dans la cellule, où se trouve la substance responsable de l hérédité? Génétique quelle est la substance responsable de l hérédité?

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimension: px
Commencer à balayer dès la page:

Download "dans la cellule, où se trouve la substance responsable de l hérédité? Génétique quelle est la substance responsable de l hérédité?"

Transcription

1 dans la cellule, où se trouve la substance responsable de l hérédité? Génétique acetabularia sp. Pr. R. Raynal Questions Si l'information était contenue dans le cytoplasme de l'ovule, de quelle couleur serait le souriceau? Si l'information était contenue dans le cytoplasme du spermatozoïde, de quelle couleur serait le souriceau? quelle est la substance responsable de l hérédité? Pourquoi a-t-on pris une souris porteuse blanche et non pas noire ou grise? Que se serait-il passé si la souris donneuse du noyau avait été noire et celle donneuse de l'œuf, grise? Que peut-on déduire de cette expérience? 1

2 génétique moléculaire 1. hérédité 2. des acides nucléiques aux chromosomes 3. réplication de l ADN 4. transcription 5. traduction des protéines 6. génie génétique Que signifie ADN? Acide désoxyribonucléique Que signifie ARN? Acide ribonucléique Où se situent l ADN et l ARN dans la cellule? ADN Dans une cellule eucaryote: Noyau (surtout) Mitochondries (peu) Chloroplastes (peu) Dans une cellule procaryote (procaryotes = bactéries) Libre dans le cytoplasme (normalement: 1 grande molécule circulaire (chromosome) et de multiples petits anneaux d ADN (les plasmides). ARN Fabriqué là où il y a de l ADN (surtout noyau) Transporté là où il y a des ribosomes (surtout cytoplasme) Qu est ce qu un nucléotide? l ADN : une chaîne de nucléotides Dans l ADN, un nucléotide est formé : 1. d une base azotée (Adénine, Thymine, Guanine, Cytosine) 2. d un sucre (le désoxyribose, C5) 3. d un groupement phosphate (attaché en 5 ) A oublier: chaque nucléotide a son propre nom. Par exemple, le nucléotide portant l adénine se nomme le désoxyadénosine phosphate ou acide adénylique M.Harry, Génétique moléculaire et évolutive, Maloine,

3 Résultats des études de Chargaff sur la composition en nucléotides de l ADN de différents organismes vivants. Origine de l ADN étudié groupe adénine guanine cytosine thymine Homme mammifère Vache mammifère Saumon poisson Oursin échinoderme Blé plante Levure champignon Mycobacterium bactérie tuberculosis Bactériophage T2 virus Virus de la polio virus Sponk (talk) / wikicommons données tirées de Biology, A. Allott and D. Mindorff, 2010 l ADN : une chaîne de nucléotides on utilise la première lettre de chacune des bases pour désigner les nucléotides composant l ADN (par simplification, le terme de base est souvent utilisé pour désigner le nucléotide lui même). Adénine Thymine Guanine Cytosine l ADN : une chaîne de nucléotides l établissement d une séquence d ADN correspond à la lecture base après base, de façon séquentielle, d un morceau d ADN. ACGGGTAACCTAGCTAGCTTAACG M.Harry, Génétique moléculaire et évolutive, Maloine, 2008 M.Harry, Génétique moléculaire et évolutive, Maloine, 2008 l ADN : une chaîne de nucléotides Quelle est la forme de l ADN? la longueur d une séquence est exprimée en nombre de bases : ACAGGGTAACCTAGCTAGCTTAAC Cette séquence à une longueur de 24 bases. M.Harry, Génétique moléculaire et évolutive, Maloine,

4 L ADN possède une structure en double hélice Bases à l intérieur de l hélice Squelette sucre phosphate à l extérieur de l hélice Les groupements phosphates sont chargés négativement L ADN possède une structure en double hélice In vivo: double brin (on parle d ADN bicaténaire) L ADN possède une structure en double hélice La force qui maintient les deux brins assemblés: => liaisons hydrogènes (non covalentes) Les bases sont complémentaires 2 à 2: L ADN possède une structure en double hélice Chaque brin a une orientation: => 5 3 (sens de synthèse de l ADN) Les 2 brins d une hélice sont orientés dans des sens opposés. C = G (trois liaisons hydrogènes) A = T (deux liaisons hydrogènes) et l ARN? 4

5 ADN ARN Quelles sont les différences entre l ADN et l ARN? Désoxyribose vs ribose Thymine vs Uracile 2 brins vs 1 brin Position dans la cellule: noyau vs noyau et cytoplasme (+ mitochondries) (+ mitochondries) (+ chloroplastes) (+ chloroplastes) Sponk (talk) / wikicommons Quelle est la fonction de l ADN? Qu'est ce qu un gène? l ADN est support sur lequel l information héréditaire est enregistré => l ADN contient les recettes (gènes) qui permettent de construire la cellule Le gène: un segment d ADN qui code une protéine Un filament d ADN contient de nombreux gènes 5 TGA GAG CTG -- ACT CTC GAC -- ADN Chromosome 11 TGA GAG CTG -- ACT CTC GAC -- (transcription) --UGA Gène GAGA CUG-- -- glutamate -- (translation) Gène B Protéine Gène C 5

6 Le gène le gène d une protéine X est la portion d ADN qui code pour cette protéine. Chaque gène est composé d une séquence spécifique de nucléotides. Le génome L ensemble des gènes d une cellule constitue son génome. Chromatine (n. fém.) Masse de matériel génétique composée d'adn et de protéines que l'on observe dans le noyau des cellules eucaryotes. Elle s observe entre les périodes de division et existe sous forme de fibres minces et très longues constituant un amas diffus. Chromosome (n. masc. ) Structure qui résulte de la condensation et de l épaississement des fibres de chromatine et dont la forme définie est visible au microscope. Les chromosomes sont composés d'une longue molécule d'adn et de protéines. Chromatides soeurs (n. fém.) Formes répliquées d'un chromosome qui sont unies par le centromère avant de se séparer pendant la mitose ou la méiose. comment passe t on d un filament à un chromosome? Le chromosome se forme par enroulements successifs de l ADN 6

7 Les différentes formes de l ADN La double hélice d ADN peut s enrouler autour de protéines (les histones) et former des nucléosomes cellule chromosome Les différentes formes de l ADN Une suite de nucléosomes forme une structure qui rappelle un collier de perles: un nucléofilament cellule chromosome Complexe d histones ADN Un nucléosome Les différentes formes de l ADN Attention: chromosome Représentez par un schéma le dogme de la génétique moléculaire le chromosome tel qu on l observe au moment de la métaphase est formé de deux filaments! cellule Chaque filament étant l exacte copie de l autre. ADN réplication transcription translation le transfert de l information est séquentiel les «alphabets» sont spécifiques ARN protéine génétique moléculaire 1. hérédité 2. des acides nucléiques aux chromosomes 3. réplication de l ADN 4. transcription 5. traduction des protéines 6. génie génétique 7

