Introduction à l annotation de séquences

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimension: px
Commencer à balayer dès la page:

Download "Introduction à l annotation de séquences"

Transcription

1 Introduction à l annotation de séquences - Université de Lille 1-2 eme Semestre

2 But de l annotation de séquences Les séquences nucléiques : Détecter la présence de gènes Trouver la structure des gènes (exons/introns) Détecter d autres objets biologiques (gènes ARN, signaux de régulation,...) Les séquences protéiques : Déterminer leur fonction Prédire la localisation cellulaire Étudier les structures 2D et 3D

3 Prédiction de gènes Localisation des gènes et de leurs exons

4 Trois types de méthodes Recherche des ORF (Open Reading Frame) localisation des régions de plus de 100 nucléotides entre un codon start (ATG) et un codon stop (TAA,TAG,TGA). Comparaison aux banques Recherche des séquences d ARNm et de protéines qui ressemblent à la séquence étudiée Etude statistique Localisation des séquences codantes et non codantes à partir d exemples

5 Recherche des ORF Traduction de la séquence nucléique dans les 6 phases de lecture Identification des codons Cinit et Cterm de la transcritption On se restreint aux régions d au moins 100 nucléotides Sélection du Cinit le plus éloigné du Cterm On obtient plusieurs possibilités...

6 Recherche des ORF N * F T S C N E A E R T P A I N L L H V T K P K E H R L K L I Y F M * R S R K N T G TTTAATTAAATGAAGTACATTGCTTCGGCTTTCTTTGTGGCCGAA

7 Recherche des ORF N * F T S C N E A E R T P A I N L L H V T K P K E H R L K L I Y F M * R S R K N T G TTTAATTAAATGAAGTACATTGCTTCGGCTTTCTTTGTGGCCGAA AAATTAATTTACTTCATGTAACGAAGCCGAAAGAAACACCGGCTT F * N V E H L S A S L V G A I L K S * T V F G F S C R S N I * K M Y R L R F F V P K

8 Recherche des ORF (ORF finder)

9 Les limites Toutes les ORF ne sont pas des gènes Elle contiennent peut-être un gène On utilise alors la comparaison de séquences avec des gènes connus On ne connaît pas la position du vrai Cinit Ce n est pas toujours le plus éloignée Existence de Cinit alternatifs Impossible de détecter les petits gènes Pas d information sur les exons

10 Comparaison aux banques Recherche de séquences similaires avec Blast ou Fasta Les banques utilisées EST CDS Vecteurs (éliminer les fragments parasites lors du séquençage d un gène) Sélection de séquences d intérêt Alignement des séquences d intérêt Alignement avec SIM4 : 1 adn génomique / 1 ARNm mature Alignement avec Wise2 : 1 adn génomique ou ARNm mature / 1 protéine

11 Les limites La séquence étudiée doit posséder des homologues dans les banques Les homologues distants sont mal identifiés

12 Prédiction statistique Principe : discriminer les séquences codantes des non codantes à l aide de critères statistiques. Mise en œuvre : apprentissage à partir d un jeu de données fiable (annoté expérimentalement) Recherche de biais Usage irrégulier des codons synonymes Asymétrie des trois positions dans les codons Enchaînement des mots de 6 nucléotides Utilisation de connaissances biologiques (promoteur, RBS, signal,...)

13 Principe Mise au point d un score (probabilité qu une fenêtre soit codante) Calcul du score pour une fenêtre glissante Extraction des fenêtres avec score significatif Reconstruction des gènes d après le score et l enchaînement des fenêtres et utilisation des signaux.

14 Les limites Apprentissage sur des données connues Limité aux séquences similaires au jeu d apprentissage GeneMark (procaryotes) : biais caractéristique pour des séquences dans un certain pourcentage de GC Apprentissage à partir de plusieurs génomes Pas de détection des petits gènes ou petits exons.

15 Prédiction chez les procaryotes Des génomes simples 80% du génome est codant séquences intergéniques courtes environ 1 gène tous les 1 kb région transcrite et pas traduite (3 et 5 UTR) courte pas d intron Détection simple test des 6 phases comparaison aux banques méthodes statistiques

16 Les limites Plusieurs codons Start Mais présence de RBS Comparaison aux banques proteiques. Prédiction statistique Gènes incomplets Gènes chevauchants

17 Prédiction chez les eucaryotes Environ 5% du génome humain est codant Longues régions 5 et 3 UTR (Untranslated) pour chaque cdna. Des introns (qui changent la phase) Epissage alternatif Variation de la densité des gènes et de leur structure (cf GC).

18 Cas particulier : les gènes ARN Signaux de régulation spécifiques Pas de contrainte de phase de lecture, d usage du code. Contrainte liée à la structure secondaire similarité faible (structure primaire/structure secondaire)

19 Partie II - comparaison aux banques (suite du cours sur la comparaison de séquences)

20 Comparaison aux banques on se donne : une séquence requête q une banque de séquences T = {t1,..., t n} on veut : trouver des alignements significatifs entre q et les t i les algorithmes classiques ne fonctionnent pas : prennent trop de temps, il faut trouver des parades

21 FASTA Pearson et Lipman, 1988 alignement global avec gaps traite les séquences de la banque les unes après les autres fonctionnement : 1. trouve tous les mots exacts de longueur > l communs à q et t i 2. sélectionne ceux de score suffisamment élevé (score PAM par exemple) 3. sélectionne une diagonale d (du dotplot) contenant le maximum de mots exacts de longueur > l 4. procède à un alignement global classique dans une bande de largeur 2k autour de la diagonale d deux paramètres : k et l, l généralement de longueur 6 pour l ADN et 2 pour les protéines

22 Schématiquement séquence q séquence t

23 Schématiquement séquence q séquence t

24 Schématiquement séquence q séquence t

25 Schématiquement séquence q séquence t

26 Schématiquement séquence q séquence t

27 Trouver les l mers chaque mot de longueur l est codé sur un entier code(u 1...u l ) = l c(u i )a l i avec c(u i ) la valeur associée à la lettre u i comprise entre 0 et a 1 et a la taille de l alphabet passage au codage du mot suivant (décalage de 1 dans la séquence) par opérations binaires : décalage binaire + masque binaire utilisation d une table de hachage pour par exemple avoir toutes les occurrences très efficace i=1

