Le modèle cellulaire THP-1 : adaptation à l étude de modulateurs de l activité inflammatoire précoce implicant l inflammasome

Dimension: px
Commencer à balayer dès la page:

Download "Le modèle cellulaire THP-1 : adaptation à l étude de modulateurs de l activité inflammatoire précoce implicant l inflammasome"

Transcription

1 Le modèle cellulaire THP-1 : adaptation à l étude de modulateurs de l activité inflammatoire précoce implicant l inflammasome Loranne Maugé To cite this version: Loranne Maugé. Le modèle cellulaire THP-1 : adaptation à l étude de modulateurs de l activité inflammatoire précoce implicant l inflammasome. Agricultural sciences. Université de Bourgogne, French. <NNT : 2013DIJOS052>. <tel > HAL Id: tel https://tel.archives-ouvertes.fr/tel Submitted on 23 May 2014 HAL is a multi-disciplinary open access archive for the deposit and dissemination of scientific research documents, whether they are published or not. The documents may come from teaching and research institutions in France or abroad, or from public or private research centers. L archive ouverte pluridisciplinaire HAL, est destinée au dépôt et à la diffusion de documents scientifiques de niveau recherche, publiés ou non, émanant des établissements d enseignement et de recherche français ou étrangers, des laboratoires publics ou privés.

2 UNIVERSITE DE BOURGOGNE ECOLE DOCTORALE ENVIRONNEMENTS - SANTE UFR SCIENCES DE LA VIE - DIJON THÈSE Pour obtenir le grade de DOCTEUR DE L UNIVERSITE DE BOURGOGNE Discipline : Biologie cellulaire LE MODELE CELLULAIRE THP-1 : ADAPTATION A L ETUDE DE MODULATEURS DE L ACTIVITE INFLAMMATOIRE PRECOCE IMPLIQUANT L INFLAMMASOME Présentée et soutenue publiquement par Loranne Maugé Le 4 décembre 2013 Membres du jury : Pr Cem Gabay CHU de Genève, Suisse Rapporteur Dr Irène Garcia-Gabay Université de Genève, Suisse Rapporteur Pr David Wendehenne Université de Bourgogne Président Pr Jean-Louis Connat Université de Bourgogne Directeur Dr Patrick Dutartre, PAST UB COHIRO Biotechnology Membre invité 1

3 REMERCIEMENTS Je remercie tout d abord mon maître de thèse Monsieur le Professeur Jean-Louis Connat de m avoir fait confiance et d avoir encadré ce travail. J ai beaucoup appris à ses côtés et je lui en suis très reconnaissante. Je remercie également Monsieur le Professeur Patrick Dutartre d avoir accepté de juger ce travail et pour m avoir accueillie au sein de l entreprise COHIRO Biotechnology avec le Docteur Stéphanie Delemasure-Chalumeau. Je les remercie aussi tous les deux pour leur soutien et leurs encouragements tout au long de cette thèse. Je tiens à remercier les Professeurs Catherine Vergely et Luc Rochette pour m avoir acceptée au sein du LPPCM. Ils ont été un soutien discret mais déterminant et très important au cours de cette aventure. Vous avez toujours eu une attention délicate pour moi. Je voudrais remercier les rapporteurs de cette thèse Madame le docteur Irène Garcia- Gabay et Monsieur le Professeur Cem Gabay pour avoir examiné ce travail et pour le temps et l intérêt qu ils y ont portés. J associe à mes remerciements Monsieur le Professeur David Wendehenne pour avoir accepté de lire et d examiner mon travail. Je souhaite remercier les équipes et personnes avec qui j ai pu collaborer lors de mon travail : Madame le Professeur Catherine Vergely avec qui j ai pu m initier à la RPE ; le centre de zootechnie dirigé par Valérie Saint-Georgio pour avoir pris soin de mes souris et pour leur aide ; Madame Zahia Benmeddour de l université de Bejaia en Algérie pour notre travail sur les extraits de dattes ; Madame le Docteur Maria Koufaki et son équipe de l institut de biologie, de chimie médicale et de biotechnologie d Athènes en Grèce qui nous ont fourni les composés dérivés de purines ; le laboratoire BioPeroxIL et notamment Messieurs le Professeur Mustapha Cherkaoui Malki et les Docteurs Pierre Andréoletti et Hammam El Hajj, pour leur accueil et leur expertise dans les techniques du western blotting et de la qpcr qu ils m ont transmis et pour le travail entrepris avec Hammam sur les souris. Je tiens à remercier 2

4 particulièrement Hammam pour sa patience, sa disponibilité et ses précieux conseils. Tu m as permis de me faire adopter par tes collègues et de passer de bons moments avec vous tous. Je tiens à remercier toutes les personnes que j ai rencontrées au laboratoire, avec qui j ai pu travailler de près ou de loin et à qui je me suis attachée : Martine, ma colocataire de bureau ; les filles du labo, Maéva et Marina, qui ont toujours été là ; la Françoise, qui a été un peu comme une maman pour les «jeunes» et qui a su être une oreille attentive pour moi quels que soient les moments de joie ou de colère ; Julie, avec qui j ai beaucoup partagé ; Na, Ahmed et Kader avec qui j ai beaucoup discuté et rigolé ; les «petites stagiaires» devenues grandes mais surtout des amies : Norenn, Eve et Claire. Je n oublie pas mes amis qui ont toujours été présents et ceux qui m ont aussi accompagnée dans cette aventure : le groupe des copines de l école (Apolline, Lucile, Marie et Coralie) ; les copains et amis de longue date (Raphaël, Damien et Davy) ; les Pierre- Fabriens (Laure, Marion et Michael) ; et qui m ont permis de m évader de la routine du labo et de m avoir changé les idées : Noémie, Lucie, Claire, Jessica, Aline, Sarah. J ai une pensée toute particulière pour Jonathan qui m a rejoint en cours d aventure et qui est devenu indispensable à mon quotidien et m a apporté un soutien affectif sans faille. Enfin, on peut le dire : «A nous la vraie vie». Un grand merci à ses parents, Jocelyne et Jean-Pierre, pour leur soutien et leur aide. Enfin, je souhaite remercier spécialement ma famille, mon oncle Jean-Marc, mes grands-parents, ma tante Isabelle, qui m a beaucoup aidée dans mon choix de parcours, ma sœur Marie pour leur soutien tout au long de ces trois dernières années de thèse. Mes dernières pensées vont vers mes parents, mum et pup, qui m ont toujours «sauvé la vie». 3

5 4

6 TABLE DES MATIERES REMERCIEMENTS... 2 TABLE DES MATIERES... 5 LISTE DES FIGURES LISTE DES ABREVIATIONS INTRODUCTION BIBLIOGRAPHIQUE L inflammation La notion d homéostasie au cœur du processus inflammatoire La réponse inflammatoire Les causes de la réponse inflammatoire Les mécanismes de la réponse inflammatoire Les inducteurs de la réponse inflammatoire Les médiateurs de la réponse inflammatoire L interleukine L IL-1β La maturation de l IL-1β L excrétion de l IL-1β IL-1β et régulation de l inflammation D autres interleukines de la famille des IL IL-1α IL IL IL Les PRRs Les NLRs Structure et fonction des récepteurs NLRs La conservation des protéines NLRs dans le monde vivant Les inflammasomes La protéine Caspase L activation non canonique des caspases inflammatoires

7 La protéine ASC L inflammasome AIM L inflammasome NLRC L inflammasome NLRP L inflammasome NLRP L inflammasome NLRP L inflammasome NLRP L inflammasome NLRP L inflammasome PYRIN Les mécanismes de régulation de l inflammasome Disponibilité des composants de l inflammasome Interactions moléculaires avec une protéine NLR Le rôle des composants libérés par le lysosome L ubiquitination/désubiquitination Implication des ROS dans l activation de l inflammasome L autophagie/la mitophagie Les flux ioniques L efflux de potassium Le calcium L ATP extracellulaire et la voie purinergique La régulation négative de l inflammasome Inflammasome et pathologies Les cryopyrinopathies La maladie périodique La goutte ou pseudogoutte Les protéines mal repliées («misfolded») Les maladies cardiaques L athérosclérose Les maladies métaboliques Les rétinopathies Le cancer Les inhibiteurs d inflammasome : nouveaux outils thérapeutiques? Objectifs de la thèse MATERIELS ET METHODES Culture de la lignée cellulaire THP Différenciation des monocytes THP Traitements appliqués aux THP-1 différenciés Traitements pro-inflammatoires appliqués Traitements anti-inflammatoires appliqués

8 Cultures primaires de cellules Macrophages dérivés de la moelle osseuse (BMDMs) Animaux Obtention et culture de BMDMs Cellules mononucléaires de sang périphérique (PBMCs) issues de couches leucocytaires («buffy coat») 70 Traitements appliqués aux cellules primaires murines et humaines Test de cytotoxicité Préparation des solutions Procédure expérimentale Traitement des résultats Mesure de la production d IL-1β Préparation des solutions et «coating» des plaques Procédure expérimentale Traitement des résultats Mesure de la concentration en sous-unité p20 de la caspase Préparation des solutions et de la gamme de standards Procédure expérimentale Traitement des résultats Mesure de la concentration en nitrites, méthode de Griess Préparation des solutions Procédure expérimentale Traitement des résultats Western blotting Extraction des protéines Mesure de la quantité de protéines, méthode BCA Préparation des solutions Procédure expérimentale Traitement des résultats Séparation des protéines en SDS-PAGE (PolyAcrylamid Gel Electrophoresis) Transfert des protéines sur membrane Immunoblotting Stripping Traitement des résultats RT-qPCR Extraction d ARNs totaux à partir de cellules Dosage des ARNs totaux Transcription inverse (RT) Réaction de polymérisation en chaîne en temps réel Préparations des échantillons Réaction de qpcr

9 Traitement des résultats Analyse par spectroscopie de Résonance Paramagnétique Electronique (RPE) Préparation des solutions Procédure expérimentale Analyse des résultats Analyses statistiques RESULTATS Mise en place d un modèle cellulaire TLR-indépendant permettant l étude de l inflammasome Effet d un ester de phorbol, le TPA, sur la différenciation des monocytes THP-1 en macrophages Influence du TPA sur l adhésion cellulaire Influence du TPA sur la production d IL-1β Cinétique de la réponse inflammatoire Influence de la concentration en TPA sur le niveau basal de production d IL-1β Effet du LPS sur la production d IL-1β par les THP Influence du LPS sur la production d IL-1β par des monocytes Influence du LPS sur la production d IL-1β par des monocytes en différenciation Influence du LPS sur la production d IL-1β par des macrophages Influence des concentrations de TPA et de LPS sur la production d IL-1β par des macrophages Induction d IL-1β inflammasome-dirigée, utilisation de modulateurs caractérisés de l inflammasome NLRP Etude de l effet de l ATP sur des macrophages THP-1 en absence d activation de la voie TLR Effet de l ATP sur la production d IL-1β par les THP Influence de l ATP sur la production d IL-1β par les macrophages et leur viabilité cellulaire Cinétique de la production d IL-1β ATP-induite par les THP Influence des concentrations de TPA et de LPS sur la production d IL-1β ATP-induite par des macrophages Influence des solvants sur la production d IL-1β ATP-induite par les THP Effet de l ATP sur la régulation de la voie IL-1β : implication de l inflammasome NLRP Influence de l ATP sur la régulation de l expression de gènes impliqués dans l inflammation Influence de l ATP sur la régulation de l expression des protéines liées à l inflammasome NLRP Influence de l inhibition des protéines de l inflammasome NLRP3 sur la régulation de la voie IL-1β après induction par ATP Implication de la voie purinergique dans la production d IL-1β ATP-induite Implication du stress oxydatif sur la production d IL-1β ATP-induite Etude de l effet de générateurs d espèces radicalaires sur des macrophages THP-1 en l absence d activation de la voie TLR Influence de H 2 O 2 sur la génération de ROS

10 Effet de générateurs de ROS sur la production d IL-1β par les THP Influence de générateurs de ROS sur la production d IL-1β par les macrophages et leur viabilité cellulaire Cinétique de la production d IL-1β H 2 O 2 -induite par les THP Influence des concentrations de TPA et de LPS sur la production d IL-1β H 2 O 2 -induite par des macrophages Influence des solvants sur la production d IL-1β H 2 O 2 -induite par les THP Influence de générateurs de ROS sur la production d IL-1β à «grande échelle» Influence de l H 2 O 2 sur la régulation de la voie IL-1β : implication de l inflammasome NLRP Influence de l H 2 O 2 sur la régulation de l expression de gènes impliqués dans l inflammation Influence de l inhibition des protéines de l inflammasome NLRP3 sur la régulation de la voie IL-1β après induction par H 2 O Implication de la voie purinergique sur la production d IL-1β H 2 O 2 -induite Application du modèle : détermination du profil inflammatoire potentiel de produits Etude de l effet inflammatoire de produits alimentaires Produits commerciaux issus de l industrie agroalimentaire Etude d extraits réalisés à partir de dattes Etude de l effet inflammatoire de composés synthétiques DISCUSSION Mise en place d un modèle cellulaire TLR-indépendant permettant l étude de l inflammasome Différenciation des THP-1 par le TPA Stimulation des THP-1 par le LPS Stimulation des THP-1 par des modulateurs de l inflammasome NLRP Etude de l effet de signaux inflammatoires précoces sur des macrophages THP-1 en absence d activation de la voie TLR Production d IL-1β ATP-dépendante Production d IL-1β dépendante de générateurs de ROS Modulation de l inflammasome par ATP et H 2 O Implication de la voie purinergique Application du modèle : détermination du profil inflammatoire potentiel de produits Les extraits naturels Les donneurs de NO Les composés MKs non donneurs de NO Conclusions et perspectives BIBLIOGRAPHIE

11 LISTE DES FIGURES Tableau 1 : Conditions de culture en fonction du but de l'expérience Tableau 2 : Amorces utilisées pour la RT-qPCR Figure 1 : Membres de la famille des protéines NLRs humaines Figure 2 : Assemblage des inflammasomes NLRs Figure 3 : Les différents types d inflammasomes Figure 4 : Mécanisme d activation de l inflammasome NLRP Figure 5 : Inhibiteurs de l inflammasome Figure 6 : Quelques exemples de traitements interférant dans la signalisation de l inflammasome Figure 7 : Modèle cellulaire permettant l'étude de la production d'il-1β Figure 8 : Spectre caractéristique du radical DMPO-OH Figure 9 : Cinétique d adhérence des cellules après un traitement avec 20 nm TPA Figure 10 : La différenciation des THP-1 s'accompagne d'un changement de morphologie Figure 11 : Cinétique de la production d'il-1β entre 48,5 et 72 heures Figure 12 : Influence du TPA sur la production d'il-1β dans les surnageants de culture Figure 13 : Influence du LPS sur la production d IL-1β par les monocytes et les macrophages Figure 14 : Influence du LPS sur la production d'il-1β par des monocytes en cours de différenciation Figure 15 : Influence de la concentration en TPA et de la concentration en LPS sur la production d IL-1β Figure 16 : Influence de modulateurs connus de l'inflammasome sur la production d'il-1β par les macrophages Figure 17 : Influence de l ATP sur la production d IL-1β par les macrophages et leur viabilité cellulaire Figure 18 : Cinétique de la production d'il-1β après traitement par ATP 1 mm au jour

