Durée : 2 heures Coefficient : 2 REMARQUES IMPORTANTES

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimension: px
Commencer à balayer dès la page:

Download "Durée : 2 heures Coefficient : 2 REMARQUES IMPORTANTES"

Transcription

1 CONCOURS EXTERNES IT 2015 EPREUVE TECHNIQUE D ADMISSION Durée : 2 heures Coefficient : 2 CONCOURS N 134 Corps : Assistant ingénieur BAP : A Sciences du Vivant Emploi-type : Assistant en techniques biologiques Délégation organisatrice : Ile de France Ouest et Nord, Meudon REMARQUES IMPORTANTES Donnez vos réponses directement sur le sujet dans l espace réservé après chaque question. Aucun document n est autorisé. L utilisation des téléphones portables est interdite. Seul l usage d une calculatrice non programmable est autorisé. Les parties et les questions au sein de chaque partie sont indépendantes. L épreuve est notée sur 70 points et comprend : Partie 1 : Questions à choix multiples (notée sur 8 points) Partie 2 : Exercices et Questions (notés sur 62 points) A. Exercice de Biologie Moléculaire (noté sur 18 points) B. Exercice de Génétique (noté sur 12 points) C. Exercice d analyse de protocole et de compréhension (noté sur 10 points) D. Questions spécifiques (notées sur 12 points) E. Questions générales (notées sur 10 points) Page introductive à lire attentivement par le candidat

2 PARTIE 1 : QCM (Noté sur 8 points) Entourez les bonnes réponses. Plusieurs réponses peuvent être possibles pour certaines questions à choix multiples. Vous devez donner toutes les réponses exactes pour une même question pour en obtenir les points. En revanche, tout oubli ou réponse fausse est pénalisant. 1. La molécule d ADN est composée de : A. de bases azotées, de lipides et de groupements phosphates B. de lipides, de groupements phosphates et de sucres C. de bases azotées, de sucres et de groupements phosphates D. de bases azotées, de lipides et de sucres 2. Une enzyme de restriction est : A. une exonucléase B. une phosphatase C. une ribonucléase D. une endonucléase 3. Pour réaliser une expérience d amplification de gène par PCR, il faut : A. une matrice d ARN, des amorces spécifiques, des ions Ca 2+, des dntps, une ARN polymérase ARN dépendante B. une matrice d ADN, des amorces spécifiques, des ions Mg 2+, des dntps, une ADN polymérase ADN dépendante C. une matrice d ADN, des amorces spécifiques, des ions Ca 2+, des dntps, une ADN polymérase ADN dépendante D. une matrice d ADN, des amorces spécifiques, des ions Mg 2+, des NTPs, une ADN polymérase ADN dépendante 4. Pour évaluer la pureté d un échantillon d ADN par rapport aux protéines, vous mesurez par spectrométrie : A. la densité optique à 260nm B. le rapport de densité optique à 260nm et 280nm C. la densité optique à 280nm 5. Quelle(s) molécule(s) permet(tent) de visualiser des fragments d ADN séparés par électrophorèse? A. le bromure d éthidium B. le bromure de potassium C. l actinomycine D D. la green fluorescent protein (GFP) 6. Quelle(s) méthode(s) utilise(nt)-on pour évaluer le niveau de pureté d une protéine en cours de purification? A. une mesure de diffusion de la lumière B. un dosage de Bradford C. une électrophorèse SDS-PAGE D. un spectre RMN 2

3 CONCOURS EXTERNES IT 2015 EPREUVE TECHNIQUE D ADMISSION Durée : 2 heures Coefficient : 2 CONCOURS N 134 Corps : Assistant ingénieur BAP : A Sciences du Vivant Emploi-type : Assistant en techniques biologiques Délégation organisatrice : Ile de France Ouest et Nord, Meudon REMARQUES IMPORTANTES Donnez vos réponses directement sur le sujet dans l espace réservé après chaque question. Aucun document n est autorisé. L utilisation des téléphones portables est interdite. Seul l usage d une calculatrice non programmable est autorisé. Les parties et les questions au sein de chaque partie sont indépendantes. L épreuve est notée sur 70 points et comprend : Partie 1 : Questions à choix multiples (notée sur 8 points) Partie 2 : Exercices et Questions (notés sur 62 points) A. Exercice de Biologie Moléculaire (noté sur 18 points) B. Exercice de Génétique (noté sur 12 points) C. Exercice d analyse de protocole et de compréhension (noté sur 10 points) D. Questions spécifiques (notées sur 12 points) E. Questions générales (notées sur 10 points) Page introductive à lire attentivement par le candidat

4 7. Dans un gel SDS dénaturant, la séparation des protéines se fait en fonction de : A. leur charge B. leur poids moléculaire C. leur point isoélectrique D. leur teneur en acides aminés aromatiques 8. Quel(s) est (sont) la(les) molécule(s) utilisée(s) habituellement pour faire polymériser un gel de polyacrylamide : A. le TEMED B. le persulfate d ammonium C. le bis-acrylamide D. la glycine 9. La révélation des protéines séparées sur un gel de polyacrylamide peut se faire par : A. coloration au réactif de Bradford B. coloration au bleu de Coomassie C. coloration au bleu de xylène cyanol D. coloration au nitrate d argent 10. Quel(s) support(s) de chromatographie permet(tent) de purifier des protéines recombinantes? A. une résine d affinité B. une résine échangeuse d ion C. une résine d exclusion D. une résine hydrophobe 11. Quel est le nom de la méthode utilisée pour transférer une protéine sur membrane? A. Southern blot B. western blot C. northern blot D. eastern blot 12. Une protéine est : A. la plus soluble quand le ph de la solution est égale à son pi B. la moins soluble quand le ph de la solution est égale à son pi C. la plus soluble quand le ph de la solution est différent de son pi 13. En utilisant le code génétique standard, quel(s) couple(s) de codons, au niveau de l ARNm, délimite(nt) une phase ouverte de lecture? A. ATG et TAA B. AUG et UAA C. AUG et UGG D. AUG et UAG 3

5 14. L épigénétique correspond à : A. L étude des changements d activité des gènes héritables mais indépendant de la séquence d ADN B. Un phénomène pouvant impliquer certaines modifications réversibles de l ADN C. Un phénomène impliquant des modifications de la séquence de l ADN 15. La méthylation de l ADN : A. a lieu au niveau de séquences CpG chez les mammifères B. a lieu au niveau de séquences CpG chez la bactérie Escherichia coli C. a lieu au niveau de séquences GATC chez la bactérie Escherichia coli D. n a pas lieu chez les bactéries 16. Le niveau d expression d un gène normalement traduit peut être déterminé par : A. Southern blot B. western blot C. qpcr D. RT-qPCR (reverse transcriptase qpcr) 17. L ARNm eucaryotique d un gène typique humain est : A. modifié à ses 2 extrémités B. uniquement polyadénylé C. épissé pour éliminer les exons D. épissé pour éliminer les introns 18. Les gènes humains codant les protéines sont transcrits par : A. l ARN polymérase I B. l ARN polymérase II C. l ARN polymérase III D. les ARN polymérases I et II 19. Une cellule haploïde A. peux contenir deux allèles d un même gène B. peut subir la meïose C. peut entrer en mitose D. contient une seule copie d un gène donné 20. Une souris adulte A. est diploïde B. est haploïde C. peut être homozygote pour une mutation D. peut être hétérozygote pour une mutation 4

6 PARTIE 2 : EXERCICES ET QUESTIONS (Notée sur 62 points) A. EXERCICE BIOLOGIE MOLÉCULAIRE (Noté sur 18 points) Figure 1 : Séquence d ADN codant pour la protéine Artemin humaine 1 ATGGAACTTGGAGGCCTCTCCACGCTGTCCCACTGCCCCTGGCCTAGGCA GCAGGATCCACTTGGTCTCTCCGCGCAGCCTGCCCTGTGGCCCACCCTGG CCGCTCTGGCTCTGCTGAGCAGCGTCGCAGAGGCCTCCCTGGGCTCCGCG CCCCGCAGCCCTGCCCCCCGCGAAGGCCCCCCGCCTGTCCTGGCGTCCCC CGCCGGCCACCTGCCGGGGGGACGCACGGCCCGCTGGTGCAGTGGAAGAG CCCGGCGGCCGCCGCCGCAGCCTTCTCGGCCCGCGCCCCCGCCGCCTGCA CCCCCATCTGCTCTTCCCCGCGGGGGCCGCGCGGCGCGGGCTGGGGGCCC GGGCAGCCGCGCTCGGGCAGCGTGA 375 Figure 2 : Carte du plasmide pgex-6p3 3C protease recognition site Ptac ori 5