8 réplication de l ADN ADN ARN réplication transcription protéine translation expérience de Meselson et Stahl ADN N 14 ADN N 15 l expérience indique que l ADN double brin se réplique en utilisant chacun des brins de l ADN parental comme une matrice pour générer un nouveau brin complémentaire: on parle de réplication semi-conservative car chacune des deux nouvelles molécules d ADN est formée d un brin de l ADN parental et d un nouveau brin comment se déroule la réplication? La réplication est un processus complexe qui fait intervenir une série de protéines (surtout des enzymes) qui contribuent à des étapes spécifiques. On peut diviser le processus de réplication en trois étapes: 1. initiation 2. synthèse 3. terminaison 1: initiation reconnaissance par un complexe de protéines d un point de départ (origine de la réplication) le long de la molécule d ADN d où débuter la réplication. chez les eucaryotes, il y a souvent plus d une origine de réplication par chromosome. le complexe de protéines s attache à l ADN et l hélicase l ouvre (sépare les deux brins). D autres protéines empêchent que la double hélice ne se reforme. 8

9 1: initiation le complexe de protéines s attache à l ADN et l hélicase l ouvre (sépare les deux brins). D autres protéines empêchent que la double hélice ne se reforme. 1: initiation le complexe de protéines s attache à l ADN et l hélicase l ouvre (sépare les deux brins). D autres protéines empêchent que la double hélice ne se reforme. modifié d après LadyofHats / wikicommons 2: synthèse une ADN polymérase s attache à chaque brin et génère une copie du brin complémentaire des ligases couplent les morceaux de nouveaux brins qui sont discontinus. 2: synthèse la réplication se déroule dans les deux sens la fourche de réplication désigne la structure en Y formée par l ADN parental et les deux molécules d ADN en formation. modifié d après LadyofHats / wikicommons fourches de réplication ADN 9

10 3: termination si l on sait que la termination recourt à des mécanismes spécifiques, mais ils ne sont encore que mal connus... modifié d après LadyofHats / wikicommons réplication où? là où il y a de l ADN et les enzymes nécessaires: noyau des cellules eucaryotes, mitochondries, chloroplastes pourquoi? multiplication cellulaire (mitose) génération de gamètes (méiose) génétique moléculaire 1. hérédité 2. des acides nucléiques aux chromosomes 3. réplication de l ADN 4. transcription 5. traduction des protéines 6. génie génétique la transcription ADN duplication / réplication ARN protéine la transcription consiste à copier une séquence d ADN en une séquence d ARN un seul brin d ADN est transcrit sur l ADN, une bulle de transcription se forme. L ADN y est déroulé et écarté sur une courte région. La queue de l ARN en formation est apparié à un brin d ADN (appelé brin matrice) dont il est complémentaire transcription translation 10

11 ADN la transcription la bulle se déplace le long d un tronçon d ADN appelée unité de transcription une unité de transcription est formée d une région appelée «promoteur», d une région codant pour une ou plusieurs protéines et d une région appelée «terminateur» promoteur région codant pour des protéines terminateur la transcription La transcription se déroule en trois phases: initiation : de l ARN polymérase se lie au promoteur (un site de l ADN) élongation : l ARN polymérase déroule l ADN localement, sépare les deux brins et se déplace le long de l unité de transcription. Durant ce processus, l ARN polymérase synthétise un brin d ARN complémentaire au brin d ADN qu elle parcourt terminaison : la fabrication d ARN s arrête quand l ARN polymérase atteint le «terminateur» la transcription fr.wikipedia.org/wiki/acide_amin%c3%a9 Dr. Hans-Heinrich Trepte / wik génétique moléculaire 1. hérédité 2. des acides nucléiques aux chromosomes 3. réplication de l ADN 4. transcription 5. traduction des protéines 6. génie génétique ADN duplication ARN protéine transcription translation (traduction) 11

12 les ARN trois grandes catégories: ARN de transfert (ARNt) ARN ribosomiques (ARNr) ARN messagers (ARNm) ARN de transfert petits ARN qui prennent une forme de trèfle par l appariement de bases le long du filament replié sur lui même. Il existe quelques autres types d ARN ARN de transfert ARN ribosomiques fonction: un site particulier attache un acide aminé spécifique Un autre site particulier (l anticodon) reconnait un codon spécifique (une suite de 3 nucléotides de l ARNm) l ARNt permet la traduction d un code «codons» à un code «acides aminés» anticodon Yikrazuul / wikicommon se lient à des protéines pour former les ribosomes: Un ribosome étant formé de deux sous unités avec en tout 4 ARNr et 82 protéines. fonction: structure qui organise la rencontre des ARNt et des ARNm et permet la formation des protéines modifié d après LadyofHats / wikicommons ARN messager l ARNm transfert l information de l ADN du noyau au cytoplasme où il est lu et traduit en protéines par les ribosomes. modifié d après LadyofHats / wikicommons une protéine est une chaîne d acides aminés enroulée sur elle même. la structure spatiale de la protéine détermine sa fonction les protéines 12

13 Chaque cellule dispose de 20 acides aminés différents pour fabriquer des protéines Code Abrév. Acide aminé Nature A Ala Alanine Apolaire, aliphatique C Cys Cystéine Polaire D Asp Acide aspartique Acide E Glu Acide glutamique Acide F Phe Phénylalanine Apolaire, aromatique G Gly Glycine Apolaire H His Histidine Basique, aromatique I Ile Isoleucine Apolaire, aliphatique K Lys Lysine Basique L Leu Leucine Apolaire, aliphatique LA STRUCTURE DES ACIDES AMINÉS M Met Méthionine Apolaire N Asn Asparagine Polaire O Pyl Pyrrolysine Polaire P Pro Proline Apolaire Q Gln Glutamine Polaire R Arg Arginine Basique S Ser Sérine Polaire T Thr Thréonine Polaire U Sec Sélénocystéine Polaire V Val Valine Apolaire, aliphatique W Trp Tryptophane Apolaire, aromatique Y Tyr Tyrosine Polaire, aromatique L-Alanine L-Aspartate L-Asparagine L-Histidine L-Isoleucine L-Leucine L-Sérine L-Thréonine L-Tryptophane L-Cystéine L-Lysine L-Tyrosine L-Glutamate L-Glutamine L-Méthionine L-Phénylalanine L-Pyrrolysine L-Valine L-Arginine L-Proline L-Sélénocystéine Glycine de l ADN à la protéine: le code génétique Problème: passer d un code à 4 nucléotides à un code à 20 acides aminés un ensemble de 3 nucléotides (codon) correspond à 1 acide aminé le code génétique est redondant: 1 acide aminé correspond à plus d un codon 64 codons pour 20 acides aminés 1 codon d initiation (AUG => méthionine) 3 codons STOP Le code génétique est (presque) universel. la traduction La traduction se déroule en trois phases: 1. initiation 2. élongation 3. terminaison Mouagip / wikicommon 13