12 Figure 19 : Sensibilisation de l effet pro-inflammatoire de l ATP sur les macrophages THP Figure 20 : Influence des solvants sur la production d IL-1β ATP-induite Figure 21 : Influence de l ATP sur la régulation de l expression de gènes impliqués dans l inflammation Figure 22 : Influence de l ATP sur l expression de protéines impliquées dans l inflammation Figure 23 : Influence de l ATP sur la voie IL-1β, implication du complexe inflammasome NLRP Figure 24 : Influence d inhibiteurs de la voie purinergique sur la production d IL-1β ATP-induite Figure 25 : Effets de la NAC sur la production d IL-1β Figure 26 : Influence de complexes anti-oxydants sur l effet pro-inflammatoire d H 2 O 2 via la génération de ROS Figure 27 : Influence de générateurs de ROS sur la production d IL-1β par les macrophages et leur viabilité cellulaire Figure 28 : Cinétique de la production d IL-1β après traitement par 125 µm H 2 O 2 au jour Figure 29 : Sensibilisation de l effet pro-inflammatoire d H 2 O 2 sur les macrophages THP Figure 30 : Influence des solvants sur la production d IL-1β H 2 O 2 -induite Figure 31 : Influence de générateurs de ROS sur la production d IL-1β par les macrophages et leur viabilité cellulaire à «grande échelle» Figure 32 : Influence d H 2 O 2 sur la régulation de l expression de gènes impliqués dans l inflammation Figure 33 : Influence d H 2 O 2 sur la voie IL-1β, implication de la caspase Figure 34 : Influence d inhibiteurs de la voie purinergique sur la production d IL-1β H 2 O 2 -induite Figure 35 : Influence du «Tabletree» sur la production d IL-1β Figure 36 : Influence d «OMU Milk» sur la production d IL-1β Figure 37 : Structure chimique des analogues MK55, MK56 et MK Figure 38 : Influence des analogues MK sur la production de nitrites et d IL-1β par les macrophages Figure 39 : Influence d ISD sur la production de nitrites et d IL-1β par les macrophages Figure 40 : Mécanisme supposé de l'activation des inflammasomes par l ATP et H 2 O

13 LISTE DES ABREVIATIONS ADN : acide désoxyribonucléique ADNc : ADN complémentaire ADP : adénosine triphosphate AIM2 : absent in melanoma 2 AMD : age-related macular degeneration (ou DMLA) AMP : adénosine monophosphate ANOVA : analyse de la variance APAF1 : apoptotic protease-activating factor 1 ARN : acide ribonucléique ARNm : ARN messager ASC : apoptosis-associated speck-like protein containing a caspase recruitment domain Asp : acide aspartique ATP : adénosine triphosphate AU : unité arbitraire (ou UA) BCA : acide bicinchoninique BEt : bromure d éthidium BIR : baculovirus inhibitor of apoptosis protein repeat BMDM : macrophage dérivé de la moelle osseuse (bone marrow-derived macrophage) BPCO : bronchopneumopathie chronique obstructive BSA : albumine bovine sérique Ca2+ : calcium CAPS : cryopyrin-associated periodic syndrome ou syndrome périodique associé à la cryopyrine CARD : caspase recruitment domain CC : coiled-coil CD : cluster de différenciation Cellule NK : cellule natural killer CIITA : class II transactivator ou transactivateur de classe II CINCA : syndrome chronique infantile neurologique cutané articulaire (ou NOMID) CLR : C-type lectin receptor CLR1.1 : CATERPILLAR 1.1 CNL : CC-NB-LRR COP : CARD-only protein CPPD : calcium pyrophosphate dihydrate CrmA : cytokine response modifier A CRP : C-reactive protein CSF : colony-stimulating factor Ct : cycle seuil Cys : cystéine DAMPs : danger-associated molecular patterns DF : death fold DMEM : dulbecco s modified eagle medium DMLA : dégénérescence maculaire liée à l âge (ou AMD) DMPO : 5,5 -dimethyl-1-pyrroline-n-oxide dntp : désoxyribonucléotide triphosphate DPI : diphénylène iodonium EC50 : concentration effective médiane EFS : établissement français du sang ELISA : enzyme-linked immunosorbent assay FCAS : familial cold-induced auto-inflammatory syndrome ou syndrome auto-inflammatoire familial au froid FIIND : function to find domain FMF : fièvre méditerranéenne familiale G-CSF : granulocyte colony-stimulating factor 12

14 Glu : acide glutamique Glut : transporteur de glucose GM-CSF : granulocyte macrophage colonystimulating factor H 2 O 2 : peroxyde d hydrogène H2Od : eau distillée HCl : acide chlorhydrique HIF-1α : hypoxia inducible factor-1α His : Histidine HMGB1 : high-mobility group box 1 HS : High-Sensitivity ICE : IL-1-converting enzyme ou enzyme transformant IL-1 IFN : interféron IL : interleukine IL-1RA : antagoniste du récepteur à l IL-1 INCA : inhibitory CARD IPAF : ICE-protease activating factor ISD : isosorbide dinitrate K+ : potassium LDLox : lipoprotéines de faible densité oxydées LDLR : récepteur aux lipoprotéines de faible densité LPS : lipopolysaccharide LRR : leucine-rich repeat LT : toxine létale de Bacillus anthracis, anthrax Lymphocyte Th : lymphocyte T helper ou T auxiliaire MAMPs : microbe-associated molecular patterns MCC (-RP) : milieu complet sans rouge de phénol MCC : milieu de culture complet MCP-1 : protéine chimio-attractive des monocytes ou monocyte chemo-attractant protein-1 M-CSF : macrophage colony-stimulating factor MDP : muramyl-dipeptide mir : microarn MMP : métalloprotéinase matricielle MSU : monosodium urate MWS : Muckle-Wells syndrome Na+ : sodium NAC : N-acétyl cystéine NACHT : NAIP, CIITA, HEP-E, TPI-1 NADPH : nicotinamide adénine dinucléotide phosphate NAIP : NLR family-apoptosis inhibitory protein NB ou NBD : nucleotide binding domain NLR : NOD-like receptor NLRA : NLR family acidic domain containing NLRB : NLR family BIR domain containing NLRC : NLR family containing a CARD domain NLRP : NLR family pyrin domain containing NLRX : NLR family containing an X domain NO : monoxyde d azote NOD : nucleotide binding oligomerization domain NOMID : neonatal onset multi-system inflammatory disorder (ou CINCA) NOX : NADPH oxydase NTP : nucléotide triphosphate P2R : récepteur P2 P2X7R : récepteur P2X7 PAI-2 : plasminogen activator inhibitor 2 PAMPs : pathogen-associated molecular patterns Panx-1 : pannexine-1 PBMC : cellule mononucléaire de sang périphérique (peripheral blood mononuclear cell) PBS : phosphate buffered saline PCR : polymérisation en chaîne en temps réel PGN : peptidoglycane PKR : protéine kinase R 13

15 PMA : phorbol 12-myristate 13-acetate (ou TPA) PMS : phenazine methosulfate POP : pyrin-only protein Protéine R : protéine de résistance PRR : pattern recognition receptor PSA : Pénicilline, Streptomycine, Amphotéricine B PVDF : Polyvinylidène difluoride, Polyscreen Dupont PY ou PYD : domaine pyrine PYPAF1 : PYrin-containing apaf-1-like protein 1 RIG-I : retinoic acid-inducible gene I RLR : RIG-I-like receptor RNS : reactive nitrogen species/espèces réactives de l azote ROS : reactive oxygen species/espèces réactives de l oxygène RPE : résonnance paramagnétique électronique Rpm : round per minute ou tour par minute RPMI-1640 : Roswell Park Memorial Institute medium RT : transcription inverse SDS : sodium dodecyl sulfate SN : surnageants de culture STAND : signal transduction ATPases with numerous domains SVF : sérum de veau fœtal T2DM : diabète de type 2 ou type 2 diabete mellitus TA : température ambiante TBE : tris/borate/edta tbhp : tert-butyl hydroperoxyde TGF : transforming growth factor TIR : Toll Il-1 receptor TLR : Toll-like receptor Tm : température de fusion TNF : tumor necrosis factor TNL : TIR-NB-LRR TNT : trinitrine ou glycérol trinitrate TPA : 12-O-Tetradecanoylphorbol 13-acetate (ou PMA) TRIM30 : tripartite-motif protein 30 Trp : tryptophane TTSS : système de sécrétion de type 3 (type three secretion system) TXN : thiorédoxine TXNIP : thioredoxin-interacting protein UA : unité arbitraire (ou AU) UV : ultraviolet VEGF : vascular endothelial growth factor WT : wild type XTT : 2,3-Bis-(2-Methoxy-4-Nitro-5-Sulfophenyl)- 2H-Tetrazolium-5-Carboxanilide 14

16 INTRODUCTION BIBLIOGRAPHIQUE 15

17 L inflammation A l origine, l inflammation, du latin «inflammare» signifiant «mettre le feu», était définie par une combinaison de signes cliniques et de symptômes, mais ne correspondait pas à une pathophysiologie spécifique. En effet, dès le 1 er siècle après J.-C., Celsus définit ce processus par quatre symptômes cliniques : une rougeur et un gonflement, accompagnés de température et douleur. Un siècle et demi plus tard, Galen ajoute à cette tétrade un cinquième symptôme, la perturbation de la fonction physiologique. Contrairement aux quatre premiers signes cardinaux s appliquant à une réponse inflammatoire aigüe classique, ce dernier est universel quel que soit le processus inflammatoire concerné (Rather, 1971). Les avancées en microscopie et biologie cellulaire au cours du 19 ème siècle donnent lieu à des définitions de l inflammation basées sur la cellule, avec la notion de changements de populations cellulaires issue du sang et de prolifération localisée. De nombreuses avancées dans la compréhension de la réponse inflammatoire s en sont suivies, dont l identification de différentes classes de médiateurs inflammatoires, l identification des voies contrôlant leur production et leur mécanisme d action. Selon le point de vue duquel on se place - clinique, cellulaire ou moléculaire - l inflammation représente des événements différents (Scott et al., 2004). L inflammation est intimement couplée à l immunité innée et adaptative. Les facteurs clés déterminant l initiation de l inflammation et sa progression sont les pathogen-/microbeassociated molecular patterns (PAMPs/MAMPs), les danger-associated molecular patterns (DAMPs), les pattern recognition receptors (PRRs), les cellules de l immunité innée et adaptative et les inflammasomes (Di Virgilio, 2013). La notion d homéostasie au cœur du processus inflammatoire L inflammation peut survenir sous plusieurs formes et modalités en fonction du contexte dans lequel elle est déclenchée, de ce qui la provoque et des tissus impliqués. C est un processus complexe, dont le mécanisme n est aujourd hui encore pas totalement compris en raison des différents niveaux de contrôle et des multiples composants impliqués (Rivas, 2010). Dans le cas d une inflammation classique, les initiateurs sont une infection ou une lésion tissulaire. Une réponse adaptative est également générée dans le cas d une dérégulation tissulaire ou d un déséquilibre homéostatique, afin de rétablir l homéostasie. Généralement, on considère qu une réponse inflammatoire contrôlée est bénéfique, alors qu une dérégulation 16

18 de cette dernière devient nuisible (Medzhitov, 2008). Fondamentalement, l inflammation est une réponse adaptative à des conditions nocives et présente des aspects à la fois bénéfiques et néfastes. En effet, cette réponse se produit aux dépends d autres processus physiologiques et fait intervenir la notion d homéostasie introduite par Claude Bernard en 1865 (Medzhitov, 2010). Les mécanismes de contrôle de l homéostasie permettent aux paramètres internes d être stables. L inflammation est provoquée dans le cas de perturbations sévères de l homéostasie, lorsque ces mécanismes ne sont plus suffisants ou incompétents. Ainsi, la réponse inflammatoire est un processus qui permet la survie pendant une infection ou une lésion afin de maintenir l homéostasie tissulaire, indépendamment de ces conditions. Quelle que soit sa cause, le but est de supprimer ou séquestrer la source de la perturbation pour permettre à l hôte de s adapter aux conditions environnementales et ainsi restaurer la fonctionnalité et l homéostasie tissulaire (Medzhitov, 2008). La réponse inflammatoire Les causes de la réponse inflammatoire Les causes de l inflammation sont multiples : microorganismes, virus, trauma, cancer, particules étrangères, ischémie, exposition aux radiations, maladies métaboliques, etc. Quelle qu en soit la cause, l inflammation se caractérise par une lésion cellulaire ou tissulaire. Les DAMPs sont des molécules normalement absentes de l environnement extracellulaire, et sont libérées, lorsqu un microorganisme étranger pénètre et se multiplie dans le corps (infection) ou en conséquence d une lésion tissulaire (inflammation stérile). Les PAMPs, quant à eux, sont des motifs moléculaires conservés par tous les microorganismes d une même classe (pathogène ou commensale). Pour initier l inflammation, une action coordonnée entre les PAMPs/MAMPs et les DAMPs est nécessaire. En effet, l inflammation est initiée par la reconnaissance de molécules étrangères et/ou de lésions cellulaires (Di Virgilio, 2013). Les mécanismes de la réponse inflammatoire La réponse inflammatoire repose sur quatre composants : des inducteurs inflammatoires, des senseurs les détectant, des médiateurs inflammatoires induits par des senseurs et des tissus cibles sur lesquels les médiateurs agissent. Le dommage tissulaire est détecté par les macrophages résidents, qui induisent des réponses inflammatoires et réparatrices, et par les récepteurs de douleurs, les nocicepteurs, qui provoquent la sensation de 17

19 douleur. Inflammation et nociception sont liées à différents stades. En effet, leurs senseurs peuvent être activés par les mêmes signaux, comme par exemple l adénosine triphosphate (ATP) extracellulaire libérée par les cellules nécrotiques. Ces dernières décades, deux types de conditions inflammatoires ont été identifiées : la réaction aigüe (lésions, infections) et l état chronique (diabète, athérosclérose, asthme, maladies neurodégénératives, cancer) (Medzhitov, 2010). Une réponse inflammatoire aigüe est due à une infection ou une lésion tissulaire. Dans un site inflammatoire, des centaines de médiateurs sont produits dans et autour des cellules, et agissent sur l endothélium vasculaire local, causant la dilatation des vaisseaux, la perméabilité capillaire, la libération de fluides et la migration de neutrophiles et des monocytes/macrophages du sang vers le tissu (Yeretssian et al., 2008). La réponse inflammatoire aigüe induite par les infections microbiennes fait appel à des récepteurs appartenant à la super-famille des PRRs, un groupe hautement conservé et spécialisé dans la reconnaissance de motifs moléculaires invariants à travers les espèces. Ces récepteurs sont situés à la surface des macrophages résidents ou des mastocytes, et leur activation mène à la production de médiateurs inflammatoires (chémokines et cytokines). Ces médiateurs sont les messagers chimiques des cellules du système immunitaire qui agissent dans les processus inflammatoires. Les leucocytes libérés lors de la réponse inflammatoire sont activés et tentent d éliminer les agents invasifs via la libération de substances toxiques contenues dans leurs granules (par exemple les espèces réactives de l oxygène et de l azote, ROS et RNS respectivement). Ces effecteurs ne discriminant pas l agent pathogène des cellules de l hôte, des dommages collatéraux sont induits et compensés par une phase de réparation nommée résolution. Cette étape est hautement régulée et s accompagne d une transition de l état homéostatique. Les mécanismes régulateurs clés de ce processus sont le changement de production des médiateurs lipidiques. Les prostaglandines pro-inflammatoires sont remplacées par les lipoxines anti-inflammatoires. La résolution s accompagne d un changement de recrutement cellulaire, où les monocytes prennent la place des neutrophiles (Medzhitov, 2008). Lorsque les agents pathogènes échappent aux réponses immunitaires innées, le système immunitaire adaptatif prend le relai. La mort cellulaire agit continuellement dans la réponse inflammatoire afin de maintenir l homéostasie en éliminant les cellules indésirables. Quatre formes de mort cellulaire fonctionnellement et morphologiquement distinctes ont été décrites : apoptose et 18