7 6

8 Clonage moléculaire (8 points) A.1) Vous allez réaliser le sous-clonage de l intégralité de la séquence d ADN codant pour la protéine Artemin en amplifiant par PCR cette séquence que vous insérerez dans le plasmide pgex-6p3 linéarisé par les endonucléases de restriction BamHI et XhoI. A.1.1) Que signifie le terme PCR? En décrire succinctement les étapes. (1 point) A.1.2) Quelle(s) particularité(s) possède(nt) généralement l ADN polymérase utilisée couramment pour la PCR? (1 point) A.2) Vous avez à votre disposition les enzymes de restriction suivantes pour réaliser le sous-clonage de la séquence d ADN : Acc65I : NlaIV : BamHI : SalI : BglII : XhoI : ClaI : Les séquences de ces sites de restriction, présents dans la séquence d ADN, sont soulignées sur la figure 1. 7

9 A.2.1) Donnez le(s) couple(s) de sites de restriction à ajouter de part et d autre de la séquence d ADN en vue de son sous-clonage dans le vecteur pgex-6p3 précédemment linéarisé? Commentez votre choix. (2 points) A.2.2) Citez une technologie de clonage permettant de s affranchir de l utilisation d enzyme(s) de restriction pour un clonage. En décrire brièvement le principe. (2 points) 8

10 A.2.3) Dessinez, en les orientant de 5 à 3, le couple d amorces (20 nucléotides chacune) nécessaires pour amplifier la séquence d ADN permettant de réaliser votre sous-clonage en utilisant les sites de restrictions que vous aurez précédemment choisis. (1,5 point) A.2.4) Vous disposez de vos amorces en solution stock à 0,1mM. Vous réalisez une dilution intermédiaire de 20x. Quel volume de la dilution intermédiaire allez-vous prélever sachant qu il faut 10pmoles de chaque amorce dans la réaction de PCR? (0,5 point) Expression de protéine (10 points) A.3) Le sous-clonage de l ADN codant pour la protéine Artemin dans le plasmide pgex-6p3 est maintenant réalisé et vous décidez d exprimer cette protéine humaine. A.3.1) Quel système d expression allez-vous utiliser? Expliquez. (1 point) A.3.2) Citez un autre système d expression pour les protéines recombinantes. Indiquez un de ses avantages. (1 point) 9

11 A.3.3) Quel type de chromatographie allez-vous utiliser préférentiellement pour purifier la protéine recombinante produite dans la phase soluble de votre extrait cellulaire? Expliquez. (1,5 points) A.3.4) Indiquez le nombre d acides aminés du polypeptide généré contenant la protéine Artemin après clivage par la protéase. Donnez en un poids moléculaire approximatif. (1 point) A.3.5) Vos analysez vos échantillons en cours de purification sur SDS-PAGE. Le tampon de charge contient du SDS et du β-mercaptoéthanol. Précisez le rôle de ces deux produits. Quelles précautions devez-vous prendre pour préparer ces solutions? (1,5 points) A.4) Soit la table du code génétique standard : 10

12 A.4.1) Donnez la séquence en acides-aminés de la séquence d ADN surlignée en gris dans la figure 1 en débutant dans la première phase de lecture. (1 point) A.4.2) Un codon est indiqué en gras dans la séquence. Pour quel acide-aminé code t il? Vous décidez de muter ce codon pour qu il code pour une lysine. Quel(s) changement(s) de nucléotide(s) allez-vous faire? (0,5 point) A.5) Vous décidez de réaliser cette mutation en utilisant la technique de «rolling-circle» qui consiste à amplifier le plasmide en une seule PCR avec un couple d amorce approprié apportant la mutation à fixer. Vous transformez la bactérie Escherichia coli dam + avec une fraction aliquote de cette réaction de PCR. Après étalement et croissance sur gélose, vous obtenez un grand nombre de colonies. Après analyse, il s avère que la majorité des colonies contiennent le plasmide parental. A.5.1) Comment réalisez-vous cette analyse pour différencier le plasmide parental du plasmide ayant intégré la mutation? (1,5 points) A.5.2) Quelle expérience simple menée au laboratoire proposez-vous pour augmenter l efficacité expérimentale? Commentez. (1 point) 11

13 B. EXERCICE GÉNÉTIQUE (Noté sur 12 points) On a généré chez la souris une mutation par intégration homologue sur un des allèles du génome d une cellule souche d un fragment d ADN contenant un gène de sélection de façon à éliminer l exon 2 d un gène d intérêt en suivant le schéma ci-dessous. Les cellules ainsi générées sont hétérozygotes pour la mutation. Elles ont ensuite servi à reconstituer une lignée de souris transmettant le gène muté dans sa lignée germinale. Techniquement, la détection des allèles sauvage et mutant peut se faire grâce aux réactions de PCR indiquées sur le schéma. Le fragment généré sur l allèle sauvage par la réaction PCR1 a une taille de 250 paires de bases. Celui généré pour l allèle mutant par la réaction de PCR2 a une taille de 400 paires de bases. (Voir schéma.) B.1) Expliquez «recombinaison homologue». (3 lignes maximum 2 points) B.2) A quoi sert le gène NeoR dans cette expérience. (3 lignes maximum 1 point) 12

14 B.3) D après vous, que sera la conséquence de la mutation sur l expression du gène ciblé? Pourquoi? (5 lignes maximum 4 points) B.4) La souris hétérozygote portant un allèle muté dans sa lignée germinale a été croisée avec une souris sauvage. Pour chacun des 5 souriceaux résultant de ce croisement, de l ADN génomique a été isolé et les réactions de PCR1 et 2 ont été effectuées. Les produits de la réaction de PCR ont été fractionnés sur un gel d agarose, et photographiés après une coloration appropriée. Les résultats sont présentés dans le schéma suivant. Donnez le génotype de chacun des souriceaux. (1 point) 13

15 B.5) L assistant-ingénieur qui suit cette lignée a effectué plusieurs croisements entre souris mâles et femelles tous hétérozygotes pour la mutation. Il a caractérisé le génotype de tous les souriceaux obtenus par la stratégie décrite ci-dessus et rassemblé les données : - Nombre de souris sauvages : 52 - Nombre de souris hétérozygotes : 98 Un autre génotype était-il attendu? Que concluez-vous de cette expérience? (On considérera que toute différence d un nombre supérieur à 10 souris par rapport au nombre théorique attendu est significative, et que toute différence inférieure résulte des aléas de l expérimentation.) (5 lignes maximum 4 points) C. ANALYSE DE PROTOCOLE / COMPRÉHENSION (Noté sur 10 points) C.1) ANALYSE DE PROTOCOLE (Noté sur 8 points) Soit un extrait de la partie «Experimental Procedures» de l article de Trispsianes K. et coll. publié en 2014 dans la revue The Journal of Biological Chemistry 289 : [..] [..] 14

16 C.1.1) Traduire les phrases encadrées en noir. (1,5 points) C.1.2) Quelle technique est utilisée pour rompre les parois bactériennes afin de libérer les protéines? Quel(s) est(sont) le(s) inconvénient(s) de cette technique? Citez une autre technique de lyse cellulaire. (1,75 points) 15

17 C.1.3) Comment se déroule l élimination de l étiquette GST? (1,5 points) C.1.4) Vous disposez des produits et solutions suivants : - Tris-HCl ph 7,5 1M - NaCl 5M - Imidazole (PM = 68,8 g.mol -1 ) - DTT 2,5M - NaN 3 (PM = 65,01 g.mol -1 ) Quelle volume de solutions et quelle quantité de poudre allez-vous prendre pour préparer le volume de tampon de lyse nécessaire à la première étape du protocole présenté dans la publication ci-dessus? Les constituants autres de ceux mentionnés cidessus ne seront pas pris en compte pour votre calcul. (1,25 points) 16

