Comment la Souris fait de la souris avec des graines?

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimension: px
Commencer à balayer dès la page:

Download "Comment la Souris fait de la souris avec des graines?"

Transcription

1 Comment la Souris fait de la souris avec des graines? d après «10 clés pour la Biologie» de J. Tavlitzki «[ ] La Souris, l Ecureuil, le Lapin mangent des graines. La Souris fait de la souris, l Ecureuil fait de l écureuil, et le Lapin fait du lapin, tous avec les mêmes graines Autrement dit, le principe général est que les êtres vivants sont dotés de la capacité extraordinaire de transformer les éléments qui leur sont étrangers en leurs propres constituants. Comment peuvent-ils le faire? Comment la Souris fait de la souris avec des graines?. La Souris mange des graines, elle les ronge, les réduit en fines particules. Au cours de la digestion, les grosses molécules organiques sont simplifiées. Chaque cellule va en assimiler des nutriments, notamment des acides aminés. Ceux ci seront à la base de la constitution de protéines, mais pas n importe lesquelles. Chaque cellule refait les protéines qui lui sont spécifiques. Cela veut dire que chaque cellule dispose du plan de construction, d un programme souris qui lui a été transmis et à partir duquel les acides aminés pourront être agencés en protéines spécifiques.» Quand la Souris fait de l humain! Expérience de transgénèse : La transgénèse est une technique permettant de transférer un gène d une espèce donneuse à une espèce receveuse.

2 Laboratoire de Sciences de la Vie et de la Terre Un gène, une protéine Première S Durant les phases G1 et G2 de l interphase, la cellule est en phase de croissance. Les cellules, sous le contrôle de leur patrimoine génétique, produisent une multitude de protéines, véritables acteurs du métabolisme. Ce laboratoire vise à mettre en évidence les relations entre protéines et ADN. Il devient alors possible de comprendre comment la production des protéines spécifiques de l individu est dirigée par l ADN. Votre mission : Comprendre l hypothèse, devenue célèbre, exposée dès 1940 par Beadle et Tatum : Un gène, une protéine. Partie 1 : Analyse de la structure d une protéine enzymatique simple Chez les vertébrés, par exemple, les globules rouges possèdent dans leur cytoplasme de l hémoglobine, une protéine complexe qui permet de fixer et de transporter le dioxygène dans l organisme (Visionner le film sur clé USB : datas/genetique/ hemoglobine). Ouvrir le logiciel MolUSc (qui permet de visualiser et traiter des données moléculaires) et sélectionner dans le dossier app/molecules le fichier relatif à l hémoglobine : 1GZX_hemoglobine.pdb. Appelez le professeur.. En vous aidant de la fiche technique de MollUSc, sélectionner une des chaines de l hémoglobine (chaîne B ou D), afficher cette chaine, identifier le dernier acide aminé et en déduire le nombre d acides aminés de cette chaine et la séquence de la chaine pour les 10 premiers acides aminés (la succession des acides aminés d une chaine constitue sa séquence). Appelez le professeur. Imprimer la chaine étudiée (édition > exporter > images). Légendez l image de la molécule traitée en mettant en évidence les premiers et dernier acides aminés. Partie 2 : La relation entre séquence des acides aminés et séquence de nucléotides La synthèse de l hémoglobine, comme pour toutes les protéines, est sous le contrôle du programme génétique de la cellule. Une portion d ADN (séquence de nucléotides) appelée gène dirige la synthèse de chaque chaine de l hémoglobine (séquence d acides aminés). Ouvrir le logiciel Anagène (qui permet d afficher et de traiter les séquences) et sélectionner dans la banque de séquences (chaîne de l hémoglobine) les molécules qui nous intéressent : beta.pro (acides aminés de la chaine globine) et betacod.adn (nucléotides de la chaine globine). Le logiciel superpose les séquences des deux molécules (nucléotides d un brin d ADN identifiés par une lettre, et acides aminés de la protéine identifiés par un nom en trois lettres). Appeler le professeur. Retrouver sur le logiciel la longueur des deux molécules (nombre de nucléotides et nombre d acides aminés).. Retranscrire la séquence des onze premiers acides aminés et la séquence correspondante de l ADN (attention retouver les deux brins constitutifs de l ADN). Quelle relation pouvez-vous établir entre gène et protéine à ce stade de l étude? Quelle peut être la fonction du dernier triplet de nucléotides? Partie 3 : Les molécules mises sous surveillance radioactive L information nécessaire à l assemblage des acides aminés d une protéine est donc portée par l ADN, localisé dans le noyau des cellules. On s interroge sur les lieux où vont se dérouler l assemblage des acides aminés dans la cellule. Prendre connaissance des résultats de biologie moléculaire en annexe. Revenir sur Anagene et sur MolUSc pour comparer les molécules d ADN et d ARN (betacod.adn, betacod.arn pour Anagene adn_c.pdb et arn.pdb pour molusc). Analyser les documents et montrer en quoi les études sur l ARN, un acide nucléique proche de l ADN, permet d imaginer un transfert de l information génétique du noyau vers le cytoplasme. Aidez vous du film sur la clé USB : datas/genetique/synthese_proteique Comparer un fragment d ADN et d ARN (composition, structure, séquence) avec les logiciels disponibles Réaliser des schémas pour rendre compte des points communs et des différences entre les deux molécules Employer des techniques d observation Utiliser des techniques bio ou géologiques Utiliser des modes de représentation Adopter une démarche explicative Compétences personnelles

3 Documentation : Les molécules mises sous surveillance radioactive L information nécessaire à l assemblage des acides aminés d une protéine est portée par l ADN, localisé dans le noyau des cellules. On s interroge sur les lieux où se déroulent l assemblage des acides aminés dans la cellule. Les documents ci-dessous (s intéressent à la localisation de l ADN dans la cellule. Document 1 : Coloration d une cellule au vert de méthyle-pyronine Les cellules contiennent des molécules chimiquement très proches de l ADN, appelées ARN (acide ribonucléique). Le vert de méthyle-pyronine, mélange de deux colorants, permet de mettre en évidence d une part l ADN, d autre part l ARN ; le vert de méthyle colore l ADN en bleu-vert et la pyronine colore l ARN en rose. La photographie ci contre présente des cellules du pancréas. Ce sont des cellules qui produisent des protéines en grande quantité. Seuls les noyaux présentent une coloration bleu-vert. La coloration rose se constate par contre dans toute la cellule (cytoplasme + noyau). Document 2 : L ARN, un acide nucléique proche de l ADN Les molécules ARN sont chimiquement proches de l ADN. Comme ce dernier, ils résultent de l assemblage de nucléotides. Leur structure diffère sur plusieurs points : - le sucre n est pas du désoxyribose mais du ribose. - la thymine (T) de l ADN est remplacée par l uracile (U). - la molécule n est formée que d une chaine de nucléotides (molécule monobrin) - les molécules d ARN sont de longueur nettement inférieure à celle de l ADN. Document 3 : Traçage radioactif de l ARN dans la cellule Les deux radiographies ci contre présentent des autoradiographies de cellules qui sont cultivée en présence d un précurseur radioactif spécifique de l ARN. Chaque tache noire repère un endroit où se trouve de l ARN ayant incorporé le présurseur radioactif. Le cliché a présente l autoradiographie d une cellule après 15 minutes de culture sur un milieu contenant le précurseur radioactif de l ARN. Le cliché b correspond à l autoraradiographie d une cellule qui a été d abord cultivée pendant 15 minutes sur un milieu contenant un précurseur radioactif de l ARN puis pendant une heure et demie sur un milieu contenant des précurseurs non radioactifs de l ARN. d après travaux de Brachet Document 4 : Localisation du lieu d assemblage des acides aminés Pour déterminer le lieu où s effectue la synthèse protéique, on utilise des Acétabulaires, algues unicellulaires de très grande taille (5 à 10 cm de haut à l âge adulte). Ces algues sont mises en présence d un acide aminé radioactif : la méthionine (MET). Après 30 mn, l autoradiographie montre le résultat schématisé ci dessous. Le résultat serait identique si les algues étaient ensuite replacées pendant 3 h dans un milieu «froid» (càd non radioactif)