20 pyroptose (exécutées par des caspases), autophagie et oncose/nécrose. Pour les trois premières, la mort cellulaire est programmée et réalisée par différents effecteurs, alors que pour la dernière, elle se déclenche dans le cas où la cellule ne peut plus faire face à l assaut (Yeretssian et al., 2008). En effet, l ultime solution pour une cellule qui ne parvient pas à éliminer le pathogène intracellulaire est la pyroptose. Elle consiste en l élimination de la cellule elle-même, mais également à l initiation de l inflammation, en alertant le corps de la présence de l agent infectieux (Di Virgilio, 2013). Ainsi, l échec de l élimination des pathogènes par le système mis en place laisse persister le processus inflammatoire qui acquiert de nouvelles caractéristiques permettant à des macrophages de s infiltrer. Un état inflammatoire chronique s installe alors. La réponse inflammatoire chronique est localisée dans le site où est présent l inducteur et résulte en différents types de remodelages tissulaires (par exemple, les voies respiratoires suite à un asthme, le ventricule gauche suite à un infarctus du myocarde, ou le tissu adipeux pendant l obésité) (Medzhitov, 2010). Les inducteurs de la réponse inflammatoire Les inducteurs de l inflammation sont des signaux qui initient la réponse inflammatoire en activant des senseurs spécifiques, provoquant ainsi la production de médiateurs particuliers. Ces médiateurs, qui sont les effecteurs de l inflammation, altèrent les états fonctionnels des tissus et organes dans le but de les faire s adapter aux nouvelles conditions. Les inducteurs peuvent être exogènes ou endogènes. Les inducteurs exogènes peuvent être d origine microbienne ou non. On retrouve deux classes d inducteurs d origine microbienne : les PAMPs et les facteurs de virulence. Ces derniers sont restreints aux pathogènes et ne sont pas détectés directement par des récepteurs dédiés comme le sont les PAMPs, mais par des senseurs spécifiques. Une voie alternative de la détection directe non spécifique d inducteurs existe via la détection de composants induits par la mort cellulaire et les lésions tissulaires. Dans ce cas, les inducteurs de la réponse inflammatoire sont des produits endogènes issus des cellules et tissus endommagés. Les inducteurs exogènes non microbiens incluent, entre autres, les allergènes, les irritants, les composés toxiques et les corps étrangers. Les corps étrangers sont des particules indigestes, qui sont trop larges pour être phagocytées ou qui causent des dommages aux membranes des macrophages. 19

21 Les inducteurs endogènes sont issus de la libération de cellules ou de molécules qui sont normalement stockées séparément des cellules ou tissus intacts (par exemple, un ligand et son récepteur ou une enzyme et son activateur ou son substrat). Cette séquestration fait appel aux membranes cellulaires, à la membrane basale, aux épithéliums de surface et aux endothéliums vasculaires. Une autre classe d inducteurs endogènes relève de conditions inflammatoires chroniques et concerne notamment les cristaux d acide urique et les lipoprotéines oxydées (Medzhitov, 2008). Les médiateurs de la réponse inflammatoire Les médiateurs de la réponse inflammatoire peuvent dériver de protéines plasmatiques ou être secrétés par les cellules. Certains peuvent circuler dans le plasma en tant que précurseurs inactifs et leur concentration peut augmenter lors d une phase aigüe de la réponse inflammatoire. Sept groupes de médiateurs peuvent être distingués en fonction de leur activité biochimique : des amines et des peptides vasoactifs, des fragments issus de composants du complément, des médiateurs lipidiques, des cytokines, des chémokines et des enzymes protéolytiques. Beaucoup de médiateurs ont un effet direct sur les tissus cibles, notamment par leurs effets sur le système vasculaire ou le recrutement de leucocytes, mais ils peuvent également eux-mêmes induire la production d autres médiateurs (Medzhitov, 2010). Un point clé régulé par des signaux anti-inflammatoires est la production de médiateurs inflammatoires. Le mot «cytokine» a été employé la première fois par Stanley Cohen en La notion d interleukine (IL) apparaît en 1979 : elle définit une protéine capable d agir comme signal de communication entre différentes populations de leucocytes. En 1989, les cytokines sont définies comme un groupe de protéines régulatrices de cellules, appelées lymphokines, monokines, interleukines et interférons et qui sont produites par une large variété de cellules dans le corps. Les cytokines sont identifiées comme jouant un rôle important dans plusieurs réponses physiologiques et impliquées dans la pathophysiologie de maladies, présentant ainsi un potentiel thérapeutique. On distingue plus de cinquante cytokines rangées dans plusieurs classes : les interleukines, les tumor necrosis factor (TNF), les interférons (IFN), les colonystimulating factor (CSF), les transforming growth factor (TGF) et les chémokines. Parmi les cytokines pro-inflammatoires, on trouve : TNF, IL-1, IL-12, IL-18, IFN-γ ; et parmi les 20

22 cytokines anti-inflammatoires, il y a IL-4, IL-10, IL-13 et TGF-β (Dinarello, 2010; Tedgui and Mallat, 2006). 21

23 L interleukine-1 L inflammation est la réponse la plus importante de l hôte vis-à-vis d agents menaçant l homéostasie interne. L arsenal qui peut être mobilisé est vaste et potentiellement très dangereux pour l hôte lui-même, c est pourquoi la phase d initiation de l inflammation doit être extrêmement contrôlée. L interleukine-1 (IL-1) est l un des médiateurs de l inflammation le plus puissant. Elle est responsable de fortes agressions dans le cadre d une inflammation systémique ou locale et contribue à de nombreuses maladies chroniques. Les processus inflammatoires liés à une production dérégulée d IL-1 sont impliqués dans la pathophysiologie de plusieurs maladies communes, comme l athérosclérose, l arthrose, les syndromes métaboliques et les diabètes de type 2 (T2DM ou type 2 diabete mellitus). L histoire de l IL-1 commence dans les années 1940 avec des études portant sur la nature des protéines endogènes produites par les leucocytes et causant de la fièvre. Ces études mèneront au clonage d IL-1α et IL-1β dans les années L analyse de leur acide désoxyribonucléique complémentaire (ADN complémentaire ou ADNc) révèle deux caractéristiques inhabituelles pour des cytokines. Premièrement, les deux protéines sont produites sous la forme de précurseurs ; et deuxièmement, l extrémité N-terminale d IL-1α et IL-1β ne possède pas de signal hydrophobe commun à la plupart des protéines secrétées, qui en permet l excrétion (Latz, 2010; Rubartelli, 2012). Aujourd hui, on dénombre onze membres de la famille des IL-1, dont IL-1β qui est la mieux caractérisée et considérée comme induisant les réponses physiologiques, hématologiques, métaboliques et immunologiques de l hôte suite à une infection, un traumatisme ou une activation immunologique (Dinarello, 2010). L IL-1β L IL-1β, ou IL-1F2, est une cytokine pro-inflammatoire essentielle, principalement produite par les cellules myéloïdes, qui joue un rôle important à tous les stades de l inflammation et de l immunité, de la diapédèse des leucocytes à la production de ROS, de la présentation de l antigène à la différenciation des lymphocytes T helper ou T auxiliaire 17 (Th17), de la phagocytose à la fièvre. L IL-1β régule le sommeil, l appétit mais également la température corporelle. 22

24 La maturation de l IL-1β Le gène codant pour l IL-1β n est pas exprimé constitutivement. En réponse aux agents inflammatoires endogènes ou exogènes, comme des ligands de Toll-like receptors (TLRs), l IL-1β est synthétisée en tant que pro-cytokine (pro-il-1β), d un poids moléculaire de 31 kda. La pro-il-1β est ensuite clivée par la caspase-1 en IL-1β mature de 17 kda, au sein d un complexe protéique nommé inflammasome (Guarda and So, 2010; Stehlik et al., 2003b). Le clivage de la pro-il-1β a lieu entre l acide aspartique 116 et l alanine 117 et donne lieu à la forme active correspondant au fragment C-terminal (Bauernfeind et al., 2011a). La pro-il-1β s accumule dans le cytosol (Rubartelli, 2012). Les processus responsables de sa maturation doivent être finement régulés mais également réactifs et donc disponibles afin de permettre une activation dès que cela est nécessaire (Rathinam et al., 2010). Deux niveaux d activation sont possibles : en augmentant la transcription de la proforme dépendante de NFκB et en clivant la proforme par la caspase-1 grâce à une maturation protéolytique (Naik and Dixit, 2010). De nombreuses études montrent que l IL-1β mature est absente des cellules et que la caspase-1 active est secrétée (Brough and Rothwell, 2007; Hornung et al., 2008; Luheshi et al., 2012; Yan et al., 2013). Le clivage et ainsi la maturation de l IL-1β semblent également avoir lieu à l extérieur des cellules et pourrait faire intervenir d autres protéases présentes dans l environnement extracellulaire inflammatoire. Il a été montré que d autres types de protéases que la caspase-1 peuvent cliver IL-1β, mais de manière minoritaire. C est le cas notamment des protéases à sérine des neutrophiles, comme la protéinase-3, l élastase de neutrophile ou la cathepsine G ; des protéases de mastocytes, telles que les chymases ; les protéases de cellules T cytotoxiques, dont les granzymes ; les protéases de diverses origines cellulaires, comme la trypsine ; les métalloprotéases matricielles (MMP), comme MMP-9 ; ou les protéases produites par les pathogènes eux-mêmes, dont Candida albicans ou Staphylococcus aureus (Wittmann et al., 2011). L excrétion de l IL-1β Le processus de l excrétion d IL-1β n est pas encore bien compris. En effet, l IL-1β ne comporte pas de séquence signal ciblant le système sécrétoire, et plusieurs voies de sécrétion ont été proposées : l exocytose de granules dérivés des lysosomes ; la libération d exosomes dérivés de corps multi-vésiculaires, et la libération de microparticules de la membrane 23

25 plasmique. Récemment, un nouveau mode de sécrétion peu conventionnel, basé sur l autophagie et associé à l inflammasome (auto-sécrétion), a été proposé dans la libération de protéines telles qu IL-1β. Ce processus est indépendant du réticulum endoplasmique et de l appareil de Golgi et fait appel à la fonction d auto-digestion des cellules par l autophagie, qui conduit à la libération du contenu cellulaire dans le milieu (Di Virgilio, 2013; Dupont et al., 2011). IL-1β et régulation de l inflammation L IL-1β participe à la plupart des événements impliqués dans l activation et la régulation de l inflammation (Naik and Dixit, 2010). Elle stimule notamment la libération d autres cytokines comme IL-6, TNF-α, IL-1α et IL-1β elle-même, ainsi que d autres facteurs importants responsables de la croissance et la différenciation des cellules immunitaires, comme granulocyte macrophage colony-stimulating factor et granulocyte colony-stimulating factor (GM-CSF et G-CSF). Elle favorise également la libération des cellules polymorphonucléaires dans le sang (neutrophiles), l activation des lymphocytes, la différenciation des lymphocytes Th17 et l activation des cellules dendritiques (Dangerfield et al., 2005; Kruse et al., 2001). IL-1β a également un rôle dans la sécrétion de vascular endothelial growth factor (VEGF) et la génération de ROS et RNS. Enfin, et de manière importante, cette cytokine intervient dans la progression de l inflammation et l expression de molécules d adhésion sur les cellules endothéliales vasculaires. Elle provoque ainsi l infiltration de cellules inflammatoires et immunocompétentes dans l espace extravasculaire (Bauernfeind et al., 2011a). L IL-1β est fondamentale pour l immunité innée et adaptative et participe à l activation et la différenciation des cellules T, B et natural killer (NK) et à la présentation de l antigène. C est une des premières cytokines à être secrétée pendant les phases initiales de l inflammation. Ce médiateur pro-inflammatoire est généré au niveau des sites de lésion et coordonne le recrutement de leucocytes, afin de neutraliser et phagocyter les pathogènes (Di Virgilio, 2013; Naik and Dixit, 2010; Schroder and Tschopp, 2010). D autres interleukines de la famille des IL-1 IL-1α L IL-1α ou IL-1F1, comme l IL-1β, a été identifiée en Par rapport à l IL-1β, peu de choses sont connues à propos de cette cytokine. Cependant, il a été montré que les 24

26 activateurs de l inflammasome activaient IL-1β et IL-1α, menant à une co-sécrétion des deux cytokines. En fonction de l activateur, la sécrétion d IL-1α est dépendante ou non de l inflammasome. En effet, les particules ou les inducteurs d influx de calcium, qui sont des activateurs de l inflammasome, provoquent également la sécrétion d IL-1α indépendamment de l inflammasome. Comme IL-1β, le précurseur d IL-1α subit un clivage protéolytique, qui fait appel à la caspase-1 (inflammasome) mais également à des protéases similaires aux calpaïnes (hors inflammasome). L IL-1α, contrairement à l IL-1β, est aussi active sous sa forme de précurseur et est présente dans les tissus sains. L IL-1α exploite la mort cellulaire pour être secrétée et exercer son activité pro-inflammatoire extracellulaire (Dinarello, 2010; Gross et al., 2012; Rubartelli, 2012). IL-18 L IL-18 (IL-1F4 ou anciennement IFN-γ-inducing factor) est une autre cytokine proinflammatoire appartenant à la famille IL-1, est activée par les inflammasomes et notamment la caspase-1. IL-18 a une structure similaire à IL-1β et est synthétisée sous forme de précurseur. Elle s exprime de manière constitutive dans les cellules saines et joue un rôle clé dans la stimulation des lymphocytes T et la libération d IFN-γ. Elle est impliquée dans la polarisation des lymphocytes Th1 et T cytotoxiques, dans la différenciation Th17, dans la production de cytokines Th2 par les cellules T, NK, les basophiles et les mastocytes (Bauernfeind et al., 2011a; Di Virgilio, 2013; Naik and Dixit, 2010). IL-33 L IL-33, également appelée IL-1F11, est la cytokine la plus récemment ajoutée à la famille des IL-1. Il s agit d une cytokine intracellulaire constitutive, qui est inactivée par son clivage. Ce dernier est réalisé par des protéases de type cathepsine G et élastase (Lefrancais et al., 2012) et indépendamment de la caspase-1 (Talabot-Ayer et al., 2009). IL-33 est localisée dans le noyau où elle fonctionne comme un facteur de transcription. Elle a un rôle dans la réponse Th2 (Bauernfeind et al., 2011a; Dinarello, 2010). IL-37 IL-37 ou IL-1F7 est la seule cytokine anti-inflammatoire de la famille des IL-1. Sa structure est semblable à celle d IL-18 et elle se lie au même récepteur qu IL-18. On ne sait 25

27 pas si son activité est due à un clivage par la caspase-1 ou si elle est active sous forme de précurseur (Bauernfeind et al., 2011a; Dinarello, 2010). 26

28 Les PRRs Le système immunitaire est un système sophistiqué qui sonde l environnement intraet extracellulaire pour la détection directe (microorganisme lui-même) ou indirecte (via une lésion) d un pathogène. La super-famille des PRRs détecte les motifs invariants microbiens. Les PRRs sont exprimés par les cellules pour lutter contre les infections et sont présents dans les cellules immunitaires classiques et les cellules non immunitaires. On les retrouve ainsi dans les macrophages, les monocytes, les cellules dendritiques, les neutrophiles, les cellules épithéliales et les cellules du système immunitaire adaptatif. L activation des PRRs mène à l activation de facteurs de transcription, tels que NF-κB, et à la production de cytokines et de chémokines inflammatoires. Les PRRs comprennent au moins quatre familles de récepteurs : les C-type lectin receptors (CLRs), les retinoic acid-inducible gene I (RIG-I) like receptors (RLRs), les TLRs et les nucleotide binding oligomerization domain ou NOD-like receptors (NLRs) (Rietdijk et al., 2008). Tous ces senseurs agissent ensemble pour détecter les microorganismes et signaler ou annuler la réponse induite. Les TLRs sont spécifiques à la reconnaissance des pathogènes et microorganismes dans l espace péri- et extracellulaire. Cependant, les microorganismes peuvent pénétrer et se multiplier dans le cytoplasme des cellules eucaryotes, menant à une évolution des senseurs vers la détection de pathogènes cytoplasmiques comme c est le cas des NLRs (Bauernfeind et al., 2011a; Schroder and Tschopp, 2010). Il existe trois classes de PRRs : secrétés, transmembranaires et cytosoliques. Parmi les PRRs secrétés, on trouve les collectines, les ficolines et les pentraxines, qui lient les microbes et activent le complément. Les PRRs transmembranaires sont les TLRs et les CLRs, alors que les PRRs cytosoliques sont les RLRs et les NLRs. Les TLRs ont été découverts en premier et sont les plus étudiés. Ces récepteurs se situent à la surface des cellules et des compartiments endosomaux et sont sensibles à plusieurs PAMPs et DAMPs de différentes natures physiologiques, comme les peptides, les lipopeptides, les glycopeptides, les glycolipides et les acides nucléiques. TLRs et NLRs coopèrent pour reconnaitre et répondre aux pathogènes et activer les mécanismes pro- et anti-inflammatoires. Les CLRs reconnaissent des polysaccharides et des glycopeptides spécifiques. Les RLRs et les NLRs sont des protéines cytosoliques qui sondent les molécules intracellulaires microbiennes et les signaux de danger contrairement aux CLRs et aux TLRs (Chen et al., 2011; Schroder and Tschopp, 2010). 27