18 C.1.5) Question en anglais à répondre en anglais : C.1.5.1) Why using imidazole for eluting proteins bound to Ni-NTA resin? (1 point) C.1.5.2) Which is the role of the size exclusion chromatography step? (1 point) C.2) COMPRÉHENSION (2 points) Soit le schéma en désordre de la procédure de construction d une banque d ADN pour un séquençage haut débit. A. B. C. D. E. F. 17

19 G. Soit la description des différentes étapes : 1. Denature, anneal 1 st and 2 nd primers 2. Size select DNA on gel 3. PCR product after 1 st cycle 4. End repair of DNA fragments 5. Denature, anneal 1 st primer 6. PCR product after 18 cycles 7. Add A overhang and ligate adapters Associez chaque étape du schéma avec sa description et proposez la suite logique de la procédure de construction d une banque d ADN pour un séquençage haut débit. Indiquez une lettre et un chiffre par case D. QUESTIONS SPÉCIFIQUES (Noté sur 12 points) D.1) QUESTION 1 (4 points) Plusieurs catégories d ARN coexistent dans une cellule eucaryote dont les ARN messagers (mrna), les «mirna» et les longs ARN non-codants. Quelles sont les caractéristiques de ces différentes classes d ARN? Comment sont-ils synthétisés (présence de précurseurs, étapes de maturation)? Quelles sont les fonctions des ARN matures? (15 lignes maximum) 18

20 D.2) QUESTION 2 (2 points) La littérature décrit abondamment l usage d une méthodologie qui a recours à l interférence à ARN dite «RNAi». Quel est le mécanisme général de l interférence avec les ARN messagers cibles et la conséquence sur ceux-ci? (5 lignes) D.3) QUESTION 3 (3 points) Pour l espèce de Drosophile «Drosophila melanogaster» des collections de milliers de mutants sont accessibles depuis plusieurs banques publiques. Ces mutants sont majoritairement obtenus par une technique génétique de modification du génome. La transposase qui reconnait des motifs dit «P elements» est l enzyme clé pour l obtention de ces collections. Pouvez-vous décrire succinctement le mécanisme mettant en jeu la transposase, les éléments P et le génome de la drosophile pour l obtention de ces banques? (10 lignes maximum) 19

21 D.4) QUESTION 4 (3 points) Comment la présence de groupe méthyl sur l ADN modifie l expression des gènes chez les plantes et les insectes? (5 lignes maximum) 20

22 E. QUESTIONS GÉNÉRALES (Noté sur 10 points) E.1) EXERCICE 1 (1,5 points) On veut faire 250 ml d'une solution aqueuse d'acide trichloracétique à 80% (poids/volume). Ce produit se présente sous forme d'une poudre. On dispose d'une balance, d un bécher, d'une éprouvette de 0,5 l graduée. Décrire précisément comment procéder. (3 lignes maximum). E.2) EXERCICE 2 : Questions sur le ph (3,5 points) E.2.1) Définition (2 lignes maximum 1 point) E.2.2) Comment le mesure-t-on? (3 lignes maximum 1 point) E.2.3) Comment préparer 200 ml d'un tampon Tris de molarité 1 M, ajusté à ph 7.2 par l'acide chlorhydrique? On présentera la méthode la plus simple. Le Tris est fourni en poudre, l'acide chlorhydrique sous forme d'une solution concentrée. On dispose de tout l'équipement classique d'un laboratoire de biochimie. À titre d'indication, on donne: le poids moléculaire du Tris = g.mol -1, son pka = 8,1 et la normalité de la solution d'acide chlorhydrique fournie : 10 N. NB : ces renseignements ne sont pas tous indispensables pour répondre à la question, aucun calcul compliqué n'est nécessaire. (5 lignes maximum 1,5 points) 21

23 E.3) EXERCICE 3 : Hygiène et sécurité (5 points) E.3.1) Indiquez une signification simple aux pictogrammes ci-dessous : (1,5 points) E.3.2) Définir le terme OGM et donner un exemple d OGM. Les OGMs ont été répartis en plusieurs classes. Expliquez pourquoi et quelles en sont les conséquences pour leur manipulation au laboratoire. (10 lignes maximum 3,5 points). 22

ANNATUT. [Année ] Qcm issus des Tutorats. Correction détaillée

ANNATUT. [Année ] Qcm issus des Tutorats. Correction détaillée ANNATUT [Année 2012-2013] Qcm issus des Tutorats Correction détaillée SOMMAIRE 1. QCM Mixtes... 3 Correction :... 6 Le tutorat est gratuit. Toute reproduction ou vente sont interdites. Page 2 sur 7 2011

Plus en détail

Epreuve technique d admission Durée : 2h Coefficient : 2

Epreuve technique d admission Durée : 2h Coefficient : 2 Epreuve technique d admission Durée : 2h Coefficient : 2 Concours N 264 Corps : Assistant Ingénieur Emploi-type : Assistant en techniques de production et expérimentation végétale. Délégation organisatrice

Plus en détail

Polytech UEF1. BONCOMPAGNI Éric MCU - Univ. Nice Sophia Antipolis Site WEB : sites.unice.fr/eb. Outils moléculaires pour l analyse des génomes

Polytech UEF1. BONCOMPAGNI Éric MCU - Univ. Nice Sophia Antipolis Site WEB : sites.unice.fr/eb. Outils moléculaires pour l analyse des génomes Polytech UEF1 BONCOMPAGNI Éric MCU - Univ. Nice Sophia Antipolis Site WEB : sites.unice.fr/eb Outils moléculaires pour l analyse des génomes Pourquoi la génétique moléculaire? La génétique formelle renseigne

Plus en détail

UNIVERSITE PARIS 12 VAL DE MARNE

UNIVERSITE PARIS 12 VAL DE MARNE UNIVERSITE PARIS 12 VAL DE MARNE CONCOURS EXTERNE D ADJOINT TECHNIQUE DE RECHERCHE ET FORMATION BAP A : Sciences du vivant PREPARATEUR EN BIOLOGIE EPREUVE ECRITE D ADMISSIBILITE (durée : 2 heures coefficient

Plus en détail

TD TRANSCRIPTION 1 I II III IV P σ. Radioactivité 125 cpm cpm 130 cpm cpm. α 2 ββ Marqueurs + + α 2 ββ. 3 kb.

TD TRANSCRIPTION 1 I II III IV P σ. Radioactivité 125 cpm cpm 130 cpm cpm. α 2 ββ Marqueurs + + α 2 ββ. 3 kb. TD TRANSCRIPTION 1 Problème 1 A) Un chercheur a cloné, dans un vecteur plasmidique, un insert de 5 kb, correspondant à une très petite portion du chromosome d Escherichia coli (génome complet d E. coli

Plus en détail

Chapitre 3 : L expression de l information génétique. Activité 1 : Les deux étapes de l expression de l information génétique

Chapitre 3 : L expression de l information génétique. Activité 1 : Les deux étapes de l expression de l information génétique Connaissances L'ADN contient des unités d'information appelées gènes. Le génome est l ensemble du matériel génétique d un organisme. Chez les eucaryotes, la transcription a lieu dans le noyau, la traduction

Plus en détail

Chapitre 3 : La cellule bactérienne, génétique et synthèse protéique

Chapitre 3 : La cellule bactérienne, génétique et synthèse protéique Chapitre 3 : La cellule bactérienne, génétique et synthèse protéique Attention, ce cours suppose la connaissance de notions de base en génétique, notamment les notions de transcription, traduction ainsi

Plus en détail

Durée : 1h30 Coefficient : 2 REMARQUES IMPORTANTES

Durée : 1h30 Coefficient : 2 REMARQUES IMPORTANTES CONCOURS EXTERNES IT 2015 EPREUVE TECHNIQUE D ADMISSION Durée : 1h30 Coefficient : 2 CONCOURS N 181 Corps : Technicien de la recherche BAP : B : Sciences chimiques et sciences des matériaux Emploi-type

