La génomique. Etude des génomes et de l ensemble de leurs gènes. Nécessite des outils bioinformatiques. Plusieurs étapes :

Dimension: px
Commencer à balayer dès la page:

Download "La génomique. Etude des génomes et de l ensemble de leurs gènes. Nécessite des outils bioinformatiques. Plusieurs étapes :"


1 La génomique Etude des génomes et de l ensemble de leurs gènes La structure Le fonctionnement L évolution Le polymorphisme, Plusieurs étapes : Nécessite des outils bioinformatiques 1

2 Chronologie sur le séquençage de l ADN

3 Bilan des projets «génomes» en 2008/2009 Genome Online Database 840/1098 génomes complets 693/912 eubactéries 53/68 archaebactéries 94/118 eucaryotes 1883/3261 génomes procaryotes en cours de séquençage 97/110 génomes d archae en cours 950/1162 génomes eucaryotes en cours de séquençage 130/200 métagénomes Soit un total de 3900/5831 projets!! 3

4 Les différents contextes de séquençage Séquences produites par des laboratoires pour étudier un gène, un groupe de gènes, une séquence intergénique, Régions d intérêts dont le génome complet n est (n était) pas connu Etude des variations alléliques, Séquences produites par des centres de séquençage Génomes complets (HTG, WGS) ou partiels (GSS) STS ETS Métagénomes 4

5 Pourquoi séquencer les génomes? Intérêt économique Médecine Biotechnologies Environnement Intérêt scientifique Evolution des espèces Fonctionnement des cellules Etude des êtres vivants Utilité publique Nutrition Propagation des maladies Environnement 5

6 Séquençage : Méthode Sanger Idée Amorcer une polymérisation de l ADN Elongation faite à l aide de 4 désoxyribonucléotides (datp, dctp, dgtp, dttp) majoritairement + faible concentration de l'un des quatre didésoxynucléotides (ddatp, ddctp, ddgtp ou ddttp) qui arrêtent l élongation. (Note : il y a 4 expériences) Source: 6

7 Séquençage : Méthode Sanger Elongation Élongation «statistique» : plusieurs chaines de longueurs différentes. Pour chacune des 4 expériences, terminent par le «même nucleotide» Electrophorèse sur gel de polyacrylamide Source: 7

8 Séquençage : Méthode Sanger Source: 8

9 Séquenceurs automatiques basés sur Sanger 4 different fluorescently labeled dideoxy nucleotides dda, ddc, ddg and ddt Voir : 9

10 Séquençage : Méthode Sanger 10

11 WGS : Whole Genome ShotGun Construction d une librairie de fragments de génome répétition Assemblage des séquences lues en contigs PCR longue Séquençage Finition (remplissage des trous) scaffolds Vérification de la structure et de la séquence 11

12 NGS : Next Generation Sequencing 12

13 NGS : Next Generation Sequencing «high-throughput sequencing» Nouvelles technologies de séquencage Récentes: 1ere commercialisé en 2005 (actuellement Roche 454), depuis 2 autres ont suivi (Illumina Solexa, Applied Biosystems SOLiD) Rapides: ~ 3 jours au lieu de 3 mois (argument «commercial») Coût initial moins élevé, coût en production également ex: 1000 génomes à «1000$» Pour le moment moins sensible: taux d erreur actuellement plus élevé => nécessite une couverture plus forte («> 10 x coverage»)

14 NGS : Next Generation Sequencing Point commun : séquençage de milliers de «reads» courts en parallèle read = fragment «lu» dont la taille est de 35 à 100 bases. principe de lecture d un read = chaque lecture d une lettre génère un point de couleur à une position sur une image la suite d images lues donne une suite de couleurs par position, et (selon un code) une suite de nucléotides [voir exemple sur slide suivant] Avantage : Lecture de centaines de milliers de reads en parallèle (dépend de la densité en points) 1 Tera de données brutes pour finalement 1 Giga de sequences utiles

15 Principe (exemple Solexa)

16 Principe (exemple Solexa)

17 Reads remappés sur génome

18 Reads remappés sur génome (des erreurs de lecture + 1SNP)

19 19

20 20

21 Exemple SOLiD : le «color space» SOLiD Un code couleur particulier : non pas «par lettre», mais «entre deux lettres» bleu = la lettre suivante est la même que la précédente rouge = la lettre suivante est le complémentaire (A <-> T, C <->G) jaune = la lettre suivante est l autre lettre du même groupe purine ou pyrimidine (purine = {A<->G}, pyrimidine = {C<->T}) vert = le dernier cas... («réponse D: la réponse D»)

22 Exemple SOLiD : le «color space» SOLiD Un code couleur particulier : Intérêt : distinguer les SNPs des erreurs de lecture SNP = «single nucleotide polymorphism» : changement d une seule lettre sur le génome séquencé/génome référence Erreur de lecture : la lecture d une couleur n a pas été effectué correctement (lire un bleu au lieu d un rouge par exemple )

Le séquençage à haut débit Mars 2011

Le séquençage à haut débit Mars 2011 Atelier Epigénétique Université Pierre et Marie Curie Le séquençage à haut débit Mars 2011 Stéphane Le Crom ( Institut de Biologie de l École normale supérieure (IBENS) de la Montagne

Plus en détail

Le séquençage à haut débit Juin 2012

Le séquençage à haut débit Juin 2012 Atelier Epigénétique Université Pierre et Marie Curie Le séquençage à haut débit Juin 2012 Stéphane Le Crom ( Laboratoire de Biologie du Développement (UPMC) de la Montagne Sainte

Plus en détail

Lettres: A, T, G, C. Mots: à 3 lettres (codons) Phrase: gène (information pour synthétiser une protéine). Ponctuation

Lettres: A, T, G, C. Mots: à 3 lettres (codons) Phrase: gène (information pour synthétiser une protéine). Ponctuation 2- Les molécules d ADN constituent le génome 2-1 La séquence d ADN représente l information génétique Lettres: A, T, G, C Mots: à 3 lettres (codons) Phrase: gène (information pour synthétiser une protéine).