14 la traduction La traduction se déroule en trois phases: 1. initiation : la petite unité d un ribosome reconnait sur l ARNm le site de départ (AUG). Elle s y couple avec un ARNt complémentaire (UAC), se qui permet à la grande unité ribosomique de les rejoindre et de former un ribosome complet, prêt à lire l ARNm. 2. élongation 3. terminaison la traduction La traduction se déroule en trois phases: 1. initiation 2. élongation : le ribosome se déplace de trois nucléotides le long de l ARNm. Un ARNt spécifique à ce codon vient s y fixer. Le ribosome porte alors 2 ARNt. Il couple à l acide aminé porté par le nouveau ARNt, l acide aminé (ou la suite d acides aminés) porté(s) par le précédent ARNt. le ribosome se déplace alors de trois nucléotides le long de l ARNm et même processus recommence. 3. terminaison la traduction La traduction se déroule en trois phases: 1. initiation 2. élongation 3. terminaison : le déplacement du ribosome le long de l ARNm continue jusqu à ce qu un codon «STOP» soit atteint. La protéine nouvellement synthétisée est libérée. Les deux unités du ribosome se séparent et libère l ARNm Une molécule d ARNm est souvent parcourue par plus d un ribosome (=>polysome) polysome (ou polyribosome) nobelprize.org Une molécule d ARNm est souvent parcourue par plus d un ribosome (=>polysome) la traduction 14

15 la traduction où? là où il y a des ribosomes, de l ARNt et de l ARNm => essentiellement dans le cytoplasme Quand? les protéines ayant une durée de vie limitée, il faut continuellement les remplacer. modifié d après LadyofHats / wikicommons 15

MÉCANISMES MOLÉCULAIRES DE L EXPRESSION DES GÉNES : LA TRADUCTION OU BIOSYNTHÈSE DES PROTÉINES

MÉCANISMES MOLÉCULAIRES DE L EXPRESSION DES GÉNES : LA TRADUCTION OU BIOSYNTHÈSE DES PROTÉINES MÉCANISMES MOLÉCULAIRES DE L EXPRESSION DES GÉNES : LA TRADUCTION OU BIOSYNTHÈSE DES PROTÉINES Le sens de lecture L ARN polymérase lit le brin matrice dans la direction 3 vers 5 de façon à synthétiser

Plus en détail

La division cellulaire Chapitre 5 Anatomie

La division cellulaire Chapitre 5 Anatomie La division cellulaire Chapitre 5 Anatomie La division cellulaire est le mode de multiplication de toute cellule. Elle lui permet de se diviser en plusieurs cellules-filles (deux le plus souvent). C'est

Plus en détail

Indications de correction exercices du chapitre 7

Indications de correction exercices du chapitre 7 RI 2 RÉIVSIR Indications de correction exercices du chapitre ➊ a) L R messager est : l acide désoxyribonucléique messager l acide ribonucléique messager une molécule constituée de deux brins de nucléotides

Plus en détail

TD 3 : LA GÉNÉTIQUE. L Homme possède 46 chromosomes, soit 23 paires de chromosomes.

TD 3 : LA GÉNÉTIQUE. L Homme possède 46 chromosomes, soit 23 paires de chromosomes. TD 3 : LA GÉNÉTIQUE ADN : acide désoxyribonucléique. ARN : acide ribonucléique.! L ADN possède deux brins, l ARN un seul. Ils sont composés de nucléotides eux-même composés d une base azoté, d un sucre,

Plus en détail

Chapitre VI : LE NOYAU

Chapitre VI : LE NOYAU Chapitre VI : LE NOYAU Le noyau est le plus gros organite cellulaire. Il a une forme sphérique ou ovale et entouré par une enveloppe membranaire qui le sépare du cytoplasme. Sa position dans la cellule

Plus en détail

Du gène à la Protéine. Réplication Transcription Traduction

Du gène à la Protéine. Réplication Transcription Traduction Du gène à la Protéine Réplication Transcription Traduction Transfert bidirectionnel de «messages»; de protéines,etc.. Membrane Nucléaire ADN Information Information Réplication Dogme de la biologie moléculaire

Plus en détail

Consultations Martinique / Guyane. Activité LABORATOIRE. Dr Odile Béra, CHU de Fort-de-France. Unité Oncogénétique

Consultations Martinique / Guyane. Activité LABORATOIRE. Dr Odile Béra, CHU de Fort-de-France. Unité Oncogénétique Dr Odile Béra, CHU de Fort-de-France Unité Oncogénétique Unité Génétique moléculaire des cancers Consultations Martinique / Guyane Prédisposition génétique cancers SEIN/OVAIRES COLON (Sd de Lynch & PAF)

Plus en détail

Biologie cellulaire. Cours 8 : Synthèse des protéines

Biologie cellulaire. Cours 8 : Synthèse des protéines Département des Troncs Communs Sciences de la Nature Faculté des Sciences de la Nature et de la Vie Université Abderrahmane Mira de Bejaia Biologie cellulaire Cours 8 : Synthèse des protéines Année universitaire

Plus en détail

5. Les interactions intermoléculaires. Questions fondamentales du chapitre 5:

5. Les interactions intermoléculaires. Questions fondamentales du chapitre 5: 5. Les interactions intermoléculaires Questions fondamentales du chapitre 5: Qu est qui détermine l état d un composé (i.e., gaz, liquide ou solide) aux conditions normales? Quels sont les types de forces

Plus en détail

CHAPITRE 1 : LA REPRODUCTION CONFORME DE LA CELLULE ET LA RÉPLICATION DE L'ADN

CHAPITRE 1 : LA REPRODUCTION CONFORME DE LA CELLULE ET LA RÉPLICATION DE L'ADN CHAPITRE 1 : LA REPRODUCTION CONFORME DE LA CELLULE ET LA RÉPLICATION DE L'ADN RAPPELS : STRUCTURE DE L'ADN RAPPELS : STRUCTURE DE L'ADN Il existe différentes représentations possibles pour l'adn. Les

Plus en détail

L expression génétique REVUE

L expression génétique REVUE L expression génétique REVUE 1. Donne trois différences entre l ADN et l ARN. L Adn est le matériel génétique qui contrôle la synthèse des protéines, alors que l ARN aide l Adn et participe à la synthèse

Plus en détail

Le noyau. Pr Edith CHEVRET Année

Le noyau. Pr Edith CHEVRET Année Le noyau Pr Edith CHEVRET Année 2016-2017 Plan Le noyau Image : Laboratoire de pathologie comparée, Saint Christol-lez-Alès Marc Ravallec / CNRS-INRA- Université Montpellier 2 2 Plan I. Définition II.

Plus en détail

PARTIE I A - QCM. 1/ Au cours de la mitose :

PARTIE I A - QCM. 1/ Au cours de la mitose : Ce sujet comporte deux parties. La Partie I est celle que vous devez effectuer lors du concours. La Partie II correspond aux sujets des autres formations qui sont donc des exercices à réaliser à la maison.