Plus en détail

Exercice 1 1) Identifier les bases présentes dans les structures suivantes :

Exercice 1 1) Identifier les bases présentes dans les structures suivantes : Exercice 1 1) Identifier les bases présentes dans les structures suivantes : 2) Parmi ces bases, lesquelles : a) contiennent du ribose. b) contiennent du désoxyribose. c) contiennent une purine. d) contiennent

Plus en détail

TD de Biologie Moléculaire (hybridation 1)

TD de Biologie Moléculaire (hybridation 1) UE BIO12 TD (hybridation 1) Année 2007-2008 Corinne MAUREL-ZAFFRAN L2 SV TD de Biologie Moléculaire (hybridation 1) RAPPEL DE QUELQUES NOTIONS SUR L HYBRIDATION Beaucoup de méthodes de biologie moléculaire

Plus en détail

REMARQUES IMPORTANTES

REMARQUES IMPORTANTES CONCOURS EXTERNES IT 2013 EPREUVE TECHNIQUE D ADMISSION Durée : 1 heure 30 Coefficient : 2 CONCOURS N 115 Corps : Technicien de la recherche BAP : A : Sciences du vivant Emploi-type : Technicien biologiste

Plus en détail

Fiche de révisions Terminale S Notions clés de génétique Sciences de la Vie et de la Terre

Fiche de révisions Terminale S Notions clés de génétique Sciences de la Vie et de la Terre Fiche de révisions Terminale S Notions clés de génétique Sciences de la Vie et de la Terre Schéma clé Relation ADN, gène, chromosome Chaque individu d une espèce donnée peut être définie par ses caractères

Plus en détail

GENIE GENETIQUE ET BIOCHIMIE UE 54

GENIE GENETIQUE ET BIOCHIMIE UE 54 GENIE GENETIQUE ET BIOCHIMIE UE 54 CATEGORIE : TECHNIQUE LONG SECTION : SCIENCES DE L'INGÉNIEUR INDUSTRIEL OPTION : BIOCHIMIE Année : Bloc 4 Acronyme : sera complété par le secrétariat Langue(s) d enseignement

Plus en détail

UE 2V311 TD Construction et criblage d une banque d ADN génomique d un phage.

UE 2V311 TD Construction et criblage d une banque d ADN génomique d un phage. UE 2V311 TD 1-2015 Construction et criblage d une banque d ADN génomique d un phage. Buts du TD: Connaître et comprendre toutes les étapes du clonage moléculaire, depuis la préparation de l'adn à cloner

Plus en détail

Outils de génie génétique 1.TERMINOLOGIE ENZYMES UTILISÉS SONDES MOLECULAIRE ET HYBRIDATION MOLECULAIRE

Outils de génie génétique 1.TERMINOLOGIE ENZYMES UTILISÉS SONDES MOLECULAIRE ET HYBRIDATION MOLECULAIRE Outils de génie génétique 1.TERMINOLOGIE ENZYMES UTILISÉS SONDES MOLECULAIRE ET HYBRIDATION MOLECULAIRE 1 Terminologie ADN recombinant : combinaison de deux molécules d ADN appartenant à deux espèces différentes;

Plus en détail

Corrigé série N 2. Exercice 1 QCS (V/F)

Corrigé série N 2. Exercice 1 QCS (V/F) Exercice 1 Corrigé série N 2 QCS (V/F) V1-Les acides nucléiques sont des polymères de nucléotides F2-Un nucléotide est un enchaînement base glucide F3-Les bases azotées sont toutes complémentaires F4-Les

Plus en détail

Cours de Biologie moléculaire de Licence professionnelle 2011

Cours de Biologie moléculaire de Licence professionnelle 2011 Cours de Biologie moléculaire de Licence professionnelle 2011 Sommaire 1. Introduction 2.1. La structure de l ADN 2.2. La structure de l ARN 2.3. Du gène à la protéine 2.3.1. La réplication 2.3.2. La transcription

Plus en détail

Examen de Biologie moléculaire 2011(1, 2), Faculté des Sciences-Semlalia, Université Cadi Ayyad, Marrakech, Maroc. Durée 1 heure

Examen de Biologie moléculaire 2011(1, 2), Faculté des Sciences-Semlalia, Université Cadi Ayyad, Marrakech, Maroc. Durée 1 heure Examen de Biologie moléculaire 2011(1, 2), Faculté des Sciences-Semlalia, Université Cadi Ayyad, Marrakech, Maroc. Durée 1 heure Examen 1 (Corrections 1) -- Examen 2 (Corrections 2) -- Examen 1 - Partie

Plus en détail

Fascicule d'exercices de biologie moléculaire Par Camille CHOCHOIS et Alexandre RICHARD

Fascicule d'exercices de biologie moléculaire Par Camille CHOCHOIS et Alexandre RICHARD Fascicule d'exercices de biologie moléculaire Par Camille CHOCHOIS et Alexandre RICHARD Ces exercices seront corrigés et expliqués dans l'armature de biologie moléculaire qui aura lieu le 15/11/12. Nous

Plus en détail

Les protéines recombinantes

Les protéines recombinantes Les protéines recombinantes Produire des protéines de manière contrôlée et en grande quantité 1 Les cellules hôtes 2 Les vecteurs recombinants 3 Purification des protéines recombinantes 1 1 Les cellules

Plus en détail

Epreuve finale d examen de BIO 121 (Session 1)

Epreuve finale d examen de BIO 121 (Session 1) Université Joseph Fourier - Grenoble 1 Année 2010-2011 Epreuve finale d examen de BIO 121 (Session 1) Conditions d examen : Durée : 2h Ni document, ni calculette, ni téléphone portable. Réponses directement

Plus en détail

SESSION 2011 EPREUVE A OPTION. (durée : 4 heures coefficient : 6 note éliminatoire <= 4 sur 20) BIOLOGIE

SESSION 2011 EPREUVE A OPTION. (durée : 4 heures coefficient : 6 note éliminatoire <= 4 sur 20) BIOLOGIE CONCOURS SUR ÉPREUVES OUVERT AUX CANDIDATS TITULAIRES D UN DIPLÔME VALIDANT LA FIN DE PREMIÈRE ANNÉE DU GRADE DE MASTER OU D UN CERTIFICAT DE SCOLARITÉ VALIDANT L ANNÉE PRÉCÉDANT CELLE DE L ATTRIBUTION

Plus en détail

SCIENCES DE LA VIE ET DE LA TERRE

SCIENCES DE LA VIE ET DE LA TERRE 1/7 SCIENCES DE LA VIE ET DE LA TERRE DS n 5 Épreuve de biologie 29 novembre 2014 Durée : 2 heures Le sujet comporte 2 parties indépendantes. Thème 1 Le candidat s appuiera essentiellement sur une analyse

Plus en détail

M É D E C I N E D E N TA I R E Z I A N I A LES OUTILS DE LA BIOLOGIE MOLECULAIRE

M É D E C I N E D E N TA I R E Z I A N I A LES OUTILS DE LA BIOLOGIE MOLECULAIRE U N I V E R S I T E D A LG E R FA C U LT É D E M É D E C I N E E T D E M É D E C I N E D E N TA I R E Z I A N I A LES OUTILS DE LA BIOLOGIE MOLECULAIRE DR H.YAHIA PR R.BOUDIAF PLAN DU COURS I/INTRODUCTION

Plus en détail

TUTORAT UE spé MEAG Correction Concours blanc

TUTORAT UE spé MEAG Correction Concours blanc FACULTE de PHARMACIE QCM n 1 : B, D TUTORAT UE spé MEAG 2010-2011 Correction Concours blanc A. FAUX 3 GATCTGATG 5 5 AGGTACTTA--------CTAGACTAC 3 3 TTCATGAAT--------GATCTGATG 5 5 AAGTACTTA 3 B. VRAI 3 CATCAGATC

Plus en détail

3 ème année BCG / LMD TD N 1

3 ème année BCG / LMD TD N 1 TD N 1 Soit le brin d ADN monocaténaire : 5 -TACGCCTAGCTTACGCAT-3 - Combien y a-t-il de liaisons phosphodiester dans le brin bicaténaire? - Combien y a-t-il de liaisons hydrogène dans le brin bicaténaire?