Plus en détail

Bioinformatique et données biologiques

Bioinformatique et données biologiques Bioinformatique et données biologiques QUELQUES MOTS SUR LA BIOINFO Cours d'introduction à la bioinformatique et de présentation des banques de séquences. Connaissances 1 ère partie Equipe Bonsai (2014)

Plus en détail

Bioinformatique et données biologiques

Bioinformatique et données biologiques Bioinformatique et données biologiques Cours d'introduction à la bioinformatique et de présentation des banques de séquences. 1 ère partie Equipe Bonsai (2014) QUELQUES MOTS SUR LA BIOINFO Connaissances

Plus en détail

Biologie Moléculaire 6 GT SG FWB Leçon n 5

Biologie Moléculaire 6 GT SG FWB Leçon n 5 Biologie Moléculaire 6 GT SG FWB Leçon n 5 Tests de paternité (fin labo électrophorèse) Un test de paternité consiste à analyser l'adn de deux personnes dans le but d'établir un lien de parenté génétique.

Plus en détail

A la rencontre du séquençage haut-débit nouvelle génération. Infosys Building, Kuwait

A la rencontre du séquençage haut-débit nouvelle génération. Infosys Building, Kuwait A la rencontre du séquençage haut-débit nouvelle génération Infosys Building, Kuwait 2001 : Aboutissement du projet Génome Humain Ancêtres & Renouveau 2010 Hélicos, Ion torrent, Pacbio, Oxford Nanopore

Plus en détail

Les technologies de séquençage à haut débit. Patrick Wincker, Genoscope, Institut de Génomique du CEA

Les technologies de séquençage à haut débit. Patrick Wincker, Genoscope, Institut de Génomique du CEA Les technologies de séquençage à haut débit Patrick Wincker, Genoscope, Institut de Génomique du CEA CNG, 12.05.2009 Séquençage Sanger (méthode des dididéoxy terminateurs) : a permis les progrès de la

Plus en détail

Méthodes de séquençage d ADN

Méthodes de séquençage d ADN Méthodes de séquençage d ADN Rappel : ADN, Clonage, Électrophorèse Méthode chimique de Maxam et Gilbert Méthode enzymatique de Sanger Détails des techniques utilisées au début des années 1990 Séquençage

Plus en détail

Obtention de données génétiques à grande échelle

Obtention de données génétiques à grande échelle Obtention de données génétiques à grande échelle Stéphanie FERREIRA Ph.D. Campus de l Institut Pasteur de Lille 1, rue du Professeur Calmette 59000 LILLE Tel : 03 20 87 71 53 Fax : 03 20 87 72 64

Plus en détail

Génie génétique. Définition : Outils nécessaires : Techniques utilisées : Application du génie génétique : - Production de protéines

Génie génétique. Définition : Outils nécessaires : Techniques utilisées : Application du génie génétique : - Production de protéines Génie génétique Définition : Ensemble de méthodes d investigation et d expérimentation sur les gènes. Outils nécessaires : ADN recombinant, enzyme de restriction, vecteur, banque ADNc, sonde nucléique...

Plus en détail


LE GÉNIE GÉNÉTIQUE ET LA BIOLOGIE MOLÉCULAIRE LE GÉNIE GÉNÉTIQUE ET LA BIOLOGIE MOLÉCULAIRE Plan Introduction I - Qu est ce Que le génie génétique? II - Quels sont les outils du génie génétique? II.1- Les Enzymes II.1.1- Enzymes de restriction II.1.2-

Plus en détail

Licence d Informatique Année 2001-2002 Option: Introduction à la biologie moléculaire. LA P.C.R. Polymerase Chain Reaction

Licence d Informatique Année 2001-2002 Option: Introduction à la biologie moléculaire. LA P.C.R. Polymerase Chain Reaction Licence d Informatique Année 2001-2002 Option: Introduction à la biologie moléculaire LA P.C.R. Polymerase Chain Reaction "chercher une aiguille dans une meule de foin"? Chercher à repérer un gène particulier

Plus en détail

Plateforme de Recherche de Mutations

Plateforme de Recherche de Mutations Plateforme de Recherche de Mutations Jean-Marc Aury contact: 29 janvier 2009 Introduction Présentation des données produites par le GSFLX : type, qualité, Méthodes de détection de

Plus en détail

8.3.3 Réactifs. La polymérase catalyse la synthèse de brins complémentaires d ADN.

8.3.3 Réactifs. La polymérase catalyse la synthèse de brins complémentaires d ADN. 8.3.3 Réactifs 1. AD polymérase: La polymérase catalyse la synthèse de brins complémentaires d AD. Des polymérases qui sont résistantes à la chaleur sont utilisées, telles que la Taq polymérase (Thermus

Plus en détail

Olivier Bouchez, GeT-PlaGe Responsable SéquenS.