Plus en détail

STRUCTURE ET FONCTION DES GÈNES ET DES CHROMOSOMES

STRUCTURE ET FONCTION DES GÈNES ET DES CHROMOSOMES Faculté de Médecine de Sousse Tunisie Année Universitaire 209-2010 Deuxième Année Médecine Support pédagogique illustré relatif au cours: STRUCTURE ET FONCTION DES GÈNES ET DES CHROMOSOMES Pr. Ag. ELGHEZAL

Plus en détail

STRUCTURE DES ACIDES AMINES

STRUCTURE DES ACIDES AMINES UNIVERSITE 3 CONSTANTINE FACULTE DE MEDECINE DEPARTEMENT DE MEDECINE 1 ERE ANNEE MEDECINE STRUCTURE DES ACIDES AMINES I. DEFINITION. II. IMPORTANCE BIOLOGIQUE. III. CLASSIFICATION. A. EN FONCTION DE LA

Plus en détail

Chapitre 3 : La cellule bactérienne, génétique et synthèse protéique

Chapitre 3 : La cellule bactérienne, génétique et synthèse protéique Chapitre 3 : La cellule bactérienne, génétique et synthèse protéique Attention, ce cours suppose la connaissance de notions de base en génétique, notamment les notions de transcription, traduction ainsi

Plus en détail

EXPRESSION DU PATRIMOINE GENETIQUE : LA TRANSCRIPTION DE L ADN

EXPRESSION DU PATRIMOINE GENETIQUE : LA TRANSCRIPTION DE L ADN EXPRESSION DU PATRIMOINE GENETIQUE : LA TRANSCRIPTION DE L ADN INTRODUCTION - DÉFINITION Rappel : définition moléculaire du gène 5 A B C 3 ARNm ARNr ARNt Protéine fonctionnelle Flux de l information génétique

Plus en détail

Thème 1A-Expression, stabilité et variation du programme génétique

Thème 1A-Expression, stabilité et variation du programme génétique Extrait du bulletin officiel : Thème 1. La Terre dans l Univers, la vie et l évolution du vivant Thème 1 - A Expression, stabilité et variation du patrimoine génétique Ce thème s appuie sur les connaissances

Plus en détail

Séance 5. Les Acides Nucléiques. 3. Conservation de l information génétique: Réplication semi-conservative de l ADN

Séance 5. Les Acides Nucléiques. 3. Conservation de l information génétique: Réplication semi-conservative de l ADN UNIVERSITE MOHAMMED V-AGDAL FACULTE DES SCIENCES Les Acides Nucléiques DEPARTEMENT DE BIOLOGIE Filière Sciences de la Vie (SVI) Module de Biochimie (M 11) Élément : Biochimie structurale - Semestre 3-2005-2006

Plus en détail

Biologie Moléculaire et Organismes Modèles

Biologie Moléculaire et Organismes Modèles Biologie Moléculaire et Organismes Modèles Sami Khuri Department of Computer Science San José State University khuri@cs.sjsu.edu Plan du Cours Biologie Moléculaire et Organismes Modèles Qu est-ce que la

Plus en détail

De l ADN aux protéines

De l ADN aux protéines Biochimie - Biologie moléculaire De l DN aux protéines Julien FRÉ Institut de Formation en Soins Infirmiers 1 ère nnée nnée universitaire 2014-2015 Introduction DN réplication transcription traduction

Plus en détail

Bases moléculaires de l hérédité et du gène à la protéine Phage injecte matériel génétique (ADN ou protéines) dans E.coli. Protéines marquées

Bases moléculaires de l hérédité et du gène à la protéine Phage injecte matériel génétique (ADN ou protéines) dans E.coli. Protéines marquées Bases moléculaires de l hérédité et du gène à la protéine Phage injecte matériel génétique (ADN ou protéines) dans E.coli Phage injecte matériel génétique (ADN ou protéines) dans E.coli Phage injecte matériel

Plus en détail

L3-BH01 Cours n 12 Traduction (1)

L3-BH01 Cours n 12 Traduction (1) L3-BH01 Cours n 12 Traduction (1) Ce cours est présent sur le web à l adresse suivante : http://www.univ-orleans.fr/sciences/biochimie/l/ressources.htm 1 Plan Introduction I- Code génétique : comment l

Plus en détail

Cours de Biologie moléculaire de Licence professionnelle 2011

Cours de Biologie moléculaire de Licence professionnelle 2011 Cours de Biologie moléculaire de Licence professionnelle 2011 Sommaire 1. Introduction 2.1. La structure de l ADN 2.2. La structure de l ARN 2.3. Du gène à la protéine 2.3.1. La réplication 2.3.2. La transcription

Plus en détail

LES BASES MOLECULAIRES DE L ORGANISATION DU GENOME HUMAIN

LES BASES MOLECULAIRES DE L ORGANISATION DU GENOME HUMAIN LES BASES MOLECULAIRES DE L ORGANISATION DU GENOME HUMAIN I. STRUCTURE DE L ADN Le génome humain est contenu dans des NOYAUX (EUCARYOTES) Petite quantité d ADN en dehors du noyau dans la MITOCHONDRIE Sous

Plus en détail

Chapitre 3 : L expression de l information génétique. Activité 1 : Les deux étapes de l expression de l information génétique

Chapitre 3 : L expression de l information génétique. Activité 1 : Les deux étapes de l expression de l information génétique Connaissances L'ADN contient des unités d'information appelées gènes. Le génome est l ensemble du matériel génétique d un organisme. Chez les eucaryotes, la transcription a lieu dans le noyau, la traduction

Plus en détail

FACULTÉ DES ARTS ET SCIENCES DÉPARTEMENT DE CHIMIE

FACULTÉ DES ARTS ET SCIENCES DÉPARTEMENT DE CHIMIE Sigle du cours: CHM 3102 page 1 de 11 FACULTÉ DES ARTS ET SCIECES DÉPARTEMET DE CHIMIE SIGLE DU CURS: CHM 3102 TITRE DU CURS: Chimie bioanalytique avancée MS DES PRFESSEURS: Karen Waldron, Pierre Thibault

Plus en détail

TP 1 : FOUILLE D ARN

TP 1 : FOUILLE D ARN TP 1 : FOUILLE D ARN Introduction Pour le premier tp, vous allez construire des classes permettant la manipulation de chaîne d ARN (acide ribonucléique). Les objectifs du tp sont : L utilisation de l héritage.