Plus en détail

Chapitre IV. Les principes de dissection génétique

Chapitre IV. Les principes de dissection génétique Chapitre IV. Les principes de dissection génétique 1 La génétique est aussi une approche expérimentale puissante pour disséquer les fonctions biologiques, cad identifier les gènes et les protéines impliquées

Plus en détail

3. Biotechnologie de l ADN

3. Biotechnologie de l ADN 3. Biotechnologie de l ADN 3.1. Technologie de l ADN recombinant 3.1.1. Isolation d ADN et d ARN 3.1.2. Fragmentation de l ADN (les Endonucléases) 3.1.3. Analyse d ADN sur d agarose et d acrylamide 3.1.4.

Plus en détail

Licence L3 mention Biologie (parcours BCGMP & BBM) UE-Contrôle de l'expression génétique chez les eucaryotes

Licence L3 mention Biologie (parcours BCGMP & BBM) UE-Contrôle de l'expression génétique chez les eucaryotes Licence L3 mention Biologie (parcours BCGMP & BBM) UE-Contrôle de l'expression génétique chez les eucaryotes Année universitaire 2006/2007 1 ère session 9 mai 2007 = = = = = = = = = = = = = = = = = = =

Plus en détail

METHODES D ISOLEMENT DES CELLULES

METHODES D ISOLEMENT DES CELLULES METHODES D ISOLEMENT DES CELLULES Isolement à partir des tissus Cultures cellulaires Clonage cellulaire 1) Isolement à partir d un tissu Etapes communes à toutes les méthodes: - dissociation mécanique

Plus en détail

3. Biotechnologie de l ADN

3. Biotechnologie de l ADN 3. Biotechnologie de l ADN 3.1. Technologie de l ADN recombinant 3.1.1. Isolation d ADN et d ARN 3.1.2. Fragmentation de l ADN (les Endonucléases) 3.1.3. Analyse d ADN sur d agarose et d acrylamide 3.1.4.

Plus en détail

Thème 1A-Expression, stabilité et variation du programme génétique

Thème 1A-Expression, stabilité et variation du programme génétique Extrait du bulletin officiel : Thème 1. La Terre dans l Univers, la vie et l évolution du vivant Thème 1 - A Expression, stabilité et variation du patrimoine génétique Ce thème s appuie sur les connaissances

Plus en détail

EXPRESSION ET ANALYSE DE

EXPRESSION ET ANALYSE DE EXPRESSION ET ANALYSE DE PROTÉINES DE FUSION DANS DES CELLULES HUMAINES EN CULTURE Assistants : Fabrizio Vacca Katarina Trajkovic - 1 - 1. Introduction Le but de cette expérience est d étudier des protéines

Plus en détail

Cours de biochimie des acides nucléiques

Cours de biochimie des acides nucléiques Module de BI 121 Cours de biochimie des acides nucléiques (Enseignante : Eve de Rosny) Plan I - Introduction = présentation rapide Les acides nucléiques Rôle de l AD et de l AR Les nucléotides II Structure

Plus en détail

X- Rôles multiples de l ARN. A- L ARN catalytique

X- Rôles multiples de l ARN. A- L ARN catalytique X- Rôles multiples de l ARN A- L ARN catalytique ! Seules les protéines ont une activité catalytique : idée profondément ancrée en biochimie! Arguments Structures tridimensionnelles variées Diversité chaînes

Plus en détail

TD 3 : LA GÉNÉTIQUE. L Homme possède 46 chromosomes, soit 23 paires de chromosomes.

TD 3 : LA GÉNÉTIQUE. L Homme possède 46 chromosomes, soit 23 paires de chromosomes. TD 3 : LA GÉNÉTIQUE ADN : acide désoxyribonucléique. ARN : acide ribonucléique.! L ADN possède deux brins, l ARN un seul. Ils sont composés de nucléotides eux-même composés d une base azoté, d un sucre,

Plus en détail

Exercice 1. KinA. Spo0F Sda. KinA. Spo0F

Exercice 1. KinA. Spo0F Sda. KinA. Spo0F Exercice 1 La protéine Sda (46 acides aminés) inhibe le phosphorelais en réponse aux dommages à l ADN. Afin de déterminer le mode d action de Sda, plusieurs expériences sont réalisées. 1. La protéine KinA

Plus en détail

PARTIE I A - QCM. 1/ Au cours de la mitose :

PARTIE I A - QCM. 1/ Au cours de la mitose : Ce sujet comporte deux parties. La Partie I est celle que vous devez effectuer lors du concours. La Partie II correspond aux sujets des autres formations qui sont donc des exercices à réaliser à la maison.

Plus en détail

Fiche d exercices 8 : Patrimoine génétique

Fiche d exercices 8 : Patrimoine génétique Fiche d exercices 8 : Patrimoine génétique Exercice 1 Patrimoine génétique 1/9 2/9 Exercice 3 I-Restitution de connaissances 1- La séquence d un polypeptide a) est déterminée par la séquence des nucléotides

Plus en détail

Héréditaire du Métabolisme» Outils de diagnostic moléculaire B. CARCY Réponses aux énoncés

Héréditaire du Métabolisme» Outils de diagnostic moléculaire B. CARCY Réponses aux énoncés 2016/17 DFGSP2 TD UE optionnelle «Maladies Héréditaire du Métabolisme» Outils de diagnostic moléculaire B. CARCY Réponses aux énoncés Exercice 1. A-Dans la cadre d une recherche de mutation responsable

Plus en détail

Chapitre 3 : L expression du patrimoine génétique

Chapitre 3 : L expression du patrimoine génétique Chapitre 3 : L expression du patrimoine génétique L ADN est une molécule informative, elle détient l ensemble des informations nécessaires au fonctionnement cellulaire. Chez les organismes eucaryotes l

Plus en détail

LES ENZYMES UTILISEES EN GENIE GENETIQUE : LES ENDONUCLEASES DE RESTRICTION

LES ENZYMES UTILISEES EN GENIE GENETIQUE : LES ENDONUCLEASES DE RESTRICTION LES ENZYMES UTILISEES EN GENIE GENETIQUE : LES ENDONUCLEASES DE RESTRICTION 1-1/ Définition : Ce sont des enzymes, principalement d origine bactérienne, capables de couper l ADN double brin (et ce quelque

Plus en détail

Concours Externe IT Epreuve technique d admission CONCOURS N 303. Corps : Technicien de la recherche BAP : B. Emploi-type : Technicien en chimie

Concours Externe IT Epreuve technique d admission CONCOURS N 303. Corps : Technicien de la recherche BAP : B. Emploi-type : Technicien en chimie Concours Externe IT 2011 Epreuve technique d admission Durée : 1h30 Coefficient : 2 CONCOURS N 303 Corps : Technicien de la recherche BAP : B Emploi-type : Technicien en chimie Délégation organisatrice

Plus en détail

PRINCIPALES TECHNIQUES DE BIOLOGIE MOLECULAIRE ET EXEMPLES D APPLICATION AU DIAGNOSTIC.

PRINCIPALES TECHNIQUES DE BIOLOGIE MOLECULAIRE ET EXEMPLES D APPLICATION AU DIAGNOSTIC. PRINIPLES EHNIQUES DE BILGIE MLEULIRE E EXEMPLES D PPLIIN U DIGNSI. I. EHNIQUES DE BSE.. Extraction des acides nucléiques. 1/ Extraction de l DN. echnique classique. Les Kits. Il existe maintenant des

Plus en détail

ORGANISATION ET EXPRESSION DU GENOME CHEZ LES EUCARYOTES, TRANSMISSION AU COURS DES DIVISIONS CELLULAIRES

ORGANISATION ET EXPRESSION DU GENOME CHEZ LES EUCARYOTES, TRANSMISSION AU COURS DES DIVISIONS CELLULAIRES Préparation à l Agrégation Interne Séances des 09 et 13 octobre 2010 ORGANISATION ET EXPRESSION DU GENOME CHEZ LES EUCARYOTES, TRANSMISSION AU COURS DES DIVISIONS CELLULAIRES Les mots clés : ADN, ARN,

Plus en détail

L EPISSAGE. I- Introduction

L EPISSAGE. I- Introduction L EPISSAGE I- Introduction Lors de la transcription des gènes codant les protéines par l ARN polymérase II, il y a synthèse d un ARN prémessager qui contient l ensemble nucléotidique du gène comprise entre

Plus en détail

LA BIOLOGIE SYNTHETIQUE. Qu est-ce que c est?

