateforme de Recherche de Mutations Jean-Marc Aury contact: pfm@genoscope.cns.fr 29 janvier 2009 Introduction Présentation des données produites par le GSFLX : type, qualité, Méthodes de détection de

Plus en détail

Atelier 5/11/2013. Structure de la chromatine et marques épigénétiques

Atelier 5/11/2013. Structure de la chromatine et marques épigénétiques Atelier 5/11/2013 Structure de la chromatine et marques épigénétiques La chromatine ADN ADN + Histones = Nucleosome ADN + Protéines + ARNs = Chromatine Niveau extrême de condensation = Chromosome métaphasique

Plus en détail

L étude des gènes et des protéines facilitée par l utilisation du web service ProteINSIDE

L étude des gènes et des protéines facilitée par l utilisation du web service ProteINSIDE L étude des gènes et des protéines facilitée par l utilisation du web service ProteINSIDE KASPRIC Nicolas Thèse débutée en février 2013 Equipe Amuvi Encadrants : Muriel BONNET Brigitte PICARD Avec l appui

Plus en détail

Influence du nombre de réplicats dans une analyse différentielle de données RNAseq

Influence du nombre de réplicats dans une analyse différentielle de données RNAseq Influence du nombre de réplicats dans une analyse différentielle de données RNAseq Statisticiens: Sophie Lamarre Steve Van Ginkel Sébastien Déjean - Magali San Cristobal Matthieu Vignes Biologistes: Stéphane

Plus en détail

Chromosome et caryotype

Chromosome et caryotype Chromosome et caryotype Définition et généralités L étude du caryotype «classique» humain est l étude des chromosomes à un stade maximum de condensation (chromosomes mitotiques en métaphase). Caryotype

Plus en détail

Quelques caractéristiques des microsatellites : définition, densité et structure. P. Jarne CEFE - Montpellier

Quelques caractéristiques des microsatellites : définition, densité et structure. P. Jarne CEFE - Montpellier Quelques caractéristiques des microsatellites : définition, densité et structure P. Jarne CEFE - Montpellier Buts * Définitions * Méthodes d études de la distribution * Qques résultats : distribution dans

Plus en détail

La CGH-array : une nouvelle technique de diagnostic en cytogénétique

La CGH-array : une nouvelle technique de diagnostic en cytogénétique La CGH-array : une nouvelle technique de diagnostic en cytogénétique Olivier Pichon (Ingénieur) Laboratoire de cytogénétique de Nantes, Service de Génétique Médicale Les techniques classiques de cytogénétique

Plus en détail

La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST.

La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST. La gestion de données dans le cadre d une application de recherche d alignement de séquence : BLAST. Gaël Le Mahec - p. 1/12 L algorithme BLAST. Basic Local Alignment Search Tool est un algorithme de recherche

Plus en détail

Introduc)on à Ensembl/ Biomart : Par)e pra)que

Introduc)on à Ensembl/ Biomart : Par)e pra)que Introduc)on à Ensembl/ Biomart : Par)e pra)que Stéphanie Le Gras Jean Muller NAVIGUER DANS ENSEMBL : PARTIE PRATIQUE 2 Naviga)on dans Ensembl : Pra)que Exercice 1 1.a. Quelle est la version de l assemblage

Plus en détail

Aujourd hui, il y a plus de consortium, ce qui permet des avancées plus rapides.

Aujourd hui, il y a plus de consortium, ce qui permet des avancées plus rapides. GFMOM 20/01/2012 Cours 2 partie 2 T. Bourgeron II. LA CYTOGENETIQUE Nous allons étudier les anomalies chromosomiques des plus grossières aux plus fines. Ces anomalies peuvent être retrouvées dans la population

Plus en détail

Quelques définitions

Quelques définitions Quelques définitions Sandrine Lagarrigue et Pascale Le Roy 1 Journée Technique SYSAAF La mise en œuvre des outils de la génomique : enjeux pour le SYSAAF et ses adhérents. 03 juin 2015. Rennes Le génome

Plus en détail

Intérêt des recherches génétiques

Intérêt des recherches génétiques Intérêt du chien dans la pathologie et la génétique comparée: exemples de maladies et de gènes partagées entre l'homme et le chien Dr. Catherine André candre@univ-rennes1.fr Intérêt des recherches génétiques