Plus en détail

Biologie moléculaire et Génie génétique

Biologie moléculaire et Génie génétique Université Mohamed Khider-Biskra Faculté des sciences exactes et des sciences de la nature et de la vie Département des sciences de la nature et de la vie Biologie moléculaire et Génie génétique Mr. BENSLAMA

Plus en détail

Réplication de l ADN

Réplication de l ADN Réplication de l ADN L ADN des différents êtres vivants L ADN est la molécule universelle de l hérédité chromosomique : Même type de structure soit 2 brins chez tous les êtres vivants : ( animal, plante,

Plus en détail

A T C G A T C G CORRECTION TD Ecole Manip RADIO (Montpellier) Base. Sucre 3. Base Purine Base Pyrimidine. G= Guanine C= Cytosine

A T C G A T C G CORRECTION TD Ecole Manip RADIO (Montpellier) Base. Sucre 3. Base Purine Base Pyrimidine. G= Guanine C= Cytosine CORRECTION TD 2 2011-2012 Question N1. Concernant la structure de l'adn (double brin) qu'elles sont la ou les réponses exactes? A) Dans un ADN, le rapport : nombre de A /nombre de G est égal à 1. B) Plus

Plus en détail

TP 4: de l ADN à l ARNm les étapes de la transcription

TP 4: de l ADN à l ARNm les étapes de la transcription TP 4: de l ADN à l ARNm les étapes de la transcription Lycée E. Delacroix 1 ère S Programme 2011 Activité 1: la localisation de la synthèse des protéines Objectif de l autoradiographie Marquer l emplacement

Plus en détail

LA TERRE DANS L UNIVERS, la vie et l évolution du vivant

LA TERRE DANS L UNIVERS, la vie et l évolution du vivant Thème 1 A Chapitre LA TERRE DANS L UNIVERS, la vie et l évolution du vivant (5 semaines) EXPRESSION, STABILITE ET VARIATION DU PATRIMOINE GENETIQUE Introduction : Les cellules de l'organisme, à l'exception

Plus en détail

Cours IFSI Rockefeller 2013 Dr Julie Marzais

Cours IFSI Rockefeller 2013 Dr Julie Marzais Cours IFSI Rockefeller 2013 Dr Julie Marzais Synthèse s Protéines Du co génétique g aux molécules du Vivant Fonction principale l information l génétique g L information est codée e dans l ADN l succession

Plus en détail

Chapitre 3 : L expression du patrimoine génétique

Chapitre 3 : L expression du patrimoine génétique Chapitre 3 : L expression du patrimoine génétique L ADN est une molécule informative, elle détient l ensemble des informations nécessaires au fonctionnement cellulaire. Chez les organismes eucaryotes l

Plus en détail

DU GÈNE À LA PROTÉINE

DU GÈNE À LA PROTÉINE 1 DU GÈNE À LA PROTÉINE 1. Le génome et la notion de gène: Génome: ensemble du matériel génétique d'un individu. = patrimoine héréditaire Gène: région d'un brin d'adn dont la séquence code l'information

Plus en détail

Alanine (Ala) Codons: GCT, GCC, GCA, GCG

Alanine (Ala) Codons: GCT, GCC, GCA, GCG A Alanine (Ala) Codons: GCT, GCC, GCA, GCG R Arginine (Arg) Le nourrisson ne peut pas la fabriquer L'arginine est fréquemment retrouvée dans les energy drinks. Depuis 2008, elle a été remplacée par la

Plus en détail

UE2.2S1 LMD infirmier. Bases moléculaires de l organisation du génome. Dr F. Maupas-Schwalm Toulouse-Rangueil Septembre 2012

UE2.2S1 LMD infirmier. Bases moléculaires de l organisation du génome. Dr F. Maupas-Schwalm Toulouse-Rangueil Septembre 2012 UE2.2S1 LMD infirmier Bases moléculaires de l organisation du génome. Dr F. Maupas-Schwalm Toulouse-Rangueil Septembre 2012 Plan du cours I. Bases moléculaires de l organisation du génome. A. otions générales

Plus en détail

Du gène à la protéine Campbell, 4 ème édition, chapitre 17. Automne 2013, 101-NYA-05

Du gène à la protéine Campbell, 4 ème édition, chapitre 17. Automne 2013, 101-NYA-05 Du gène à la protéine Campbell, 4 ème édition, chapitre 17 Automne 2013, 101-NYA-05 1 Objectif général à l issue de ce cours Schématiser les principales étapes de la synthèse des protéines en identifiant

Plus en détail

III/De la structure à la fonction.. Le B.A.-ba Principes généraux la réplication/la transcription/la traduction

III/De la structure à la fonction.. Le B.A.-ba Principes généraux la réplication/la transcription/la traduction III/De la structure à la fonction.. Le B.A.-ba Principes généraux la réplication/la transcription/la traduction Attention! Seuls les concepts généraux seront explicités en cours Mais vous pouvez approfondir

Plus en détail

STRUCTURE DES PROTEINES

STRUCTURE DES PROTEINES STRUCTURE DES PRTEIES STRUCTURE DES PRTEIES!Les protéines sont formées à partir d un répertoire (alphabet) de 20 acides α-aminés naturels (configuration L) Chaine Latérale Amine primaire R 2 carbone α

Plus en détail

Structure et propriétés des acides aminés

Structure et propriétés des acides aminés Structure et propriétés des acides aminés Les acides aminés sont les monomères bifonctionnels constituant les chaînes polypeptidiques. Ils sont aussi les précurseurs de petites molécules bio-actives. 1)

Plus en détail

Problèmes préparatoires à l'intra III

Problèmes préparatoires à l'intra III Problèmes préparatoires à l'intra III 1. Les doubles liaisons dans les acides gras sont généralement de configuration. Réponse: cis 2. Les sels de sodium des acides gras sont utilisés dans la fabrication

Plus en détail

CORRECTION TD GENETIQUE MOLECULAIRE

CORRECTION TD GENETIQUE MOLECULAIRE CORRECTION TD GENETIQUE MOLECULAIRE SÉANCE 1 : 1. Comment est le patrimoine génétique des cellules d un individu? Identique dans toutes ses cellules somatiques. 2. Quelle molécule est le support de ce

Plus en détail

Fiche d exercices 8 : Patrimoine génétique

Fiche d exercices 8 : Patrimoine génétique Fiche d exercices 8 : Patrimoine génétique Exercice 1 Patrimoine génétique 1/9 2/9 Exercice 3 I-Restitution de connaissances 1- La séquence d un polypeptide a) est déterminée par la séquence des nucléotides

Plus en détail

AVL Liban 2011 Biologie Moléculaire et Organismes Modèles

AVL Liban 2011 Biologie Moléculaire et Organismes Modèles AVL Liban 2011 Biologie Moléculaire et Organismes Modèles Sami Khuri Department of omputer Science San José State University San José, alifornia, USA sami.khuri@sjsu.edu www.cs.sjsu.edu/faculty/khuri Plan

Plus en détail

Chapitre 6. Faisons le point sur la structure des protéines

Chapitre 6. Faisons le point sur la structure des protéines Chapitre 6. Faisons le point sur la structure des protéines 6.1. Structures primaires, secondaires, tertiaires et quaternaires 6.2. La notion de domaine fonctionnel est essentielle 6.3. Les éléments de

Plus en détail

GENETIQUE. La génétique est l étude de la transmission des caractères héréditaires et de ses anomalies.