LA BIOLOGIE SYNTHETIQUE. Qu est-ce que c est? LA BIOLOGIE SYNTHETIQUE Qu est-ce que c est? L ADN Qu est-ce: L ADN Molécule renfermant l'ensemble des informations nécessaires au développementet au fonctionnementd'un organisme. Support de l'hérédité:

Plus en détail

Université de Bordeaux CONCOURS PACES - PARAMEDICAUX. UE9s. Méthodes d études et d analyse du génome. Mardi 28 avril 2015

Université de Bordeaux CONCOURS PACES - PARAMEDICAUX. UE9s. Méthodes d études et d analyse du génome. Mardi 28 avril 2015 Université de ordeaux ONOURS PS - PRMIUX U9s Méthodes d études et d analyse du génome Mardi 28 avril 2015 urée de l épreuve : 30 minutes Recommandations Le sujet comporte 5 pages (page de garde non comprise)

Plus en détail

CM: LES MALADIES HEREDITAIRES MONOGENIQUES HUMAINES: APPARITION, DIAGNOSTIC ET APPROCHES THERAPEUTIQUES

CM: LES MALADIES HEREDITAIRES MONOGENIQUES HUMAINES: APPARITION, DIAGNOSTIC ET APPROCHES THERAPEUTIQUES DFGSP2 Module SB2 UE11 : Biologie Moléculaire et Cellulaire Année 2016/2017 CM: LES MALADIES HEREDITAIRES MONOGENIQUES HUMAINES: APPARITION, DIAGNOSTIC ET APPROCHES THERAPEUTIQUES -CHAPITRE III METHODES

Plus en détail

Du galactose à la glycolyse. Approche génétique. Intérieur de la cellule

Du galactose à la glycolyse. Approche génétique. Intérieur de la cellule Du galactose à la glycolyse. Approche génétique Perméase Milieu extérieur Intérieur de la cellule Analyse génétique 2 sites mutés 1 souche de levure m5 double mutante [gal-, lys-] Double mutant Quel déterminisme

Plus en détail

MÉCANISMES MOLÉCULAIRES DE L EXPRESSION DES GÉNES : LA TRANSCRIPTION DU DNA

MÉCANISMES MOLÉCULAIRES DE L EXPRESSION DES GÉNES : LA TRANSCRIPTION DU DNA MÉCANISMES MOLÉCULAIRES DE L EXPRESSION DES GÉNES : LA TRANSCRIPTION DU DNA I- INTRODUCTION - DÉFINITION Rappel : définition moléculaire du gène Expression moléculaire du gène Clase II A B C Transcription

Plus en détail

BIOCHIMIE ET BIOLOGIE MOLECULAIRE Biochimie des acides nucléiques et de l information génétique (Professeur Joël Lunardi - PCEM )

BIOCHIMIE ET BIOLOGIE MOLECULAIRE Biochimie des acides nucléiques et de l information génétique (Professeur Joël Lunardi - PCEM ) BIOCHIMIE ET BIOLOGIE MOLECULAIRE Biochimie des acides nucléiques et de l information génétique (Professeur Joël Lunardi - PCEM1 2006-2007) CHAPITRE 1. INTRODUCTION CHAPITRE 2. LES ACIDES NUCLEIQUES I.

Plus en détail

OUTILS DE BIOLOGIE MOLECULAIRE ET GENIE GENETIQUE

OUTILS DE BIOLOGIE MOLECULAIRE ET GENIE GENETIQUE UNIVERSITE D ALGER Faculté de Médecine et de Médecine Dentaire ZIANIA (Château Neuf) OUTILS DE BIOLOGIE MOLECULAIRE ET GENIE GENETIQUE COURS DE GENETIQUE -2014-2015- Introduction les méthodes de la biologie

Plus en détail

TP d étude de la complémentation et de la recombinaison de la région rii chez le bactériophage T4

TP d étude de la complémentation et de la recombinaison de la région rii chez le bactériophage T4 TP d étude de la complémentation et de la recombinaison de la région rii chez le bactériophage T4 I. Introduction A. Phage T4 1. Structure Ce TP a pour but d étudier la complémentation et la recombinaison

Plus en détail

Polytech UEF1. BONCOMPAGNI Éric MCU - Univ. Nice Sophia Antipolis Site WEB : sites.unice.fr/eb. Outils moléculaires pour l analyse des génomes

Polytech UEF1. BONCOMPAGNI Éric MCU - Univ. Nice Sophia Antipolis Site WEB : sites.unice.fr/eb. Outils moléculaires pour l analyse des génomes Polytech UEF1 BONCOMPAGNI Éric MCU - Univ. Nice Sophia Antipolis Site WEB : sites.unice.fr/eb Outils moléculaires pour l analyse des génomes Cloner des séquences d intérêt Le clonage d une séquence But

Plus en détail

a) Donnez une explication à cette limite du nombre de mitoses des cellules somatiques (= du corps, non reproductrice). (1pt)

a) Donnez une explication à cette limite du nombre de mitoses des cellules somatiques (= du corps, non reproductrice). (1pt) Nom :_CORRECTIONS Groupe : 3 nov 2009 Test intermédiaire 2OS (45 ) 2BIos-1 B. Emery Génétique moléculaire COPAD Aucun document autorisé (ni personnel, ni fourni). En annexe détachable, se trouve le tableau

Plus en détail

Les Mécanismes de transcription dans E. coli par Stéphanie Monnet

Les Mécanismes de transcription dans E. coli par Stéphanie Monnet Les Mécanismes de transcription dans E. coli par Stéphanie Monnet Professeur accompagnant : M. Dominique Belin Problème posé : Le but du projet était de se pencher sur l analyse de l ADN plasmidique, ADN

Plus en détail

Bases moléculaires de l hérédité et du gène à la protéine Phage injecte matériel génétique (ADN ou protéines) dans E.coli. Protéines marquées

Bases moléculaires de l hérédité et du gène à la protéine Phage injecte matériel génétique (ADN ou protéines) dans E.coli. Protéines marquées Bases moléculaires de l hérédité et du gène à la protéine Phage injecte matériel génétique (ADN ou protéines) dans E.coli Phage injecte matériel génétique (ADN ou protéines) dans E.coli Phage injecte matériel

Plus en détail

Quiz 2. A. GAA GAA B. GT ATAC C. GGG CCC B and D D. CC ATGG E. TTAT AA

Quiz 2. A. GAA GAA B. GT ATAC C. GGG CCC B and D D. CC ATGG E. TTAT AA Quiz 1 1. What volume of a 50X TBE solution would you need to add to 79ml of water to obtain a 1X solution? Ans.: 79/49=1.61ml 2. If 50X TBE contains 125g of TRIS per liter, what is the final percent concentration

Plus en détail

Dans un milieu de culture dépourvu de tryptophane, on cultive des bactéries [Try -] en présence de la partie P1.