Olivier Bouchez, GeT-PlaGe Responsable SéquenS. Séquençage Haut-Débit sur GeT Olivier Bouchez, GeT-PlaGe Responsable SéquenS quençage Haut-débit Localisation des séquenceurss Plateforme Génomique INRA Auzeville Séquenceurs

Plus en détail

Interprétation des résultats et troubleshooting

Interprétation des résultats et troubleshooting Interprétation des résultats et troubleshooting Le Service de séquençage du Centre d innovation Génome Québec et Université McGill utilise des appareils 3730xl DNA Analyzer d Applied Biosystems. Cette

Plus en détail

Le séquençage haut-débit

Le séquençage haut-débit Nouveaux outils en biologie Le séquençage haut-débit DES d hématologie 16 janvier 2015 Paris Alice Marceau-Renaut Laboratoire d hématologie CHRU Lille NGS = Next-Generation Sequencing Whole-genome Whole-exome

Plus en détail


INTRODUCTION À LA GÉNOMIQUE 0 INTRODUCTION À LA GÉNOMIQUE Diversité des génomes à l échelle du vivant. I. Outils de la génomique Cours INSA AMIG - Février 2013 - Yann Lesecque - 1 Plan Trois types d approches

Plus en détail

Etapes générales. Polonator. Protocole. Préparation des échantillons. Dover. Séquençage par hybridation/ligation de nonamères. Mise en service en 2009

Etapes générales. Polonator. Protocole. Préparation des échantillons. Dover. Séquençage par hybridation/ligation de nonamères. Mise en service en 2009 Next Generation DNA Sequencing Pourquoi? Séquençage par la méthode de Sanger est pour l instant le «gold standard» Besoins de séquencer toujours plus, plus vite et moins cher But: Séquencer 1 génome humain

Plus en détail

3. Biotechnologie de l ADN

3. Biotechnologie de l ADN 3. Biotechnologie de l ADN 3.1. Technologie de l ADN recombinant 3.1.1. Isolation d ADN et d ARN 3.1.2. Fragmentation de l ADN (les Endonucléases) 3.1.3. Analyse d ADN sur d agarose et d acrylamide 3.1.4.

Plus en détail

15 septembre 2010. Démo #2 MySQL Séquençage

15 septembre 2010. Démo #2 MySQL Séquençage 15 septembre 2010 Démo #2 MySQL Séquençage SQL et MySQL SQL: structured query language langage pour manipuler des données dans des bases de données relationnelles MySQL: Implantation de SQL Ajout à SQL

Plus en détail

Génotypage et Séquençage. Pierre Mournet

Génotypage et Séquençage. Pierre Mournet Génotypage et Séquençage Pierre Mournet Plan Séquençage/Génotypage Classique (usat, Sanger) Séquençage NGS (Next Generation Sequencing) Séquenceur Préparation Pré-NGS Exemple 1 NGS Exemple 2 NGS Génotypage

Plus en détail

Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013

Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013 Sélectionner les propositions exactes Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013 QCM 1 La plupart des techniques de biologie moléculaire repose sur le principe de complémentarité

Plus en détail

Séquençage haut débit (Next Generation Sequencing) 12/03/2012 Pascal Le Bourgeois, M1BBT, EM8BTGM 1

Séquençage haut débit (Next Generation Sequencing) 12/03/2012 Pascal Le Bourgeois, M1BBT, EM8BTGM 1 Séquençage haut débit (Next Generation Sequencing) 1 Pyroséquençage (454) Margulies M. et al. (2005). Genome sequencing in microfabricated high-density picolitre reactors. Nature 437:376-80 Pas de banques

Plus en détail

Génomique et GPU. Jean Michel Batto

Génomique et GPU. Jean Michel Batto Génomique et GPU Jean Michel Batto INRA, Laboratoire de Génétique Microbienne Centre de Recherche de Jouy en Josas (78) Forum TER@TEC, Ecole Supélec (91), 1 er Juillet 2009

Plus en détail

L'ADN mitochondrial a été découvert en 1962 par Margit MK Nass et Sylvan Nass par microscopie électronique.

L'ADN mitochondrial a été découvert en 1962 par Margit MK Nass et Sylvan Nass par microscopie électronique. L L'ADN mitochondrial a été découvert en 1962 par Margit MK Nass et Sylvan Nass par microscopie électronique. Figure 1 Mitochondries observées au microscope électronique à transmission Plus tard, cet ADN

Plus en détail

Génotypage par Séquençage (GBS) : Création d une carte génétique haute densité de Tournesol Population INEDI (RILs PSC8 x XRQ)

Génotypage par Séquençage (GBS) : Création d une carte génétique haute densité de Tournesol Population INEDI (RILs PSC8 x XRQ) Génotypage par Séquençage (GBS) : Création d une carte génétique haute densité de Tournesol Population INEDI (RILs PSC8 x XRQ) Baptiste Mayjonade (IE-CDD SUNRISE) Génétique et génomique des réponses aux

Plus en détail

LE SEQUENCAGE DU GENOME HUMAIN. Historique Séquençage Résultats

LE SEQUENCAGE DU GENOME HUMAIN. Historique Séquençage Résultats LE SEQUENCAGE DU GENOME HUMAIN Historique Séquençage Résultats Séquençage de Macromolécules Enchaînement d unités répétitives Petite molécule Couper de façon précise en sous-ensemble 50 25 25 reconstruire