28 Blast Altschul, Gish, Miller, Myers, Lipman, 1990 naît en 1990 : trouve des matchs significatifs sans gaps évolution vers une version 2, avec gaps NCBI-Blast WU-Blast : très similaire à NCBI-Blast (mixe entre Blast1 et FASTA pour la dernière étape) évolution vers des versions avec raffinement des résultats

29 Blast 1 recherche de mots similaires de taille w (11 pour l ADN, 3 pour les protéines), de score supérieur à un seuil T pour chaque position de la requête q chaque couple de mots w entre q et un t i forme un hit chaque hit est étendu à gauche et à droite : l extension est stoppée lorsque le score du hit décroît de plus de X

30 Blast 1 - Schématiquement q étape 1 mots de taille w voisins

31 Blast 1 - Schématiquement q étape 1 mots de taille w voisins étape t1 t2 mots de taille w voisins 2 t4 t3

32 Blast 1 - Schématiquement q étape 1 mots de taille w voisins étape t1 t2 mots de taille w 2 voisins t4 q t3 étape 3 t3

33 Blast 1 chaque hit étendu forme un HSP : High scoring Segment Pair le HSP de meilleur score est le MSP : Maximal scoring Segment Pair

34 NCBI - Blast 2 idée : incorporer des gaps mise en oeuvre : se baser sur 2 hits distants au maximum de A q A étendre les hits comme dans Blast 1 (avec limitation de score) mais en autorisant les gaps t3

35 Exemple de résultats Query= Felis catus DRD4 gene fordopamine receptor D4 (276 letters) Database: All GenBank+EMBL+DDBJ+PDB sequences 1,174,453 sequences; 5,001,591,585 total letters Sequences producing significant alignments: Score E (bits) Value gi AB Felis catus DRD4 gene f e-52 gi AB Nyctereutes procyonoide e-36 gi AB Canis lupus DRD4 gene f e-36 gi AB Bos taurus DRD4 gene fo e-31 gi Homo sapiens Dopamine D4 recep e-29

36 Exemple de résultats >gi dbj AB AB Nyctereutes procyonoides DRD4 gene fordopamine receptor D4. Length = 393 Score = 157 bits (79), Expect = 7e-36 Identities = 94/99 (94%) Strand = Plus / Plus Query 1 ttcttcctaccctgcccgctcatgctgctgctctactgggccacgttcc 48 Sbjct 1 ttcttcctaccctgcccgctcatgctgctgctctactgggccacgttcc 48 Query 49 ggggcctgcggcgctgggaggcggctcgccaggccaagctgcactgccgg 99 Sbjct 49 ggggcctgcggcgctgggaggccgcgcgtcgggccaagctgcacggccgg 99 Score = 107 bits (54), Expect = 5e-21 Identities = 60/62 (96%) Strand = Plus / Plus Query 215 ggaggcgcgccaagatcaccggccgggagcgcaaggccatgagggtcct 252 Sbjct 332 ggagacgcgccaagatcacgggccgggagcgcaaggccatgagggtcct 379 Query 253 tgccggtggtggtc 276 Sbjct 380 tgccggtggtggtc 393

37 Les systèmes de score score HSP = Score de similarité utilise une matrice de substitution utilisé lors de l extension des hits bit score = score normalisé utilisé (en partie) pour analyser les résultats mesure statistique de l alignement dépendant de la banque interrogée (taille de la banque)

38 Significativité des MSPs deux séquences peuvent toujours être alignées il existe toujours un (au moins) alignement de meilleur score S entre deux séquences (un MSP) question : ce score est-il suffisamment élevé pour prouver une homologie? problème : peut-on trouver un MSP de meilleur score dans deux séquences aléatoires?

39 Mesures de significativité la p-valeur (p-value) mesure la probabilité que 2 séquences aléatoires de même longueur et de même composition possèdent un MSP de score supérieur ou égal S la e-valeur (e-value) mesure le nombre de MSPs de score supérieur ou égal S de 2 séquences aléatoires de même longueur et de même composition

40 Variation de la e-value si la taille de la séquence double : la e-value augmente si la taille de la banque est divisée par deux : la e-value diminue si le score augmente : la e-value diminue

41 Les différents programmes BLAST nucléique protéique nucléique traduit nucléique blastn blastp protéique blastp tblastn nucléique traduit blastx tblastx

Alignement de séquences (2/2)

Alignement de séquences (2/2) Alignement de séquences (2/2) Observation à l aide de l outil graphique : le dotplot. Simple, visuel, Très informatif : Permet de repérer une similarité globale Permet de repérer des similarités locales

Plus en détail

Initiation à la Bioinformatique

Initiation à la Bioinformatique Université d Alexandrie Initiation à la Bioinformatique Basic Local Alignment Search Tool BLAST Université d Alexandrie AUF Auteur(s): Mohamed GAD 2009/2010 Auteur(s) : Mohamed GAD Professeur à l institut

Plus en détail

Algorithmes pour la comparaison de séquences II

Algorithmes pour la comparaison de séquences II Algorithmes pour la comparaison de séquences II Hélène TOUZET touzet@lifl.fr Equipe Bioinfo Master recherche informatique www.lifl.fr/~touzet/masterrecherche.html Pourquoi comparer des séquences? Puisque

Plus en détail

A BIOINFORMATIQUE FONCTIONNELLE

A BIOINFORMATIQUE FONCTIONNELLE Biologie moléculaire-2017 1 A BIOINFORMATIQUE FONCTIONNELLE PRÉDIRE LA FONCTION D UNE PROTÉINE INCONNUE Supposons que vous avez trouvé la séquence d'acides aminés d'une protéine inconnue et que vous souhaitez

Plus en détail

Contenu du cours. Comparaisons locales et matrices de score. Matrice BLOSUM-62 pour les protéines. Exemples pour l ADN

Contenu du cours. Comparaisons locales et matrices de score. Matrice BLOSUM-62 pour les protéines. Exemples pour l ADN Contenu du cours Comparaisons locales et matrices de score Équipe Bonsai http://www.lifl.fr/bonsai Matrices de scores Recherches locales : BLAST et FastA année 2013 Équipe Bonsai Comparaisons locales et

Plus en détail

Prédiction de gènes. Cours de présentation des outils bio-informatiques pour la localisation puis l'étude des gènes. Equipe Bonsai (2014)

Prédiction de gènes. Cours de présentation des outils bio-informatiques pour la localisation puis l'étude des gènes. Equipe Bonsai (2014) Prédiction de gènes Cours de présentation des outils bio-informatiques pour la localisation puis l'étude des gènes Equipe Bonsai (2014) La localisation des gènes C'est la première étape pour interpréter

Plus en détail

Recherche par similarité dans les banques/bases de données La suite Blast (Basic Local Alignment Search Tool)

Recherche par similarité dans les banques/bases de données La suite Blast (Basic Local Alignment Search Tool) Recherche par similarité dans les banques/bases de données La suite Blast (Basic Local Alignment Search Tool) A A C T G G T A A C C G A G C T A C G G T C C G Algorithme de Blast (version 1) (Altschul et

Plus en détail

Prédiction des gènes chez les procaryotes.