Plus en détail

Automatisation de la certification formelle de systèmes critiques par instrumentation d interpréteurs abstraits

Automatisation de la certification formelle de systèmes critiques par instrumentation d interpréteurs abstraits 1 d Automatisation de la certification formelle de systèmes critiques par instrumentation d sous la direction de Michaël Périn Soutenance de Thèse de Doctorat Université de Grenoble - Laboratoire Verimag

Plus en détail

FORMATION RADSEQ SOUS GALAXY. Intervenant(s) : Yvan Le Bras, Cyril Monjeaud

FORMATION RADSEQ SOUS GALAXY. Intervenant(s) : Yvan Le Bras, Cyril Monjeaud FORMATION RADSEQ SOUS GALAXY Intervenant(s) : Yvan Le Bras, Cyril Monjeaud E-BIOGENOUEST Programme fédérateur Biogenouest co-financé par les Régions Bretagne et Pays de la Loire 24 mois Lancé depuis Mai

Plus en détail

Structure des génomes bactériens / systèmes de mutagénèse / génomique comparative

Structure des génomes bactériens / systèmes de mutagénèse / génomique comparative Master 1 Bactério 10/01/09 8h30-10h30 RT : Stéphanie Ripert-Bernusset RL: Benjamin de Sainte Marie Structure des génomes bactériens / systèmes de mutagénèse / génomique comparative PLAN DU COURS : I- GENOME

Plus en détail

INTRODUCTION À LA BIO-INFORMATIQUE

INTRODUCTION À LA BIO-INFORMATIQUE Biologie moléculaire-2016 1 INTRODUCTION À LA BIO-INFORMATIQUE Dans cette section, on désire vous donner une introduction sur l utilisation du site web du National Center for Biotechnology Information

Plus en détail

Cahier de texte de la classe 1 ère 4 - SVT

Cahier de texte de la classe 1 ère 4 - SVT Cahier de texte de la classe 1 ère 4 - SVT DATE SEQUENCE lundi 12 : revoir la fiche méthodologique «utiliser le microscope optique» (disponible sur le site du lycée) Lundi 12 1 er contact avec les élèves.

Plus en détail

Cycle de Découverte n 1 VISUALISER Créer la prochaine application innovante

Cycle de Découverte n 1 VISUALISER Créer la prochaine application innovante Cycle de Découverte n 1 VISUALISER Créer la prochaine application innovante 1 Data Driven Summit 2014 Paris Mardi 18 novembre Visualisation efficace du Big Data Bonne pratique de l expérience utilisateur

Plus en détail

MODULE 4 Introduction à IGV

MODULE 4 Introduction à IGV MODULE 4 Introduction à IGV Jean-Baptiste Rivière jean-baptiste.riviere@u-bourgogne.fr 22/01/2014 Integrative Genomics Viewer (IGV) Logiciel de visualisation de données génomiques (NGS, microarray, annotations

Plus en détail

Chapitre 17 Les changements chromosomiques à grande échelle

Chapitre 17 Les changements chromosomiques à grande échelle Chapitre 17 Les changements chromosomiques à grande échelle Une translocation réciproque démontrée par une technique appelée coloration des chromosomes Les mutations chromosomiques Les mutations chromosomiques

Plus en détail

Génotypage par Séquençage (GBS) : Création d une carte génétique haute densité de Tournesol Population INEDI (RILs PSC8 x XRQ)

Génotypage par Séquençage (GBS) : Création d une carte génétique haute densité de Tournesol Population INEDI (RILs PSC8 x XRQ) Génotypage par Séquençage (GBS) : Création d une carte génétique haute densité de Tournesol Population INEDI (RILs PSC8 x XRQ) Baptiste Mayjonade (IE-CDD SUNRISE) Génétique et génomique des réponses aux

Plus en détail

Utiliser un modèle d état prédéfini

Utiliser un modèle d état prédéfini Chapitre 8 Etats rapides Certains boutons sont désactivés, en fonction du type de cellule sélectionné. 4 Répétez les étapes 2 et 3 pour chaque bordure à paramétrer. 5 Cliquez sur le bouton OK pour valider

Plus en détail

Cours d introduction à la génétique de la souris Notion de Souche

Cours d introduction à la génétique de la souris Notion de Souche Cours d introduction à la génétique de la souris Notion de Souche Introduction: - Réponse d un animal à l expérimentation (diapo 1) Facteurs environnementaux et propres à l animal - Notion d animal standardisé