4 Laboratoire de Sciences de la Vie et de la Terre Un gène, une protéine Première S Votre mission : Comprendre l hypothèse, devenue célèbre, exposée dès 1940 par Beadle et Tatum : Un gène, une protéine. Partie 1 : Analyse de la structure d une protéine enzymatique simple Ouvrir le logiciel MolUSc La molécule choisie (l hémoglobine humaine apparait en représentation : boules et bâtons Cette protéine est faite de quatre chaines d acides aminés distinctes. Le logiciel permet de les visualiser, de changer leur représentation, leur couleur Plusieurs options du logiciel permettent d arriver au résultat suivant : Les quatre chaines de l hémoglobine identifiées par une couleur La chaine D de la béta globine isolée (par effacement progressif des trois autres chaines) On demande de travailler sur une des chaines (béta globine soit chaine B ou D). Le logiciel permet de n afficher qu une des chaines. Voir ci-dessus. On traite alors la séquence des acides aminés qui la composent (par le mode séquence) et/ou l affichage des acides aminés. (soit HIS : histidine)

5 Un travail similaire peut être fait pour identifier les dix premiers acides aminés de la chaine On en déduit la séquence des dix premiers acides aminés : VAL-HIS-LEU-THR-PRO-GLU-GLU-LYS-SER-ALA Le dernier acide amine de la chaine est : HIS La longueur de la chaine est de 146 a.aminés. fin de la chaine : dernier acide aminé Début de la chaine : 10 premiers acides aminés Chaine béta de l hémoglobine (146 a.a) Partie 2 : La relation entre séquence des acides aminés et séquence de nucléotides Ouvrir le logiciel Anagène et les séquences demandées On retrouve pour le brin d ADN : 444 nucléotides, et pour la chaine d acides aminés : 147 acides aminés. On constate que la chaine peptidique finit bien par l histidine : HIS mais commence différemment (méthionine MET). On constate enfin que chaque triplet de nucléotide correspond à un acide aminé sauf le dernier triplet de nucléotide.

6 On en déduit l existence d un code entre l ADN et la protéine correspondante. Ce code serait que chaque acide aminé est déterminé par un triplet de nucléotides. Le dernier nucléotide marquant la fin de la protéine. Partie 3 : Les molécules mises sous surveillance radioactive A partir de l étude des documents, on constate que l ADN est localisé dans le noyau de la cellule alors que l assemblage des protéines se déroule dans le cytoplasme. On met aussi en évidence l existence d un acide nucléique proche de l ADN présent aussi bien dans le noyau que dans le cytoplasme. Cet acide nucléique (ARN) semble jouer un rôle dans le transfert de l information génétique entre le noyau et le cytoplasme. Comparaison avec MolUSc

7 Comparaison ADN, ARN et protéine avec Anagène On constate que le monobrin d ARNm est similaire (U remplaçant T) à un des deux brins de l ADN. On confirme qu il y a bien une correspondance des acides aminés avec des triplets de nucléotides aussi bien de l ADN que de l ARNm. On en déduit que l assemblage des protéines doit se dérouler en deux étapes : Une synthèse d ARN dans le noyau au contact d un des deux brins de l ADN, puis à partir de cet ARNm et après migration de celui-ci dans le cytoplasme, s opère l assemblage des acides aminés selon une séquence précise dictée par l information génétique de l ADN donc portée par l ARNm. A partir de ces observations et du film sur la synthèse des protéines on peut réaliser et compéter le schéma suivant.

8 Laboratoire de Sciences de la Vie et de la Terre Le code génétique Première S Nous avons déjà vu qu il existe une relation entre un triplet de nucléotides de l ADN et un acide aminé. On retrouve cette correspondance entre un triplet de nucléotides de l ARNm (que l on nomme : un codon) et un acide aminé. Un tableau de correspondance ou code génétique, permet de décoder l ARNm. Votre mission : Comprendre comment on a pu découvrir pas à pas le code génétique et quelles sont ses particularités. Partie 1 : Décoder le message : expérience de Niremberg et Khorana Ces deux chercheurs ont réalisé un système acellulaire privé d ADN et contenant les 20 types d acides aminés. A ce système ils ont ajouté des ARNm répétitifs comme par exemple GUGUGUGUGUGU. Ils obtiennent une protéine composée de la séquence suivante : valine cystéine -valine cystéine On a renouvelé cette expérience avec d autres séquences répétitives, on obtient les résultats ci contre : Séquences d ARNm CCCCCCCCCCCC CGAAGGAGACGU CAUAUCCAUAUC UUUUUUUUUUUU Protéines obtenues pro-pro-pro-pro arg-arg-arg-arg his-ile-his-ile phe-phe-phe-phe A l aide des résultats de cette expérience, compléter le code génétique en annexe. Partie 2 : Modéliser une traduction d un gène en protéine Vous disposez d une boite contenant des «acides aminés», des nucléotides et des «liaisons». Construire une molécule d ADN dont la séquence de nucléotides du brin transcrit est : TACAAACGCTTCGGAAGCATCCAC Puis construire la molécule d ARNm qui lui correspond (attention au sens de lecture). Et en déduire la protéine correspondante. Appelez le professeur Recopiez vos résultats dans le tableau en annexe : Partie 3 : Quand l expression du gène est plus complexe Jusque ici on a assimilé l ARM messager à sa région strictement codante. En réalité, on constate que l ARN élaboré dans le noyau au contact de l ADN est plus long, plus lourd. Il est appelé ARN pré-messager. Comparer à l aide d Anagène la séquence de l ADN complet, de l ARN pré-messager résultant de la transcription du gène et de l ARN messager (fichier HB-Beta.edi). Montrer que l ARNm est un assemblage de morceaux non contigus de l ARN prémessager. Il faudra, pour cela utiliser la fonction dotplot du logiciel qui permet de comparer l identité de deux molécules. Appeler le professeur Analyser le résultat d une comparaison ARN pré-messager et ARN messager. Montrer que l ARN messager résulte d une maturation de l ARN pré-messager avec une élimination de certains fragments (introns) et soudure d autres fragments (exons). Ce phénomène est appelé l épissage. Légender pour cela le document en annexe Expliquer alors l expression gène morcelé. Employer des techniques d observation Utiliser des techniques bio ou géologiques Utiliser des modes de représentation Adopter une démarche explicative Compétences personnelles