Dans un milieu de culture dépourvu de tryptophane, on cultive des bactéries [Try -] en présence de la partie P1. Série de génétique n 1 3 ème Sciences Expérimentales Exercice n 1 On considère deux souches de bactérie, le bacille subtil, (bactéries) de phénotype respectivement [Try +] et [Try -]. (Try est un acide

Plus en détail

TUTORAT UE spécifiques

TUTORAT UE spécifiques FACULTE de PHARMACIE TUTORAT UE spécifiques 2010-2011 Méthodes d étude et d analyse du génome Annales du concours PCEM1 (2005 à 2010) QCM n 1 : Concours 2010 Soient les sites de reconnaissance suivants

Plus en détail

Académie de Paris, Créteil, Versailles - Université de Cergy-Pontoise. Concours externe BAP A : Adjoint Technique préparateur en Biologie

Académie de Paris, Créteil, Versailles - Université de Cergy-Pontoise. Concours externe BAP A : Adjoint Technique préparateur en Biologie Académie de Paris, Créteil, Versailles - Université de Cergy-Pontoise Concours externe BAP A : Adjoint Technique préparateur en Biologie Epreuve écrite d admissibilité. Durée : 2h coefficient 3 Le sujet

Plus en détail

groupement carboxyle (-COOH) liés ensemble par un atome de carbone (C) auquel

groupement carboxyle (-COOH) liés ensemble par un atome de carbone (C) auquel UV. /. Les gènes et les protéines Manuel, p. 390 à 39. Dites à quoi correspondent les définitions suivantes. a) Les unités de base de l ADN. Les nucléotides. b) Les «barreaux» dans la structure en double

Plus en détail

Examen 4F : Les biotechnologies, partie I

Examen 4F : Les biotechnologies, partie I Nom, Prénom : Corrigé 23.03.2015 Examen 4F : Les biotechnologies, partie I Durée 45 minutes. Total 49 points. 1. QCM (= questionnaire à choix multiples). Vous avez, pour chaque question, une ou plusieurs

Plus en détail

L expression génétique REVUE

L expression génétique REVUE L expression génétique REVUE 1. Donne trois différences entre l ADN et l ARN. L Adn est le matériel génétique qui contrôle la synthèse des protéines, alors que l ARN aide l Adn et participe à la synthèse

Plus en détail

Cours 2. Fin de la microscopie + Manipulation des cellules et Analyse du contenu cellulaire.

Cours 2. Fin de la microscopie + Manipulation des cellules et Analyse du contenu cellulaire. Cours 2 Fin de la microscopie + Manipulation des cellules et Analyse du contenu cellulaire. By Alexis & Michaël Tutorat Niçois 2012-2013 1 Plan Partie 1 : Suite et Fin de la microscopie I. Microscopie

Plus en détail

Durée : 2 heures Coefficient : 2

Durée : 2 heures Coefficient : 2 CONCOURS EXTERNES IT 2013 EPREUVE TECHNIQUE D ADMISSION Durée : 2 heures Coefficient : 2 CONCOURS N 86 Corps : Assistants Ingénieurs BAP A : Sciences du vivant Emploi-type : Assistant en techniques d'élevage

Plus en détail

TD de Biochimie 4 : Coloration.

TD de Biochimie 4 : Coloration. TD de Biochimie 4 : Coloration. Synthèse de l expérience 2 Les questions posées durant l expérience 2 Exposé sur les méthodes de coloration des molécules : Générique Spécifique Autres Questions Pourquoi

Plus en détail

Génie génétique et biotechnologie

Génie génétique et biotechnologie Génie génétique et biotechnologie Acides nucléiques (rappel) Transcription ADN ARNm Traduction protéines Nucléotides Acides aminés Acides nucléiques Nucléotides : Gr. Phosphate Campbell 2 e edition, fig.

Plus en détail

Connaissance et Techniques du Gène

Connaissance et Techniques du Gène Bio57 2010 Connaissance et Techniques du Gène Application du clonage dans la génération d une souris transgénique Yannick Alexandre alexandre@ciml.univ-mrs.fr Rappel : promoteur d un gène - Les facteurs

Plus en détail

Séance 3. Les Acides Nucléiques. IV- Caractéristiques physicochimiques et fonctionnelles de l ADN

Séance 3. Les Acides Nucléiques. IV- Caractéristiques physicochimiques et fonctionnelles de l ADN UNIVERSITE MOHAMMED V-AGDAL FACULTE DES SCIENCES Les Acides Nucléiques DEPARTEMENT DE BIOLOGIE Filière Sciences de la Vie (SVI) Module de Biochimie (M 11) Elément : Biochimie structurale - Semestre 3-2005-2006

Plus en détail

LV312 Génétique et Biologie Moléculaire I 1 ère session-26 mai 2009 CORRIGE

LV312 Génétique et Biologie Moléculaire I 1 ère session-26 mai 2009 CORRIGE LV312 Génétique et Biologie Moléculaire I 1 ère session-26 mai 2009 CORRIGE Sujet de Génétique- Durée conseillée : 1h- Sans document ni calculatrice- Les téléphones portables doivent être éteints. Vos

Plus en détail

BACCALAURÉAT TECHNOLOGIQUE

BACCALAURÉAT TECHNOLOGIQUE BACCALAURÉAT TECHNOLOGIQUE Série : Sciences et Technologies de Laboratoire Spécialités : - Biotechnologies - Sciences physiques et chimiques en laboratoire SESSION 2015 Sous-épreuve écrite de Chimie biochimie

Plus en détail

BIO241 année

BIO241 année BIO241 année 2008-2009 Examen de contrôle continu (CC2) du 25 mars 2009 Etudiant Nom : Prénom : N d étudiant : salle d examen : Note / 20 : Groupe :... (6 pages) Documents et calculatrice non autorisés

Plus en détail

ORGANISATION DU GÉNOME 4ème séance 2016

ORGANISATION DU GÉNOME 4ème séance 2016 ORGANISATION DU GÉNOME 4ème séance 2016 Un Génome est l ensemble de l information héréditaire d un organisme, présente en totalité dans chaque cellule. Caractéristiques des génomes procaryotes: Chromosome

Plus en détail

Quiz 1. Quiz 1. partie = 2.2µL

Quiz 1. Quiz 1. partie = 2.2µL Quiz 1 1. What volume of a 10X DNA loading dye must you add to a 20 µl DNA sample to obtain a final concentration of 1X? Ans.: dilution =1/10. Therefore 9 parts=20µl. 1 part = 2.2µL 2. f 10X TBE contains

Plus en détail

Structure du gène Eucaryote, du gène Procaryote la Transcription, le Code génétique et la Traduction

Structure du gène Eucaryote, du gène Procaryote la Transcription, le Code génétique et la Traduction UNIVERSITE D ALGER Faculté de Médecine et de Médecine Dentaire ZIANIA (Château Neuf) Structure du gène Eucaryote, du gène Procaryote la Transcription, le Code génétique et la Traduction COURS DE GENETIQUE

Plus en détail

STRUCTURE ET FONCTION DES GÈNES ET DES CHROMOSOMES

STRUCTURE ET FONCTION DES GÈNES ET DES CHROMOSOMES Faculté de Médecine de Sousse Tunisie Année Universitaire 209-2010 Deuxième Année Médecine Support pédagogique illustré relatif au cours: STRUCTURE ET FONCTION DES GÈNES ET DES CHROMOSOMES Pr. Ag. ELGHEZAL

Plus en détail

Cours 1. Comment tout savoir sur la biologie moléculaire en moins de 90 minutes?... quitte à faire quelques simplifications

Cours 1. Comment tout savoir sur la biologie moléculaire en moins de 90 minutes?... quitte à faire quelques simplifications Cours 1 Comment tout savoir sur la biologie moléculaire en moins de 90 minutes?... quitte à faire quelques simplifications Hélène Touzet La cellule 2 Que trouve-t-on dans une cellule? 30% ions,... 4% phospolipides

Plus en détail

Correction Simulation d examen 30 novembre 2016

Correction Simulation d examen 30 novembre 2016 Correction Simulation d examen 30 novembre 2016 1. Donnez la formule (en projection de Haworth pour les sucres) des substances suivantes : a - D- glucopyranose Syllabus I, page 49 novembre 2016 1 Inuline

Plus en détail

Prépa scientifique Vivant, cellules, molécules organiques et génétique (E 01)

Prépa scientifique Vivant, cellules, molécules organiques et génétique (E 01) Maestris 2016-2017 Mardi 4 octobre 2016 Durée : 1 heure Prépa scientifique Vivant, cellules, molécules organiques et génétique (E 01) Question 1 : Brassage génétique et diversité (5 points) On s intéresse

Plus en détail

Méthodes d étude et d analyse du génome

Méthodes d étude et d analyse du génome TUT RENTREE 2012 / 2013 UE11 Méthodes d étude et d analyse du génome 1 OBJECTIFS : - Connaître les principales techniques de Biologie Moléculaire - Comprendre ses applications en génétique médicale 2 Les