Plus en détail

Classes et templates C++

Classes et templates C++ Classes et templates C++ Ce TP propose une application des classes, des templates et du polymorphisme au travers du design de classes permettant de gérer des courbes de Bézier. Contents 1 Bézier unidimensionnelle

Plus en détail

Concevoir un tableau de bord en ligne

Concevoir un tableau de bord en ligne Concevoir un tableau de bord en ligne Principe Les tableaux de bord en ligne permettent de publier les résultats d une enquête en organisant le contenu dans différentes pages. Ce contenu est actualisé

Plus en détail

Sommaire. A) Méthode de contrôle manuel des résultats produits par GLADX

Sommaire. A) Méthode de contrôle manuel des résultats produits par GLADX Sommaire Définitions et abréviations Résumé Introduction I. Matériel II. Méthode A) Méthode de contrôle manuel des résultats produits par GLADX B) Comparaison des résultats de l outil GLADX avec les résultats

Plus en détail

Télémédecine, télésanté :

Télémédecine, télésanté : Télémédecine, télésanté : vision prospective Table ronde du Collège des Economistes de la Santé, 15 mai 2014. «État des lieux et perspectives de latélémédecine»? Robert PICARD Référent Santé, CGEiet Plan

Plus en détail

UE1 Chromosomes Caryotypes anomalies 2009/2010. Les chromosomes, le caryotype et ses anomalies

UE1 Chromosomes Caryotypes anomalies 2009/2010. Les chromosomes, le caryotype et ses anomalies Les chromosomes, le caryotype et ses anomalies 1 I. Intérêt de l établissement du caryotype II. Structure t du chromosome métaphasique 1. Le centromère 2. Les télomères III. Le caryotype 1. Le rangement

Plus en détail

De la biologie molécualire à la génomique

De la biologie molécualire à la génomique De la biologie molécualire à la génomique Pierre Neuvial École Nationale de la Statistique et de l Administration Économique Méthodes statistiques pour la biologie Plan du cours 1 Introduction à la biologie

Plus en détail

Polymorphismes de l ADN

Polymorphismes de l ADN Introduction Polymorphismes de l ADN Présentation et mise en évidence Recherche de gènes responsables de maladies génétiques : Analyse de pedigrees où la maladie est présente Sur quel chromosome? À quel

Plus en détail

REPERES POUR UNE PROGRESSIVITE DES APPRENTISSAGES EN PHONOLOGIE

REPERES POUR UNE PROGRESSIVITE DES APPRENTISSAGES EN PHONOLOGIE REPERES POUR UNE PROGRESSIVITE DES APPRENTISSAGES EN PHONOLOGIE Trois types de critères sont à prendre en compte : 1) Critères relatifs à la nature des unités linguistiques : Taille des unités : mot, syllabe,

Plus en détail

II. EXCEL/QUERY ET SQL

II. EXCEL/QUERY ET SQL I. AU TRAVAIL, SQL! 1. Qu est-ce que SQL?... 19 2. SQL est un indépendant... 19 3. Comment est structuré le SQL?... 20 4. Base, table et champ... 21 5. Quelle est la syntaxe générale des instructions SQL?...

Plus en détail

SCI03 - Analyse de données expérimentales

SCI03 - Analyse de données expérimentales SCI03 - Analyse de données expérimentales Introduction à la statistique Thierry Denœux 1 1 Université de Technologie de Compiègne tél : 44 96 tdenoeux@hds.utc.fr Automne 2014 Qu est ce que la statistique?

Plus en détail

DAEU- cours de Sciences de la Nature et de la Vie- Marie Claire Garnier

DAEU- cours de Sciences de la Nature et de la Vie- Marie Claire Garnier Partie 3 : génétique Chapitre 1 : la transmission d un caractère au cours de la reproduction sexuée Rappel : la reproduction sexuée comprend 2 phénomènes fondamentaux successifs : La méiose lors de la

Plus en détail

metarnaseq: un package pour la méta-analyse de données RNA-seq

metarnaseq: un package pour la méta-analyse de données RNA-seq metarnaseq: un package pour la méta-analyse de données RNA-seq Guillemette Marot, Florence Jaffrézic, Andrea Rau 28/06/13 Overview 1 Introduction 2 Analyse statistique d une seule étude 3 Méta-analyse