9 Le code génétique : correspondance entre les codons de l ARNm et les acides aminés. Vous complèterez le tableau à partir des données issues des travaux de Niremberg et Khorana Modélisation d une traduction d un gène Triplets de l ADN brin non transcrit Triplets de l ADN brin transcrit Codon de l ARN messager Protéine... La maturation de l ARN pré-messager avant la production d une protéine Comparaison ARN pré-messager (beta globine) avec ARN m (beta-globine) : mise en évidence de trois exons et deux introns. Un gène est transcrit sous forme d un ARN pré-messager qui subira une maturation pour donner l ARN messager. C est cet ARN messager qui sera traduit en une protéine.

10 Laboratoire de Sciences de la Vie et de la Terre Le code génétique Première S Partie 1 : Décoder le message : expérience de Niremberg et Khorana Partie 2 : Modéliser une traduction d un gène en protéine Triplets de l ADN brin non transcrit ATG TTT GCG AAG CCT TCG TAG GTG Triplets de l ADN brin transcrit TAC AAA CGC TTC GGA AGC ATC CAC Codon de l ARN messager AUG UUU GCG AAG CCU UCG UAG GUG Protéine MET PHE ALA LYS PRO SER stop Partie 3 : Quand l expression du gène est plus complexe La maturation de l ARN pré-messager avant la production d une protéine Comparaison ARN pré-messager (beta globine) avec ARN m (beta-globine) : mise en évidence de trois exons et deux introns. Un gène est transcrit sous forme d un ARN pré-messager qui subira une maturation pour donner l ARN messager. C est cet ARN messager qui sera traduit en une protéine.

11

THEME 1 A EXPRESSION, STABILITE ET VARIATION DU PATRIMOINE GENETIQUE

THEME 1 A EXPRESSION, STABILITE ET VARIATION DU PATRIMOINE GENETIQUE THEME 1 A EXPRESSION, STABILITE ET VARIATION DU PATRIMOINE GENETIQUE CHAPITRE 3 L EXPRESSION DU PATRIMOINE GENETIQUE I. LA RELATION GENES-PROTEINES Les protéines interviennent dans le fonctionnement d

Plus en détail

! recenser, extraire, saisir l informa3on u3le d un document !!! Que code un gène? Comment? Activité 1 :

! recenser, extraire, saisir l informa3on u3le d un document !!! Que code un gène? Comment? Activité 1 : Que code un gène? Comment? C2 recenser, extraire, saisir l informa3on u3le d un document C12 C26 C27 savoir exploiter un logiciel déduire interpréter Activité 1 : Le phénotype de la maladie héréditaire

Plus en détail

CHAPITRE 3 LA SYNTHESE DES PROTEINES

CHAPITRE 3 LA SYNTHESE DES PROTEINES CHAITRE 3 LA SYNTHESE DES ROTEINES On sait qu un gène détient dans sa séquence nucléotidique, l information permettant la synthèse d un polypeptide. Ce dernier caractérisé par sa séquence d acides aminés

Plus en détail

Cahier de texte de la classe 1 ère 4 - SVT

Cahier de texte de la classe 1 ère 4 - SVT Cahier de texte de la classe 1 ère 4 - SVT DATE SEQUENCE lundi 12 : revoir la fiche méthodologique «utiliser le microscope optique» (disponible sur le site du lycée) Lundi 12 1 er contact avec les élèves.

Plus en détail

L'ordre et la nature des acides aminés (ou séquence) d un polypeptide dépend de la séquence des nucléotides de l ADN du gène qui le code.

L'ordre et la nature des acides aminés (ou séquence) d un polypeptide dépend de la séquence des nucléotides de l ADN du gène qui le code. L'ordre et la nature des acides aminés (ou séquence) d un polypeptide dépend de la séquence des nucléotides de l ADN du gène qui le code. Une mutation, peut entraîner une modification de la séquence des

Plus en détail

Collège Notre Dame de Jamhour. THEME 1A : Expression, stabilité et variation du patrimoine génétique

Collège Notre Dame de Jamhour. THEME 1A : Expression, stabilité et variation du patrimoine génétique Collège Notre Dame de Jamhour Classe : 1 ère S THEME 1A : Expression, stabilité et variation du patrimoine génétique Chapitre 3 : L expression du patrimoine génétique TD- 5 : La protéosynthèse, un processus

Plus en détail

Chapitre 2. La synthèse protéique : la relation entre le génotype et le phénotype.

Chapitre 2. La synthèse protéique : la relation entre le génotype et le phénotype. Chapitre 2. La synthèse protéique : la relation entre le génotype et le phénotype. Les maladies génétiques comme la drépanocytose ou l'albinisme sont liées à des modifications du génotype des individus

Plus en détail

Cahier de texte de la classe 1 ère 3 - SVT

Cahier de texte de la classe 1 ère 3 - SVT Cahier de texte de la classe 1 ère 3 - SVT DATE SEQUENCE jeudi 8 : revoir la fiche méthodologique «utiliser le microscope optique» (disponible sur le site du lycée) Jeudi 8 1 er contact avec les élèves.

Plus en détail

Acides Nucléiques. ADN et ARN Unités de base : les nucléotides donc les nucléotides = monomères ADN et ARN = polynucléotides = polymères

Acides Nucléiques. ADN et ARN Unités de base : les nucléotides donc les nucléotides = monomères ADN et ARN = polynucléotides = polymères Acides Nucléiques ADN et ARN Unités de base : les nucléotides donc les nucléotides = monomères ADN et ARN = polynucléotides = polymères Structure d un nucléotide Tous composés d une base azotée, d un sucre

Plus en détail

Baccalauréat général Sciences de la vie et de la Terre

Baccalauréat général Sciences de la vie et de la Terre Baccalauréat général Sciences de la vie et de la Terre Épreuve obligatoire série S Partie 1 (5 points) Thème 1-: Expression, stabilité, variation du patrimoine génétique. Sujet : On cherche à montrer,

Plus en détail

La synthèse des protéines transcription code génétique traduction

La synthèse des protéines transcription code génétique traduction CEC André-Chavanne BIO 3 OS La synthèse des protéines transcription code génétique traduction I. La «Transcription» : de l ADN à l ARNm. L'adresse suivante permet d accéder à une ANIMATION sur la TRANSCRIPTION.

Plus en détail

Quelques termes-clef de biologie moléculaire et leur définition

Quelques termes-clef de biologie moléculaire et leur définition Acide aminé (AA) Quelques termes-clef de biologie moléculaire et leur définition Isabelle Quinkal INRIA Rhône-Alpes Septembre 2003 Petite molécule dont l enchaînement compose les protéines - on dit qu

Plus en détail

Fiche technique : utilisation d Anagène (logiciel d étude des données moléculaires).