GENETIQUE. La génétique est l étude de la transmission des caractères héréditaires et de ses anomalies. GENETIQUE La génétique est l étude de la transmission des caractères héréditaires et de ses anomalies. I- BASES BIOCHIMIQUES DE LA GENETIQUE L ADN est le support de l information génétique, c est à dire

Plus en détail

Cours 1. Comment tout savoir sur la biologie moléculaire en moins de 90 minutes?... quitte à faire quelques simplifications

Cours 1. Comment tout savoir sur la biologie moléculaire en moins de 90 minutes?... quitte à faire quelques simplifications Cours 1 Comment tout savoir sur la biologie moléculaire en moins de 90 minutes?... quitte à faire quelques simplifications Hélène Touzet La cellule 2 Que trouve-t-on dans une cellule? 30% ions,... 4% phospolipides

Plus en détail

L usage de la calculatrice n est pas autorisé.

L usage de la calculatrice n est pas autorisé. DUREE : 2 heures. Dès que ce sujet vous est remis, assurez-vous qu il est complet. Ce sujet comporte 7 pages numérotées de 1/7 à 7/7. L usage de la calculatrice n est pas autorisé. Le sujet comporte 2

Plus en détail

Qu'est-ce que l'adn?

Qu'est-ce que l'adn? Structure Physico-chimique de l'adn Qu'est-ce que l'adn? L'ADN (acide désoxyribonucléique) est une macromolécule biologique formée par deux chaînes complémentaires qui s'emboîtent tout en s'enroulant l'une

Plus en détail

Toutes les caractéristiques d'un organisme vivant sont déterminées par le type de protéines que fabrique cet être vivant. Ce qui différencie un être

Toutes les caractéristiques d'un organisme vivant sont déterminées par le type de protéines que fabrique cet être vivant. Ce qui différencie un être 2 L ADN ET LES PROTÉINES : GÉNÉRALITÉS Toutes les caractéristiques d'un organisme vivant sont déterminées par le type de protéines que fabrique cet être vivant. Ce qui différencie un être vivant d'un autre,

Plus en détail

La traduction. Synthèse des protéines: La machinerie. Composition des ribosomes procaryotes Protéines ribosomales ARNs ribosomiques.

La traduction. Synthèse des protéines: La machinerie. Composition des ribosomes procaryotes Protéines ribosomales ARNs ribosomiques. La traduction 1 triplet de nucléotide sur l ARN m (codon) 1 acide aminé Synthèse des protéines: La machinerie Le mécanisme et les éléments : polypeptide ribosome acide aminé Composition des ribosomes procaryotes

Plus en détail

Cours Biologie cellulaire

Cours Biologie cellulaire Cours Biologie cellulaire GLBE102_ L1-S1 Le Noyau et la Transcription Généralités Un organite interphasique (disparaît en fin de prophase) Contient l ADN de la cellule = génome (sauf ADN mito. et chloroplastique)

Plus en détail

BACCALAUREAT TECHNOLOGIQUE CHIMIE, BIOCHIMIE, SCIENCES DU VIVANT ET ENSEIGNEMENT SPECIFIQUE A LA SPECIALITE SCIENCES ET TECHNOLOGIES DE LABORATOIRE

BACCALAUREAT TECHNOLOGIQUE CHIMIE, BIOCHIMIE, SCIENCES DU VIVANT ET ENSEIGNEMENT SPECIFIQUE A LA SPECIALITE SCIENCES ET TECHNOLOGIES DE LABORATOIRE BAALAUREAT TEHNLGIQUE ANNALE ZER 2013 Epreuve : HIMIE, BIHIMIE, SIENES DU VIVANT ET ENSEIGNEMENT SPEIFIQUE A LA SPEIALITE Série SIENES ET TEHNLGIES DE LABRATIRE Sous-épreuve de himie, Biochimie, Sciences

Plus en détail

Thème 1 thème 1A expression, stabilité et variation du patrimoine génétique RAPPELS

Thème 1 thème 1A expression, stabilité et variation du patrimoine génétique RAPPELS Thème 1 thème 1A expression, stabilité et variation du patrimoine génétique RAPPELS Cellule Toutes les cellules possèdent un ou des chromosomes qui renferment l information génétique et sont constituées

Plus en détail

TD3: support du cours/td

TD3: support du cours/td TD3: support du cours/td Auteur: P RAG D BRUANT Livres de complément: -Maillet (Biologie cellulaire) Masson -Alberts (la cellule) Médecine-science Flammarion -Koolman (Atlas de poche de biochimie) Médecinescience

Plus en détail

THEME IA : EXPRESSION, STABILITE ET VARIATION DU PATRIMOINE GENETIQUE

THEME IA : EXPRESSION, STABILITE ET VARIATION DU PATRIMOINE GENETIQUE THEME IA : EXPRESSION, STABILITE ET VARIATION DU PATRIMOINE GENETIQUE CHAPITRE 1 : REPRODUCTION CONFORME DE LA CELLULE ET REPLICATION DE LA CELLULE INTRODUCTION : Une des propriétés fondamentales d une

Plus en détail

FLUX D INFORMATION GÉNÉTIQUE

FLUX D INFORMATION GÉNÉTIQUE FLUX D INFORMATION GÉNÉTIQUE 3 TRADUCTION C est le mécanisme par lequel le flux d information va passer de la forme acide nucléique (alphabet à 4 lettres) à la forme protéine (alphabet à 20 lettres) selon

Plus en détail

ORGANISATION MOLÉCULAIRE DES GÈNES ET RÉPLICATION DE L ADN

ORGANISATION MOLÉCULAIRE DES GÈNES ET RÉPLICATION DE L ADN ORGANISATION MOLÉCULAIRE DES GÈNES ET RÉPLICATION DE L ADN I- Définition moléculaire du gène Génos qui donne naissance Classe II (structure) Classe III Classe I Gène A Gène B Gène C mrna trna rrna Protéines

Plus en détail

Structure du gène Eucaryote, du gène Procaryote la Transcription, le Code génétique et la Traduction

Structure du gène Eucaryote, du gène Procaryote la Transcription, le Code génétique et la Traduction UNIVERSITE D ALGER Faculté de Médecine et de Médecine Dentaire ZIANIA (Château Neuf) Structure du gène Eucaryote, du gène Procaryote la Transcription, le Code génétique et la Traduction COURS DE GENETIQUE

Plus en détail

Génie génétique et biotechnologie

Génie génétique et biotechnologie Génie génétique et biotechnologie Acides nucléiques (rappel) Transcription ADN ARNm Traduction protéines Nucléotides Acides aminés Acides nucléiques Nucléotides : Gr. Phosphate Campbell 2 e edition, fig.