29 Les NLRs Structure et fonction des récepteurs NLRs Les protéines NLRs sont une famille de récepteurs situés dans le cytosol, qui détectent des motifs moléculaires de pathogènes, les PAMPs, ainsi que des ligands intracellulaires. Les protéines NLRs contiennent des motifs protéiques nommés «death fold» (DF), qui peuvent être soit un domaine caspase recruitment domain (CARD), soit un domaine pyrine (PY ou PYD). Les DF forment des multi-mères avec d autres membres de la même famille. Le domaine CARD est un domaine de recrutement de protéases nommées caspases et permet leur régulation. Les NLRs les mieux caractérisés sont NOD1, NOD2, NLR family containing a CARD domain 4 (NLRC4) et NLR family pyrin domain containing 3 (NLRP3) (Rietdijk et al., 2008). Les récepteurs NLRs sont composés de trois domaines. En C-terminal se situe un domaine de liaison aux pathogènes et d auto-inhibition : leucine rich repeats (LRR). Ce domaine présente une répétition de structures communes de vingt à trente acides aminés avec une séquence caractéristique riche en leucine, qui est un acide aminé hydrophobe. Au centre se trouve un domaine NACHT (NAIP (NLR family-apoptosis inhibitory protein), CIITA (class II transactivator ou transactivateur de classe II), HEP-E, TPI-1) également appelé NOD ou NBD (nucleotide binding domain ou NB), responsable de l oligomérisation après activation en présence d ATP. Ce domaine présente des similarités avec le domaine central NB-ARC de l apoptosome APAF1 (apoptotic protease-activating factor 1). En N-terminal, les domaines sont variables en fonction de la sous-famille à laquelle ils appartiennent et sont responsables de la fonction effectrice des NLRs. Il est à noter que la liaison entre le domaine LRR et le domaine central est indispensable pour la fonction (Bauernfeind et al., 2011a; Schroder and Tschopp, 2010). Les NLRs, grâce au domaine central NOD, appartiennent également à un sous-groupe de protéines capables de lier et d hydrolyser l ATP, les protéines signal transduction ATPases with numerous domains (STAND). Ces protéines sont des membres de la super-famille des ATPases. Les protéines STAND sont régulées via la liaison aux nucléotides : la forme latente est liée à l ADP (adénosine diphosphate) et la forme activée est liée à l ATP. La liaison aux PAMPs/MAMPs ou DAMPs provoque un changement conformationnel, qui échange l ADP par l ATP dans le domaine NOD. L hydrolyse de l ATP peut permuter la protéine STAND au 28

30 stade latent. Chez les plantes, les protéines NLRs s homodimérisent alors que chez les mammifères, elles recrutent d autres protéines pour former des plateformes protéiques multimériques. L oligomérisation se produit via l association des domaines N-terminaux (CARD ou PYD chez les mammifères) (Stehlik et al., 2003b). Ce mécanisme semble crucial notamment pour le contrôle de l activité des NLRs participant aux inflammasomes. Les NLRs suivent un cycle lent alternant entre les états activés et inactivés, ce qui permet au système de répondre rapidement aux stimuli (Di Virgilio, 2013; Latz, 2010; Naik and Dixit, 2010). La conservation des protéines NLRs dans le monde vivant Globalement, les NLRs sont des récepteurs très conservés des plantes aux mammifères. Chez les plantes, les pathogènes sont détectés par des récepteurs de surface, qui induisent l immunité provoquée par des motifs. Un deuxième type d immunité est activée par des protéines de résistance (les protéines R) situées dans le cytoplasme. Les protéines R appartiennent à la famille des récepteurs intracellulaires portant un site de liaison nucléotidique (NB) et un LRR : les récepteurs NB-LRR, similaires aux NLRs des mammifères. Cette famille se compose de deux groupes en fonction du domaine N-terminal : les TIR-NB-LRR (TNL) contiennent un domaine Toll Il-1 receptor (TIR) et les CC-NB-LRR (CNL) contiennent un domaine coiled-coil (CC). Comme chez les mammifères, le cœur NB- LRR subit un changement conformationnel suite à son activation et oligomérisation, ce qui active les réponses de défense. L hôte reconnait une protéine cible qui est modifiée par des molécules effectrices libérées par le pathogène. Les réponses de défense provoquées par TNL ou CNL mènent à une voie finale commune donnant lieu à la synthèse de l hormone de défense acide salicylique et d autres facteurs de défense comme l acide jasmonique, l éthylène ou le NO (Di Virgilio, 2013). Chez les invertébrés, les deux organismes les plus étudiés (Drosophila melanogaster et Caenorhabditis elegans) ne possèdent pas de gène codant pour les NLRs. Cependant, grâce à d autres invertébrés, beaucoup de NLRs de structures analogues à celles des vertébrés ont été découverts. Il semblerait qu une interaction entre les NLRs avec un domaine DF ou un domaine CARD se produise pour former un complexe moléculaire apparenté aux inflammasomes des mammifères. Les NLRs des invertébrés n ont pas fait l objet de nombreuses études et restent aujourd hui très peu connus (Lange et al., 2011). 29

31 Chez les mammifères, les protéines NLRs ont été étudiées chez l Homme et chez la souris. On en dénombre 22 pour l humain et 34 pour la souris. Elles se répartissent en cinq sous-familles en fonction du domaine N-terminal (Figure 1). Figure 1 : Membres de la famille des protéines NLRs humaines. Les protéines de la famille des NLRs humaines sont classées en cinq sous-familles selon leur domaine N-terminal. Les NLRA contiennent un domaine acidique, composé du motif CARD et d un domaine de transactivation. Cette famille ne contient qu un membre qui est CIITA. Les NLRB, également appelés NAIP, contiennent un domaine baculovirus inhibitor of apoptosis protein repeat (BIR). Un seul membre est connu pour les humains et sept ont été identifiés chez la souris. Les NLRC contiennent au moins un domaine CARD. Cinq membres en font partie NLRC1 ou NOD1, NLRC2 ou NOD2, NLRC3, NLRC4 et NLRC5 ; et possèdent tous un domaine CARD sauf NOD2 qui en contient deux. Les NLRP contiennent un domaine PYD et 14 membres sont identifiés chez l humain et 20 chez la souris. Les NLRX contiennent un domaine qui présente une faible homologie de sa partie N-terminale avec les autres sous-familles NLRs. Un membre compose ce groupe : NLRX1. La légende concernant la représentation des domaines, ainsi que leur signification, est présentée à droite de la figure. D après Bauernfeind et al. (2011a). 30

32 Les inflammasomes Les complexes multi-protéiques de haut poids moléculaires activant la caspase-1 ont été nommés «inflammasomes» (Bauernfeind et al., 2011a). Ils ont un rôle central dans la pathogenèse de presque tous les types d inflammation chronique, dans les maladies métaboliques et les cancers, et participent à la prolifération, la régulation du métabolisme glycolytique et l activation cellulaire (Paragraphe «Inflammasome et pathologies»). L activation de l inflammasome par les PAMPs/MAMPs ou les DAMPs se fait directement grâce à une liaison entre le complexe et le signal, ou de manière indirecte par la génération de signaux intracellulaires, telle que la chute du potassium (K+) intracellulaire. Les inflammasomes présentent de nombreuses similarités avec l apoptosome. En effet, l apoptosome est activé par le cytochrome c libéré par la mitochondrie et s agrège pour former une structure supramoléculaire. Les inflammasomes s agrègent également et donnent lieu à des complexes penta-/heptamériques en forme de roue de 500 à 700 kda. De plus, comme l apoptosome, les inflammasomes ont pour but final d activer les caspases. Huit types d inflammasomes différents ont été identifiés, partageant les mêmes caractéristiques qui sont de contenir la protéine apoptosis-associated speck-like protein containing a caspase recruitment domain (ASC) et d activer et cliver la pro-caspase-1 (Figure 2) (Di Virgilio, 2013). 31

33 Figure 2 : Assemblage des inflammasomes NLRs. L assemblage des protéines NLRs, ASC et caspase-1 mène à la formation de structures penta- ou heptamériques, l inflammasome. L activation de l inflammasome conduit à la maturation et à la sécrétion d IL-1β et d IL-18, ainsi qu à la mort cellulaire inflammatoire par pyroptose. D après Davis et al. (2011). La protéine Caspase-1 Les caspases appartiennent à une famille d enzymes, les protéases à cystéine, dont le site actif est caractérisé par une cystéine (cys285), et qui existent sous forme inactive (appelée proforme ou zymogène), les pro-caspases. Douze caspases ont été décrites chez l Homme, réparties en deux sous-familles en fonction de leur rôle dans l apoptose (caspases-2, -3, -6, -7, -8, -9 et -10) ou dans la maturation de cytokines. Cette dernière sous-classe, impliquée dans les réponses pro-inflammatoires, est composée des caspases-1, -4, -5 et -12 chez l Homme et des caspases-11 et -12 chez la souris (Bauernfeind et al., 2011a). La caspase-1, celle qui est la mieux caractérisée, est universelle pour tous les inflammasomes et a été isolée et identifiée en 1992 (Yeretssian et al., 2008). Le nom d origine de la caspase-1 était ICE (IL-1-converting enzyme ou enzyme transformant IL-1) en raison de son activité dans la conversion et la maturation de la pro-il-1β en IL-1β ; elle est considérée comme la fondatrice de la famille des caspases. Le mécanisme impliqué dans son activation n a été élucidé qu en 2002 par l équipe de Tschopp, qui a découvert une plateforme moléculaire provoquant sa maturation, 32

34 appelée inflammasome (Laliberte et al., 1999; Martinon et al., 2002; Rubartelli, 2012). La caspase-1 est présente dans le cytoplasme sous une forme inactive, la pro-caspase-1, de 45 kda, qui est clivée et ainsi activée en caspase-1. La forme active est un tétramère de sousunités de 10 et 20 kda issues du clivage. La pro-caspase-1 est recrutée au sein du complexe inflammasome via une interaction avec le domaine CARD des protéines le composant. Dans le complexe inflammasome, la pro-caspase-1 va subir une auto-protéolyse (Naik and Dixit, 2010; Schroder and Tschopp, 2010). La caspase-1 clive ses substrats après un résidu acide aspartique et reconnait spécifiquement le motif : Trp-Glu-His-Asp (Tryptophane-Acide glutamique-histidine-acide aspartique) (Martinon et al., 2002). D autres substrats de la caspase-1 ont été identifiés, comme IL-1F7 (ou IL-37) (Bauernfeind et al., 2011a). Les fonctions de la caspase-1 ne sont pas restreintes à la maturation de cytokines, mais également au contrôle d un type non conventionnel de mort cellulaire programmée : la pyroptose (Denes et al., 2012; Di Virgilio, 2013; Gross et al., 2011). L activation non canonique des caspases inflammatoires La caspase-11 murine est une caspase inflammatoire impliquée dans la pyroptose. Il a été récemment montré que cette caspase est activée au sein de l inflammasome NLRP3 et provoque la sécrétion d IL-1β. Il existe une activité coordonnée entre la caspase-1 et la caspase-11 afin d éliminer les infections bactériennes et de limiter les dommages inflammatoires à l hôte (Kayagaki et al., 2011). Chez l Homme, les orthologues de la caspase- 11 sont la caspase-4 et la caspase-5, mais ce mécanisme n a pas été mis en évidence. Une autre caspase a été impliquée dans ce type d activation non canonique. En effet, la caspase-8 clive et active l IL-1β pendant les réponses immunitaires. La caspase-8 semble former un complexe inflammasome non canonique, avec la protéine ASC notamment, et ne nécessite pas de récepteur cytosolique (Gringhuis et al., 2012; Latz et al., 2013). La protéine ASC Les protéines ASC sont des petites protéines de 22 kda constituées de 179 à 195 acides aminés selon l isoforme. Comme leur nom l indique, elles forment de petits agrégats cytoplasmiques associés à l apoptose, contiennent un domaine de recrutement de la caspase, et peuvent provoquer l apoptose si elles sont sur-exprimées dans des lignées cellulaires tumorales. La protéine ASC est un adaptateur essentiel et était auparavant nommée CARD5, 33

35 PYCARD ou TMS1. Elle a un rôle central dans l activation de tous les inflammasomes et un rôle stimulateur mais non nécessaire pour l inflammasome NLRC4. ASC est impliquée dans la sécrétion d IL-1β, d IL-18 et d IFN-γ induit par IL-18, mais pas de TNF-α et d IL-6. ASC contient un domaine PYD et un domaine CARD, à l extrémité N-terminale à l extrémité C- terminale respectivement (Figures 2 et 3) (Hoffman et al., 2001). Le domaine PYD régule son auto-association et les interactions avec la protéine NLRP3 ou la protéine de modulation POP1 (pyrin-only protein 1). En effet, ce domaine comporte deux sites de liaison distincts importants, permettant ces activités (Vajjhala et al., 2012). Le domaine CARD régule les protéases de la famille des caspases et c est via ce domaine et une interaction CARD-CARD qu ASC se lie à la pro-caspase-1 et à des protéines de type inflammasome activant la caspase- 1, comme NLRC4. Il a été montré in vitro que la protéine ASC totale, ou simplement son domaine CARD, est responsable de son activité. En fonction de sa concentration, ASC module l activation de la pro-caspase-1 et la sécrétion d IL-1β. En effet in vitro, à de faibles concentrations, il se produit un effet activateur ; alors qu à plus fortes concentrations, on observe un effet inhibiteur. Cependant, les taux endogènes d ASC ne sont pas suffisamment importants pour supprimer l activation de la caspase-1 (Stehlik et al., 2003b). Des stimuli proinflammatoires, tels que le lipopolysaccharide (LPS) et le TNF-α, augmentent l expression de l acide ribonucléique messager (ARN messager ou ARNm) et de la protéine ASC dans les cellules monocytaires. Dans des macrophages au repos, ASC est séquestrée dans le noyau et est libérée dans le cytoplasme seulement après activation des macrophages. Dans le cytosol, ASC forme des agrégats péri-nucléaires contenant la caspase-1. NLRP3 colocalise avec ces agrégats, qui sont nécessaires à la maturation de l IL-1β (Komune et al., 2011; Stehlik et al., 2003b). L inflammasome AIM2 L inflammasome absent in melanoma 2 (AIM2) est le premier et le mieux caractérisé des inflammasomes non NLRs. Il appartient aux protéines de la famille PYHIN-200, caractérisée par un domaine pyrine (PY) et un domaine HIN et nommée ainsi grâce à la présence d un motif de 200 acides aminés. La protéine AIM2 porte à l extrémité N-terminale le domaine PY et le domaine HIN200 en C-terminal et recrute et active la caspase-1 via ASC (Figure 3). L activation de cet inflammasome a lieu après une stimulation par IFN-γ ou par des ADNs double brin qui se lient à HIN200. La liaison provoque la formation d un complexe avec le recrutement d ASC et de la caspase-1 par AIM2. AIM2 détecte les ADNs bactériens 34