Fiche technique : utilisation d Anagène (logiciel d étude des données moléculaires). Fiche technique : utilisation d Anagène (logiciel d étude des données moléculaires). Objectifs de la fiche : 1. Ouvrir des séquences (ADN ou protéine). 2. Changer de règle de numérotation & faire apparaître

Plus en détail

TRANSCRIPTION TRADUCTION

TRANSCRIPTION TRADUCTION 4 TRANSCRIPTION TRADUCTION Objectifs : définir transcription et traduction et donner leur localisation cellulaire sur un schéma, identifier les acteurs de la transcription (ARNpol, brin transcrit, ARNm)

Plus en détail

Série : STL Spécialité biotechnologies SESSION 2014 BACCALAURÉAT TECHNOLOGIQUE

Série : STL Spécialité biotechnologies SESSION 2014 BACCALAURÉAT TECHNOLOGIQUE BACCALAURÉAT TECHNLGIQUE Série : STL Spécialité biotechnologies SESSIN 2014 CBSV : sous épreuve coefficient 4 Biotechnologies : sous épreuve coefficient 4 Durée totale de l épreuve: 4 heures Les sujets

Plus en détail

CORRECTION DES EXERCICES DE GENETIQUE SYNTHESE PROTEIQUE : P 136-137

CORRECTION DES EXERCICES DE GENETIQUE SYNTHESE PROTEIQUE : P 136-137 CORRECTION DES EXERCICES DE GENETIQUE SYNTHESE PROTEIQUE : P 136-137 Exercice 1 p 171 : définir en une phrase les mots suivants Polypeptide : chaine de plusieurs acides aminés. Séquence protéinique : séquence

Plus en détail

Cours IFSI Rockefeller 2013 Dr Julie Marzais

Cours IFSI Rockefeller 2013 Dr Julie Marzais Cours IFSI Rockefeller 2013 Dr Julie Marzais Synthèse s Protéines Du co génétique g aux molécules du Vivant Fonction principale l information l génétique g L information est codée e dans l ADN l succession

Plus en détail

Eléments primordiaux de biologie moléculaire

Eléments primordiaux de biologie moléculaire Eléments primordiaux de biologie moléculaire Pourquoi s intéresser au matériel génétique? Base de l information génétique Tissu Cellule Noyau Organisme entier Lieu où est localisé l ADN Mol d ADN qui est

Plus en détail

Thème 1 : La Terre dans l Univers, la Vie et l évolution du vivant. Partie 1 : Expression, stabilité et variation du patrimoine génétique

Thème 1 : La Terre dans l Univers, la Vie et l évolution du vivant. Partie 1 : Expression, stabilité et variation du patrimoine génétique TP 6 : Du gène à la protéine (2) Thème 1 : La Terre dans l Univers, la Vie et l évolution du vivant Partie 1 : Expression, stabilité et variation du patrimoine génétique Chapitre 3 : L expression du patrimoine

Plus en détail

Thème 1A-Expression, stabilité et variation du programme génétique

Thème 1A-Expression, stabilité et variation du programme génétique Extrait du bulletin officiel : Thème 1. La Terre dans l Univers, la vie et l évolution du vivant Thème 1 - A Expression, stabilité et variation du patrimoine génétique Ce thème s appuie sur les connaissances

Plus en détail

LA SYNTHÈSE DES PROTÉINES

LA SYNTHÈSE DES PROTÉINES LA SYNTHÈSE DES PROTÉINES La transcription Information : dans le noyau (sous forme d'adn) Synthèse des protéines : dans le cytoplasme (au niveau des ribosomes du reticulum endoplasmique) L'ADN ne sort

Plus en détail

TP 1.2 : SYNTHESE DE LA PROTEINE HEMOGLOBINE

TP 1.2 : SYNTHESE DE LA PROTEINE HEMOGLOBINE Le cytoplasme des hématies contient de l hémoglobine, protéine constituée d une chaîne de 144 acides aminés. Le gène de l hémoglobine β se localise dans le noyau, au niveau du chromosome 11 (HB α sur le

Plus en détail

IMMUNOLOGIE. La spécificité des immunoglobulines et des récepteurs T. Informations scientifiques

IMMUNOLOGIE. La spécificité des immunoglobulines et des récepteurs T. Informations scientifiques IMMUNOLOGIE La spécificité des immunoglobulines et des récepteurs T Informations scientifiques L infection par le VIH entraîne des réactions immunitaires de l organisme qui se traduisent par la production

Plus en détail

A- Exploiter des animations pour repérer une mutation et étudier son mécanisme de réparation.

A- Exploiter des animations pour repérer une mutation et étudier son mécanisme de réparation. THEME 1A : Expression, stabilité et variation du patrimoine génétique Chapitre 2 : Variabilité Génétique et Mutation de l ADN TP-3-: Réparation de l ADN, mutations et polyallélisme Les mutations de l ADN

Plus en détail

THÈME 3 : DU GÉNOTYPE AU PHÉNOTYPE. CHAPITRE 1 : la relation entre ADN et protéines

THÈME 3 : DU GÉNOTYPE AU PHÉNOTYPE. CHAPITRE 1 : la relation entre ADN et protéines THÈME 3 : DU GÉNOTYPE AU PHÉNOTYPE CHAPITRE 1 : la relation entre ADN et protéines Les caractères d un individu dépendent de plusieurs facteurs : certains dépendent des caractères présents dans la famille

Plus en détail

Biologie Moléculaire et Organismes Modèles

Biologie Moléculaire et Organismes Modèles Biologie Moléculaire et Organismes Modèles Sami Khuri Department of Computer Science San José State University khuri@cs.sjsu.edu Usine de Protéines Les protéines sont responsables de la plupart des fonctions

Plus en détail

Chapitre 5: Evolution de la biodiversité

Chapitre 5: Evolution de la biodiversité Chapitre 5: Evolution de la biodiversité Constat: Tous les êtres vivants ont la même structure (cellules, MO) et pourtant ils ont beaucoup évolué au cours des temps géologiques. Problème: Par quels mécanismes

Plus en détail

Principales techniques utilisées en génie génétique Ces différentes techniques peuvent également se combiner entre elles. Séquençage de l ADN

Principales techniques utilisées en génie génétique Ces différentes techniques peuvent également se combiner entre elles. Séquençage de l ADN Principales techniques utilisées en génie génétique Ces différentes techniques peuvent également se combiner entre elles Séquençage de l ADN 1- Un brin complémentaire de l ADN à séquencer est fabriqué

Plus en détail

DU GÈNE À LA PROTÉINE

DU GÈNE À LA PROTÉINE 1 DU GÈNE À LA PROTÉINE 1. Le génome et la notion de gène: Génome: ensemble du matériel génétique d'un individu. = patrimoine héréditaire Gène: région d'un brin d'adn dont la séquence code l'information