Plus en détail

Chapitre 4 Les tableaux

Chapitre 4 Les tableaux Chapitre 4 Les tableaux A. Introduction AutoCAD 2010 permet la création automatisée d objets tableaux. Ceci vous évite de concevoir des tableaux à partir de lignes individuelles, textes, et blocs. Après

Plus en détail

Translocations réciproques. Translocations réciproques. Ségrégation méïotique. Ségrégation alterne : équilibrée (2 types de gamètes)

Translocations réciproques. Translocations réciproques. Ségrégation méïotique. Ségrégation alterne : équilibrée (2 types de gamètes) Anomalies de structure Réarrangements du matériel chromosomique Un seul ou plusieurs Anomalies Translocations robertsoniennes et réciproques équilibrées Mécanismes de déséquilibre Héritées ou de novo Equilibrées

Plus en détail

CHAPITRE 3 LA SYNTHESE DES PROTEINES

CHAPITRE 3 LA SYNTHESE DES PROTEINES CHAITRE 3 LA SYNTHESE DES ROTEINES On sait qu un gène détient dans sa séquence nucléotidique, l information permettant la synthèse d un polypeptide. Ce dernier caractérisé par sa séquence d acides aminés

Plus en détail

Cours BOXI R3 Infoview

Cours BOXI R3 Infoview DIRECTION DE LA FORMATION ORGANISATION ET GESTION INFORMATIQUE DE LA FORMATION EPFL-VPAA-DAF-OGIF Bâtiment BP Station 16 CH 1015 Lausanne Tél. : E-mail : Site web: +4121 693.48.08 statistiques.formation@epfl.ch

Plus en détail

Chapitre 2 La diversification du vivant

Chapitre 2 La diversification du vivant Chapitre 2 La diversification du vivant 1 Introduction Méiose et fécondation : sources de diversité Mutations germinales : processus fondamental de diversification génétique, générateur de biodiversité

Plus en détail

Chapitre 2. La synthèse protéique : la relation entre le génotype et le phénotype.

Chapitre 2. La synthèse protéique : la relation entre le génotype et le phénotype. Chapitre 2. La synthèse protéique : la relation entre le génotype et le phénotype. Les maladies génétiques comme la drépanocytose ou l'albinisme sont liées à des modifications du génotype des individus

Plus en détail

Calcul intensif en Bioinformatique

Calcul intensif en Bioinformatique Calcul intensif en Bioinformatique Réalisations en génétique et génomique évolutives Pôle Rhône Alpin de BioInformatique (PRABI) Laboratoire de Biologie et Biométrie Evolutives (LBBE) Contexte De plus

Plus en détail

Recherche et analyse de polymorphismes SNP

Recherche et analyse de polymorphismes SNP Recherche et analyse de polymorphismes SNP 1- Tablet : Détection visuelle de SNP avec Tablet Tablet est un outil graphique de visualisation d assemblage et d alignement de séquences issues de NGS (Next

Plus en détail

SUGARCRM MODULE RAPPORTS

SUGARCRM MODULE RAPPORTS SUGARCRM MODULE RAPPORTS Référence document : SYNOLIA_Support_SugarCRM_Module_Rapports_v1.0.docx Version document : 1.0 Date version : 2 octobre 2012 Etat du document : En cours de rédaction Emetteur/Rédacteur

Plus en détail

LES MARQUEURS MOLECULAIRES

LES MARQUEURS MOLECULAIRES LES MARQUEURS MOLECULAIRES Il y a différents types de marqueurs : o Les caractères phénotypiques : limités, observations sur l arbre entier et sur différentes années o Les marqueurs biochimiques o Les

Plus en détail

Pipeline d'annotation des variants

Pipeline d'annotation des variants Pipeline d'annotation des variants École Bioinformatique AVIESAN 2015 Maria Bernard Rachel Legendre Sabrina Rodriguez 30/09/2015 Pourquoi et comment analyser les variants? Quelques définitions. Variation

Plus en détail

GESCIM : Introduction

GESCIM : Introduction GESCIM : Introduction Ce document est une notice simplifiée pour l utilisation du logiciel GESCIM. Il permet de prendre en main le logiciel et de découvrir ses principales fonctions. Bien sûr l ensemble

Plus en détail

IMPRESSION. Plusieurs formats sont proposés et il est possible de personnaliser sa présentation. En général les marges normales sont satisfaisantes.