Plus en détail

Marc DELPECH. CORATA La Rochelle le 21 mai 2008

Marc DELPECH. CORATA La Rochelle le 21 mai 2008 Marc DELPECH CORATA La Rochelle le 21 mai 2008 En 24 ans les progrès ont été considérables Premières utilisation des techniques de génétique moléculaire en diagnostic : 1984 Une palette de techniques très

Plus en détail

Bioinformatique dans l IUP

Bioinformatique dans l IUP Bioinformatique dans l IUP Intervenants Equipe Bioinfo (Laboratoire d Informatique Fondamentale de Lille) Cours : Jean-Stéphane Varré ( TD sur machine : Jean-Stéphane Varré,

Plus en détail

génomes Présentation La biologie à l'heure du séquençage des génomes Séquençage de génomes: Pourquoi? Comment? Annotation des génomes

génomes Présentation La biologie à l'heure du séquençage des génomes Séquençage de génomes: Pourquoi? Comment? Annotation des génomes Présentation Bioinformatique: analyse des génomes Céline Brochier-Armanet (Laurent Duret) Université Claude Bernard, Lyon 1 Laboratoire de Biométrie et Biologie évolutive (UMR 5558)

Plus en détail

RNAseq et NGS. Adriana Alberti Karine Labadie

RNAseq et NGS. Adriana Alberti Karine Labadie RNAseq et NGS Séquençage et Diversité LES ORGANISMES EUCARYOTES animaux plantes champignons protistes BACTERIES ARCHEES VIRUS METAGENOMES LES SOURCES ADN GENOMIQUE ARN / cdna AMPLICONS BACs ET FOSMIDES

Plus en détail

Objectif : identifier la mutation responsable de la maladie parmi les millions de polymorphisme.

Objectif : identifier la mutation responsable de la maladie parmi les millions de polymorphisme. Identification de gènes morbides Analyses mutationnelles Maladies monogéniques Objectif : identifier la mutation responsable de la maladie parmi les millions de polymorphisme. Plan : Variations du nombre

Plus en détail

Détection de mutations somatiques par NGS sur GAIIx

Détection de mutations somatiques par NGS sur GAIIx Détection de mutations somatiques par NGS sur GAIIx Aude Lamy Laboratoire de Génétique Somatique des Tumeurs CHU de Rouen Inserm U1079 Faculté de Médecine et Pharmacie de Rouen La médecine personalisée

Plus en détail

Séquençage. Bérénice Batut, DUT Génie Biologique Option Bioinformatique Année 2014-2015

Séquençage. Bérénice Batut, DUT Génie Biologique Option Bioinformatique Année 2014-2015 Séquençage Bérénice Batut, DUT Génie Biologique Option Bioinformatique Année 2014-2015 Séquençage Séquençage ADN Détermination de l ordre d enchainement des nucléotides d un fragment

Plus en détail

Étude de la biodiversité fongique à l aide de techniques de pyroséquençage

Étude de la biodiversité fongique à l aide de techniques de pyroséquençage Étude de la biodiversité fongique à l aide de techniques de pyroséquençage Biodiversité fongique Biodiversité: diversité spécifique d une communauté écologique, correspondant au nombre d espèces et à leur

Plus en détail

Analyse de l'évolution d'une épidémie bactérienne par comparaison de génomes

Analyse de l'évolution d'une épidémie bactérienne par comparaison de génomes Analyse de l'évolution d'une épidémie bactérienne par comparaison de génomes Marie Petitjean Directeur de thèse : Didier Hocquet Laboratoire d'hygiène Hospitalière - CHRU Besançon Laboratoire Chrono-Environnement

Plus en détail

Barcoding environnemental par séquençage haut débit

Barcoding environnemental par séquençage haut débit Barcoding environnemental par séquençage haut débit Potentiel et limites Jean-François Martin Échantillonnage Spécificités du barcoding environnemental Amplification (PCR) de marqueurs choisis Séquençage

Plus en détail

Pathologies et génétique moléculaire

Pathologies et génétique moléculaire Biochimie - Biologie moléculaire Pathologies et génétique moléculaire Julien Fauré Institut de Formation en Soins Infirmiers 1 ère Année Année universitaire 2014-2015 Plan Les outils de la génétique moléculaire

Plus en détail

THÈME 3 : DU GÉNOTYPE AU PHÉNOTYPE. CHAPITRE 1 : la relation entre ADN et protéines

THÈME 3 : DU GÉNOTYPE AU PHÉNOTYPE. CHAPITRE 1 : la relation entre ADN et protéines THÈME 3 : DU GÉNOTYPE AU PHÉNOTYPE CHAPITRE 1 : la relation entre ADN et protéines Les caractères d un individu dépendent de plusieurs facteurs : certains dépendent des caractères présents dans la famille

Plus en détail

Cumulo Numbio 2015. La révolution next-generation sequencing et les enjeux de l'expansion de la bioinformatique pour les biologistes.