Prédiction des gènes chez les procaryotes. Prédiction des gènes chez les procaryotes Hélène OUZE touzet@lifl.fr Deux approches 1. prédiction par similarité ES BLSN BLSX traduction suivant les 6 cadres de lecture 2. prédiction de novo, ou ab initio

Plus en détail

Plan. Comparaison de 2 séquences. Dotplot, alignement optimal Recherche de similarité. Alignement multiple. Phylogénie moléculaire

Plan. Comparaison de 2 séquences. Dotplot, alignement optimal Recherche de similarité. Alignement multiple. Phylogénie moléculaire Plan 1 Banques de données 2 Comparaison de 2 séquences Dotplot, alignement optimal Recherche de similarité 3 Alignement multiple l 4 Phylogénie moléculaire Recherche de similarité 1 séquence (Query) comparée

Plus en détail

Introduction à l Analyse des séquences biologiques.

Introduction à l Analyse des séquences biologiques. Introduction à l Analyse des séquences biologiques Christian.Fondrat@dsi.univ-paris5.fr Les outils d analyse de séquences C est QUOI? DES BASES DE DONNEES DES PROGRAMMES Utilitaires (consultation, acquisition

Plus en détail

AVL Liban La Bioinformatique. Bioinformatique

AVL Liban La Bioinformatique. Bioinformatique AVL Liban 2011 La Sami Khuri Department of Computer Science San José State University San José, California, USA sami.khuri@sjsu.edu www.cs.sjsu.edu/faculty/khuri Sami Khuri sami.khuri@sjsu.edu Qu est-ce

Plus en détail

Master 1 IUP Génomique et Protéomique Examen de GP4 - Bioinformatique

Master 1 IUP Génomique et Protéomique Examen de GP4 - Bioinformatique Master 1 IUP Génomique et Protéomique Examen de GP4 - Bioinformatique Exercice 1 : banques de données. Durée de l épreuve : 2h Documents autorisés Q1) Le schéma ci-dessous représente le nombre d articles

Plus en détail

Prédiction de gènes. La localisation des gènes. Quel est le point de départ? Une idée naïve : les phases ouvertes de lecture

Prédiction de gènes. La localisation des gènes. Quel est le point de départ? Une idée naïve : les phases ouvertes de lecture La localisation des gènes Prédiction de gènes Crs de présentation des tils bio-informatiques pr la localisation puis l'étude des gènes C'est la première étape pr interpréter un génome Distinction entre

Plus en détail

Introduction à la comparaison de séquences

Introduction à la comparaison de séquences Introduction à la comparaison de séquences - Université de Lille 1-2 eme Semestre Pourquoi comparer des séquences Recherche de similarités. Déterminer si des séquences sont homologues. Rechercher les exons/introns....

Plus en détail

BIOINFORMATIQUE APPLIQUÉE - CHMI 3206 F. Professeur : Eric R. Gauthier. Test de mi-session. 31 octobre Votre nom :

BIOINFORMATIQUE APPLIQUÉE - CHMI 3206 F. Professeur : Eric R. Gauthier. Test de mi-session. 31 octobre Votre nom : BIOINFORMATIQUE APPLIQUÉE - CHMI 3206 F Professeur : Eric R. Gauthier Test de mi-session 31 octobre 2006 Votre nom : Consignes : 1) Durée : 85 min 2) 5 questions sur 5 pages, pour 80 points. Compte pour

Plus en détail

Comparaison et alignement. de séquences 2 LV348 -BI. sophie.pasek@upmc.fr. Sophie Pasek

Comparaison et alignement. de séquences 2 LV348 -BI. sophie.pasek@upmc.fr. Sophie Pasek Comparaison et alignement de séquences 2 LV348 -BI Sophie Pasek sophie.pasek@upmc.fr Comment comparer une séquence contre une banque? Comparaison séquence/banque Pourquoi? : Réunir un échantillon taxonomique

Plus en détail

Biologie Moléculaire et Organismes Modèles

Biologie Moléculaire et Organismes Modèles Biologie Moléculaire et Organismes Modèles Sami Khuri Department of Computer Science San José State University khuri@cs.sjsu.edu Plan du Cours Biologie Moléculaire et Organismes Modèles Qu est-ce que la

Plus en détail

Banques de Données de séquences

Banques de Données de séquences Banques de Données de séquences D après cours de l équipe Bonsai, CRIStAL UMR 9189 Sylvain.legrand@univ-lille1.fr 7 et 8 Septembre 2016 Sylvain Legrand Introduction Définition bioinformatique Un domaine

Plus en détail

éléments répétés gènes des ARN stables (ARNr, ARNt) gènes protéiques Nb de gènes, taille du génome et complexité pseudogènes régions régulatrices

éléments répétés gènes des ARN stables (ARNr, ARNt) gènes protéiques Nb de gènes, taille du génome et complexité pseudogènes régions régulatrices Plan 3. Annotation des génomes a) Annotation structurale : localisation des éléments génétiques éléments répétés gènes des ARN stables (ARNr, ARNt) gènes protéiques Nb de gènes, taille du génome et complexité

Plus en détail

Bio-informatique et bio-analyse :

Bio-informatique et bio-analyse : Fiche 1 Bio-informatique et bio-analyse : Jean-Loup Risler La «bio-informatique». J entends ce mot depuis bien longtemps, mais je ne sais toujours pas ce qu il veut dire Je me souviens d une rencontre

Plus en détail

HMSN206 - Partie Alignement

HMSN206 - Partie Alignement M1 Bioinformatique, Connaissances et Données Master Sciences et Numérique pour la Santé Année 2016-2017 HMSN206 - Partie Alignement Partie I-2 : Matrices de scores, BLAST, FASTA Anne-Muriel Arigon Chifolleau

Plus en détail

Comparaison et alignement de séquences 2

Comparaison et alignement de séquences 2 Comparaison et alignement de séquences 2 LV348 -BI Sophie Pasek sophie.pasek@upmc.fr Comment comparer une séquence contre une banque? Comparaison séquence/banque Pourquoi? : Réunir un échantillon taxonomique

Plus en détail

Stage de Pré-Rentrée de Biochimie. Chapitre 3 : Biologie Moléculaire. Correction des exercices

Stage de Pré-Rentrée de Biochimie. Chapitre 3 : Biologie Moléculaire. Correction des exercices Stage de Pré-Rentrée de Biochimie Chapitre 3 : Biologie Moléculaire Correction des exercices 3 septembre 2013 1 Question 1 Parmi les séquences suivantes, laquelle s hybride parfaitement avec ce fragment?

