HEMOGLOBINOPATHIES. Professeur Photis BERIS Service d Hématologie Hôpital Cantonal, Genève

Transcription

1 HEMOGLOBINOPATHIES Professeur Photis BERIS Service d Hématologie Hôpital Cantonal, Genève

2 Hémoglobinopathies : classification Défaut de synthèse syndromes thalassémiques Protéine anormale hémoglobines anormales Pathologie mixte hémoglobines anormales avec phénotype thalassémique

3 I Syndromes Thalassémiques α-thalassémies β-thalassémies DELETION mutation MUTATION délétion

4 Diagnostic des β-thalassémies 1 Hématométrie 2 Frottis (morphologie) 3 Dosage de l Hb A2 4 Séquençage du gène β (cas rares de β-thalassémie à Hb A2 normale, pour identifier la mutation en cas de conseil génétique)

5

6 CASE 1: Infant F.L. born on 1990 Hb: 85g/L; MCV 54.5 fl; ferritin; 96 μg/l IEF : no abnormal Hb Hb A2: 6,6 % Hb F: 9,5 % DNA analysis for α-thal and α globin gene triplication by Southern : negative bilirubine, LDH, test de Coombs: neg

7

8 Father of portuguese origin Hb 129g/L; MCV 63 fl Hb A 2 5%; Hb F 0.4% Diagnosis : β-thalassemia minor (heterozygous state) secondary to IVS I nt 1 G A (β 0 -thalassemia) mutation

9 Mother of portuguese origin Hb 146 g/l IEF: no abnormal MCV 86,6 fl MCH 29,2 pg Hb A 2 : 3,6 % MCHC 337 g/l Hb F: 1,6 % Reti 7,9 (39,5 G/L) Screening for α-thal.: negative

10 Mother of portuguese origin Sequening of the totalityof the β gene : -101 C T (G A complementaryseq) mutation of the distal CACCC box leading to β silent thalassemia

11 Silent β-thalassemia Promoter mutations: -88 (C A), -87 (C T), -87 (C G), -86 (C A), -86 (C G), in the proximal CACCC box; C>T at nt 101, in the distal CACCC box; C>T at position 92; Generally there is no anemia, no microcytosis, but slight Hb A2 and Hb F increase In combination with β o or severe β + thalassemia alleles a clinical phenotype of thalassemia intermedia results

12 Silent β-thalassemia 5 untranslated region: CAP (+1) A-C, +33 (C G), +22 (G A), +40 to 43 4bp del, +10 (-T), +20 (C G) and +45 (G C) +22 (G A) +33 (C G) +45 (G C) CAP tgcttacatttgcttctgacacaactgtgttccactagcaacctcaaacagacaccatg +1(A C) +10(-T) +20 (C G) +40 to pb deletion

13 Silent β-thalassemia 3 untranslated region: termination Cd +6 C G This mutation is common in Greece and leads to a 20-34% reduction in mrna levels IVS II nt 844 C T

14 Diagnosis of α-thalassemia (I) Microcytosis with normal Hb A2 values and normal iron status Thalassemia belt origin and positive familial history Inclusion bodies Hb electrophoresis GAP-PCR for common mutations Southern blotting

15

16

17

18 Molecular pathology of alpha thalassemia I. α-thalassemia resulting from deletions II. non-deletional types of α-thalassemia III. α-thalassemia with mental retardation or myelodysplasia the ATR-16 syndrome the ATR-X syndrome (non-deletional) the ATMDS

19

20

21 CLARK BE, THEIN SL Molecular diagnosis of haemoglobin disorders Multiplex gap-pcr for detection of the common α-thalassaemia deletions. Note an internal PCR control is included which amplifies another region of the genome to monitor false negatives (Clin Lab Haem 2004, 26: )

22 Diagnosis of α-thalassemia (II) Direct sequence analysis Thalassemia array (screening for known mutations) Restriction enzyme analysis (mutations that alter a restriction site). α/β ratio in reticulocytes It is good practice for any DNA diagnostic laboratory to have at least two alternative methods for detecting each mutation

23 Biosynthèse de l hémoglobine

24 II Hémoglobines anormales Hb S, C, D Punjab. Le diagnostic repose sur l IEF et la HPLC.

25

26 Hb anormales : clinique La majorité des Hb anormales sont asymptomatiques (actuellement 335 variantes bêta et 199 variantes alpha sont décrites). Certaines Hb anormales provoquent : 1. Hémolyse 2. Polyglobulie (Hb hyperaffines) 3. Cyanose 4. Crises vaso-occlusives

27 III Hb anormales avec phénotype thalassémique Hb E et similaires Hb hybrides (Lepore) Hb avec chaine alpha allongée (Hb CS)

28 Conclusions Les syndromes thalassémiques et les Hbs anormales sont les pathologies héréditaires les plus fréquentes. Leur apparition et sélection a été favorisée par la malaria ( zone des hémoglobinopathies = zone de la malaria). En règle générale, un état homozygote ou hétérozygote composite conduit à une anémie sévère transfuso-dépendante. Ceci justifie un dépistage systématique des hétérozygotes afin d offrir un conseil génétique ou un diagnostique prénatal.