36 et viraux dans le cytosol, comme le cytomégalovirus murin (Komune et al., 2011). Cet inflammasome est également responsable de l immunité contre des pathogènes intracellulaires localisés dans le cytoplasme comme Francisella tularensis (Rathinam et al., 2010). AIM2 semble provoquer la mort cellulaire dans le cas d infections afin de restreindre la croissance bactérienne et collabore avec NLRP3 pour détecter Listeria monocytogenes (Kim et al., 2010). L inflammasome NLRC4 L inflammasome NLRC4 ou ICE-protease activating factor (IPAF) ou CARD12 est composé de la protéine NLRC4 et caspase-1. La protéine NLRC4 possède un domaine CARD en N-terminal permettant l interaction directe avec la caspase-1 (Figure 3). L activateur de l inflammasome NLRC4 le plus connu est la flagelline bactérienne cytosolique et des composants cytoplasmiques endogènes semblent s y lier et l activer (Bauernfeind et al., 2011a). Il est à noter que la flagelline bactérienne extracellulaire active TLR5 (Latz, 2010). Des bactéries ne présentant pas de flagelline activent également l inflammasome NLRC4, qui est activé par le corps basal de la tige composant le système de sécrétion de type 3 (TTSS) (Rathinam et al., 2010). Il joue un rôle clé dans les réponses de protection contre Salmonella, Shigella, Pseudomonas and Legionella. Les protéines de la famille des NAIPs semblent jouer un rôle et confèrent une spécificité effectrice à l inflammasome NLRC4. Bien que non nécessaire dans cet inflammasome, la protéine ASC semble optimiser la production d IL-1β et d IL-18, mais pas la pyroptose. Il a été montré que l efflux de K+ intervient dans le mécanisme d activation de l inflammasome NLRC4 (Di Virgilio, 2013; Latz, 2010). L inflammasome NLRP1 Bien qu étant le premier des inflammasomes composés par les NLRs à avoir été identifié, NLRP1 est curieusement le moins étudié. Il est constitué de la protéine NLRP1 contenant les domaines, de l extrêmité C-terminale à N-terminale, CARD, function to find domain (FIIND), LRR, NACHT et PYD (Figure 3). Il est exprimé dans les cellules immunitaires et non immunitaires et s associe aux caspases-1 et -5 pour procéder à la maturation de l IL-1β et l IL-18. L interaction entre NLRP1 et les caspases s effectue spontanément via le domaine CARD, toutefois l intégration d ASC dans le milieu réactionnel favorise son activité (Faustin et al., 2007). Son domaine NACHT possède une activité 35

37 nucléoside triphosphatase hydrolysant tous les nucléotides triphosphates (NTPs) (Faustin et al., 2007). Il permet également une oligomérisation ATP-dépendante et ainsi l activation de l inflammasome. Le domaine LRR, que les NLRPs partagent avec les TLRs, est responsable de la détection des PAMPs/MAMPs/DAMPs et de son auto-inhibition (Lopez-Castejon and Pelegrin, 2012). Le NLRP1 est associé à l activation de la pyroptose et l activation des caspases-2 et -9 dans l apoptosome. NLRP1 peut être activé spécifiquement par la toxine létale de Bacillus anthracis (anthrax ou LT) et peut également être activé par le muramyl-dipeptide (MDP) (Bauernfeind et al., 2011a; Latz, 2010; Martinon et al., 2004). Le mécanisme d activation est indirect, impliquant l efflux de K+ ou la libération de cathepsine B dans le cytoplasme. La voie purinergique semble également impliquée. En effet, il a été montré que LT provoque la libération d ATP qui stimule alors le récepteur P2X7 (P2X7R) (Di Virgilio, 2013). L inflammasome NLRP3 NLRP3 se nomme également cryopyrine, PYrin-containing apaf-1-like protein 1 (PYPAF1), CIAS1, NALP3 ou CATERPILLAR 1.1 (CLR1.1). La découverte de mutations du gène codant pour cette protéine, responsables de la pathogenèse de trois syndromes autoinflammatoires rares, a mis en avant le rôle de l inflammasome NLRP3. La protéine NLRP3, d environ 110 kda, est codée à partir du gène Cias situé sur le chromosome 1q44. Elle est constituée de 1036 acides aminés avec un domaine PYD de la position 1 à 93 en N-terminal ; un domaine central NACHT de la position 220 à 536 avec le domaine potentiel de liaison à l ATP de 226 à 233 ; et neuf LRRs de la position 742 à 991 en C-terminal (Figure 3) (Bauernfeind et al., 2011a; Hoffman et al., 2001). L inflammasome NLRP3 est celui qui réagit à la plus grande diversité d agents chimiques et biologiques, comme les toxines formant des pores, les bactéries, les virus et les molécules endogènes (Rubartelli, 2012). Il est le plus étudié et le mieux caractérisé et provoque la maturation et la sécrétion d IL-1β et IL-18. Ne possédant pas de séquence CARD, il a besoin de la protéine adaptatrice ASC pour recruter la caspase-1. CARD8 faciliterait son assemblage (Bauernfeind et al., 2011a; Latz, 2010; Manji et al., 2002). Après activation des macrophages humains par des pathogènes, ASC est relocalisé du noyau au cytosol pour former des agrégats péri-nucléaires annulaires, dont la taille est de 4 à 6 µm, contenant les protéines ASC et NLRP3. Il a été montré qu après l infection, ASC relocalise dans le cytosol où il s assemble avec la caspase-1 pour former des 36

38 corps denses de 1 à 2 µm de diamètre dans lesquels la caspase-1 est activée. Un corps par cellule semble être formé (Di Virgilio, 2013). Chez les souris, NLRP3 est principalement exprimé dans les organes lymphoïdes et les organes contenant une population cellulaire importante en cellules immunitaires, notamment la rate, les poumons, le foie et les ganglions lymphatiques. Les neutrophiles de rate, les macrophages et en particulier les monocytes et les cellules dendritiques conventionnelles expriment fortement NLRP3 chez les souris, alors que les cellules lymphoïdes, les éosinophiles et les cellules dendritiques plasmacytoïdes présentent des taux plus modérés voire négligeables (Guarda et al., 2011). De plus, les cellules mononucléaires de sang périphérique (PBMCs : peripheral blood mononuclear cells) et les cellules dendritiques dérivées de la moelle osseuse expriment fortement NLRP3 chez les souris, alors que les macrophages dérivés de la moelle osseuse (BMDMs : bone marrow-derived macrophages) et les cellules Th2 l expriment modérément. Si les BMDMs sont stimulés via leurs récepteurs TLRs ou leurs récepteurs à TNF, ils sur-expriment NLRP3 grâce à l activation de NF-κB. Les ostéoblastes humains et de souris expriment également NLRP3. Les PBMCs humains, la lignée monocytaire humaine THP-1, les kératinocytes primaires humains, la lignée kératinocytaire humaine HaCaT, les mastocytes primaires, les granulocytes et les cellules B expriment toutes NLRP3. Chez l Homme, NLRP3 est présent dans les couches urothéliales de la vessie et des cellules épithéliales le long des voies orales et génitales et dans les kératinocytes (Chen et al., 2011; Manji et al., 2002). Parmi les différents PAMPs/MAMPs/DAMPs activant NLRP3, on trouve : LPS, MDP, PGN (peptidoglycane), les ARNs bactériens et viraux, l ADN viral, les composés imidazoquinoline mimant l ARN ou l ADN simple brin (comme R837), l ATP, la toxine maitotoxine, le monosodium urate (MSU ou cristaux d acide urique), le calcium pyrophosphate dihydrate (CPPD), le peptide amyloïde-β (marqueur d Alzheimer), les cristaux de cholestérol, le hyaluronane glucosaminoglycane, l alun (adjuvant le plus fréquent dans les vaccins humains), l amiante, la silice, des nanoparticules métalliques ou non (comme des nanoparticules de polyester, d oxyde de titane, de carbone, de polystyrène, d or et d argent) et des irritants de la peau. Des agents physiques stimulent également l inflammasome NLRP3 comme les ultraviolets (UV). Les pathogènes sont les agents activateurs de l inflammasome NLRP3 les mieux caractérisés. NLRP3 peut détecter les PAMPs/MAMPs libérés par de nombreuses bactéries (comme Listeria monocytogenes et Staphylococcus aureus), des virus 37

39 (comme le virus de la rougeole ou de la grippe) et des levures (comme Candida albicans et Saccharomyces cerevisiae). Les toxines bactériennes, telles que la nigéricine, peuvent également le stimuler (Di Virgilio, 2013; Dostert et al., 2008; Hornung et al., 2008; Komune et al., 2011; Latz, 2010; Mariathasan et al., 2006; Martinon et al., 2004; Meunier et al., 2012; Pan et al., 2007; Rajamaki et al., 2010; Rietdijk et al., 2008; Riteau et al., 2012; Schroder and Tschopp, 2010). L activation de l inflammasome requiert deux étapes : l amorçage, consistant en la production de pro-il-1β ; et l activation à proprement parler de NLRP3. Certains stimuli sont responsables de l amorçage de NLRP3 via la stimulation des PRRs, comme la stimulation des TLRs par LPS, ou de récepteurs de cytokines pro-inflammatoires, comme TNF-α, conduisant à la sur-expression de NLRP3. Cela induit également l expression de pro-il-1β via l activation du facteur de transcription NF-κB. L activité de l inflammasome et la disponibilité en pro-il-1β sont régulées par cette étape d amorçage, sans laquelle la sécrétion d IL-1β est minimale. D autres stimuli sont responsables de l activation à proprement parler de NLRP3. Trois voies sont décrites : l efflux de K+, la dégradation lysosomale et la production de ROS. L amorçage de NLRP3 implique qu un premier signal indiquant la présence d une infection ou la présence d autres cellules stimulées est nécessaire pour les macrophages. Un des facteurs limitant de l activation de NLRP3 est son niveau d expression (Bauernfeind et al., 2011a; Hornung and Latz, 2010; Latz, 2010; Schroder and Tschopp, 2010). La capacité de NLRP3 à réagir à cette large gamme de ligands suggère la présence d un signal d activation commun. Les hypothèses tendent vers l ATP extracellulaire, qui réagit avec P2X7R et donne lieu à l activation de la caspase-1 et la maturation et la sécrétion de l IL-1β et l IL-18. Ce pore s ouvre alors et provoque un efflux rapide et important de K+, ce qui modifie la force ionique cytoplasmique et provoque des changements conformationnels de NLRP3 menant à l assemblage de l inflammasome. La libération de K+ est un intermédiaire nécessaire à cette activation. 38

40 Figure 3 : Les différents types d inflammasomes. Les inflammasomes sont classés en fonction de leurs composants structuraux. Des exemples de facteurs les activant sont présentés dans les encarts bleus. Pour l inflammasome NLRC4, la phosphorylation (indiquée dans l étoile rouge) est également un facteur d activation possible. La légende des différents domaines exposés se situe dans l encart en bas à droite. D après Di Virgilio (2013). L inflammasome NLRP6 L inflammasome NLRP6 (Figure 3) est impliqué dans l homéostasie hôte-flore microbienne de l appareil digestif. Sa localisation dans l épithélium intestinal confère à NLRP6 un rôle protecteur en préservant la composition saine de la flore intestinale d un côté, mais également un rôle délétère en aggravant les infections bactériennes d un autre côté. En effet, son activité inhibitrice de la sécrétion d IL-1β et d IL-18 peut être bénéfique dans l appareil intestinal en empêchant une sur-activation du système immunitaire en présence de la flore symbiotique (Elinav et al., 2011). Cette activité peut être néfaste dans le cadre de la lutte contre les infections systémiques, quand l inflammation serait protectrice pour l hôte (Anand et al., 2012). L activation spatio-temporelle de l inflammasome NLRP6 est donc cruciale (Ng et al., 2013). 39

41 L inflammasome NLRP7 L inflammasome NLRP7 est responsable de la production d IL-1β et d IL-18 suite à une stimulation par des lipopeptides microbiens (Figure 3). Ce complexe moléculaire est composé de la protéine NLRP7, l adaptateur ASC et la caspase-1. Son mécanisme d action ne semble pas impliquer la production de ROS, mais la voie de la cathepsine B et l efflux de K+ (Ng et al., 2013). L inflammasome NLRP12 L inflammasome NLRP12 (Figure 3) participe à la reconnaissance de la bactérie Yersinia pestis et favorise la sécrétion d IL-1β, d IL-18 et d IFN-γ par les lymphocytes activés. Il est également associé à l inhibition de NF-κB. La protéine NLRP12 interagit avec ASC pour former l inflammasome et semble être un facteur clé dans la régulation de la réponse immunitaire (Ng et al., 2013). L inflammasome PYRIN L inflammasome PYRIN est responsable de la production d IL-1β. PYRIN comporte un domaine PYD à l extrémité N-terminale, qui peut recruter ASC et ainsi former un complexe avec la caspase-1 (Figure 3) (Di Virgilio, 2013). Les mécanismes de régulation de l inflammasome Disponibilité des composants de l inflammasome Bien que chaque inflammasome soit activé par des agents spécifiques, tous les inflammasomes partagent un signal intracellulaire commun, qui provoque leur assemblage et leur activation. Un premier niveau de contrôle est exercé par la limitation de la disponibilité des composants de l inflammasome dans les cellules au repos. Alors que ASC et la procaspase-1 sont disponibles même en cas d absence de stimulus inflammatoire, NLRP3 est exprimé normalement à des taux très faibles, sauf si les TLRs sont activés ou des PAMPs/MAMPs ou DAMPs sont détectés par la cellule (Bryan et al., 2009; Wang et al., 2013b). Cependant, il est à noter que, dans les cellules immunitaires quiescentes, l inflammasome conserve une activité basale donnant lieu à l auto-catalyse de la caspase-1. 40

42 Cette activité basale stable permet une réponse plus rapide aux pathogènes ou aux DAMPs endogènes et une régulation fine de l activité de l inflammasome (Figure 4) (Netea et al., 2009). 41

43 Figure 4 : Mécanisme d activation de l inflammasome NLRP3. L expression d IL-1β et de NLRP3 est un facteur déterminant dans le mécanisme d activation. Leur transcription est induite par les voies de signalisation des TLRs. Divers stimuli peuvent activer NLRP3, qui est supposé présent dans un état autoinhibé. L activation de NLRP3 provoque la formation d agrégats multi-protéiques avec la protéine ASC et le recrutement de la caspase-1. Une auto-catalyse a alors lieu et mène à l activation de la caspase-1 qui, à son tour, clive la pro-il-1β et permet sa maturation en une forme active, qui est secrétée. Un mécanisme commun probable en aval ou un médiateur de signalisation qui intègre les divers signaux activateurs de NLRP3 semble exister, mais n a pas été identifié. Plusieurs modèles, dont notamment la production de ROS ou la libération de calcium (Ca2+), ont été proposés. En contraste de cette voie d activation canonique, des stimuli non canoniques, tels que les bactéries Gram négatives vivantes, requièrent également la caspase-11 pour une activation totale de la caspase-1. L activité de la caspase-11 est régulée de manière transcriptionnelle par IFN-I, dont la voie de signalisation est simultanément engagée par les composés bactériens via l activation de TLRs. Le mécanisme moléculaire liant la caspase-11 à la caspase-1 n a pas été entièrement identifié. D après Bauernfeind and Hornung (2013). Interactions moléculaires avec une protéine NLR L interaction directe des PAMPs/MAMPs ou DAMPs avec des inflammasomes a été montrée pour la protéine thioredoxin-interacting protein (TXNIP), la protéine kinase R (PKR), la kinase dépendante aux ARNs double brin cytoplasmiques et les ADNs double brin (Di Virgilio, 2013; Zhou et al., 2010). L inflammasome NLRP3, quant à lui, se lie directement à certains de ses ligands, comme le PGN ou le MDP via le domaine LRR 42