Cumulo Numbio 2015. La révolution next-generation sequencing et les enjeux de l'expansion de la bioinformatique pour les biologistes. Cumulo Numbio 2015 La révolution next-generation sequencing et les enjeux de l'expansion de la bioinformatique pour les biologistes. Human genome sequence June 26th 2000: official announcement of the completion

Plus en détail

Le séquençage Roche 454

Le séquençage Roche 454 Le séquençage Roche 454 Stéphane Fénart, Arnaud Mouchon Roscoff, Avril 2012 Systèmes Genome Sequencers Une stratégie unique en séquençage nouvelle génération Pionniers en séquençage de nouvelle

Plus en détail



Plus en détail


DIAGNOSTIC PRÉNATAL NON INVASIF : LE SANG MATERNEL 6 LE TEST DIAGNOSTIC PRÉNATAL NON INVASIF : LE SANG MATERNEL Source : les cellules trophoblastiques Fetal cell Cell isolation Détection 5-6SA Disparition rapide après accouchement Pas de persistance après

Plus en détail

Influence du nombre de réplicats dans une analyse différentielle de données RNAseq

Influence du nombre de réplicats dans une analyse différentielle de données RNAseq Influence du nombre de réplicats dans une analyse différentielle de données RNAseq Statisticiens: Sophie Lamarre Steve Van Ginkel Sébastien Déjean - Magali San Cristobal Matthieu Vignes Biologistes: Stéphane

Plus en détail

Table des matières. Liste des figures. Liste des tableaux. Liste des notations

Table des matières. Liste des figures. Liste des tableaux. Liste des notations i ii Table des matières Liste des figures ix Liste des tableaux xi Liste des notations xi 1 Estimation des pressions de sélection sur les séquences d ADN 1 1.1 Données de séquences...........................

Plus en détail

Introduction : l ère de la génomique

Introduction : l ère de la génomique Introduction : l ère de la génomique En 1995, pour la première fois, la séquence complète du génome d une cellule vivante a été déterminée. Il s agissait d Haemophilus influenzae, une bactérie responsable

Plus en détail

Les Evolutions techniques. Marc Delpech Laboratoire de Génétique et Biologie moléculaires de l hôpital Cochin

Les Evolutions techniques. Marc Delpech Laboratoire de Génétique et Biologie moléculaires de l hôpital Cochin Les Evolutions techniques Marc Delpech Laboratoire de Génétique et Biologie moléculaires de l hôpital Cochin 1 Les principales étapes de l évolution technologique 1975 Southern blot 1977 Séquençage Sanger

Plus en détail

Principales techniques utilisées en génie génétique Ces différentes techniques peuvent également se combiner entre elles. Séquençage de l ADN

Principales techniques utilisées en génie génétique Ces différentes techniques peuvent également se combiner entre elles. Séquençage de l ADN Principales techniques utilisées en génie génétique Ces différentes techniques peuvent également se combiner entre elles Séquençage de l ADN 1- Un brin complémentaire de l ADN à séquencer est fabriqué

Plus en détail

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq Présenté par Xi LIU ATCGCGCTAGCTGGTGTATCGCATCGCGCTAGCTGGTGTATCGCGCTAGCTGGTGTATCGCGCTAGCCTGGTGTATCGCCATCGCGCTAGCTGGCGCTAGCTGAATCGCGCATATG 17 Septembre 2013 Homéoallèles Génome Normalisation Analyse différentielle

Plus en détail

Virologie vétérinaire

Virologie vétérinaire Virologie vétérinaire Chapitre 14 Perspectives en virologie Perspectives en virologie Diagnostic virologique de nouvelle génération Recherche des nouveaux virus : virus discovery Les virus comme agents

Plus en détail

Méthodes diagnostiques en génétique moléculaire

Méthodes diagnostiques en génétique moléculaire Méthodes diagnostiques en génétique moléculaire P. Latour Praticien Hospitalier Responsable UF 3427 Neurogénétique Moléculaire Laboratoire de Neurochimie Pr Renaud HCL Centre de Biologie Est DES Neurologie

Plus en détail

La médecine personnalisée Daniel Locker Professeur honoraire Université Orléans

La médecine personnalisée Daniel Locker Professeur honoraire Université Orléans La médecine personnalisée Daniel Locker Professeur honoraire Université Orléans Introduction En 1992, l introduction d'un anticorps monoclonal, l herceptine, pour le traitement du cancer du sein a donné

Plus en détail

Place et avenir du séquençage haut-débit

Place et avenir du séquençage haut-débit Place et avenir du séquençage haut-débit Olivier Bouchez La Plateforme GeT Expertise et mise à disposition d une plateforme technologique en génomique : Séquençage Génotypage

Plus en détail

Les nouvelles technologies de séquençage au Genoscope. Jean-Marc Aury, France Denoeud

Les nouvelles technologies de séquençage au Genoscope. Jean-Marc Aury, France Denoeud Les nouvelles technologies de séquençage au Genoscope Jean-Marc Aury, France Denoeud Introduction Présentation du Genoscope et des activités liées aux NTS Séquençage et assemblage des génomes procaryotes

Plus en détail


PRINCIPES DE BASES DE L ANALYSE DES CHROMOSOMES HUMAINS PRINCIPES DE BASES DE L ANALYSE DES CHROMOSOMES HUMAINS II. Outils CONTEXTE CLINIQUE Jonction entre chromosomique et moléculaire Dr G. Lefort II. TECHNIQUE 1) Le caryotype conventionnel en bandes Nécessite