Plus en détail

Tut Rentrée Cours 2. Le tutorat est gratuit. Toute reproduction ou vente est interdite

Tut Rentrée Cours 2. Le tutorat est gratuit. Toute reproduction ou vente est interdite Tut Rentrée 2016 1 Cours 2 2 Synthèse des protéines o Code génétique o Traduction d un ARNm o Mutations Régulation de l expression d un gène o Généralités o Régulation des gènes procaryotes o Régulation

Plus en détail

COURS N 8 DE BIOLOGIE CELLULAIRE : LA TRANSCRIPTION

COURS N 8 DE BIOLOGIE CELLULAIRE : LA TRANSCRIPTION COURS N 8 DE BIOLOGIE CELLULAIRE : LA TRANSCRIPTION

Plus en détail

Génome humain, hérédité et information génétique

Génome humain, hérédité et information génétique Diplôme d État Infirmier - Cycle de la vie et grandes fonctions UE 2.2 Génome humain, hérédité et information génétique Service de Biochimie & Génétique Moléculaire Jean-Pierre Rabès 23 septembre 2011

Plus en détail

MÉCANISMES MOLÉCULAIRES DE L EXPRESSION DES GÉNES : LA TRADUCTION OU BIOSYNTHÈSE DES PROTÉINES

MÉCANISMES MOLÉCULAIRES DE L EXPRESSION DES GÉNES : LA TRADUCTION OU BIOSYNTHÈSE DES PROTÉINES MÉCANISMES MOLÉCULAIRES DE L EXPRESSION DES GÉNES : LA TRADUCTION OU BIOSYNTHÈSE DES PROTÉINES I-Introduction - définition gène 5 A B C 3 transcription Traduction mrna AA1-AA2-AA3 AAn Protéines fonctionnelles

Plus en détail

Corrigé série N 2. Exercice 1 QCS (V/F)

Corrigé série N 2. Exercice 1 QCS (V/F) Exercice 1 Corrigé série N 2 QCS (V/F) V1-Les acides nucléiques sont des polymères de nucléotides F2-Un nucléotide est un enchaînement base glucide F3-Les bases azotées sont toutes complémentaires F4-Les

Plus en détail

Chapitre 7 La reproduction conforme des cellules eucaryotes. 1- Dans les méristèmes, la mitose végétale permet la production de nouvelles cellules

Chapitre 7 La reproduction conforme des cellules eucaryotes. 1- Dans les méristèmes, la mitose végétale permet la production de nouvelles cellules Chapitre 7 La reproduction conforme des cellules eucaryotes 1- Dans les méristèmes, la mitose végétale permet la production de nouvelles cellules L activité d un méristème est marquée par des divisions

Plus en détail

CHAPITRE III : Synthèse Protéique. ADN ARN Protéines

CHAPITRE III : Synthèse Protéique. ADN ARN Protéines CHAPITRE III : Synthèse Protéique Introduction : L information contenue dans l ADN, c'est-à-dire le matériel génétique, se présente sous forme de séquences nucléotidiques précises, alignées sur les brins

Plus en détail

Eléments primordiaux de biologie moléculaire

Eléments primordiaux de biologie moléculaire Eléments primordiaux de biologie moléculaire Pourquoi s intéresser au matériel génétique? Base de l information génétique Tissu Cellule Noyau Organisme entier Lieu où est localisé l ADN Mol d ADN qui est

Plus en détail

Les interactions protéine-ligand règles de Lipinski. Pour mémoire

Les interactions protéine-ligand règles de Lipinski. Pour mémoire Les interactions protéïne-ligand Règles de Lipinski et «drugabilité» «Un des points qui nous distingue des générations précédentes, c est que nous, nous avons vu nos atomes.» Karl Kelchner Darrow (physicien)

Plus en détail

Structure secondaire (α-hélice, feuillet. Structure primaire enchaînement. Structure Tertiaire ---> fonction

Structure secondaire (α-hélice, feuillet. Structure primaire enchaînement. Structure Tertiaire ---> fonction Structure secondaire (α-hélice, feuillet ß ) Structure primaire enchaînement Structure Tertiaire ---> fonction Protéines Fonction Structure tridimensionnelle Structure primaire = enchaînement d acides

Plus en détail

Brin transcrit : chaine de l ADN qui, par complémentarité des nucléotides, sert de modèle pour la synthèse de l ARN messager

Brin transcrit : chaine de l ADN qui, par complémentarité des nucléotides, sert de modèle pour la synthèse de l ARN messager Fin du cours chap 5 La transcription : de l ADN à l ARN : Par définition, le brin transcrit est le brin d ADN complémentaire de l ARN : c est le brin qui sert à la synthèse de l ARN, donc ici le brin2.

Plus en détail

Unité de Biologie Moléculaire

Unité de Biologie Moléculaire Le dogme central de la Biologie Moléculaire Unité de Biologie Moléculaire Cours général (Transcription et Traduction) C. Jourlin-Castelli Acide DéoxyriboNucléique () Transcription Biologie Moléculaire

Plus en détail

Examen de Biologie moléculaire 2011(1, 2), Faculté des Sciences-Semlalia, Université Cadi Ayyad, Marrakech, Maroc. Durée 1 heure

Examen de Biologie moléculaire 2011(1, 2), Faculté des Sciences-Semlalia, Université Cadi Ayyad, Marrakech, Maroc. Durée 1 heure Examen de Biologie moléculaire 2011(1, 2), Faculté des Sciences-Semlalia, Université Cadi Ayyad, Marrakech, Maroc. Durée 1 heure Examen 1 (Corrections 1) -- Examen 2 (Corrections 2) -- Examen 1 - Partie

Plus en détail

a. Participent à la transcription nucléotides b. Participent à la traduction b. Sont le support de l information

a. Participent à la transcription nucléotides b. Participent à la traduction b. Sont le support de l information Nom Prénom : EVALUATION Première S 4 février 2015 /29 Restituer et mobiliser des connaissances exigibles Raisonner, argumenter, Informations : une évaluation doit être rédigée sur une copie correctement

Plus en détail

Cours de Biologie Moléculaire SVI- S5 ( )

Cours de Biologie Moléculaire SVI- S5 ( ) Cours de Biologie Moléculaire SVI- S5 (2014-15) Le dogme centrale de la Biologie Moléculaire Représente le mécanisme d expression de l information génétique (Francis Crick (fin des années 50) et Nature

Plus en détail

Structure des protéines, des acides nucléiques et de leurs complexes E.Westhof

Structure des protéines, des acides nucléiques et de leurs complexes E.Westhof Structure des protéines, des acides nucléiques et de leurs complexes E.Westhof Big bang il y au moins 15 milliards d années Qu est-ce que la vie? Le mieux est de considérer les propriétés qui sont nécessaires

Plus en détail

Biologie Moléculaire

Biologie Moléculaire Biologie Moléculaire Sommaire Des liaisons chimiques à la structure des acides nucléiques La Transcription Maturation du transcrit La Traduction La Réplication Les Télomères 1 Des liaisons chimiques à

Plus en détail

Professeur Michel SEVE

Professeur Michel SEVE UE1: Cycle 4 : Biomolécules (1) : Acides aminés et protéines Chapitre 2 Les acides aminés: Propriétés Physicochimiques Professeur Michel SEVE Année universitaire 2009/2010 Université Joseph Fourier de

Plus en détail

Baccalauréat technologique annale zéro

Baccalauréat technologique annale zéro éduscl Baccalauréat technologique Enseignement de Chimie, Biochimie, Sciences du Vivant Baccalauréat technologique annale zéro Annale zéro 3 : Sciences et technologies de laboratoire Durée de la sous-épreuve