IMPRESSION. Plusieurs formats sont proposés et il est possible de personnaliser sa présentation. En général les marges normales sont satisfaisantes. IMPRESSION L'impression d'un tableau dépend de beaucoup de paramètres : Taille du tableau par rapport au format papier, Police de caractères Besoin de cohérence entre pages. MISE EN PAGE Les outils de

Plus en détail

Le logiciel Ethnos. Ethnos est un logiciel de traitement d enquête conçu pour répondre à des besoins de collecte et de traitement de l information.

Le logiciel Ethnos. Ethnos est un logiciel de traitement d enquête conçu pour répondre à des besoins de collecte et de traitement de l information. Le logiciel Ethnos Ethnos est un logiciel de traitement d enquête conçu pour répondre à des besoins de collecte et de traitement de l information. Pour lancer l exécution du programme, il suffit de cliquer

Plus en détail

Séquençage haut débit (Next Generation Sequencing) 12/03/2012 Pascal Le Bourgeois, M1BBT, EM8BTGM 1

Séquençage haut débit (Next Generation Sequencing) 12/03/2012 Pascal Le Bourgeois, M1BBT, EM8BTGM 1 Séquençage haut débit (Next Generation Sequencing) 1 Pyroséquençage (454) Margulies M. et al. (2005). Genome sequencing in microfabricated high-density picolitre reactors. Nature 437:376-80 Pas de banques

Plus en détail

1. Introduction. 2. Objectifs de la réalisation. 3. Analyse de besoins

1. Introduction. 2. Objectifs de la réalisation. 3. Analyse de besoins 1. Introduction Le travail consiste à concevoir et à élaborer un dispositif de formation à distance, qui va au-delà de simples pages web statiques. On a choisi de faire appel à tout un module d apprentissage

Plus en détail

Mise en place... 3. Plans analytiques... 3 Fiche Plan analytique... 3

Mise en place... 3. Plans analytiques... 3 Fiche Plan analytique... 3 Mise en place... 3 Plans analytiques... 3 Fiche Plan analytique... 3 Modèles de ventilation... 5 Liste des modèles de ventilation analytique... 5 Fiche modèle de ventilation analytique... 5 Ecritures analytiques...

Plus en détail

Module Analyse de Génomes 2011-2012 Master 2 module FMBS 326 Immunoinformatique

Module Analyse de Génomes 2011-2012 Master 2 module FMBS 326 Immunoinformatique Module Analyse de Génomes 2011-2012 Master 2 module FMBS 326 Immunoinformatique Planning du Module : Date Heure Salle 12/12 9h-12h TD info TA1Z bat 25 13h-17h TD info TA1Z bat 25 13/12 9h-12h TD info TA1Z

Plus en détail

IFT3913 Qualité du logiciel et métriques. Chapitre 5 Mesure de la qualité du logiciel

IFT3913 Qualité du logiciel et métriques. Chapitre 5 Mesure de la qualité du logiciel IFT3913 Qualité du logiciel et métriques Chapitre 5 Mesure de la qualité du logiciel Plan du cours Introduction Théorie de la mesure Qualité du logiciel Mesure du produit logiciel Mesure de la qualité

Plus en détail

Eléments pratiques de test des Hiérarchies et Frameworks

Eléments pratiques de test des Hiérarchies et Frameworks Eléments pratiques de test des Hiérarchies et Frameworks Notes de cours Christophe Dony Master Info Pro - Université Montpellier-II 1 Introduction 1.1 Définitions Génie Logiciel No 18, Mars 1990. EC2.

Plus en détail

1. L ADN et l information génétique. l ADN l information génétique est contenue dans l ADN. traduction. comment fait-on une protéine?