44 (Martinon et al., 2004). D autres inflammasomes que NLRP3 se lient directement à leur ligand grâce à ce domaine. C est le cas de NLRP1, NAIP et AIM2 qui se lient à MDP, la flagelline et les ADNs double brin, respectivement (Petrilli et al., 2007). Certains activateurs provoquent une protéolyse de l inflammasome, c est le cas de la métalloprotéase LT de B. anthracis, qui semble cliver NLRP1 à son extrémité N-terminale et ainsi activer l inflammasome NLRP1. Ce couple ligand/inflammasome est le seul identifié faisant appel à ce mécanisme d action (Di Virgilio, 2013). Un des DAMPs les plus étudiés est l amphotérine également connue sous le nom de protéine high-mobility group box 1 (HMGB1). HMGB1 est une alarmine, c est-à-dire une molécule libérée par les tissus ou cellules lésés et capables de produire une réaction proinflammatoire locale. C est une protéine chaperonne qui se lie à l ADN et est localisée dans le noyau de la cellule. Elle est impliquée dans la différenciation et la migration cellulaire et joue un rôle dans la septicémie. HMGB1 est libérée par les macrophages stimulés par le LPS, TNF-α, l IL-1β, les ARNs double brin ou un agent mimétique via une voie inflammasomedépendante (Vande Walle et al., 2011). Cette protéine active une kinase intracellulaire, PKR, qui est également activée par d autres DAMPs comme ATP, MSU, les adjuvants, la roténone, la toxine LT et Escherichia coli. PKR subit une auto-phosphorylation, active l inflammasome et provoque la sécrétion d IL-1β et d IL-18. PKR interagit physiquement avec les protéines NLRP1, NLRP3, NLRC4 et AIM2 (Lu et al., 2012). Le rôle des composants libérés par le lysosome Les activateurs qui forment des cristaux ou des particules sont phagocytés. C est le cas notamment de la silice, l amiante, l alun, du peptide amyloïde-β ou du MSU (Dostert et al., 2008; Halle et al., 2008; Hornung et al., 2008). Les endosomes issus de la phagocytose des cristaux fusionnent avec des lysosomes acidiques. La diminution du ph lysosomal provoque alors une déstabilisation et une perméabilisation du lysosome, dont la rupture diminue le ph intracellulaire. Le contenu lysosomal protéolytique est alors libéré dans le cytosol. Cette rupture lysosomale provoque également un efflux de K+, qui provoque à son tour l augmentation de sodium intracellulaire (Na+), ce qui augmente l osmolarité et induit un influx d eau, qui fait gonfler la cellule et qui est dû aux aquaporines. Ainsi la concentration en K+ intracellulaire diminue dramatiquement (Schorn et al., 2011). 43

45 Il a été montré que des inhibiteurs de la pompe à protons, qui neutralisent le ph lysosomal faible, empêchent l activation de la plupart des protéases lysosomales et inhibent efficacement l activation de NLRP3 en réponse aux cristaux (Hornung et al., 2008). L inhibition ou la délétion partielle de certaines cathepsines réduisent l activation de NLRP3 suggérant un rôle pour ces enzymes en amont de NLRP3 (Hornung and Latz, 2010). La cathepsine B, protéase endosomale lysosomale, a été identifiée comme l agent responsable détecté par NLRP3 suite à sa libération du lysosome, provoquant ainsi l activation de l inflammasome NLRP3 (Bruchard et al., 2013). L ubiquitination/désubiquitination Les réactions d ubiquitination et désubiquitination ont également un rôle important dans le contrôle de l activation de l inflammasome. En effet, chez des macrophages murins, le signal TLR4 peut rapidement (dès 10 minutes) et de manière non transcriptionnelle stimuler la désubiquitination de NLRP3. Ce processus dépend de la production de ROS mitochondriales et peut être inhibé par des anti-oxydants, tels que la N-acétyl cystéine (NAC). De plus, l ATP peut également induire ce mécanisme de désubiquitination, mais de manière ROSindépendante, suggérant des enzymes désubiquitinantes différentes. Des inhibiteurs de ces enzymes montrent une inhibition de l assemblage des inflammasomes NLRP3 et AIM2, de l activation de la caspase-1 et la sécrétion d IL-1β (Juliana et al., 2012; Lopez-Castejon et al., 2013). Implication des ROS dans l activation de l inflammasome Les ROS peuvent être produits par différents organites cellulaires comme, par exemple, les peroxysomes, les mitochondries ou la membrane plasmique. Il a été démontré que l IL-1β et la caspase-1 étaient activées par les ROS générées par la nicotinamide adénine dinucléotide phosphate (NADPH) oxydase (ou NOX) dans des macrophages stimulés par le LPS (Cruz et al., 2007). L ATP extracellulaire provoque également la génération de ROS. Beaucoup d autres agents ont montré une activation de l inflammasome NLRP3 via la libération d ATP. Ainsi, l augmentation de la concentration en ATP extracellulaire suite à une lésion cellulaire ou tissulaire semble être un facteur majeur contribuant à la génération de ROS en réponse aux stimuli nuisibles pour l hôte. Les ROS générées régulent l expression du gène ainsi que de la protéine immature pro-il-1β. Elles agissent aussi en augmentant l activité de la caspase-1 (Hsu and Wen, 2002). Pour finir, l inflammasome NLRP3 peut être 44

46 activé par les ROS et leur piégeage inhibe son activité (Zhou et al., 2011). En effet NLRP3, comme IL-1β, requiert un premier signal pro-inflammatoire qui donne lieu à la production de ROS qui induisent NLRP3 sans l activer. Cependant, en l absence de la NOX, l activation de l inflammasome NLRP3 ainsi que la maturation et la sécrétion d IL-1β ne sont pas affectées. Le rôle précis des ROS dans l activation de l inflammasome est donc contesté (Bauernfeind et al., 2011b; Bulua et al., 2011). De ce fait, d autres mécanismes ont été proposés pour expliquer la contribution des ROS dans l activation de l inflammasome NLRP3. En effet, les ROS générées par des mitochondries stressées auraient un rôle dans l assemblage de l inflammasome (Nakahira et al., 2011). Trois mécanismes intimement liés activant l inflammasome NLRP3 semblent finalement émerger : l efflux de K+, la dégradation lysosomale et les ROS. Ils induiraient la libération d ADN mitochondrial oxydé dans le cytosol, où il se lie et active l inflammasome NLRP3 (Mathew et al., 2012). Un mécanisme faisant appel au système anti-oxydant plutôt qu aux ROS a également été proposé. En effet, dans des souris déficientes pour la SOD1, le taux de ROS élevé dans les macrophages inhibe la pro-caspase-1 via des oxydations des résidus cystéine sur le zymogène et l ajout d agents réducteurs inverse cette inhibition. De même, Nrf2, un facteur de transcription répondant au stress oxydatif et induisant des enzymes anti-oxydantes clés, est essentiel pour l activation de l inflammasome induite par des cristaux de cholestérol (Rubartelli, 2012). La protéine se liant à la thiorédoxine (TXN), la TXNIP a également été proposée comme un médiateur de l action des ROS sur l inflammasome NLRP3. TXN appartient à une famille de petites protéines ubiquitaires sensibles au stress oxydant et est présente dans beaucoup d organismes, de la bactérie à la cellule animale. TXN participe à la formation d un réseau de voies de signalisation redox cruciales pour la régulation du métabolisme cellulaire, la prolifération, la différentiation et l apoptose. La génération de ROS provoque la dissociation de TXN à TXNIP, qui va alors interagir avec NLRP3 et provoquer l assemblage de l inflammasome. Un stress métabolique tel que l hyperglycémie libère également TXNIP de TXN et provoque la sécrétion d IL-1β NLRP3-dépendante (Di Virgilio, 2013; Zhou et al., 2010). Cependant, il a été rapporté qu il n y avait pas de différence dans l activation de la caspase-1 et la sécrétion d IL-1β en réponse à des activateurs de l inflammasome entre des macrophages normaux et déficients en TXNIP (Lopez-Armada et al., 2013; Rubartelli, 2012). 45

47 L autophagie/la mitophagie L autophagie est un processus cellulaire conservé impliqué dans le nettoyage d organites intracellulaires endommagés, le renouvellement protéique et l élimination de parasites intracellulaires. Elle est considérée comme un régulateur négatif de l inflammation car elle supprime les DAMPs cytosoliques, comme les organites intracellulaires dégradés, les acides nucléiques endommagés ou les protéines dont la structure tertiaire est incorrecte, qui peuvent stimuler l inflammasome. Les mitochondries endommagées sont éliminées dans des vacuoles autophagiques via une forme d autophagie particulière appelée mitophagie. Ces mitochondries libèrent des taux très importants de ROS et de l ADN mitochondrial, qui sont tous les deux des agents activateurs de l inflammasome NLRP3. (Kepp et al., 2011; Sorbara and Girardin, 2011). Ainsi, autophagie et mitophagie sont inhibiteurs de l activité de l inflammasome (Zhou et al., 2011). Cependant, l autophagie a également montré un rôle activateur dans la sécrétion d IL- 1β. En effet, sous certaines conditions, l autophagie constitue une adaptation au stress qui évite la mort cellulaire et supprime l apoptose par la dégradation des protéines les plus anciennes et les organites endommagés via la voie autophago-lysosomale, alors que sous d autres paramètres cellulaires, cela constitue une voie alternative de mort cellulaire. Les cellules mourant par le mécanisme d autophagie induisent une réponse pro-inflammatoire dans les macrophages humains (Deretic, 2012; Dupont et al., 2011). L autophagie joue donc un rôle négatif et positif dans l activation de l inflammasome et dans la réponse inflammatoire en général en fonction des conditions spécifiques (Gombault et al., 2012). Les flux ioniques L efflux de potassium L efflux de K+ a un rôle essentiel dans l activation d au moins quatre inflammasomes (NLRP1, NLRP3, NLRC4 et AIM2). Une diminution de la concentration en K+ est un stimulus rapide et puissant induisant l assemblage de l inflammasome et le clivage de la procaspase-1. Ce stimulus a également été montré comme activateur de l apoptosome APAF1 activant la caspase-9. La concentration physiologique normale en K+ intracellulaire de 143 mm inhibe l apoptosome en empêchant son oligomérisation dépendante du cytochrome c et inhibe également l inflammasome par un mécanisme plus complexe. Des expériences in vitro 46

48 montrent qu une concentration en K+ intracellulaire de 90 mm active l inflammasome et cela semble être une caractéristique commune des caspases inflammatoires et apoptotiques (Petrilli et al., 2007). Le rôle de l épuisement en K+ dans l activation de la caspase-1 est connu depuis longtemps, avant même la découverte des inflammasomes (Perregaux and Gabel, 1994). L efflux de K+ provoque également la libération d ATP extracellulaire, un stimulus puissant pour la maturation et la sécrétion de l IL-1β. Tous les pathogènes perturbent l homéostasie ionique intracellulaire provoquant un déséquilibre dans la distribution ionique transmembranaire. En effet, les dommages causés aux membranes sont précoces et participent à l activation de l inflammasome par au moins deux mécanismes : en causant une chute de la concentration cytoplasmique en K+ à 90 mm et en induisant la libération d ATP dans l activation d une boucle autocrine de stimulation de la cellule via P2X7R (Riteau et al., 2012). L efflux de K+ est impliqué et nécessaire pour l activation de l inflammasome par des stimuli divers, comme MSU, PGN, les composés imidazoquinoline mimant l ARN ou l ADN simple brin (tel que R837), E. coli, LT, les toxines de L. monocytogenes et S. aureus. Une chute localisée de la concentration en K+ est perçue par les cellules eucaryotes comme un indicateur alertant de lésions de la membrane plasmique et de dommages cellulaires potentiellement irréversibles, nécessitant une réponse de défense rapide (activation de l inflammasome), pouvant être immédiatement suivie par une suppression de la cellule (pyroptose). Ce système de détection de danger basé sur l efflux de K+ est intimement couplé aux récepteurs P2 (P2Rs), qui constituent un système efficace dans la détection et le déchiffrage de la concentration en ATP dans le microenvironnement du tissu. L efflux de K+ provoque le recrutement d un pore non sélectif de la membrane plasmique, la pannexine-1 (panx-1), qui va permettre aux agonistes extracellulaires jusqu à 1 kda d accéder au cytosol et d activer directement NLRP3. Le MDP active l inflammasome NLRP3 et requièrent panx-1 (Marina-Garcia et al., 2008). D autres produits bactériens comme le LPS, le lipide A, Pam3, PGN, MDP, l acide lipotéichoïque, les ARNs et ADNs d Escherichia coli ainsi que le zymosane de la membrane des cellules de levure font également appel à ce mécanisme. Cependant, il a également été montré que panx-1 n est pas nécessaire dans l activation de l inflammasome par l ATP, la nigéricine, l alun, la silice, la flagelline et l ADN cytoplasmique. Ainsi, la panx-1 joue un rôle important dans les phases précoces de l inflammation mais elle n est pas un composant nécessaire de la chaine d événements menant à l activation de l inflammasome (Di Virgilio, 2013; Schroder and Tschopp, 2010). 47

49 Le calcium Le rôle des cations dans l activation de l inflammasome NLRP3 s étend avec l identification du calcium extracellulaire comme activateur de l inflammasome NLRP3 via la stimulation d un récepteur de la membrane plasmique le détectant. En effet, dans les macrophages, un traitement par ATP mène notamment à l influx de Ca2+ et à l activation de phospholipases calcium-dépendantes. Ces protéines vont stimuler la colocalisation de la caspase-1 et de la pro-il-1β dans les lysosomes sécrétoires, ce qui favoriserait leur activation. Les taux élevés de Ca2+ cytosoliques stimulent la production de ROS, qui régulent ellesmêmes les flux calciques. Une coopération entre la génération de ROS et les flux de Ca2+ semble être impliquée dans l activation de l inflammasome via P2X7R (Cruz et al., 2007; Haneklaus et al., 2013). L ATP extracellulaire et la voie purinergique De nombreux activateurs de l inflammasome comme l acide urique, la silice ou l alun, sont des inducteurs d ATP et d autres nucléotides (Riteau et al., 2012). Dans les tissus sains, l ATP extracellulaire est négligeable, de l ordre de quelques nanomolaires, mais sa concentration peut atteindre plusieurs micromolaires au site inflammatoire à la suite d une lésion tissulaire ou dans le microenvironnement tumoral (Ghiringhelli et al., 2009). L essentiel des cellules est en effet capable de libérer des nucléotides, dont l ATP. L ATP est très hydrophile et diffuse rapidement dans le milieu extracellulaire aqueux, dans lequel il est rapidement détecté par de nombreux récepteurs, dont les affinités recouvrent toutes les concentrations en ATP dans des conditions physiologiques et pathologiques. La présence d ecto-atpases ubiquitaires permet de mettre un terme rapidement au signal ATP (Di Virgilio, 2013). L ATP extracellulaire induit un efflux de K+, nécessaire à l activation de l inflammasome NLRP3 (Laliberte et al., 1999; Mariathasan et al., 2006; Perregaux and Gabel, 1994). L ATP libéré interagit spécifiquement avec des récepteurs purinergiques, comme les récepteurs P2X et P2Y. Il peut également être dégradé par les ecto-atpases en ADP, adénosine monophosphate (AMP), puis en adénosine, qui peuvent aussi interagir avec des récepteurs purinergiques. En effet, l ADP est un ligand spécifique des récepteurs P2Y, alors que l adénosine interagit avec le récepteur adénosine P1. L activation des P2Ys induit la production d IL-1β alors que celle de P1 inhibe la production d IL-1β (Riteau et al., 2012). Les récepteurs purinergiques sont stimulés de manière autocrine, à la surface des cellules libérant l ATP, ou de manière paracrine, à la surface des cellules adjacentes (Piccini et al., 48