Plus en détail

Chapitre 3 : L expression du patrimoine génétique

Chapitre 3 : L expression du patrimoine génétique Chapitre 3 : L expression du patrimoine génétique L ADN est une molécule informative, elle détient l ensemble des informations nécessaires au fonctionnement cellulaire. Chez les organismes eucaryotes l

Plus en détail

DST DE SCIENCES DE LA VIE ET DE LA TERRE 1) RESTITUTION ORGANISÉE DES CONNAISSANCES (8 PTS)

DST DE SCIENCES DE LA VIE ET DE LA TERRE 1) RESTITUTION ORGANISÉE DES CONNAISSANCES (8 PTS) 1s_cntsvt_2011_11_16_corrigé.doc 1/6 CLASSE DE 1ère S - DURÉE 3H00 DST DE SCIENCES DE LA VIE ET DE LA TERRE CALCULATRICES INTERDITES 1) RESTITUTION ORGANISÉE DES CONNAISSANCES (8 PTS) Le cycle cellulaire

Plus en détail

LES FAMILLES MULTIGÉNIQUES : L'EXEMPLE DES CHAÎNES DE L'HÉMOGLOBINE

LES FAMILLES MULTIGÉNIQUES : L'EXEMPLE DES CHAÎNES DE L'HÉMOGLOBINE Fiche sujet-élève Les similitudes entre gènes sont interprétées comme le résultat d une ou plusieurs duplications d un gène ancestral. Des molécules homologues appartiennent à la même famille multigénique

Plus en détail

Capacités Connaissances Attitudes Recenser, extraire et organiser des informations

Capacités Connaissances Attitudes Recenser, extraire et organiser des informations Préparer une «Situation complexe disciplinaire», situation d apprentissage et/ou d évaluation TITRE : L ADN, molécule support de l information génétique classe : 2 nde durée : 60 minutes Capacités Connaissances

Plus en détail

CHAPITRE 3 : L'EXPRESSION DU PATRIMOINE GÉNÉTIQUE

CHAPITRE 3 : L'EXPRESSION DU PATRIMOINE GÉNÉTIQUE CHAPITRE 3 : L'EXPRESSION DU PATRIMOINE GÉNÉTIQUE LES PROTÉINES SONT LE RÉSULTAT DE L'EXPRESSION DES GÈNES On observe de nombreuses différences entre ces deux gènes; 1061 nucléotides pour l'allèle du groupe

Plus en détail

Chapitre 14: La génétique

Chapitre 14: La génétique Chapitre 14: La génétique A) Les gènes et les protéines, ça te gêne? 1) a) Quel est l élément de base des vivants? Les cellules b) Qu a-t-elle en son centre? Un noyau c) Qu y retrouve-t-on sous forme de

Plus en détail

Expression des gènes Comparatif entre procaryotes et eucaryotes

Expression des gènes Comparatif entre procaryotes et eucaryotes Comparaison procaryotes/ 2TSbc Expression des gènes Comparatif entre procaryotes et eucaryotes La majeure partie des connaissances de biologie moléculaire a d'abord débuté par l'étude des phénomènes chez

Plus en détail

I. Histoire de la biologie moléculaire (Q1 à Q5)

I. Histoire de la biologie moléculaire (Q1 à Q5) I. Histoire de la biologie moléculaire (Q1 à Q5) Q1. Concernant les premières lois sur l hérédité : Elles ont été établies grâce à des expériences menées sur la drosophile (Drosophila melanogaster). Elles

Plus en détail

DOCUMENT ELEVE. Etapes) de votre activité

DOCUMENT ELEVE. Etapes) de votre activité DOCUMENT ELEVE 2 nde ACT La Terre dans l univers la vie et l évolution du vivant : une planète habitée > Les molécules du vivant > L'unité chimique du vivant > L ADN à l Echelle moléculaire Compétences

Plus en détail

De la biologie molécualire à la génomique

De la biologie molécualire à la génomique De la biologie molécualire à la génomique Pierre Neuvial École Nationale de la Statistique et de l Administration Économique Méthodes statistiques pour la biologie Plan du cours 1 Introduction à la biologie

Plus en détail

Université du Québec à Montréal

Université du Québec à Montréal RECUEIL D EXERCICES DE BICHIMIE 6. Les acides nucléiques 6.2. Réplication, transcription et traduction P P P CH 2 H N H N N NH NH 2 Université du Québec à Montréal 6.2. Réplication, transcription et traduction

Plus en détail

CAPACITÉS MISES EN ŒUVRE o o o o o

CAPACITÉS MISES EN ŒUVRE o o o o o Partie du prgramme : la Terre dans l Univers, la vie et l évlutin du vivant Niveau : première Titre de la séance : expressin de l infrmatin génétique EXTRAIT DU PROGRAMME La séquence des nuclétides d une

Plus en détail

Séquence 2. L expression du patrimoine génétique. Sommaire

Séquence 2. L expression du patrimoine génétique. Sommaire Séquence 2 L expression du patrimoine génétique Sommaire 1. La synthèse des protéines 2. Phénotypes, génotypes et environnement Synthèse de la séquence 2 Exercices de la séquence 2 Glossaire des séquences

Plus en détail

Du génotype au phénotype, relation avec l environnement

Du génotype au phénotype, relation avec l environnement Du génotype au phénotype, relation avec l environnement Pré-requis (troisième et seconde) : Chaque individu présente les caractères de l'espèce avec des variations qui lui sont propres. C'est le résultat

Plus en détail

SCIENCES DE LA VIE ET DE LA TERRE

SCIENCES DE LA VIE ET DE LA TERRE BACCALAURÉAT GÉNÉRAL SESSION 2012 SCIENCES DE LA VIE ET DE LA TERRE Série S Durée de l'épreuve : 3h30 Coefficient : 6 ENSEIGNEMENT OBLIGATOIRE L'usage de la calculatrice n'est pas autorisé. Dès que le

Plus en détail

Licence-Master Bioinformatique Contrôle continu 06/03/06. Correction

Licence-Master Bioinformatique Contrôle continu 06/03/06. Correction Licence-Master Bioinformatique Contrôle continu 06/03/06 Correction -«Vraies» questions de cours -«fausses» questions de cours: questions pour voir si pouviez imaginer une réponse crédible qui n était

Plus en détail

1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16.

1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 1. Indiquer ce qu est un gène. 2. Décrire la structure de la molécule d ADN. 3. Indiquer ce que sont les allèles d un gène. 4. Indiquer ce qu est le génotype. 5. Indiquer ce qu est le phénotype. 6. Citer

Plus en détail

Anagène. Démarrer avec le logiciel. Ressources. Traitements courants. Aller plus loin

Anagène. Démarrer avec le logiciel. Ressources. Traitements courants. Aller plus loin Anagène Anagène est un logiciel conçu par le CNDP et INRP. Il est destiné à l'exploitation pédagogique de données moléculaires : séquences de gènes et de protéines. L'élève peut ainsi travailler sur des

Plus en détail

DEVOIR DE SCIENCES DE LA VIE et de LA TERRE. Septembre 2014.