Plus en détail

Single Molecule Real Time (SMRT) Sequencing : PacBio RS II

Single Molecule Real Time (SMRT) Sequencing : PacBio RS II Single Molecule Real Time (SMRT) Sequencing : PacBio RS II Input sample Genome DNA, Amplicons, cdna Input sample amounts according to the protocols (10ng-10µg) High Input sample quality (integrity and

Plus en détail

Génétique et génomique Pierre Martin

Génétique et génomique Pierre Martin Génétique et génomique Pierre Martin Principe de la sélections Repérage des animaux intéressants X Accouplements Programmés Sélection des meilleurs mâles pour la diffusion Index diffusés Indexation simultanée

Plus en détail

Jean-Louis Bergé-Lefranc

Jean-Louis Bergé-Lefranc Apport du séquençage du génome humain à la toxicologie: Toxicogénomique Jean-Louis Bergé-Lefranc QuickTime et un décompresseur TIFF (LZW) sont requis pour visionner cette image. QuickTime et un décompresseur

Plus en détail

Apport des NGS dans l'amélioration des algues

Apport des NGS dans l'amélioration des algues Des approches originales basées sur le séquençage nouvelle génération Apport des NGS dans l'amélioration des algues Gregory Carrier Laboratoire PBA Physiologie et Biotechnologie des Algues Direction: Gaël

Plus en détail

L2 microbiologie TD08: méthodes de la microbiologie moléculaire

L2 microbiologie TD08: méthodes de la microbiologie moléculaire # Andrew Tolonen ( # avril 2013 L2 microbiologie TD08: méthodes de la microbiologie moléculaire Exercise 1: amplification d'un gène d'intéret par PCR Vous êtes un médecin travaillant

Plus en détail

I. TOUITOU (Mise ligne 15/10/08 LIPCOM-RM) Faculté de Médecine Montpellier-Nîmes

I. TOUITOU (Mise ligne 15/10/08 LIPCOM-RM) Faculté de Médecine Montpellier-Nîmes er cycle PCEM MI5 Génétique moléculaire et clinique Année Universitaire 008-009 Comment apprécier la composante héréditaire des maladies?. Excès de cas familiaux - Les études familiales - - La plupart

Plus en détail

Introduction, présentation de la plateforme South Green. h"p://

Introduction, présentation de la plateforme South Green. hp:// Introduction, présentation de la plateforme South Green. h"p:// SupAgro, Montpellier, 10 février 2014 Le déluge de données NGS Next-generation sequencing Rappel: synthèse de l ADN 5

Plus en détail

PERCIMAP. Oreochromis niloticus. Construction d une carte RH à haute densité du génome de Tilapia CNRS UMR 6061

PERCIMAP. Oreochromis niloticus. Construction d une carte RH à haute densité du génome de Tilapia CNRS UMR 6061 PERCIMAP Construction d une carte RH à haute densité du génome de Tilapia Oreochromis niloticus CIRAD UPR20 Aquaculture et gestion des ressources aquatiques, Montpellier H. D Cotta E. Pepey J.F. Baroiller

Plus en détail

1809-2009 Deux siècles de science Questions d'hier, réponses d'aujourd'hui, horizons de demain

1809-2009 Deux siècles de science Questions d'hier, réponses d'aujourd'hui, horizons de demain 1809-2009 Deux siècles de science Questions d'hier, réponses d'aujourd'hui, horizons de demain Le séquençage du génome humain et après? Comment a-t-il été séquencé? Que nous apprend la séquence? Et après?

Plus en détail


REPLICATION DE L ADN REPLICATION DE L ADN I/ Caractéristiques fondamentales de la réplication 1. Modèle de réplication: La réplication peut se faire suivant 3 modèles représentés sur la figure 1. -Modèle conservatif : Les

Plus en détail

Les microarrays: technologie pour interroger le génome

Les microarrays: technologie pour interroger le génome Les microarrays: technologie pour interroger le génome Patrick DESCOMBES Plate forme génomique NCCR Frontiers in Genetics Université de Genève

Plus en détail


VI. L APPORT DES MARQUEURS MOLECULAIRES. A. Définitions VI. L APPORT DES MARQUEURS MOLECULAIRES Comme nous l avons vu précédemment, l étude des caractères quantitatifs est fondée sur l analyse statistique des performances mesurées des individus. Il en est de

Plus en détail

Gènes Diffusion - EPIC 2010

Gènes Diffusion - EPIC 2010 Gènes Diffusion - EPIC 2010 1. Contexte. 2. Notion de génétique animale. 3. Profil de l équipe plateforme. 4. Type et gestion des données biologiques. 5. Environnement Matériel et Logiciel. 6. Analyses

Plus en détail

ACTIVITE Extrait du rapport de Stage de Séverine ESCAICH

ACTIVITE Extrait du rapport de Stage de Séverine ESCAICH ACTIVITE Extrait du rapport de Stage de Séverine ESCAICH SOMMAIRE I. RÉACTION DE SÉQUENCE...2 I1. Principe de la méthode de SANGER...2 I2. Adaptation de la technique à la fluorescence...3 I3. Conditions

Plus en détail

Structure de l Opéron Tryptophane

Structure de l Opéron Tryptophane Régulation de la transcription (procaryote) Structure de l Opéron Tryptophane Opéron anabolique 5 gènes de structure nécessaires à la synthèse du tryptophane Trp Trp Trp Trp Trp 1 Régulation de la transcription

Plus en détail

10b : La PCR (locus PV92)

10b : La PCR (locus PV92) 10b : La PCR (locus PV92) Cette expérience a été mise en place afin de remplacer le protocole intitulé "PCR (locus D1S80)". L amplification est en effet meilleure et les résultats plus simples à interpréter.