50 2008). L ATP extracellulaire est aussi libéré par les cellules stimulées et active l inflammasome NLRP3 (Gombault et al., 2012; Riteau et al., 2012). Dans la famille P2Rs, P2X7R joue un rôle important dans la détection du danger et l activation des cellules défensives ou de la mort cellulaire. Ce récepteur tient une place spéciale dans la biologie de l inflammasome car sa stimulation est considérée comme étant la plus puissante et la plus fiable pour activer l inflammasome NLRP3. P2X7R ne semble pas avoir de rôle dans l activation des autres inflammasomes, comme NLRP1, NLRC4 et AIM2, malgré leur dépendance à la concentration en K+. P2X7R est une chaine cationique sélective de la membrane plasmique ATP-dépendante formant un pore. Il est constitué de trois sousunités P2X7 et devient sélectif en présence de fortes concentrations en ATP extracellulaire. L ouverture du pore provoque des flux importants de K+ et des flux transmembranaires de solutés aqueux, dont le poids moléculaire peut atteindre jusqu à 900 kda, dont l ATP par exemple. L ATP étant l agoniste de P2X7R, son ouverture initie un processus d autoamplification de la stimulation cellulaire, qui provoque la mort cellulaire dans les tissus enflammés, s il n est pas interrompu par l élimination de l ATP extracellulaire ou l extinction de P2X7R. Ce processus de stimulation autocrine/paracrine a un rôle important dans les phases précoces de propagation et d amplification de l inflammation. P2X7R est adapté pour répondre aux taux d ATP inhabituels et pathologiques et sa concentration effective médiane (EC50) pour l ATP est de 100 à 300 µm. Cette caractéristique lui permet de s ouvrir dès que la concentration ATP extracellulaire est supérieure aux taux physiologiques (Di Virgilio, 2013). La régulation négative de l inflammasome Tous les processus homéostatiques finement régulés impliquent des mécanismes de rétro-contrôle afin de prévenir les activations inutiles ou d atténuer une réponse excessive. L inflammation est gardée sous contrôle par des facteurs solubles de l hôte ou des éléments cellulaires qui contre-balancent l effet d agents pro-inflammatoires endogènes ou exogènes. Dans l interaction hôte/pathogène, cette aptitude à éteindre l inflammation est très importante. Ainsi, beaucoup d agents infectieux synthétisent et libèrent des facteurs anti-inflammatoires. Les cellules immunitaires elles-mêmes ont un système précoce anti-inflammatoire, autoinhibiteur basé sur une différence dans l assemblage des composants de l inflammasome (Figure 5). 49

51 Figure 5 : Inhibiteurs de l inflammasome. Les inhibiteurs de l inflammmasome sont divisés en deux catégories : endogènes et exogènes. Les inhibiteurs de l inflammasome sont dynamiques dans la nature. Les mécanismes moléculaires impliqués ne sont pas toujours entièrement compris. Leur existence souligne l importance de cette voie dans le contrôle de l inflammation. D après Davis et al. (2011). Trois isoformes de la protéine adaptatrice ASC ont été décrites (b, c et d) et ont un potentiel de régulation différent des inflammasomes. En effet, certaines isoformes favorisent (ASC et ASC-b), inhibent (ASC-c) ou ne modifient pas (ASC-d) le fonctionnement de l inflammasome. Cette activité semble liée à leur localisation puisque ASC et ASC-b colocalisent avec NLRP3 et la caspase-1, ASC-c colocalise seulement avec la caspase-1, alors que ASC-d ne colocalise pas avec NLRP3, ni la caspase-1 (Bryan et al., 2010; Di Virgilio, 2013). Certaines protéines de la sous-famille NLRP agissent comme des inhibiteurs de l inflammasome. En effet, la protéine NLRP10 (PYNOD) se lie à ASC, à la caspase-1 et l IL- 1β. NLRP10 inhibe l activation de NF-κB par ASC et la sécrétion d IL-1β par la caspase-1 (Wang et al., 2004). De la même manière, NLRP7 inhibe l assemblage de l inflammasome en ciblant la protéine ASC (Latz et al., 2013). Les protéines NLRP1 (DEFCAP) et NOD2 sont épissées différemment, produisant des isoformes qui sont des régulateurs négatifs de l activité de l isoforme active (Hlaing et al., 2001; Rosenstiel et al., 2006). NLRP3 possède également un système d auto-inhibition via le domaine LRR faisant intervenir les protéines chaperonnes SGT1 et HSP90. Ces protéines maintiennent NLRP3 dans sa forme inactive mais compétente au signal (Schroder and Tschopp, 2010; Zhou et al., 2010). 50

52 Dans le cas des cancers, certaines isoformes tronquées de P2X7 peuvent constituer des inhibiteurs endogènes de l inflammasome. Ainsi, P2X7-j, joue un rôle négatif dominant quand elle est exprimée avec P2X7A (l isoforme longue) (Feng et al., 2006). Un autre variant de P2X7R, P2X7B, co-assemble avec P2X7A et potentialise son action, dont la formation de larges pores (Adinolfi et al., 2010). Des mécanismes d inhibition endogènes font également appel au système oxydant et sa régulation. Il a été montré qu après la stimulation des TLRs, la protéine TRIM30 (tripartite-motif protein 30) est induite et que cette protéine atténue la production de ROS et l activation de l inflammasome NLRP3. Le mécanisme d action de TRIM30 n est pas clair mais ne semble pas interférer dans l assemblage de l inflammasome (Hu et al., 2010). Un autre inhibiteur récemment identifié est le monoxyde d azote (NO). Le NO endogène bloque l assemblage du complexe inflammasome NLRP3 via une nitrosylation sur des résidus thiol et en favorisant la stabilisation de la mitochondrie (Hernandez-Cuellar et al., 2012; Mao et al., 2013; Mishra et al., 2013). Plusieurs gènes du génome humain codent pour des protéines qui interfèrent avec la formation de l inflammasome. Ainsi, les protéines CARD-only protein (COP), inhibitory CARD (INCA) et ICEBERG inhibent l activation de la caspase-1 via une interaction CARD- CARD. En effet, grâce à leur domaine CARD, elles agissent comme des leurres de la caspase- 1, empêchant ainsi l assemblage de l inflammasome (Humke et al., 2000; Lamkanfi et al., 2004; Lee et al., 2001). Une autre protéine contenant un domaine CARD, la caspase-12, est un régulateur négatif de la caspase-1 (Saleh et al., 2006). De la même manière, les protéines contenant un domaine PYD peuvent aussi empêcher la formation de l inflammasome. C est le cas de la pyrine, dont le gène est muté chez les patients atteints de la maladie inflammatoire appelée maladie périodique (Paragraphe «Inflammasome et pathologies») (Papin et al., 2007). Deux autres protéines contenant un domaine PYD, POP1 (également connu sous le nom d ASC2, ASCI, ASCL ou PYDC1) et POP2, influencent également l activité de l inflammasome en agissant comme un leurre pour ASC (Dorfleutner et al., 2007; Stehlik et al., 2003a). L inflammasome AIM2 possède aussi un mécanisme spécifique de régulation. En effet, p202, un autre membre de la famille HIN, joue un rôle d antagoniste de l activation de la caspase-1 dépendante d AIM2. Les deux protéines peuvent se lier aux ADNs double brin 51

53 via leur domaine HIN, mais p202 ne possède pas de domaine PYD, séquestrant ainsi les molécules d ADN. De plus, p202 peut se lier à AIM2 directement, le séquestrant également (Guarda and So, 2010; Yin et al., 2013). Les serpines, des inhibiteurs de protéinases à sérine, sont une famille de protéines qui se lient et bloquent le site actif des protéases cibles. La plupart des serpines inhibe les protéases à sérine, mais certaines interagissent avec des protéases à cystéine, comme la caspase-1. Par exemple, la serpineb9 (également nommée protéinase inhibitor-9 chez l Homme ou sérine protéinase inhibitor-6 chez la souris) présente une activité inhibitrice de la caspase-1 (Annand et al., 1999). Un autre membre de la famille des serpines, la serpineb2 (également nommée PAI-2 : plasminogen activator inhibitor 2), est impliquée dans la régulation négative de la caspase-1. Son expression provoque la diminution de ROS générées et du taux de protéines NLRP3 et IL-1β mature (Chuang et al., 2013; Jensen et al., 1999). Les protéines anti-apoptotiques Bcl-2 et BCL-X L agissent comme des régulateurs négatifs de l activité de l inflammasome NLRP1 en empêchant sa liaison avec ATP et inhibent ainsi l activation de la caspase-1 (Di Virgilio, 2013; Guarda and So, 2010). D autres effecteurs négatifs sont les microarns (mir), dont certains ont été identifiés comme étant des rétro-inhibiteurs directs dans la signalisation des TLRs (mir-146 et mir- 155). mir-223, quant à lui, est un inhibiteur post-transcriptionnel, qui limite temporellement l expression de NLRP3. mir-223 est exprimé à différents niveaux dans les cellules myéloïdes. Il est le plus abondant dans les granulocytes, puis dans les macrophages et enfin dans les cellules dendritiques (Bauernfeind et al., 2012; Di Virgilio, 2013). Les pathogènes ont également développé des facteurs inhibiteurs ciblant les inflammasomes. Les bactéries du genre Yersinia injectent des facteurs de virulence, qui sont les protéines Yop, dont certaines inhibent l activation de la caspase-1 et ainsi la sécrétion d IL-1β mature. Les virus, comme par exemple les virus de la myxomatose, ont également développé des inhibiteurs, qui sont des protéines homologues aux POPs et qui interagissent avec ASC. On trouve également des protéines similaires aux serpines, comme la protéine cytokine response modifier A (CrmA) codée par le virus de la variole bovine. Cette protéine cible l activité enzymatique de la caspase-1 en l inhibant suite au clivage de CrmA par la caspase-1 elle-même, générant ensuite une liaison covalente permanente avec le site actif. 52

54 Actif à 0,01 nm, CrmA est un des inhibiteurs de la caspase-1 le plus efficace (Guarda and So, 2010; Komune et al., 2011; Lamkanfi and Dixit, 2011). Inflammasome et pathologies Les cryopyrinopathies Les cryopyrinopathies, ou syndromes périodiques associés à la cryopyrine (CAPS : cryopyrin-associated periodic syndromes), sont des inflammasomopathies causées par des mutations non-sens autosomiques dominantes du gène codant pour la protéine NLRP3. Trois inflammasomopathies de ce type ont été identifiées : le syndrome auto-inflammatoire familial au froid (FCAS : familial cold-induced auto-inflammatory syndrome), syndrome de Muckle- Wells (MWS : Muckle-Wells syndrome) et le syndrome chronique infantile neurologique cutané articulaire (CINCA ou NOMID : neonatal onset multi-system inflammatory disorder) (Hoffman et al., 2001). Ces trois maladies rares débutent pendant l enfance et présentent des signes cliniques communs dont la sévérité augmente avec le temps. FCAS est de sévérité moyenne alors que NOMID est la plus sévère des trois cryopyrinopathies décrites. Les signes cliniques se manifestent sous la forme de sécrétion d IL-1β dérégulée et incluent des fièvres périodiques, rougeurs, douleurs articulaires, sensibilité au froid, conjonctivite et méningite stérile. Les mutations du gène codant pour la protéine NLRP3 sont détectées chez 55 à 60% des patients atteints de CAPS. La protéine NLRP3 mutée a tendance à s oligomériser spontanément, favorisant ainsi l activation de l inflammasome NLRP3 et la sécrétion d IL-1β sous la dépendance d ASC (Dowds et al., 2004; Rietdijk et al., 2008). D autres protéines NLRs sont impliquées dans les syndromes fiévreux périodiques, comme NLRP12, dont la mutation est responsable d un syndrome similaire à FCAS et qui se nomme FCAS2 (Di Virgilio, 2013). La maladie périodique Cette maladie est également appelée fièvre méditerranéenne familiale (FMF) ou encore maladie arménienne. C est un syndrome de fièvre périodique qui était commun chez les Arméniens, les Arabes, les Juifs ou les Turcs et chez les autres populations originaires de pays du bassin méditerranéen. Il se manifeste par des épisodes récurrents de fièvre, de sérite (inflammation séreuse) stérile, de monoarthrite et de splénomégalie (augmentation du volume de la rate). L amylose (maladie rare caractérisée par la présence de dépôts de protéines 53

55 insolubles dans les tissus) est une complication fréquente chez les patients non traités. La FMF est due à des mutations du gène codant pour la pyrine et est souvent classée comme une maladie autosomale récessive (Di Virgilio, 2013). La goutte ou pseudogoutte La goutte et la pseudogoutte sont des maladies causées par des dépôts intracellulaires de cristaux de MSU ou de CPPD respectivement. Ces deux molécules sont des activateurs puissants de l inflammasome NLRP3. Elles sont phagocytées par des cellules mononucléées puis ensuite libérées dans le cytoplasme à la suite de dommages endosomaux/phagosomaux, ce qui active l inflammasome. L activation de l inflammasome par des agents sous forme de particules est un exemple général d inflammation stérile (Pazar et al., 2011). Les protéines mal repliées («misfolded») Les protéines mal repliées sont à la base de pathologies humaines chroniques qui ont une base inflammatoire commune importante. L excès de production d IL-1β et d IL-18 par les inflammasomes (le plus souvent NLRP3) est commun à ces pathologies. Les protéines mal repliées provoquent l assemblage de l inflammasome et son activation via une perturbation phagolysosomale et la libération de la cathepsine B ou la génération de ROS. L amyloïde-β fait partie de cette catégorie de protéines et son mode d action semble faire appel à P2X7R. Ces mécanismes suggèrent l implication de l inflammasome dans la maladie d Alzheimer. Il semble également avoir un rôle dans la maladie de Parkinson et de Huntington (Halle et al., 2008; Masters, 2013). Les maladies cardiaques L inflammasome a été impliqué dans les pathologies cardiaques. En effet, les lésions initiées au cours de l ischémie/reperfusion myocardique sont favorables à l installation de l inflammation. De nombreuses études se sont naturellement penchées sur l implication de l inflammasome dans ces processus et ont démontré que l hypoxie/réoxygénation stimule l inflammasome dans les fibroblastes cardiaques mais pas les cardiomyocytes. L activation de l inflammasome cause la sécrétion d IL-1β et l infiltration de cellules inflammatoires. La taille de l infarctus induit par l ischémie/reperfusion, la fibrose et la dysfonction contractile qui en résultent sont réduites chez les souris ASC-/- (Kawaguchi et al., 2011). L activation de 54