Plus en détail

Chapitre 3 : L expression de l information génétique. Activité 1 : Les deux étapes de l expression de l information génétique

Chapitre 3 : L expression de l information génétique. Activité 1 : Les deux étapes de l expression de l information génétique Connaissances L'ADN contient des unités d'information appelées gènes. Le génome est l ensemble du matériel génétique d un organisme. Chez les eucaryotes, la transcription a lieu dans le noyau, la traduction

Plus en détail

Introduction à la Bio-Informatique IFT3295- Aut Nadia El-Mabrouk DIRO, Université de Montréal

Introduction à la Bio-Informatique IFT3295- Aut Nadia El-Mabrouk DIRO, Université de Montréal Introduction à la Bio-Informatique IFT3295- Aut 2011 Nadia El-Mabrouk DIRO, Université de Montréal Plan Qu est-ce que la Bio-Informatique? Probématiques liées aux trois macro-molécules ADN Séquençage Annotation

Plus en détail

Cours de Biologie moléculaire de Licence professionnelle 2011

Cours de Biologie moléculaire de Licence professionnelle 2011 Cours de Biologie moléculaire de Licence professionnelle 2011 Sommaire 1. Introduction 2.1. La structure de l ADN 2.2. La structure de l ARN 2.3. Du gène à la protéine 2.3.1. La réplication 2.3.2. La transcription

Plus en détail

Chapitre 3 : La cellule bactérienne, génétique et synthèse protéique

Chapitre 3 : La cellule bactérienne, génétique et synthèse protéique Chapitre 3 : La cellule bactérienne, génétique et synthèse protéique Attention, ce cours suppose la connaissance de notions de base en génétique, notamment les notions de transcription, traduction ainsi

Plus en détail

Comparaison de séquences

Comparaison de séquences Comparaison de séquences Qu est-ce que comparer des séquences? Identifier les points communs ou les différences entre deux séquences ou plus Retracer l histoire évolutive des séquences en simulant les

Plus en détail

FONCTIONS DES GENES, TRANSCRIPTION ET TRADUCTION

FONCTIONS DES GENES, TRANSCRIPTION ET TRADUCTION FONCTIONS DES GENES, TRANSCRIPTION ET TRADUCTION I. Transcription et propriétés de l ARN La transcription est la synthèse d un ARN à partir d un ADN double brin. La transcription est catalysée par une

Plus en détail

Bioinformatique Appliquée Recherche de similitudes

Bioinformatique Appliquée Recherche de similitudes Besoin d'accélérer la recherche de similitude dans une banque Bioinformatique Appliquée Recherche de similitudes La recherche de similitude permet de comparer une séquence appelée requête (query) à une

Plus en détail

Organisation physique et génétique des génomes

Organisation physique et génétique des génomes Organisation physique et génétique des génomes Table des matières Organisation physique de l ADN Nucléosomes Chromatine Principes d organisation des génomes Exemple d un génome bactérien Exemple du génome

Plus en détail

Alignements de deux séquences

Alignements de deux séquences Alignements de deux séquences Informatique Génomique - Master 1 Guillaume Blin IGM-LabInfo UMR 8049, Bureau 4B066 Université de Marne La Vallée gblin@univ-mlv.fr http://igm.univ-mlv.fr/ gblin 2007-08 Plan

Plus en détail

AVL Liban 2011 Biologie Moléculaire et Organismes Modèles

AVL Liban 2011 Biologie Moléculaire et Organismes Modèles AVL Liban 2011 Biologie Moléculaire et Organismes Modèles Sami Khuri Department of omputer Science San José State University San José, alifornia, USA sami.khuri@sjsu.edu www.cs.sjsu.edu/faculty/khuri Plan

Plus en détail

Séance 5. Les Acides Nucléiques. 3. Conservation de l information génétique: Réplication semi-conservative de l ADN

Séance 5. Les Acides Nucléiques. 3. Conservation de l information génétique: Réplication semi-conservative de l ADN UNIVERSITE MOHAMMED V-AGDAL FACULTE DES SCIENCES Les Acides Nucléiques DEPARTEMENT DE BIOLOGIE Filière Sciences de la Vie (SVI) Module de Biochimie (M 11) Élément : Biochimie structurale - Semestre 3-2005-2006

Plus en détail

Lancer FASTA et BLAST en ligne de commande

Lancer FASTA et BLAST en ligne de commande Lancer FASTA et BLAST en ligne de commande V.2006.1 http://www.esil.univ-mrs.fr/~dgaut/cours Daniel Gautheret ESIL, Université de la Méditerranée Fasta Article original: Lipman and Pearson (1985) Science

Plus en détail

BIOINFORMATIQUE APPLIQUEE (BI4U2) EXAMEN DE SECONDE SESSION JUIN 2013

BIOINFORMATIQUE APPLIQUEE (BI4U2) EXAMEN DE SECONDE SESSION JUIN 2013 Année universitaire 2012/2013 Site : X Luminy X St-Charles o St-Jérôme o Cht-Gombert o Aix-Montperrin o Aubagne-SATIS Sujet session de : o 1 er semestre - o 2 ème semestre - X Session 2 Examen de : X L1/L2/oL3

Plus en détail

Introduction. La bioinformatique : Traitement des informations biologiques par des méthodes informatiques et/ou mathématiques.

Introduction. La bioinformatique : Traitement des informations biologiques par des méthodes informatiques et/ou mathématiques. Introduction La bioinformatique : Traitement des informations biologiques par des méthodes informatiques et/ou mathématiques. Interdisciplinaire par nature, la bioinformatique est fondée sur les acquis

Plus en détail

La traduction. Synthèse des protéines: La machinerie. Composition des ribosomes procaryotes Protéines ribosomales ARNs ribosomiques.