1. L ADN et l information génétique. l ADN l information génétique est contenue dans l ADN. traduction. comment fait-on une protéine? 1. L ADN et l information génétique l ADN l information génétique est contenue dans l ADN (ADN) (ARN) 1 2 A G T C U comment fait-on une protéine? traduction l information génétique est organisée par triplets

Plus en détail

Logiciel Analyse des Filières Agroalimentaires AFA. CIRAD - UR 88 & 13 - Présentation Logiciel AFA - 2009 - F.Lançon 1

Logiciel Analyse des Filières Agroalimentaires AFA. CIRAD - UR 88 & 13 - Présentation Logiciel AFA - 2009 - F.Lançon 1 Logiciel Analyse des Filières Agroalimentaires AFA CIRAD - UR 88 & 13 - Présentation Logiciel AFA - 2009 - F.Lançon 1 Contexte et Objectif Un élément d un processus de consolidation d une expertise associé

Plus en détail

Réalisez votre propre carte de vœux Éléctronique

Réalisez votre propre carte de vœux Éléctronique Les différentes possibilités d animer une carte de vœux Il existe plusieurs possibilités d animer une carte de vœux : - Une Vidéo : Vous pouvez créer une vidéo, un film simplement avec Windows Media Player.

Plus en détail

Table des Matières. Table des Figures 7. Introduction Générale 9. Chapitre 1 - Langages de description d architectures matérielles hybrides 23

Table des Matières. Table des Figures 7. Introduction Générale 9. Chapitre 1 - Langages de description d architectures matérielles hybrides 23 Table des Figures 7 Introduction Générale 9 1. Outils et plate-formes de construction d application 9 2. Intégration de paradigmes de conception dans le cycle de vie 10 2.1. Equilibrage de charge et équilibrage

Plus en détail

TP BIOINFORMATIQUE Bases de Données relationnelles

TP BIOINFORMATIQUE Bases de Données relationnelles TP BIOINFORMATIQUE Bases de Données relationnelles Objectif : Construire et utiliser une base de données relationnelle simple. Déroulement : Ce TP se déroulera sur 2 séances. 1. Modélisation simplifiée

Plus en détail

Gènes Diffusion - EPIC 2010

Gènes Diffusion - EPIC 2010 Gènes Diffusion - EPIC 2010 1. Contexte. 2. Notion de génétique animale. 3. Profil de l équipe plateforme. 4. Type et gestion des données biologiques. 5. Environnement Matériel et Logiciel. 6. Analyses

Plus en détail

Phylogénomique : introduction

Phylogénomique : introduction Phylogénomique : introduction Les limites des phylogénies basées sur un seul gène Résolution limitée (erreur stochastique) La phylogénie du gène peut être différente de la phylogénie des espèces à cause

Plus en détail

Fonctionnalités avancées de Word

Fonctionnalités avancées de Word BIBLIOTHÈQUE UNIVERSITAIRE DE LILLE 1 Thèses et littérature grise Fonctionnalités avancées de Word Bibliothèque de l université des sciences et technologies de Lille 1 Diffusion électronique des thèses

Plus en détail

Logiciel Concerto Outil de connaissance de l accidentologie

Logiciel Concerto Outil de connaissance de l accidentologie Logiciel Concerto Outil de connaissance de l accidentologie Un outil de la connaissance de l accidentologie Concerto est un applicatif SIG dédié à la connaissance de l accidentologie : Il est conçu pour

Plus en détail

Analyse Chromosomique sur Puce à ADN Applications en Prénatal

Analyse Chromosomique sur Puce à ADN Applications en Prénatal Analyse Chromosomique sur Puce à ADN Applications en Prénatal Véronique Satre, Charles Coutton, Gaëlle Vieville, Françoise Devillard et Florence Amblard Maladies génétiques Anomalies chromosomiques Cytogénétique

Plus en détail

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq Présenté par Xi LIU ATCGCGCTAGCTGGTGTATCGCATCGCGCTAGCTGGTGTATCGCGCTAGCTGGTGTATCGCGCTAGCCTGGTGTATCGCCATCGCGCTAGCTGGCGCTAGCTGAATCGCGCATATG 17 Septembre 2013 Homéoallèles Génome Normalisation Analyse différentielle

Plus en détail

Modélisation de la structure 3D des protéines

Modélisation de la structure 3D des protéines Modélisation de la structure 3D des protéines We are drowning in data and starving for knowledge -R.D. Roger Unité Mathématique Informatique et Génome Séminaire AGENAE, Seignosse-le-Pénon, 20-21 mai 2003

Plus en détail

CGH array. Alain AURIAS INSERM U509 Institut Curie-Paris

CGH array. Alain AURIAS INSERM U509 Institut Curie-Paris CGH array Alain AURIAS INSERM U509 Institut Curie-Paris Caryotype normal Environ 300 bandes Résolution: 10Mb Ewing Translocation réciproque avec gène de fusion 11 22 EWS FLI1 Nouvelle protéine chimérique,