Plus en détail

Thème 1 : La Terre dans l Univers, la Vie et l évolution du vivant. Partie 1 : Expression, stabilité et variation du patrimoine génétique

Thème 1 : La Terre dans l Univers, la Vie et l évolution du vivant. Partie 1 : Expression, stabilité et variation du patrimoine génétique TP 6 : Du gène à la protéine (2) Thème 1 : La Terre dans l Univers, la Vie et l évolution du vivant Partie 1 : Expression, stabilité et variation du patrimoine génétique Chapitre 3 : L expression du patrimoine

Plus en détail

Microbiologie BIOL La génétique microbienne: les mécanismes de la variation génétique

Microbiologie BIOL La génétique microbienne: les mécanismes de la variation génétique Microbiologie BIOL 3253 La génétique microbienne: les mécanismes de la variation génétique Reproduction sexuée et asexuée Contrairement aux organismes eucaryotes, les procaryotes n effectuent pas de reproduction

Plus en détail

La souris verte : transgenèse

La souris verte : transgenèse La souris verte : transgenèse méduse equorea victoria cellule de méduse prélèvement du gène FP equorea victoria (http://mabryonline.org) micro-injection du (transgène) dans la cellule-œuf de souris Lucie,

Plus en détail

La traduction. Synthèse des protéines: La machinerie. Composition des ribosomes procaryotes Protéines ribosomales ARNs ribosomiques.

La traduction. Synthèse des protéines: La machinerie. Composition des ribosomes procaryotes Protéines ribosomales ARNs ribosomiques. La traduction 1 triplet de nucléotide sur l ARN m (codon) 1 acide aminé Synthèse des protéines: La machinerie Le mécanisme et les éléments : polypeptide ribosome acide aminé Composition des ribosomes procaryotes

Plus en détail

EXPRESSION DU PATRIMOINE GENETIQUE : LA TRANSCRIPTION DE L ADN

EXPRESSION DU PATRIMOINE GENETIQUE : LA TRANSCRIPTION DE L ADN EXPRESSION DU PATRIMOINE GENETIQUE : LA TRANSCRIPTION DE L ADN INTRODUCTION - DÉFINITION Rappel : définition moléculaire du gène 5 A B C 3 ARNm ARNr ARNt Protéine fonctionnelle Flux de l information génétique

Plus en détail

Analyse génétique chez Caenorhabditis elegans

Analyse génétique chez Caenorhabditis elegans Analyse génétique chez Caenorhabditis elegans Qu est ce que le nématode C. elegans? Génétique de C. elegans Analyse génétique chez C. elegans Anatomie de C. elegans L hermaphrodite 1 mm http://www.wormatlas.org/

Plus en détail

Viande de cheval ou viande de bœuf?

Viande de cheval ou viande de bœuf? Fête de la science 2016 Viande de cheval ou viande de bœuf Viande de cheval ou viande de bœuf? Quand une entreprise qui fabrique des lasagnes affiche qu elles sont «pur bœuf», on ne doit pas trouver d

Plus en détail

Biologie Moléculaire et Organismes Modèles

Biologie Moléculaire et Organismes Modèles Biologie Moléculaire et Organismes Modèles Sami Khuri Department of Computer Science San José State University khuri@cs.sjsu.edu Plan du Cours Biologie Moléculaire et Organismes Modèles Qu est-ce que la

Plus en détail

Stage de Pré-Rentrée de Biochimie. Chapitre 3 : Biologie Moléculaire. Correction des exercices

Stage de Pré-Rentrée de Biochimie. Chapitre 3 : Biologie Moléculaire. Correction des exercices Stage de Pré-Rentrée de Biochimie Chapitre 3 : Biologie Moléculaire Correction des exercices 3 septembre 2013 1 Question 1 Parmi les séquences suivantes, laquelle s hybride parfaitement avec ce fragment?

Plus en détail

INRA-DRH Concours externes 2007

INRA-DRH Concours externes 2007 INRA-DRH Concours externes 2007 Page 1 of 1 AI Assistant en techniques biologiques profil n : AI07-BV-3 emploi-type n : A3B03 Versailles-Grignon concours : AIA02 Lieu du concours : Versailles-Grignon :::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::

Plus en détail

Nom : Groupe : Date : 1 LES RESPONSABLES DES CARACTÈRES CHEZ LES ÊTRES VIVANTS (p )

Nom : Groupe : Date : 1 LES RESPONSABLES DES CARACTÈRES CHEZ LES ÊTRES VIVANTS (p ) CHAPITRE 811 STE Questions 1 à 17, A, B. Verdict 1 LES RESPONSABLES DES CARACTÈRES CHEZ LES ÊTRES VIVANTS (p. 350-358) 1. Observez les deux cellules ci-contre. a) Sous quelle forme apparaît l ADN dans

Plus en détail

III/De la structure à la fonction.. Le B.A.-ba Principes généraux la réplication/la transcription/la traduction

III/De la structure à la fonction.. Le B.A.-ba Principes généraux la réplication/la transcription/la traduction III/De la structure à la fonction.. Le B.A.-ba Principes généraux la réplication/la transcription/la traduction Attention! Seuls les concepts généraux seront explicités en cours Mais vous pouvez approfondir

Plus en détail

BIO 57 - Année Connaissance et Technique du Gène ( Gene Science pour les anglophones) L1 SV, L1 BIM, L2 SME Semestre d Automne

BIO 57 - Année Connaissance et Technique du Gène ( Gene Science pour les anglophones) L1 SV, L1 BIM, L2 SME Semestre d Automne BIO 57 - Année 2007-08 Connaissance et Technique du Gène ( Gene Science pour les anglophones) L1 SV, L1 BIM, L2 SME Semestre d Automne Responsable : Professeur Keith DUDLEY - 2 - CONNAISSANCE ET TECHNIQUE

Plus en détail

BIOLOGIE BIOLOGIE SUJET. I. QUESTIONS À CHOIX MULTIPLE OU À COMPLÉTER (13 points sur 20)

BIOLOGIE BIOLOGIE SUJET. I. QUESTIONS À CHOIX MULTIPLE OU À COMPLÉTER (13 points sur 20) durée Durée : 2 heures. heures. SUJET I. QUESTIONS À CHOIX MULTIPLE OU À COMPLÉTER (13 points sur 20) Veuillez reporter sur votre copie d'examen le numéro de la question et répondez de façon précise en

Plus en détail

Les acides nucléiques

Les acides nucléiques Les acides nucléiques 1. Introduction 2. Structure de l'adn 3. Structure des ARN 4. Techniques d'études Introduction Reproduction = propriété essentielle des êtres vivants Chaque génération une copie du

Plus en détail

FEUILLE REPONSE A RENDRE AVEC LA COPIE : NOM : PARTIE 1 : MAITRISE DES CONNAISSANCES QCM : 8 points

FEUILLE REPONSE A RENDRE AVEC LA COPIE : NOM : PARTIE 1 : MAITRISE DES CONNAISSANCES QCM : 8 points FEUILLE REPONSE A RENDRE AVEC LA COPIE : NOM : PARTIE 1 : MAITRISE DES CONNAISSANCES QCM : 8 points 1. Une mutation décalante par délétion est une mutation qui : enlève un nucléotide de l ARN messager

Plus en détail

2b. La conjugaison est un phénomène très répandu chez les bactéries, mais pas chez les eucaryotes. Pourquoi? (1pt)

2b. La conjugaison est un phénomène très répandu chez les bactéries, mais pas chez les eucaryotes. Pourquoi? (1pt) Semestrielle Biologie 2OS (95 ) 2BIos-2 8 juin 2010 B. Emery Génétique moléculaire - Biotechnologie COPAD Aucun document autorisé (ni personnel, ni fourni). Calculatrice non programmable personnelle autorisée.

Plus en détail

Expression, stabilité et variation du patrimoine génétique Expression du patrimoine génétique

Expression, stabilité et variation du patrimoine génétique Expression du patrimoine génétique Thème I A Chapitre 3 Expression, stabilité et variation du patrimoine génétique Expression du patrimoine génétique Introduction : - gène = portion d ADN = information détermination des caractères [phénotype]

Plus en détail