La traduction. Synthèse des protéines: La machinerie. Composition des ribosomes procaryotes Protéines ribosomales ARNs ribosomiques. La traduction 1 triplet de nucléotide sur l ARN m (codon) 1 acide aminé Synthèse des protéines: La machinerie Le mécanisme et les éléments : polypeptide ribosome acide aminé Composition des ribosomes procaryotes

Plus en détail

Bioinformatique appliquée. Cours 4 BLAST. idée. lire un résultat de Blast. la famille Blast

Bioinformatique appliquée. Cours 4 BLAST. idée. lire un résultat de Blast. la famille Blast Bioinformatique appliquée Cours 4 BLAST idée lire un résultat de Blast la famille Blast -1- "quelle est la similarité entre ces 2 séquences? et donc: est-ce que ces deux séquences sont homologues?" "existe-t-il

Plus en détail

MÉCANISMES MOLÉCULAIRES DE L EXPRESSION DES GÉNES : LA TRADUCTION OU BIOSYNTHÈSE DES PROTÉINES

MÉCANISMES MOLÉCULAIRES DE L EXPRESSION DES GÉNES : LA TRADUCTION OU BIOSYNTHÈSE DES PROTÉINES MÉCANISMES MOLÉCULAIRES DE L EXPRESSION DES GÉNES : LA TRADUCTION OU BIOSYNTHÈSE DES PROTÉINES Le sens de lecture L ARN polymérase lit le brin matrice dans la direction 3 vers 5 de façon à synthétiser

Plus en détail

Alignement Multiple de séquences

Alignement Multiple de séquences Alignement Multiple de séquences Introduction Alignement multiple = Alignement simultané de plusieurs séquences (Nt ou Prot) Outil essentiel pour : Signatures protéiques Homologie avec une famille de protéines

Plus en détail

STRUCTURE ET FONCTION DES GÈNES ET DES CHROMOSOMES

STRUCTURE ET FONCTION DES GÈNES ET DES CHROMOSOMES Faculté de Médecine de Sousse Tunisie Année Universitaire 209-2010 Deuxième Année Médecine Support pédagogique illustré relatif au cours: STRUCTURE ET FONCTION DES GÈNES ET DES CHROMOSOMES Pr. Ag. ELGHEZAL

Plus en détail

Examen de bioinformatique Février 2009

Examen de bioinformatique Février 2009 Examen de bioinformatique Février 2009 Durée : 2h (ou 2h30) - Documents interdits Première partie (4 points) 1) La séquence ci-dessous est-elle au format fasta (justifiez votre réponse)? 1 pt Is the sequence

Plus en détail

Recherche de régions génomiques conservées

Recherche de régions génomiques conservées Recherche de régions génomiques conservées Modèle mathématique et test statistique S. Grusea, E. Pardoux 1 V. Lopez Rascol, P. Pontarotti 2 1 L.A.T.P., Centre de Mathématique et d Informatique Université

Plus en détail

Cette séance traite de la prise en main de l outil de calcul Galaxy, et de son utilisation pour différentes analyses de phylogénie.

Cette séance traite de la prise en main de l outil de calcul Galaxy, et de son utilisation pour différentes analyses de phylogénie. Analyse phylogénétique Cette séance traite de la prise en main de l outil de calcul Galaxy, et de son utilisation pour différentes analyses de phylogénie. Au préalable Connectez vous sur: http://gohelle.cirad.fr/galaxy/root/

Plus en détail

Bioinformatique: alignement de séquences

Bioinformatique: alignement de séquences Bioinformatique: alignement de séquences Céline Brochier-Armanet Université Claude Bernard, Lyon 1 Laboratoire de Biométrie et Biologie évolutive (UMR 5558) Celine.brochier-armanet@univ-lyon1.fr Problème

Plus en détail

Introduction à la bioinformatique

Introduction à la bioinformatique Introduction à la bioinformatique Céline Brochier-Armanet Université Claude Bernard, Lyon 1 Laboratoire de Biométrie et Biologie Evolutive (UMR 5558) celine.brochier-armanet@univ-lyon1.fr Lectures recommandées

Plus en détail

Structure du gène Eucaryote, du gène Procaryote la Transcription, le Code génétique et la Traduction

Structure du gène Eucaryote, du gène Procaryote la Transcription, le Code génétique et la Traduction UNIVERSITE D ALGER Faculté de Médecine et de Médecine Dentaire ZIANIA (Château Neuf) Structure du gène Eucaryote, du gène Procaryote la Transcription, le Code génétique et la Traduction COURS DE GENETIQUE

Plus en détail

MÉCANISMES MOLÉCULAIRES DE L EXPRESSION DES GÉNES : LA TRANSCRIPTION DU DNA

MÉCANISMES MOLÉCULAIRES DE L EXPRESSION DES GÉNES : LA TRANSCRIPTION DU DNA MÉCANISMES MOLÉCULAIRES DE L EXPRESSION DES GÉNES : LA TRANSCRIPTION DU DNA I- INTRODUCTION - DÉFINITION Rappel : définition moléculaire du gène Expression moléculaire du gène Clase II A B C Transcription

Plus en détail

Programmes de comparaison de banques de données

Programmes de comparaison de banques de données Programmes decomparaison debanquesdedonnées FASTA introduction Programmesdecomparaisonde2séquencestroplongs Méthodesheuristiques But:filtrerparétapessuccessiveslesséquences «intéressantes» Etablissementd'unscorepourclasserlesmeilleuressimilitudes

Plus en détail

Traduction des ARNm : synthèse protéique

Traduction des ARNm : synthèse protéique Traduction des ARNm : synthèse protéique Traduction Notions générales. Traduction : synthèse d une protéine donnée à partir d un ARNm spécifique. Synthèse protéique localisée dans le cytoplasme (et la

Plus en détail

Prédiction de gènes. Présentation du problème. Open Reading Frame. HMM (Modèles de Markov cachés) Fonctionnement Exemples Limites

Prédiction de gènes. Présentation du problème. Open Reading Frame. HMM (Modèles de Markov cachés) Fonctionnement Exemples Limites Présentation du problème Open Reading Frame Fonctionnement Exemples Limites Procaryotes versus eucaryotes Validation des résultats: 1) comparaison de séquences 2) utilisation de données statistiques HMM

Plus en détail

Informatique et biologie moléculaire

Informatique et biologie moléculaire UE09s Méthodes d étude et analyse du génome Techniques d analyse des gènes à grande échelle Bio-informatique PACES 2013-2014 Dr Nicolas SEVENET Informatique et biologie moléculaire Avertissement Utilisation