DEVOIR DE SCIENCES DE LA VIE et de LA TERRE. Septembre 2014. DEVOIR DE SCIENCES DE LA VIE et de LA TERRE. Septembre 2014. Vous devez choisir pour chaque question proposée, zéro, une ou plusieurs réponses exactes parmi celles proposées ou bien répondez à la question.

Plus en détail

Macromolécules et la Cellule

Macromolécules et la Cellule Macromolécules et la Cellule Macromolécules Campbell chapitre 5 Macromolécules Définition: Molécule géante formée par l assemblage de plusieurs petites molécules organiques Macromolécules Définition:

Plus en détail

Fiche n 9 : Le brunissement des pommes Niveau : 1 ère S SVT

Fiche n 9 : Le brunissement des pommes Niveau : 1 ère S SVT FICHE RÉCAPITULATIVE Lorsque nous croquons une pomme, la chair de celle-ci est blanche. Nous avons tous pu remarquer, après avoir oublié cette même pomme croquée sur une table pendant plusieurs minutes,

Plus en détail

Tutoriel pour les enseignants de lycée. Rappel du contenu des programmes au lycée en classe de seconde

Tutoriel pour les enseignants de lycée. Rappel du contenu des programmes au lycée en classe de seconde Tutoriel pour les enseignants de lycée Ce document sert à l enseignant pour préparer différentes séquences pédagogiques afin d aborder : les questions de la génétique, des maladies génétiques, et les métiers

Plus en détail

Figure 3-4 Fonction du nucléole dans la synthèse des ribosomes.

Figure 3-4 Fonction du nucléole dans la synthèse des ribosomes. III.1.6 Le Nucléole Ce sont des structures fibrillaires sphériques denses du noyau interphasique et prophasique des organismes supérieurs. Les nucléoles qui sont le site de formation des ribosomes fixent

Plus en détail

TP6 : Le support de l'information génétique

TP6 : Le support de l'information génétique Objectifs : TP6 : Le support de l'information génétique (notionnel) : comprendre le codage de l'information génétique comprendre la variabilité de l'information génétique connaître la structure de la molécule

Plus en détail

Expression, stabilité et variation du patrimoine génétique Expression du patrimoine génétique

Expression, stabilité et variation du patrimoine génétique Expression du patrimoine génétique Thème I A Chapitre 3 Expression, stabilité et variation du patrimoine génétique Expression du patrimoine génétique Introduction : - gène = portion d ADN = information détermination des caractères [phénotype]

Plus en détail

Prédiction de gènes. Présentation du problème. Open Reading Frame. HMM (Modèles de Markov cachés) Fonctionnement Exemples Limites

Prédiction de gènes. Présentation du problème. Open Reading Frame. HMM (Modèles de Markov cachés) Fonctionnement Exemples Limites Présentation du problème Open Reading Frame Fonctionnement Exemples Limites Procaryotes versus eucaryotes Validation des résultats: 1) comparaison de séquences 2) utilisation de données statistiques HMM

Plus en détail

Transcription ??? NOYAU. ARNm. ADN Séquence de nucléotides : transmission de l info pour produire la protéine

Transcription ??? NOYAU. ARNm. ADN Séquence de nucléotides : transmission de l info pour produire la protéine NOYAU Transcrip ARNm ADN Séquence de nucléotides : transmission de l info pour produire la protéine??? Séquence de nucléotides = gène qui contient l info pr synthétiser une protéine Séquence d acides aminés

Plus en détail

Tp6 Du gène à la protéine (partie 2) 1 TP 6 Du gène à la protéine (partie 2). I - Niveau : première S La synthèse des protéines

Tp6 Du gène à la protéine (partie 2) 1 TP 6 Du gène à la protéine (partie 2). I - Niveau : première S La synthèse des protéines Tp6 Du gène à la protéine (partie 2) I - Niveau : première S La synthèse des protéines II- Extrait de programme : La traduction permet la synthèse cytoplasmique de chaînes polypeptidiques. La séquence

Plus en détail

Méthodes et techniques de la biologie du développement

Méthodes et techniques de la biologie du développement Méthodes et techniques de la biologie du développement 1. Etude de l expression des gènes : Détecter les transcrits et les protéines au cours de l ontogenèse l outil anticorps 1.1. La RT-PCR La réaction

Plus en détail

Fiche de présentation

Fiche de présentation Fiche de présentation Classe : 1 ère STL Enseignement : Chimie-biochimie-sciences du vivant THEME du programme : 4 Sous-thème : 4.1 Les propriétés informatives de l ADN sont liées à sa structure Présentation

Plus en détail

EXERCICES : DU GENE A LA PROTEINE : pages 64 65 66 EXERCICE 1 PAGE 64 : PHENOTYPES ASSOCIES A UN ENZYME : G6PD

EXERCICES : DU GENE A LA PROTEINE : pages 64 65 66 EXERCICE 1 PAGE 64 : PHENOTYPES ASSOCIES A UN ENZYME : G6PD EXERCICES : DU GENE A LA PROTEINE : pages 64 65 66 EXERCICE 1 PAGE 64 : PHENOTYPES ASSOCIES A UN ENZYME : G6PD Question 1 : définir le phénotype à plusieurs échelles Enzyme G6PD active : eau oxygénée transformée

Plus en détail

Fiche technique : étudier les protéines avec UniProt

Fiche technique : étudier les protéines avec UniProt Fiche technique : étudier les protéines avec UniProt http://www.uniprot.org/ Objectifs : ce site en ligne «UniProt», pour Universal Protein Resource, permet d étudier les protéines dans un cadre évolutionniste.

Plus en détail

MÉCANISMES MOLÉCULAIRES DE L EXPRESSION DES GÉNES : LA TRADUCTION OU BIOSYNTHÈSE DES PROTÉINES

MÉCANISMES MOLÉCULAIRES DE L EXPRESSION DES GÉNES : LA TRADUCTION OU BIOSYNTHÈSE DES PROTÉINES MÉCANISMES MOLÉCULAIRES DE L EXPRESSION DES GÉNES : LA TRADUCTION OU BIOSYNTHÈSE DES PROTÉINES Le sens de lecture L ARN polymérase lit le brin matrice dans la direction 3 vers 5 de façon à synthétiser

Plus en détail

TICE CONTRAT D ACTIVITE N 7 NIVEAU 4 ème Réalisation assistée par ordinateur Analyser le besoin Rédiger le Cahier des Charges Fonctionnel Concevoir le produit Définir le produit Préparer la fabrication

Plus en détail

PHENOTYPE - GENOTYPE Le phénotype d un individu : - peut être observé uniquement à l échelle moléculaire et à l échelle cellulaire PROTEINES ENZYMES

PHENOTYPE - GENOTYPE Le phénotype d un individu : - peut être observé uniquement à l échelle moléculaire et à l échelle cellulaire PROTEINES ENZYMES REVISIONS DE 1 S. Vous devez indiquer pour chaque proposition si celle-ci est vraie (V) ou fausse (F) en cochant la case correspondante ; une abstention ou une réponse trop peu lisible seront considérées

Plus en détail

BACCALAURÉAT GÉNÉRAL SCIENCES DE LA VIE ET DE LA TERRE

BACCALAURÉAT GÉNÉRAL SCIENCES DE LA VIE ET DE LA TERRE BACCALAURÉAT GÉNÉRAL SESSION 2013 SCIENCES DE LA VIE ET DE LA TERRE Série S Durée de l'épreuve : 3h30 Coefficient : 6 ENSEIGNEMENT OBLIGATOIRE L'usage de la calculatrice n'est pas autorisé. Dès que le

Plus en détail

Brin transcrit : chaine de l ADN qui, par complémentarité des nucléotides, sert de modèle pour la synthèse de l ARN messager

Brin transcrit : chaine de l ADN qui, par complémentarité des nucléotides, sert de modèle pour la synthèse de l ARN messager Fin du cours chap 5 La transcription : de l ADN à l ARN : Par définition, le brin transcrit est le brin d ADN complémentaire de l ARN : c est le brin qui sert à la synthèse de l ARN, donc ici le brin2.