Plus en détail

Séquençage Haut-Débit : HiSeq 2000 et HiSeq 2500 (Illumina)

Séquençage Haut-Débit : HiSeq 2000 et HiSeq 2500 (Illumina) Séquençage Haut-Débit : HiSeq 2000 et HiSeq 2500 (Illumina) avec automatisation sur robot Tecan EVO200 Préparation des librairies High Output - HiSeq 2000 ou 2500 Run : 11 jours -2 Flowcells, 8 lanes /

Plus en détail

ECUE 2 (L 1 -S 2 ) : Microbiologie générale Microbiologie générale

ECUE 2 (L 1 -S 2 ) : Microbiologie générale Microbiologie générale Unité d enseignement UE 8 : Biologie Moléculaire - Microbiologie ECUE 2 (L 1 -S 2 ) : Microbiologie générale Microbiologie générale 1h30 de cours et 1h15 de Travaux pratiques Un examen écrit ; un examen

Plus en détail

Information Génétique et hérédité 1- Réplication, mitose, méiose

Information Génétique et hérédité 1- Réplication, mitose, méiose Information Génétique et hérédité 1- Réplication, mitose, méiose REPLICATION DE L ADN et CYCLE CELLULAIRE quantité d'adn 4C 2C G 1 S G 2 M G 1 5 12 15 16 duplication de l'adn mitose temps heures CYCLE

Plus en détail

Utilisation de la métagénomique 16S pour la surveillance de l émergence de zoonoses bactériennes dans les populations animales

Utilisation de la métagénomique 16S pour la surveillance de l émergence de zoonoses bactériennes dans les populations animales Utilisation de la métagénomique 16S pour la surveillance de l émergence de zoonoses bactériennes dans les populations animales Réunion Rongeur 2014 CBGP Maxime Galan Métagénomique 16S: Pourquoi? Identification

Plus en détail

Formation Galaxy 13 Novembre 2014. 1 Premiers Pas

Formation Galaxy 13 Novembre 2014. 1 Premiers Pas Formation Galaxy 13 Novembre 2014 1 1-1 Connexion 1 Premiers Pas Connectez-vous sur la plateforme Galaxy SouthGreen à l adresse suivante : Utiliser votre adresse email et

Plus en détail


BIOLOGIE MOLECULAIRE BIOLOGIE MOLECULAIRE I. Eléments importants de la structure des génomes eucaryotes 1. Chromosomes et chromatines a) Caractéristiques générales d'un chromosome Les chromosomes des eucaryotes sont des grosses

Plus en détail


IDENTIFICATION DES PERSONNES PAR TESTS GENETIQUES IDENTIFICATION DES PERSONNES PAR TESTS GENETIQUES DIFFERENTES SITUATIONS - Pénal: affaires criminelles FNAEG (950000 individus actuellement) individus associés aux affaires - Civil: tests de paternité

Plus en détail

Clonage de Vénus et transformation de E.Coli.

Clonage de Vénus et transformation de E.Coli. Clonage de Vénus et transformation de E.Coli. Samueal Joseph, Romain Laverrière, Elias Laudato, Noé Mage Assisstants : Gisele Dewhurst, Charlotte Gehin, Miwa Umebayashi Résumé [1] L expérience consiste

Plus en détail

La PCR en temps réel

La PCR en temps réel La PCR en temps réel Hôpital La Rabta Tunis 6 juin 2013 Dr Sabine Favre-Bonté Maître de Conférences, Université Claude Bernard Lyon 1 UMR CNRS 5557 Ecologie Microbienne Equipe Multi-résistance environnementale

Plus en détail

Role du microbiota pulmonaire dans la mucoviscidose

Role du microbiota pulmonaire dans la mucoviscidose 29. März 2014 Role du microbiota pulmonaire dans la mucoviscidose Gaudenz Hafen, MD & MER1 Médecin assoicé Résponsable de l unité pneumologie et mucoviscidose pédiatrique Table des matières 1. Introduction

Plus en détail

Recherche et analyse de polymorphismes SNP

Recherche et analyse de polymorphismes SNP Recherche et analyse de polymorphismes SNP 1- Tablet : Détection visuelle de SNP avec Tablet Tablet est un outil graphique de visualisation d assemblage et d alignement de séquences issues de NGS (Next

Plus en détail

Interprétation des résultats

Interprétation des résultats Plateforme de séquençage Cochin Interprétation des résultats Grace à la base de données vous avez un accès direct à vos séquences. Pour valider la qualité de ces séquences vous devez visualiser leur chromatogramme.