Plus en détail

Consultations Martinique / Guyane. Activité LABORATOIRE. Dr Odile Béra, CHU de Fort-de-France. Unité Oncogénétique

Consultations Martinique / Guyane. Activité LABORATOIRE. Dr Odile Béra, CHU de Fort-de-France. Unité Oncogénétique Dr Odile Béra, CHU de Fort-de-France Unité Oncogénétique Unité Génétique moléculaire des cancers Consultations Martinique / Guyane Prédisposition génétique cancers SEIN/OVAIRES COLON (Sd de Lynch & PAF)

Plus en détail

Introduction à la bioinformatique

Introduction à la bioinformatique Faculté des Sciences - Rabat Laboratoire de Microbiologie et Biologie Moléculaire -------------------------------------- Université Mohamed V - Agdal Faculté des Sciences B.P. 1014 - Rabat - MAROC TD Biologie

Plus en détail

L EPISSAGE. I- Introduction

L EPISSAGE. I- Introduction L EPISSAGE I- Introduction Lors de la transcription des gènes codant les protéines par l ARN polymérase II, il y a synthèse d un ARN prémessager qui contient l ensemble nucléotidique du gène comprise entre

Plus en détail

Alignements de séquences

Alignements de séquences de séquences Problématique Matrices de points Distance d édition + calcul d un alignement optimal Qu est-ce qu une distance Méthode naïve: énumération de tous les alignements possibles Programmation dynamique

Plus en détail

Informatique et biologie moléculaire

Informatique et biologie moléculaire UE 1B-biomolécules, génome, bioénergétique, métabolisme, méthodes d étude et analyse du génome II-le génome : sa structure, son expression Organisation, évolution et fonction du génome humain Approches

Plus en détail

Cours Biologie cellulaire ULBI 101 _ L1-S1

Cours Biologie cellulaire ULBI 101 _ L1-S1 Cours Biologie cellulaire ULBI 101 _ L1-S1 RMI_Partie 2-2 Le Noyau et la Transcription 5- Définition des organites et des fonctions associées 5.1 Noyau : ADN et information génétique - Généralités - Structure

Plus en détail

TRANSPORT ET STABILITE DES ARNs

TRANSPORT ET STABILITE DES ARNs TRANSPORT ET STABILITE DES ARNs I- Transport des ARNm Après sa maturation dans le noyau, l ARNm reste associé avec des protéines spécifiques pour former des complexes ribonucléoprotéiques (mrnp). L assemblage

Plus en détail

Les principales bases de données en bioinformatique

Les principales bases de données en bioinformatique Les principales bases de données en bioinformatique 156 Bases de données en bioinformatique Nombreuses bases de données en bioinformatique Données issues d'expériences, de publications, d'analyses faites

Plus en détail

Les principales bases de données en bioinformatique

Les principales bases de données en bioinformatique Bases de données en bioinformatique Les principales bases de données en bioinformatique Nombreuses bases de données en bioinformatique Données issues d'expériences, de publications, d'analyses faites à

Plus en détail

Dans chaque cellule: -génome nucléaire -génome mitochondrial (-génome chloroplastique)

Dans chaque cellule: -génome nucléaire -génome mitochondrial (-génome chloroplastique) 6- Structure et organisation des génomes 6-1 Génomes eucaryotes Dans chaque cellule: -génome nucléaire -génome mitochondrial (-génome chloroplastique) 6-1-1 Génomes nucléaires 6-1-1-1 Nombre d exemplaires

Plus en détail

Biologie Moléculaire et Organismes Modèles

Biologie Moléculaire et Organismes Modèles Biologie Moléculaire et Organismes Modèles Sami Khuri Department of Computer Science San José State University khuri@cs.sjsu.edu Usine de Protéines Les protéines sont responsables de la plupart des fonctions

Plus en détail

Analyse in-silico de séquences biologiques

Analyse in-silico de séquences biologiques Analyse in-silico de séquences biologiques Carl Herrmann IBDML Université de la Méditerranée herrmann@ibdm.univ-mrs.fr année 2006-2007 1 Génomique "traditionnelle" organisme à séquencer séquençage "contigs"

Plus en détail

Bioinformatique dans l IUP

Bioinformatique dans l IUP Bioinformatique dans l IUP Intervenants Equipe Bioinfo (Laboratoire d Informatique Fondamentale de Lille) Cours : Jean-Stéphane Varré (jean-stephane.varre@lifl.fr) TD sur machine : Jean-Stéphane Varré,

Plus en détail

Cours Biologie cellulaire

Cours Biologie cellulaire Cours Biologie cellulaire GLBE102_ L1-S1 Le Noyau et la Transcription Généralités Un organite interphasique (disparaît en fin de prophase) Contient l ADN de la cellule = génome (sauf ADN mito. et chloroplastique)

Plus en détail

La galaxie BLAST 20 ans d'utilisation de la méthode BLAST

La galaxie BLAST 20 ans d'utilisation de la méthode BLAST megablast rpstblastn LEGACY BLAST blastp tblastn BLAST+ BLAST2 PHI BLAST bl2seq tblastx GAPPED BLAST formatdb blastall GAPPED BLAST PSI BLAST PHI PSI BLAST BLAST+ blastdbcmd PSI BLAST blastn GAPPED BLAST

Plus en détail

Biologie cellulaire. Cours 8 : Synthèse des protéines

Biologie cellulaire. Cours 8 : Synthèse des protéines Département des Troncs Communs Sciences de la Nature Faculté des Sciences de la Nature et de la Vie Université Abderrahmane Mira de Bejaia Biologie cellulaire Cours 8 : Synthèse des protéines Année universitaire

Plus en détail

Exemple 1 - heat shock protein beta 9. Comparaison de séquences deux à deux. Exemple 3 : domaine conservé. Exemple 2 - E.coli peptidyl trna hydrolase

Exemple 1 - heat shock protein beta 9. Comparaison de séquences deux à deux. Exemple 3 : domaine conservé. Exemple 2 - E.coli peptidyl trna hydrolase Exemple 1 - heat shock protein beta 9 Comparaison de séquences deux à deux >human MQRVGNTFSN ESRVSRCPS VGLERNRV TMPVRLLRDS PQEDNDH RDGFQMKLD HGFPEELVV QVDGQWLMVT GQQQLDVRDP ERVSYRMSQK VHRKMLPSNL SPTMTCCLT