Plus en détail

TD Révision BIO57. Connaissance et Technique du gène

TD Révision BIO57. Connaissance et Technique du gène TD Révision BIO57 Connaissance et Technique du gène Novembre 2007 Cécile BAUDOT cecile.baudot@medecine.univ-mrs.fr INSERM 910 «Génétique Médicale et Génomique Fonctionnelle» Maladies Neuromusculaires Le

Plus en détail

Titre de la séance : la structure moléculaire du vivant

Titre de la séance : la structure moléculaire du vivant Partie du programme : la Terre dans l Univers, la vie et l évolution du vivant : une planète habitée Niveau : seconde EXTRAIT DU PROGRAMME Les êtres vivants sont constitués d éléments chimiques disponibles

Plus en détail

Sauvegarder sa messagerie Outlook 2003 et 2007

Sauvegarder sa messagerie Outlook 2003 et 2007 Messagerie Outlook 2003 et 2007 Solutions informatiques w Procédure Sauvegarder sa messagerie Outlook 2003 et 2007 1/8 Sommaire SOMMAIRE 1 Introduction... 3 2 Définir la version d Outlook... 3 3... 5 2/8

Plus en détail

Chapitre 3 : L expression de l information génétique. Activité 1 : Les deux étapes de l expression de l information génétique

Chapitre 3 : L expression de l information génétique. Activité 1 : Les deux étapes de l expression de l information génétique Connaissances L'ADN contient des unités d'information appelées gènes. Le génome est l ensemble du matériel génétique d un organisme. Chez les eucaryotes, la transcription a lieu dans le noyau, la traduction

Plus en détail

TP3 Test immunologique et spécificité anticorps - déterminant antigénique

TP3 Test immunologique et spécificité anticorps - déterminant antigénique TP3 Test immunologique et spécificité anticorps - déterminant antigénique Partie 1 : Spécificité d'un anticorps pour un déterminant antigénique du VIH La séropositivité pour le VIH correspond à la présence

Plus en détail

Ingénierie des protéines

Ingénierie des protéines Ingénierie des protéines Stéphane Delbecq EA 4558 Vaccination antiparasitaire Laboratoire de Biologie Cellulaire et Moléculaire Faculté de Pharmacie - Montpellier Rappel: transcription et traduction Universalité

Plus en détail

Recherche de parenté entre les vertébrés

Recherche de parenté entre les vertébrés 1 CHAPITRE A Recherche de parenté entre les vertébrés 2 Chapitre A : Recherche de parentés entre les êtres vivants Tous les êtres vivants présentent des structures cellulaires et un fonctionnement commun

Plus en détail

Traduction des ARNm : synthèse protéique

Traduction des ARNm : synthèse protéique Traduction des ARNm : synthèse protéique Traduction Notions générales. Traduction : synthèse d une protéine donnée à partir d un ARNm spécifique. Synthèse protéique localisée dans le cytoplasme (et la

Plus en détail

Du gène à la Protéine. Réplication Transcription Traduction

Du gène à la Protéine. Réplication Transcription Traduction Du gène à la Protéine Réplication Transcription Traduction Transfert bidirectionnel de «messages»; de protéines,etc.. Membrane Nucléaire ADN Information Information Réplication Dogme de la biologie moléculaire

Plus en détail

Fiche sujet candidat 1/2

Fiche sujet candidat 1/2 Fiche sujet candidat 1/2 Mise en situation et recherche à mener Dans le cytoplasme, la synthèse de protéine constitue l expression de l information génétique contenue dans l ADN. Pour aboutir à cette synthèse

Plus en détail

Ressources pour le lycée technologique

Ressources pour le lycée technologique éduscol Chimie biochimie sciences du vivant Classe terminale Pistes d activités sur l épissage de l ARN, avec Anagène 2 Ressources pour le lycée technologique Fiche de présentation Thème 4 du programme

Plus en détail

CHAPITRE 4 - LA COMPLEXITÉ DES RELATIONS ENRE GÈNES, PHÉNOTYPES ET ENVIRONNEMENT

CHAPITRE 4 - LA COMPLEXITÉ DES RELATIONS ENRE GÈNES, PHÉNOTYPES ET ENVIRONNEMENT CHAPITRE 4 - LA COMPLEXITÉ DES RELATIONS ENRE GÈNES, PHÉNOTYPES ET ENVIRONNEMENT Introduction Tous les individus de la même espèce possèdent le même patrimoine génétique, cependant chaque individu est

Plus en détail

1A 01 Brassage génétique et sa contribution à la diversité génétique Ex 2.1 SUJET 1

1A 01 Brassage génétique et sa contribution à la diversité génétique Ex 2.1 SUJET 1 SUJET 1 On réalise deux croisements expérimentaux chez la drosophile afin d étudier le devenir de deux caractères : la couleur du corps et l aspect des ailes au cours de la reproduction sexuée La longueur

Plus en détail

Nom : Groupe : Date : 1 LES RESPONSABLES DES CARACTÈRES CHEZ LES ÊTRES VIVANTS (p. 350-358)

Nom : Groupe : Date : 1 LES RESPONSABLES DES CARACTÈRES CHEZ LES ÊTRES VIVANTS (p. 350-358) CHAPITRE 811 STE Questions 1 à 17, A, B. Verdict 1 LES RESPONSABLES DES CARACTÈRES CHEZ LES ÊTRES VIVANTS (p. 350-358) 1. Observez les deux cellules ci-contre. a) Sous quelle forme apparaît l ADN dans

Plus en détail

Fiche d exercices 8 : Patrimoine génétique

Fiche d exercices 8 : Patrimoine génétique Fiche d exercices 8 : Patrimoine génétique Exercice 1 Patrimoine génétique 1/9 2/9 Exercice 3 I-Restitution de connaissances 1- La séquence d un polypeptide a) est déterminée par la séquence des nucléotides

Plus en détail

Dossier I Découverte de Base d Open Office

Dossier I Découverte de Base d Open Office ETUDE D UN SYSTEME DE GESTION DE BASE DE DONNEES RELATIONNELLES Définition : Un SGBD est un logiciel de gestion des données fournissant des méthodes d accès aux informations. Un SGBDR permet de décrire

Plus en détail

Ressources. Production attendue

Ressources. Production attendue Thème du programme : la tectonique des plaques histoire d un modèle Etape 1 : Concevoir une stratégie pour résoudre une situation problème proposer une démarche d investigation Contre arguments de la théorie

Plus en détail

PROCEDURES TAKE FIVE SOMMAIRE. 1. Paramétrage. 2. Page d accueil. 3. Clients. 4. Catalogue. 5. Ventes. 6. Statistiques. 7. Agenda. 8.