Plus en détail

De la biologie molécualire à la génomique

De la biologie molécualire à la génomique De la biologie molécualire à la génomique Pierre Neuvial École Nationale de la Statistique et de l Administration Économique Méthodes statistiques pour la biologie Plan du cours 1 Introduction à la biologie

Plus en détail

TD Révision BIO57. Connaissance et Technique du gène

TD Révision BIO57. Connaissance et Technique du gène TD Révision BIO57 Connaissance et Technique du gène Novembre 2007 Cécile BAUDOT INSERM 910 «Génétique Médicale et Génomique Fonctionnelle» Maladies Neuromusculaires Le

Plus en détail

Analyse d échantillons alimentaires pour la présence d organismes génétiquement modifiés

Analyse d échantillons alimentaires pour la présence d organismes génétiquement modifiés Analyse d échantillons alimentaires pour la présence d organismes génétiquement modifiés Exemple de programme de travail (Base pour un cours d une semaine) M. Querci WORLD HEALTH ORGANIZATION REGIONAL

Plus en détail

1-4 Les sucres (ou saccharides)

1-4 Les sucres (ou saccharides) 1-4 Les sucres (ou saccharides) Fonctions des sucres -Fonction énergétique (mono et poly) -Sucres rapides (mono et di) -Sucres de réserves (ex: glycogène) -Fonction structurale (poly) Ex: -paroi des

Plus en détail

Les expériences françaises en analyse de «l exome» CFTR Laboratoire de Géné:que Moléculaire Inserm U827 MONTPELLIER Anne Bergougnoux Caroline Raynal

Les expériences françaises en analyse de «l exome» CFTR Laboratoire de Géné:que Moléculaire Inserm U827 MONTPELLIER Anne Bergougnoux Caroline Raynal Les expériences françaises en analyse de «l exome» CFTR Laboratoire de Géné:que Moléculaire Inserm U827 MONTPELLIER Anne Bergougnoux Caroline Raynal I. CFTR MASTR TM v2 Dx performance evalua:on study (Mul$plicom)

Plus en détail


1. PRINCIPES DE BASE DE LA BIOLOGIE MOLECULAIRE Liste d articles pour exercices EPSC à télécharger! BiolMol 2-1 1. PRINCIPES DE BASE DE LA BIOLOGIE MOLECULAIRE 1.1. Les acides nucléiques 1.1.1. Structure et expression des acides nucléiques 1.1.2. Réplication

Plus en détail

Atelier 5/11/2013. Structure de la chromatine et marques épigénétiques

Atelier 5/11/2013. Structure de la chromatine et marques épigénétiques Atelier 5/11/2013 Structure de la chromatine et marques épigénétiques La chromatine ADN ADN + Histones = Nucleosome ADN + Protéines + ARNs = Chromatine Niveau extrême de condensation = Chromosome métaphasique

Plus en détail

Le marquage moléculaire

Le marquage moléculaire Le marquage moléculaire Le marquage moléculaire regroupe un ensemble de techniques révélant des différences de séquences d (acide désoxyribonucléique) entre individus. Les marqueurs moléculaires permettent

Plus en détail

Séquençage massif en parallèle Défis technologiques et informatiques

Séquençage massif en parallèle Défis technologiques et informatiques Séquençage massif en parallèle Défis technologiques et informatiques Jean-Baptiste Rivière, PhD 10/09/2014 Séquençage massif en parallèle Défis technologiques de Sanger

Plus en détail

Stratégie de management des ressources microbiennes : application au suivi des stations d épuration industrielle du groupe Sanofi

Stratégie de management des ressources microbiennes : application au suivi des stations d épuration industrielle du groupe Sanofi Stratégie de management des ressources microbiennes : application au suivi des stations d épuration industrielle du groupe Sanofi Mise en place d outils de biologie moléculaire Céline Martinez, Pierre

Plus en détail

Aujourd hui, il y a plus de consortium, ce qui permet des avancées plus rapides.

Aujourd hui, il y a plus de consortium, ce qui permet des avancées plus rapides. GFMOM 20/01/2012 Cours 2 partie 2 T. Bourgeron II. LA CYTOGENETIQUE Nous allons étudier les anomalies chromosomiques des plus grossières aux plus fines. Ces anomalies peuvent être retrouvées dans la population

Plus en détail

Quelques termes-clef de biologie moléculaire et leur définition

Quelques termes-clef de biologie moléculaire et leur définition Acide aminé (AA) Quelques termes-clef de biologie moléculaire et leur définition Isabelle Quinkal INRIA Rhône-Alpes Septembre 2003 Petite molécule dont l enchaînement compose les protéines - on dit qu

Plus en détail

Jean-Michel CLAVERIE Information Génomique & Structurale UPR 2589 - CNRS Marseille

Jean-Michel CLAVERIE Information Génomique & Structurale UPR 2589 - CNRS Marseille Jean-Michel CLAVERIE Information Génomique & Structurale UPR 2589 - CNRS Marseille ROBOTS DE NOUVELLE GÉNÉRATION POUR LE SÉQUENÇAGE (NGS): LES IMPLICATIONS Avant (1991-2005): les étapes du séquençage (ADN)

Plus en détail

Présentation ADN Fishbase. Jolien Bamps

Présentation ADN Fishbase. Jolien Bamps Présentation ADN Fishbase Jolien Bamps Les lois de Mendel et la transmission de l hérédité Gregor Mendel Moine et botaniste hongrois (1822-1884), en charge de maintenir le potager de son monastère Considéré

Plus en détail

Dépistage Prénatal Non Invasif

Dépistage Prénatal Non Invasif Dépistage Prénatal Non Invasif Dr Mélanie JIMENEZ POCQUET Biologiste - Cytogéneticien L ABOcaryo+ L ABO+ - Chambray les Tours Les patientes connectées Les forums La presse Le presse DPNI : pourquoi

Plus en détail