Plus en détail

Groupe Eyrolles, 2003, ISBN : 2-212-11317-X

Groupe Eyrolles, 2003, ISBN : 2-212-11317-X Groupe Eyrolles, 2003, ISBN : 2-212-11317-X 7 Étude de cas : la boutique MX Dans ce dernier chapitre, nous allons exploiter Dreamweaver MX pour développer une boutique marchande utilisant la technologie

Plus en détail

15 septembre 2010. Démo #2 MySQL Séquençage

15 septembre 2010. Démo #2 MySQL Séquençage 15 septembre 2010 Démo #2 MySQL Séquençage SQL et MySQL SQL: structured query language langage pour manipuler des données dans des bases de données relationnelles MySQL: Implantation de SQL Ajout à SQL

Plus en détail

Professeur Joël LUNARDI

Professeur Joël LUNARDI Biochimie - Biologie moléculaire Chapitre 9 : Applications médicales Professeur Joël LUNARDI MED@TICE PCEM1 - Année 2006/2007 Faculté de Médecine de Grenoble - Tous droits réservés. Chapitre 9. APPLICATIONS

Plus en détail

Initiation WORD. Module 3 : La mise en forme d un document

Initiation WORD. Module 3 : La mise en forme d un document Initiation WORD. Module 3 : La mise en forme d un document Système d exploitation utilisé : Windows XP Service Pack 2 Créé par Xavier CABANAT Version 1.0 Document créé par Xavier CABANAT Page 1 sur 21

Plus en détail

Styler un document sous Word 2010*

Styler un document sous Word 2010* Février 2014 Styler un document sous Word 2010* Un style est un ensemble de caractéristiques de mise en forme (police, taille, espacement, etc.) qui sert à structurer un document en l organisant de manière

Plus en détail

Détection de mutations somatiques par NGS sur GAIIx

Détection de mutations somatiques par NGS sur GAIIx Détection de mutations somatiques par NGS sur GAIIx Aude Lamy Laboratoire de Génétique Somatique des Tumeurs CHU de Rouen Inserm U1079 Faculté de Médecine et Pharmacie de Rouen La médecine personalisée

Plus en détail

Introduction. La bioinformatique : Traitement des informations biologiques par des méthodes informatiques et/ou mathématiques.

Introduction. La bioinformatique : Traitement des informations biologiques par des méthodes informatiques et/ou mathématiques. Introduction La bioinformatique : Traitement des informations biologiques par des méthodes informatiques et/ou mathématiques. Interdisciplinaire par nature, la bioinformatique est fondée sur les acquis

Plus en détail

Marie-Claude L Homme Université de Montréal

Marie-Claude L Homme Université de Montréal Évaluation de logiciels d extraction de terminologie : examen de quelques critères Plan Marie-Claude L Homme Université de Montréal Unités recherchées et problèmes de base Catégories de critères Critères

Plus en détail

COMPTE RENDU D ACTIVITE ACTIVITE N 4. Identification (objectif) de l'activité. Contexte dans lequel le projet s'inscrit

COMPTE RENDU D ACTIVITE ACTIVITE N 4. Identification (objectif) de l'activité. Contexte dans lequel le projet s'inscrit BTS INFORMATIQUE DE GESTION Option Administrateur de réseaux Développeur d applications COMPTE RENDU D ACTIVITE ACTIVITE N 4 Nom et Prénom : BUISSON Pierre-Adrien EPSI Lyon 107 rue de Marseille 69 007

Plus en détail

Cartographie génomique comparée chez les mammifères G. Bronner, B. Spataro, C. Gautier

Cartographie génomique comparée chez les mammifères G. Bronner, B. Spataro, C. Gautier Cartographie génomique comparée chez les mammifères G. Bronner, B. Spataro, C. Gautier Introduction La cartographie comparée est une analyse comparative, elle repose donc sur l'exploitation de la biodiversité

Plus en détail

génomes Présentation La biologie à l'heure du séquençage des génomes Séquençage de génomes: Pourquoi? Comment? Annotation des génomes

génomes Présentation La biologie à l'heure du séquençage des génomes Séquençage de génomes: Pourquoi? Comment? Annotation des génomes Présentation Bioinformatique: analyse des génomes Céline Brochier-Armanet (Laurent Duret) Université Claude Bernard, Lyon 1 Laboratoire de Biométrie et Biologie évolutive (UMR 5558) Celine.brochier-armanet@univ-lyon1.fr