Plus en détail

Recherche et caractérisation de nouveaux ARN non codant (ARNnc) chez Pyrococcus abyssi

Recherche et caractérisation de nouveaux ARN non codant (ARNnc) chez Pyrococcus abyssi Recherche et caractérisation de nouveaux ARN non codant (ARNnc) chez Pyrococcus abyssi Kounthéa Phok Béatrice Clouet d Orval Equipe AJ Carpousis LMGM UMR5100 UPS-CNRS Christine Gaspin et Annick Moisan

Plus en détail

Annotation in silico de séquences biologiques

Annotation in silico de séquences biologiques Annotation in silico de séquences biologiques Carl Herrmann TAGC Inserm U928 Université de la Méditerranée carl.herrmann@univmed.fr Pourquoi Diana est-elle ce qu'elle est...? génotype = l'information génétique

Plus en détail

Tp6 Du gène à la protéine (partie 2) 1 TP 6 Du gène à la protéine (partie 2). I - Niveau : première S La synthèse des protéines

Tp6 Du gène à la protéine (partie 2) 1 TP 6 Du gène à la protéine (partie 2). I - Niveau : première S La synthèse des protéines Tp6 Du gène à la protéine (partie 2) I - Niveau : première S La synthèse des protéines II- Extrait de programme : La traduction permet la synthèse cytoplasmique de chaînes polypeptidiques. La séquence

Plus en détail

De la biologie molécualire à la génomique

De la biologie molécualire à la génomique De la biologie molécualire à la génomique Pierre Neuvial École Nationale de la Statistique et de l Administration Économique Méthodes statistiques pour la biologie Plan du cours 1 Introduction à la biologie

Plus en détail

Chapitre 1 Les mutations de l ADN et les duplications de gènes : les moteurs des innovations génétiques

Chapitre 1 Les mutations de l ADN et les duplications de gènes : les moteurs des innovations génétiques 1 La molécule d ADN est apparemment stable mais elle présente une certaine variabilité. Des modifications d ADN créent : - de nouveaux allèles à l origine du polymorphisme génétique et phénotypique des

Plus en détail

Connaissance et Techniques du Gène

Connaissance et Techniques du Gène Bio57 2010 Connaissance et Techniques du Gène Application du clonage dans la génération d une souris transgénique Yannick Alexandre alexandre@ciml.univ-mrs.fr Rappel : promoteur d un gène - Les facteurs

Plus en détail

Brin transcrit : chaine de l ADN qui, par complémentarité des nucléotides, sert de modèle pour la synthèse de l ARN messager

Brin transcrit : chaine de l ADN qui, par complémentarité des nucléotides, sert de modèle pour la synthèse de l ARN messager Fin du cours chap 5 La transcription : de l ADN à l ARN : Par définition, le brin transcrit est le brin d ADN complémentaire de l ARN : c est le brin qui sert à la synthèse de l ARN, donc ici le brin2.

Plus en détail

VECTEURS ET BANQUES VECTEURS ET BANQUES. Définitions. DEFINITIONS VECTEURS et CLONAGE BANQUES. Utilité Principe Différents vecteurs / différents usage

VECTEURS ET BANQUES VECTEURS ET BANQUES. Définitions. DEFINITIONS VECTEURS et CLONAGE BANQUES. Utilité Principe Différents vecteurs / différents usage VECTEURS ET BANQUES VECTEURS ET BANQUES Yann audic _2006 1 DEFINITIONS VECTEURS et CLONAGE Utilité Principe Différents vecteurs / différents usage BANQUES Principe Banques génomiques Banques d'adnc Normalisation

Plus en détail

Module de Bioinformatique appliquée. GB Karine Robbe-Sermesant Romain Gautier

Module de Bioinformatique appliquée. GB Karine Robbe-Sermesant Romain Gautier Module de Bioinformatique appliquée à l analyse des séquences GB3 2012-2013 Karine Robbe-Sermesant Romain Gautier Objectifs du module Bioinformatique appliquée à l analyse des séquences Comprendre et apprendre

Plus en détail

Microbiologie BIOL La génétique microbienne: les mécanismes de la variation génétique

Microbiologie BIOL La génétique microbienne: les mécanismes de la variation génétique Microbiologie BIOL 3253 La génétique microbienne: les mécanismes de la variation génétique Reproduction sexuée et asexuée Contrairement aux organismes eucaryotes, les procaryotes n effectuent pas de reproduction

Plus en détail

Corrigé série N 2. Exercice 1 QCS (V/F)

Corrigé série N 2. Exercice 1 QCS (V/F) Exercice 1 Corrigé série N 2 QCS (V/F) V1-Les acides nucléiques sont des polymères de nucléotides F2-Un nucléotide est un enchaînement base glucide F3-Les bases azotées sont toutes complémentaires F4-Les

Plus en détail

Notions de bioinformatique

Notions de bioinformatique Notions de bioinformatique Souvent les avancées des biotechnologies ont été possibles du fait d avancées technologiques relevant d autres domaines que la biologie. - En juillet 1995 le séquençage d Haemophilus

Plus en détail

CHAPITRE 3 : L'EXPRESSION DU PATRIMOINE GÉNÉTIQUE

CHAPITRE 3 : L'EXPRESSION DU PATRIMOINE GÉNÉTIQUE CHAPITRE 3 : L'EXPRESSION DU PATRIMOINE GÉNÉTIQUE LES PROTÉINES SONT LE RÉSULTAT DE L'EXPRESSION DES GÈNES On observe de nombreuses différences entre ces deux gènes; 1061 nucléotides pour l'allèle du groupe

Plus en détail

Alignements multiples

Alignements multiples Alignements multiples Celine Brochier celine.brochier@up.univ-mrs.fr http://194.57.197.233:800/ 04.91.10.64.75 Intérêt des alignements multiples Caractérisation des familles multigéniques Démontrer l homologie

Plus en détail

FLUX D INFORMATION GÉNÉTIQUE

FLUX D INFORMATION GÉNÉTIQUE FLUX D INFORMATION GÉNÉTIQUE 3 TRADUCTION C est le mécanisme par lequel le flux d information va passer de la forme acide nucléique (alphabet à 4 lettres) à la forme protéine (alphabet à 20 lettres) selon

Plus en détail

IV Expression des gènes : transcription et traduction

IV Expression des gènes : transcription et traduction IV Expression des gènes : transcription et traduction La transcription et la traduction ont lieu dans des compartiments séparés chez les eucaryotes Procaryote 1/ Définition d un gène Gène : segment d ADN