Plus en détail

Microbiologie BIOL La génétique microbienne: les mécanismes de la variation génétique

Microbiologie BIOL La génétique microbienne: les mécanismes de la variation génétique Microbiologie BIOL 3253 La génétique microbienne: les mécanismes de la variation génétique Reproduction sexuée et asexuée Contrairement aux organismes eucaryotes, les procaryotes n effectuent pas de reproduction

Plus en détail

Traduction des ARNm : synthèse protéique

Traduction des ARNm : synthèse protéique Traduction des ARNm : synthèse protéique Traduction Notions générales. Traduction : synthèse d une protéine donnée à partir d un ARNm spécifique. Synthèse protéique localisée dans le cytoplasme (et la

Plus en détail

Stage de Pré-Rentrée de Biochimie. Chapitre 3 : Biologie Moléculaire. Cours

Stage de Pré-Rentrée de Biochimie. Chapitre 3 : Biologie Moléculaire. Cours Stage de Pré-Rentrée de Biochimie Chapitre 3 : Biologie Moléculaire Cours 30 août 2013 1 Les acides nucléiques Il existe plusieurs types d'acides nucléiques, mais essentiellement deux vont nous intéresser,

Plus en détail

IV Expression des gènes : transcription et traduction

IV Expression des gènes : transcription et traduction IV Expression des gènes : transcription et traduction La transcription et la traduction ont lieu dans des compartiments séparés chez les eucaryotes Procaryote 1/ Définition d un gène Gène : segment d ADN

Plus en détail

Cours 3 : Bases de la génétique, transcription, synthèse des protéines, structures des protéines, enzymes

Cours 3 : Bases de la génétique, transcription, synthèse des protéines, structures des protéines, enzymes Cours 3 : Bases de la génétique, transcription, synthèse des protéines, structures des protéines, enzymes Partie 1 : Bases de la génétique, transcription, synthèse des protéines I) Les gènes contrôlent

Plus en détail

Le support de l information génétique est constitué par une ou plusieurs molécules d ADN

Le support de l information génétique est constitué par une ou plusieurs molécules d ADN Le support de l information génétique est constitué par une ou plusieurs molécules d ADN Dr. R. Raynal, 2003 Les êtres vivants possèdent au sein de leurs cellules un "programme génétique" (donnant les

Plus en détail

La synthèse des protéines

La synthèse des protéines La synthèse des protéines exemple vers théorie Rappel : le phénotype correspond à l'ensemble des caractéristiques d'un individu. Ces caractéristiques peuvent s'observer à différentes échelles. Un caractère

Plus en détail

CHAPITRE 3 LA SYNTHESE DES PROTEINES

CHAPITRE 3 LA SYNTHESE DES PROTEINES CHAITRE 3 LA SYNTHESE DES ROTEINES On sait qu un gène détient dans sa séquence nucléotidique, l information permettant la synthèse d un polypeptide. Ce dernier caractérisé par sa séquence d acides aminés

Plus en détail

CORRECTION EXERCICES MORPHOGENESE MITOSE ET MORPHOGENESE : P 221

CORRECTION EXERCICES MORPHOGENESE MITOSE ET MORPHOGENESE : P 221 ORREION EXERIES MORPHOENESE MIOSE E MORPHOENESE : P 221 Exercice 1 p 221 : Définir en une phrase les mots suivants Méristème = zone de croissance végétale, par multiplication cellulaire Morphogenèse =

Plus en détail

Thème 1 : La Terre dans l Univers, la Vie et l évolution du vivant. Partie 1 : Expression, stabilité et variation du patrimoine génétique

Thème 1 : La Terre dans l Univers, la Vie et l évolution du vivant. Partie 1 : Expression, stabilité et variation du patrimoine génétique TP 6 : Du gène à la protéine (2) Thème 1 : La Terre dans l Univers, la Vie et l évolution du vivant Partie 1 : Expression, stabilité et variation du patrimoine génétique Chapitre 3 : L expression du patrimoine

Plus en détail

Chapitre 1 Les acides aminés : Structures. Professeur Michel SEVE

Chapitre 1 Les acides aminés : Structures. Professeur Michel SEVE UE1 : Biomolécules (1) : Acides aminés et protéines Chapitre 1 Les acides aminés : Structures Professeur Michel SEVE Année universitaire 2010/2011 Université Joseph Fourier de Grenoble - Tous droits réservés.

Plus en détail

Prépa scientifique Vivant, cellules, molécules organiques et génétique (E 01)

Prépa scientifique Vivant, cellules, molécules organiques et génétique (E 01) Maestris 2016-2017 Mardi 4 octobre 2016 Durée : 1 heure Prépa scientifique Vivant, cellules, molécules organiques et génétique (E 01) Question 1 : Brassage génétique et diversité (5 points) On s intéresse

Plus en détail

Chapitre 7 Les acides nucléiques

Chapitre 7 Les acides nucléiques Chapitre 7 Les acides nucléiques Section 3: La réplication de l ADN http://highered.mcgrawhill.com/olcweb/cgi/pluginpop.cgi?it=swf::535::535::/sites/dl/free/0072 437316/120076/micro04.swf::DNA%20Replication%20Fork

Plus en détail

LA TRADUCTION. Le code génétique correspond à l enchainement ordonné de trois bases nucléotidiques (triplets) permettant de définir un acide aminé.

LA TRADUCTION. Le code génétique correspond à l enchainement ordonné de trois bases nucléotidiques (triplets) permettant de définir un acide aminé. Faculté de médecine d Alger Module de génétique. Dr Boudiaf Benaferi R. LA TRADUCTION I /CODE GENETIQUE : a/ définition : Le code génétique correspond à l enchainement ordonné de trois bases nucléotidiques

Plus en détail

BIOCHIMIE ET BIOLOGIE MOLECULAIRE Biochimie des acides nucléiques et de l information génétique (Professeur Joël Lunardi - PCEM )

BIOCHIMIE ET BIOLOGIE MOLECULAIRE Biochimie des acides nucléiques et de l information génétique (Professeur Joël Lunardi - PCEM ) BIOCHIMIE ET BIOLOGIE MOLECULAIRE Biochimie des acides nucléiques et de l information génétique (Professeur Joël Lunardi - PCEM1 2006-2007) CHAPITRE 1. INTRODUCTION CHAPITRE 2. LES ACIDES NUCLEIQUES I.

Plus en détail

QCM supplémentaire n 2 - Correction

QCM supplémentaire n 2 - Correction QUESTION N 1 Les agents mutagènes : A) - peuvent provoquer des modifications de la séquence nucléotidique de l'adn B) - sont sans effet sur les cellules somatiques C) - augmentent la fréquence des mutations

Plus en détail

Université du Québec à Montréal

Université du Québec à Montréal RECUEIL D EXERCICES DE BICIMIE 4. Les acides aminés, peptides et polypeptides 4.1. Structure et classification 4.. Propriétés physicochimiques 4.3. Liaisons peptidiques, peptides et polypeptides Université

Plus en détail