Plus en détail

Le Dépistage Prénatal Non Invasif de la Trisomie 21 : du rêve à la réalité

Le Dépistage Prénatal Non Invasif de la Trisomie 21 : du rêve à la réalité PARIS ILE-DE-FRANCE OUEST Le Dépistage Prénatal Non Invasif de la Trisomie 21 : du rêve à la réalité Françoise Muller Hôpital Robert Debré Le contexte Le dépistage prénatal de la trisomie 21 repose sur

Plus en détail

AP SVT. Exercice 1. Exercice 2. Exercice 3.

AP SVT. Exercice 1. Exercice 2. Exercice 3. Exercice 1. AP SVT On cherche à comprendre le mode de transmission de deux caractères chez la Drosophile, organisme diploïde. Effectuez une analyse génétique pour expliquer les résultats des croisements

Plus en détail

MUSEUM NAT. D'HISTOIRE NATURELLE PARIS Référence GALAXIE : 4113

MUSEUM NAT. D'HISTOIRE NATURELLE PARIS Référence GALAXIE : 4113 MUSEUM NAT. D'HISTOIRE NATURELLE PARIS Référence GALAXIE : 4113 Numéro dans le SI local : Référence GESUP : 4113 Corps : Maître de conférences du Muséum national d'histoire naturelle Article : 32ou40 Chaire

Plus en détail

Référence : Emplacement des commandes Excel 2003 dans Excel 2007

Référence : Emplacement des commandes Excel 2003 dans Excel 2007 Référence : Emplacement des commandes Excel 2003 dans Excel 2007 Astuces d'utilisation de ce classeur 1. L'ordre des feuilles correspond à celui de l'interface utilisateur par défaut. Si vous le souhaitez,

Plus en détail

Cahier des charges. Jonathan HAEHNEL. Université de Strasbourg IUT Robert Schuman

Cahier des charges. Jonathan HAEHNEL. Université de Strasbourg IUT Robert Schuman Université de Strasbourg IUT Robert Schuman Maître de stage : Nicolas Lachiche Tuteur universitaire : Marie-Paule Muller Cahier des charges Jonathan HAEHNEL Strasbourg, le 6 mai 2011 Table des matières

Plus en détail

Algorithmes pour la comparaison de séquences II

Algorithmes pour la comparaison de séquences II Algorithmes pour la comparaison de séquences II Hélène TOUZET touzet@lifl.fr Equipe Bioinfo Master recherche informatique www.lifl.fr/~touzet/masterrecherche.html Pourquoi comparer des séquences? Puisque

Plus en détail

Dans chaque cellule: -génome nucléaire -génome mitochondrial (-génome chloroplastique)

Dans chaque cellule: -génome nucléaire -génome mitochondrial (-génome chloroplastique) 6- Structure et organisation des génomes 6-1 Génomes eucaryotes Dans chaque cellule: -génome nucléaire -génome mitochondrial (-génome chloroplastique) 6-1-1 Génomes nucléaires 6-1-1-1 Nombre d exemplaires

Plus en détail

Plate-forme de Cytogénétique Moléculaire Végétale (Axe Bio-imagerie) Resp. Olivier CORITON UMR 1349 IGEPP INRA LE RHEU olivier.coriton@rennes.inra.

Plate-forme de Cytogénétique Moléculaire Végétale (Axe Bio-imagerie) Resp. Olivier CORITON UMR 1349 IGEPP INRA LE RHEU olivier.coriton@rennes.inra. Plate-forme de Cytogénétique Moléculaire Végétale (Axe Bio-imagerie) Resp. Olivier CORITON UMR 1349 IGEPP INRA LE RHEU olivier.coriton@rennes.inra.fr Offre actuelle, Contour Cytogénétique Moléculaire?

Plus en détail

Chapitre 7 Organisation et évolution des génomes

Chapitre 7 Organisation et évolution des génomes Chapitre 7 Organisation et évolution des génomes Enseignant : Benoit Nabholz benoit.nabholz@univ-montp2.fr Année 2014-15 I. Architecture des génomes I.1 Le génomes des métazoaires I.2 Le génomes des Eubactéries

Plus en détail