PROCEDURES TAKE FIVE SOMMAIRE. 1. Paramétrage. 2. Page d accueil. 3. Clients. 4. Catalogue. 5. Ventes. 6. Statistiques. 7. Agenda. 8. PROCEDURES TAKE FIVE SOMMAIRE 1. Paramétrage 2. Page d accueil 3. Clients 4. Catalogue 5. Ventes 6. Statistiques 7. Agenda 8. Taches 9. Bloc-notes 10. Procédure(s) automatisée(s) 11. Sauvegarde 1. Paramétrage

Plus en détail

Chapitre 2 : Organisation de la cellule

Chapitre 2 : Organisation de la cellule Partie 1 : notions de biologie cellulaire DAEU- Cours Sciences de la Nature & de la Vie- Marc Cantaloube Chapitre 2 : Organisation de la cellule La cellule est l unité de base des êtres vivants. Il existe

Plus en détail

Fiche pédagogique : De l ADN aux protéines. Les secrets de l expression de l information génétique.

Fiche pédagogique : De l ADN aux protéines. Les secrets de l expression de l information génétique. Fiche pédagogique : De l ADN aux protéines. Les secrets de l expression de l information génétique. Pourquoi êtes-vous blonds? bruns? chauves? Pourquoi avez-vous les yeux bleus? Pourquoi ressemblez-vous

Plus en détail

Créer l album Photo facilement:

Créer l album Photo facilement: Créer l album Photo facilement: Nous allons voir comment insérer automatiquement dans un diaporama des photos stockées sur votre ordinateur. Il ne nous sera pas nécessaire de créer les diapositives, elles

Plus en détail

Réaliser une composition photographique avec the Gimp

Réaliser une composition photographique avec the Gimp Réaliser une composition photographique avec the Gimp Introduction Ouvrir le logiciel The Gimp Ouvrir un fichier image dans Gimp Ouvrir la boite de dialogue calques Détourer une photo Réalisation : François

Plus en détail

Sujets de mini-projets

Sujets de mini-projets Sujets de mini-projets Sujet I: Décodage neuronal Assistant responsable: Samuel.Gmehlin@epfl.ch et Lukas.Rytz@epfl.ch Motivation Certains neurones du cerveau sont corrélés avec des stimuli complexes, par

Plus en détail

L3-BH01 Cours n 10 Modifications post-transcriptionnelles

L3-BH01 Cours n 10 Modifications post-transcriptionnelles L3-BH01 Cours n 10 Modifications post-transcriptionnelles Ce cours est présent sur le web à l adresse suivante : http://www.univ-orleans.fr/sciences/biochimie/l/ressources.htm Plan (cours n 10 & 11) Introduction

Plus en détail

La souris verte : transgenèse

La souris verte : transgenèse La souris verte : transgenèse méduse equorea victoria cellule de méduse prélèvement du gène FP equorea victoria (http://mabryonline.org) micro-injection du (transgène) dans la cellule-œuf de souris Lucie,

Plus en détail

Cours de Biologie moléculaire de Licence professionnelle 2011

Cours de Biologie moléculaire de Licence professionnelle 2011 Cours de Biologie moléculaire de Licence professionnelle 2011 Sommaire 1. Introduction 2.1. La structure de l ADN 2.2. La structure de l ARN 2.3. Du gène à la protéine 2.3.1. La réplication 2.3.2. La transcription

Plus en détail

TP7 : Du gène à la protéine : le langage génétique

TP7 : Du gène à la protéine : le langage génétique TP7 : Du gène à la protéine : le langage génétique Vous avez reçu un message de F. Jacob et J. Monod : «Nous avons caché un trésor dans la salle D4. Pour le trouver vous devrez percer le mystère du code

Plus en détail

Chapitre C. (ancien programme) (Nouveau programme) POLY-PREPAS AMIENS M.LAIGNIER ll.polyprepas@orange.fr

Chapitre C. (ancien programme) (Nouveau programme) POLY-PREPAS AMIENS M.LAIGNIER ll.polyprepas@orange.fr 1 Chapitre C LA SYNTHÈSE PROTÉIQUE (ancien programme) L expression du matériel génétique (Nouveau programme) Le phénotype macroscopique des individus est sous la dépendance des protéines. Le phénotype

Plus en détail

TP 4: de l ADN à l ARNm les étapes de la transcription

TP 4: de l ADN à l ARNm les étapes de la transcription TP 4: de l ADN à l ARNm les étapes de la transcription Lycée E. Delacroix 1 ère S Programme 2011 Activité 1: la localisation de la synthèse des protéines Objectif de l autoradiographie Marquer l emplacement

Plus en détail

CHAPITRE III: Le Clonage

CHAPITRE III: Le Clonage BIOLOGIE MOLECULAIRE CHAPITRE III: Le Clonage I) Définition: Cloner un fragment d'adn consiste à: isoler physiquement ce fragment. en augmenter le nombre de copie (cf: amplification) II) Principe: Le clonage

Plus en détail

ED Biologie moléculaire. E. Turpin J. Lehmann-Che 5-6 novembre 2007

ED Biologie moléculaire. E. Turpin J. Lehmann-Che 5-6 novembre 2007 ED Biologie moléculaire E. Turpin J. Lehmann-Che 5-6 novembre 2007 PCR 1983: Kary Mullis Amplification in vitro par une méthode enzymatique d'un fragmentd'adn en présence de deux oligonucléotides spécifiques

Plus en détail

À PROPOS D IMAGES : Fiche professeur

À PROPOS D IMAGES : Fiche professeur À PROPOS D IMAGES : Fiche professeur Damier Assiette Danseuse Eventail Danseuse 1 FICHE ÉLÈVE (1) Que devient une image lorsqu on la grossit? Ouvrir (par exemple avec l application «Aperçu»), les deux

Plus en détail

TP 2 : Les enzymes digestives.

TP 2 : Les enzymes digestives. TP 2 : Les enzymes digestives. Animation : Enzymes Ils existent des milliers d enzymes qui interviennent simultanément dans des réactions chimiques. Problèmes : Comment les enzymes agissent-elles sur leur

Plus en détail

Sauvegarder sa messagerie Outlook 2010

Sauvegarder sa messagerie Outlook 2010 Messagerie Outlook 2010 Solutions informatiques w Procédure Sauvegarder sa messagerie Outlook 2010 1/8 Sommaire SOMMAIRE 1 Introduction... 3 2 Définir la version d Outlook... 3 3... 5 2/8 1 Introduction

Plus en détail