Plus en détail

08/05/2016. La TRANSCRIPTION. Eucaryotes. La synthèse des protéines. Procaryotes. La TRANSCRIPTION. cours_bm_2015_transcription_pr_makrelouf 1

08/05/2016. La TRANSCRIPTION. Eucaryotes. La synthèse des protéines. Procaryotes. La TRANSCRIPTION. cours_bm_2015_transcription_pr_makrelouf 1 La TRANSCRIPTION La synthèse des protéines Eucaryotes Procaryotes La TRANSCRIPTION cours_bm_2015_transcription_pr_makrelouf 1 MÉCANISME GÉNÉRAL DE LA TRANSCRIPTION La transcription est une biosynthèse

Plus en détail

Du gène à la protéine Campbell, 4 ème édition, chapitre 17. Automne 2013, 101-NYA-05

Du gène à la protéine Campbell, 4 ème édition, chapitre 17. Automne 2013, 101-NYA-05 Du gène à la protéine Campbell, 4 ème édition, chapitre 17 Automne 2013, 101-NYA-05 1 Objectif général à l issue de ce cours Schématiser les principales étapes de la synthèse des protéines en identifiant

Plus en détail

LA TERRE DANS L UNIVERS, la vie et l évolution du vivant

LA TERRE DANS L UNIVERS, la vie et l évolution du vivant Thème 1 A Chapitre LA TERRE DANS L UNIVERS, la vie et l évolution du vivant (5 semaines) EXPRESSION, STABILITE ET VARIATION DU PATRIMOINE GENETIQUE Introduction : Les cellules de l'organisme, à l'exception

Plus en détail

Alignement de séquences

Alignement de séquences Bioinformatique appliquée ours lignement de séquences principes un algorithme d'alignement: programmation dynamique alignement global, alignement local -- Les comparaisons de séquences DOPLO j'ai séquences,

Plus en détail

ORGANISATION DU GÉNOME 4ème séance 2016

ORGANISATION DU GÉNOME 4ème séance 2016 ORGANISATION DU GÉNOME 4ème séance 2016 Un Génome est l ensemble de l information héréditaire d un organisme, présente en totalité dans chaque cellule. Caractéristiques des génomes procaryotes: Chromosome

Plus en détail

Espaces vectoriels et recherche d information

Espaces vectoriels et recherche d information Espaces vectoriels et recherche d information Matthieu Constant Université Paris-Est Marne-la-Vallée, LIGM Plan Introduction Géométrie vectorielle Rappels sur les vecteurs en géométrie 2D Généralisation

Plus en détail

Algorithmes sur les séquences en bioinformatique

Algorithmes sur les séquences en bioinformatique M2 - STL Prédiction de gènes: défi algorithmique Algorithmes sur les séquences en bioinformatique Cours 7 : Algorithmes de recherche des gènes chez les procaryotes et les eucaryotes Gène: une séquence

Plus en détail

Cours n 2. Les 3 domaines du vivant. Marc Prudhomme. Ce travail est largement facilité par l analyse génétique dans le royaume des procaryotes car

Cours n 2. Les 3 domaines du vivant. Marc Prudhomme. Ce travail est largement facilité par l analyse génétique dans le royaume des procaryotes car Cours n 2 Marc Prudhomme Les 3 domaines du vivant Comment observer l apparition l de mutations? Ce travail est largement facilité par l analyse génétique dans le royaume des procaryotes car Gram positif

Plus en détail

Thème 1 : La Terre dans l Univers, la Vie et l évolution du vivant. Partie 1 : Expression, stabilité et variation du patrimoine génétique

Thème 1 : La Terre dans l Univers, la Vie et l évolution du vivant. Partie 1 : Expression, stabilité et variation du patrimoine génétique TP 6 : Du gène à la protéine (2) Thème 1 : La Terre dans l Univers, la Vie et l évolution du vivant Partie 1 : Expression, stabilité et variation du patrimoine génétique Chapitre 3 : L expression du patrimoine

Plus en détail

Notions de biologie. Les molécules biologiques. L UE Algorithmes pour la bioinformatique. Qu est-ce que la bioinformatique?

Notions de biologie. Les molécules biologiques. L UE Algorithmes pour la bioinformatique. Qu est-ce que la bioinformatique? L UE Algorithmes pour la bioinformatique UE Algorithmes pour la bioinformatique, Master recherche Informatique Maude Pupin URL : http://www2.lifl.fr/sequoia/mri.php Animée par l équipe Sequoia (LIFL, INRIA)

Plus en détail

Cycle «Analyse de données de séquençage à hautdébit», Module 2/5 : Analyses RNA-seq Avril 2017

Cycle «Analyse de données de séquençage à hautdébit», Module 2/5 : Analyses RNA-seq Avril 2017 Cycle «Analyse de données de séquençage à hautdébit», Module 2/5 : Analyses RNA-seq 05-07 Avril 2017 Cycle «Analyse de données de séquençage à hautdébit», Module 2/5 : Analyses RNA-seq 05-07 Avril 2017

Plus en détail

ORGANISATION MOLÉCULAIRE DES GÈNES ET RÉPLICATION DE L ADN

ORGANISATION MOLÉCULAIRE DES GÈNES ET RÉPLICATION DE L ADN ORGANISATION MOLÉCULAIRE DES GÈNES ET RÉPLICATION DE L ADN I- Définition moléculaire du gène Génos qui donne naissance Classe II (structure) Classe III Classe I Gène A Gène B Gène C mrna trna rrna Protéines

Plus en détail

Chapitre 1 La recherche de parentés chez les Vertébrés. L établissement de phylogénies. I Critères de comparaison. A Données embryologiques

Chapitre 1 La recherche de parentés chez les Vertébrés. L établissement de phylogénies. I Critères de comparaison. A Données embryologiques Chapitre 1 La recherche de parentés chez les Vertébrés. L établissement de phylogénies. Les êtres vivants, très diversifiés, partagent pourtant des propriétés communes : - une structure cellulaire - un

Plus en détail

Formation "Initiation à la bioinformatique": Module 2 Alignement de séquences

Formation Initiation à la bioinformatique: Module 2 Alignement de séquences Formation "Initiation à la bioinformatique": Module 2 Alignement de séquences Listes des exercices Dotplots Exercice 1 Exercice 2 Alignement deux à deux Exercice 3 Exercice 4 Exercice 5 Exercice 6 Exercice

Plus en détail