56 l inflammasome NLRP3 dans les cardiomyocytes conduit à une augmentation de la taille de l infarctus et favorise un remodelage cardiaque délétère. La taille de l infarctus et le remodelage cardiaque pathologique peuvent être réduits en inhibant NLRP3 et P2X7R (Mezzaroma et al., 2011). Le blocage de l IL-1β empêche l apoptose des cardiomyocytes et limite la dilatation ventriculaire gauche suite à un infarctus du myocarde, conférant ainsi une approche thérapeutique potentielle dans l insuffisance cardiaque (Bracey et al., 2013; Toldo et al., 2013). Plus récemment, une étude sur des patients atteints de cardiomyopathies dilatées idiopathiques a montré que des taux élevés d ARNm codant pour la protéine NLRP3 dans les PBMCs sont plus souvent associés à une récidive menant à une ré-hospitalisation dans les six mois (Luo et al., 2013). L athérosclérose L athérosclérose est la première cause de morbidité cardiovasculaire. Le rôle de l inflammasome NLRP3 dans l athérosclérose et le processus athéromateux a été controversé pendant quelques années. La première indication est fournie par la thèse de Matthieu Pesant (Pesant, 2008), qui met en évidence les protéines NLRP3 et ASC, ainsi que la caspase-1 active et l IL-1β au niveau de la plaque. Il montre également que la protéine NLRP3 est surexprimée dans des monocytes circulants de souris nourries avec un régime hypercholestérolémiant (Giroux, 2008) et que les lipoprotéines de faible densité oxydées (LDLox) stimulent l expression de Nlrp3 in vitro. Par la suite, les travaux de Duewell et al. (2010) ont montré, d une part que des cristaux de cholestérol étaient capables d induire l activité de NLRP3 et que, d autre part, le développement de la plaque était inhibé chez des souris invalidées pour le gène codant pour la protéine LDLR (récepteur aux lipoprotéines de faible densité) transplantées avec des monocytes NLRP3-/- ou bien IL-1β-/-, IL-1α-/- ainsi que ASC-/-. En même temps, Rajamaki et al. (2010) ont confirmé le rôle des cristaux de cholestérol en tant qu activateurs de NLRP3 sur des modèles cellulaires humains pré-stimulés par le LPS (dont les THP-1). Plus récemment (Jiang et al., 2012), l activation de l inflammasome NLRP3 par des LDLox dans les macrophages humains (PBMCs et THP-1) a été confirmée. Les auteurs indiquent que la sécrétion d IL-1β est augmentée via la génération de ROS et la voie de la cathepsine B. A l opposé de toutes les études précédemment décrites, l étude de Menu et al. (2011) réalisée chez des souris ApoE-/-NLRP3-/-, ApoE-/-ASC-/- et ApoE-/-Casp1-/- nie le rôle joué par l inflammasome dans la progression de l athérosclérose. Toutefois, une nouvelle étude (Usui et al., 2012) utilisant également des souris ApoE-/-Casp1-55

57 /- montre, au contraire, une diminution significative des lésions athérosclérotiques, de l infiltration des macrophages, ainsi que de l expression d IL-1β dans les plaques. La seule différence entre ces deux études réside dans le régime utilisé : Western Diet contenant 0,15% de cholestérol chez les souris ApoE-/- pour Usui et al. ; High Fat Diet contenant 1,25% de cholestérol et fortement athérogénique pour Menu et al. L étude initiale de Duewell et al. utilisant le même régime athérogène et démontrant le rôle des cristaux de cholestérol dans l activation de l inflammasome appuie donc l étude de Usui et al. L inflammasome NLRP3 semble donc être impliqué dans le processus athéromateux mais son rôle reste à déterminer. Le lien athérosclérose/inflammasome est également montré dans une étude de Razani datant de 2012, se basant sur des modèles murins (Razani et al., 2012). Les auteurs constatent que la formation de la plaque s accompagne, au niveau des macrophages, d une déficience de l autophagie, chargée d éliminer les mitochondries déficientes. La production d IL-1β induite par des cristaux de cholestérol est exacerbée dans des macrophages déficients suggérant ainsi le rôle de l autophagie dans l activation de l inflammasome. Le mécanisme d action impliquerait des fuites lysosomales et la génération de ROS. Les maladies métaboliques La pathogenèse inflammatoire dans les maladies métaboliques est de plus en plus reconnue. En effet, il a été prouvé que l inflammation et l immunité étaient impliquées dans l obésité et le T2DM. Les adipokines, comme l adiponectine et la leptine, modulent l état inflammatoire lors de l installation de ces pathologies. L adiponectine et l insuline ont des activités anti-inflammatoires, alors que la leptine est pro-inflammatoire. L insulino-résistance est liée à l augmentation des médiateurs pro-inflammatoires chez ces sujets et des taux élevés d acide sialique, d IL-6 et de C-reactive protein (CRP) favorisent le T2DM (Khan, 2006). Des dysfonctions multi-systémiques ont lieu au cours de l évolution du syndrome métabolique et incluent des altérations des inflammasomes dans les tissus cardiaques, adipeux, pancréatiques et hépatiques. Ces altérations incluent une diminution dans la sensibilité à l insuline, des dysfonctions des cellules β pancréatiques, des maladies du foie non alcooliques et l athérosclérose. L IL-1β et l IL-18 ont un rôle important en tant qu agents causatifs dans toutes ces dysfonctions. L hyperglycémie chronique comme celle se produisant dans le T2DM est toxique pour les cellules β pancréatiques, menant à la mort de ces cellules et une diminution de la sécrétion d insuline. La perte de tissu pancréatique est due à la 56

58 stimulation par IL-1β secrétée par les macrophages inflammatoires s y infiltrant. Le mécanisme de la toxicité due au glucose semble être lié à l activation de l inflammasome NLRP3 TXNIP-dépendante. L hyperglycémie provoque la génération de ROS au niveau mitochondrial, qui provoque la dissociation de TXN à TXNIP et la liaison de TXNIP à NLRP3 (Tschopp, 2011). NLRP3 et la caspase-1 sont sur-exprimés dans le tissu adipeux et le foie d individus obèses. Les macrophages infiltrant le tissu adipeux sur-expriment NLRP3, ASC et la caspase-1 et sont la cible des acides gras saturés qui ont une activité proinflammatoire, comme les céramides ou le palmitate (Wen et al., 2011). Une sur-activation de l inflammasome et de la caspase-1 a des effets secondaires sur le métabolisme du tissu adipeux, en amplifiant la réponse inflammatoire locale et en augmentant la résistance à l insuline. Les macrophages de patients T2DM sur-expriment NLRP3, ASC et IL-1β (De Nardo and Latz, 2011; Strowig et al., 2012; Wen et al., 2012). Les inflammasomes ont également une fonction importante en dehors du système immunitaire inné. Un exemple de ce rôle non inflammatoire se situe au niveau du tissu adipeux. La caspase-1 est sur-régulée pendant la différenciation des adipocytes et favorise l acquisition d un phénotype insulino-résistant. Réciproquement, les animaux déficients pour la caspase-1 sont plus sensibles à l insuline et leurs adipocytes présentent des taux d oxydation des graisses plus importants. De plus, les souris déficientes pour NLRP3, ASC et caspase-1 sont résistantes à l obésité induite par un régime gras et sont protégées de la résistance à l insuline induite par l obésité. L infiltration du tissu adipeux par des macrophages inflammatoires est également réduite chez les souris NLRP3-/-, ASC-/- et Casp1-/- due à la diminution de la sécrétion de la protéine chimio-attractive des monocytes (MCP-1 ou monocyte chemo-attractant protein-1). Plusieurs autres facteurs endocrines liés à l obésité sont également altérés chez ces souris déficientes pour l inflammasome (Stienstra et al., 2011). Ces données montrent que l inflammation via la voie effectrice de l inflammasome est un lien important entre le stress métabolique, l obésité et le T2DM et l hyperglycémie et les dommages aux cellules β pancréatiques (Strowig et al., 2012). Il existe un lien entre le métabolisme et l inflammasome, qui joue un rôle central dans les changements biochimiques se produisant au cours de l inflammation et des désordres métaboliques. Le glucose stimule la sécrétion d IL-1β par les cellules β pancréatiques et l inhibition du métabolisme du glucose empêche l expression du gène de l IL-1β. Réciproquement, le LPS favorise la glycolyse aérobie, appelée «effet de Warburg». Il y a 57

59 donc un lien entre l inflammation et le métabolisme du glucose. La liaison entre la glycolyse et les inflammasomes semble reposer sur P2X7R. En effet, les cellules exprimant P2X7R présentent une glycolyse aérobie très active et les agents connus pour stimuler ce processus requièrent l expression de P2X7R. Les cellules exprimant P2X7R sur-expriment des enzymes clés de la glycolyse, comme la glycéraldéhyde 3-déshydrogénase, la pyruvate kinase M2, la pyruvate kinase déshydrogénase et la phosphofructokinase, ainsi que le facteur de transcription hypoxia inducible factor-1α (HIF-1α). De plus, P2X7R cause la sur-expression du transporteur de glucose Glut1, et augmente l accumulation de réserves intracellulaires en glycogène. Ces conséquences sur le métabolisme du glucose miment plusieurs des effets induits par le LPS, mettant le doigt sur le rôle clé de P2X7R au croisement entre les voies glycolytiques et inflammatoires (Di Virgilio, 2013; Wen et al., 2012). Les rétinopathies L activation de l inflammasome NLRP3 provoque une dégénérescence des cellules épithéliales rétiniennes, phénomène impliqué dans la dégénérescence maculaire liée à l âge (DMLA ou AMD : age-related macular degeneration) (Tseng et al., 2013). De plus, les drusens (amas de protéines anormales qui s accumulent sous la rétine pendant la DMLA) activent l inflammasome NLRP3. Cependant, l induction d une DMLA chez des souris NLRP3-/- est exacerbée, suggérant un rôle protecteur de l inflammasome NLRP3 (Doyle et al., 2012). Par ailleurs, TXNIP et l inflammasome contribuent à la pathogenèse de la rétinopathie diabétique. En effet, l hyperglycémie active TXNIP dans les cellules rétiniennes, ainsi que l expression de la pro-il-1β et l activation de l inflammasome NLRP3 et de la caspase-1 (Devi et al., 2012). Le cancer Le microenvironnement inflammatoire est un facteur fondamental déterminant la progression tumorale. IL-1β et IL-18 sont souvent sur-exprimées dans les tumeurs et leur concentration dans les fluides biologiques offre des indications pronostiques. Dans le cadre d un cancer, l activité de l inflammasome est dérégulée, ce qui guide ou/et maintient la dégénération maligne. Le rôle de l inflammasome dans la tumorigenèse n est pas clair. Un des mécanismes par lequel l inflammasome contribue à la carcinogenèse du colon est la modulation de la composition de la flore microbienne colique et l équilibre hôte/pathogène. 58

60 Cependant, de manière générale, un inflammasome actif affecte la carcinogenèse en modulant le contenu en cytokines dans le microenvironnement tumoral (Masters, 2013). L interstice des tumeurs solides est très propice à l activité de l inflammasome en raison des fortes concentrations extracellulaires en ATP et à la forte expression de P2X7R par les tumeurs et les cellules inflammatoires qui s y infiltrent (Aymeric et al., 2010). De nombreux cancers sont caractérisés par de fortes sécrétions en IL-1β. Pour certains types de cancer, le rôle de l IL-1β dans la progression du cancer et la métastase est attribué à sa capacité à mener le recrutement intratumoral de cellules myéloïdes immunosuppressives. Ainsi, la sur-expression de l IL-1β due à l activation de l inflammasome dans l interstice tumoral est néfaste pour l hôte. De plus, NLRP3 est fortement activé dans les cellules tumorales. Tous ces mécanismes permettent une auto-activation de l inflammasome, causant une amplification du signal qui favorise la croissance des cellules cancéreuses (Ghiringhelli et al., 2009). L IL-18 a un rôle protecteur dans l inflammation colique et la tumorigenèse, ainsi que dans les tumeurs de la prostate, bien que son rôle soit remis en cause dans d autres cancers. L inflammasome a donc un rôle important mais controversé dans la formation de tumeurs primaires et métastatiques. La difficulté réside dans le fait de différencier les effets intrinsèques de l inflammasome dans les cellules tumorales (autonomie des cellules) de ceux dus à l activation de l inflammasome au sein des cellules inflammatoires infiltrant les tumeurs. Les inhibiteurs d inflammasome : nouveaux outils thérapeutiques? Toutes les données accumulées jusqu à présent confirment que l inflammasome est l unité centrale qui intègre les signaux responsables de l initiation et l amplification de l inflammation, la stimulation de l immunité innée et adaptative et la modulation de la croissance et de la différenciation cellulaire. Ainsi, interférer dans l efficacité de l inflammasome implique de cibler une des différentes étapes de son assemblage, de l activation de la caspase-1 et de la maturation et de la sécrétion de cytokines. Il est également possible d antagoniser l inflammasome en ciblant les voies en amont, telles que celle des récepteurs de la membrane plasmique impliqués dans l activation de l inflammasome 59

61 (P2X7R, panx-1) ou celle des médiateurs cytoplasmiques et les seconds messagers (ROS, TXNIP, PKR, cathepsine B, ions K+) (Figure 6). Figure 6 : Quelques exemples de traitements interférant dans la signalisation de l inflammasome. L objectif est de réduire l inflammation en altérant la signalisation de l inflammasome NLRP3. Les flèches représentent les voies d activation menant à l inflammation et les lignes représentent les étapes inhibant l inflammation via des composés spécifiques. Pour les antagonistes de P2X7R, par exemple, AZD9056 est développé par AstraZeneca, CE224,535 par Pfizer, EVT-401 par Evotec et GSK par GlaxoSmithKline. D après Lopez-Castejon and Pelegrin (2012). Cibler les récepteurs de la membrane plasmique activant l inflammasome est une des voies les plus prometteuses dans le développement de médicaments, au moins pour les inflammasomes dont l activation dépend de P2X7R ou panx-1. En effet, P2X7R est de plus en plus considéré comme crucial pour de nombreuses réponses impliquant l inflammasome et 60

62 beaucoup d industries pharmaceutiques ont développé des inhibiteurs de P2X7R au cours des dix dernières années. Plus de vingt essais cliniques ont été menés à partir de 2011 pour tester la sureté et l efficacité d inhibiteurs de P2X7R comme anti-inflammatoires. Ainsi, une large panoplie de composés est disponible et des essais cliniques de phase I et II ont été réalisés afin de tester la sureté et l efficacité d inhibiteurs de P2X7R dans des maladies inflammatoires chroniques comme l arthrose, la polyarthrite rhumatoïde, la bronchopneumopathie chronique obstructive (BPCO) et la maladie de Crohn. Les catégories principales de composés, dans lesquelles des inhibiteurs sélectifs de P2X7R ont été développés, sont les dérivés benzamide, les composés bicyclohétéroaryle, les antagonistes acylhydrazine, les antagonistes amine aromatique, les dérivés amine, les dérivés amide, les antagonistes bi-aromatiques et les inhibiteurs hétérocycliques de chaines ioniques (Di Virgilio, 2013; Lopez-Castejon and Pelegrin, 2012). Cibler panx-1 pour antagoniser l inflammasome est plus problématique pour deux raisons : panx-1 n est pas nécessaire pour l activation de l inflammasome induite par P2X7R et, à ce jour, il semble n exister que peu de molécules inhibant spécifiquement panx-1, comme le FD&C Blue No. 1 (Wang et al., 2013a). De plus, un transporteur organique d anions faisant partie de la famille des protéines de résistance multi-drogue, le probécénide, semble être un inhibiteur potentiel de panx-1 (Lopez-Castejon and Pelegrin, 2012). En aval de P2X7R et panx-1, il est possible de cibler les perturbations ioniques, comme la diminution en K+ dans le cytosol, causées par l ouverture de pores P2X7R/panx-1 non sélectifs. Le glyburide (ou glybenclamide) est un composé de la famille des sulfonylurées utilisé pour traiter les T2DM. Cette molécule se lie aux canaux K+ sensibles à l ATP (canaux K ATP ) et inhibe la sécrétion d insuline dans les cellules β pancréatiques. Le glyburide bloque la maturation et la sécrétion de l IL-1β, mais également l activation de l inflammasome NLRP3. Le glyburide cible une molécule en aval du récepteur P2X7 et en amont de la caspase-1 et ASC, mais n agit pas sur la panx-1 (Lamkanfi et al., 2009). L inhibition de l efflux de K+ est un moyen puissant d inhiber une majorité d inflammasomes mais cela nécessite le ciblage des chaines P2X7R ou panx-1 et préférentiellement P2X7R (Lopez- Castejon and Pelegrin, 2012). La génération de ROS est une autre voie de l activation de l inflammasome. TXNIP est un composant clé reliant la formation de ROS à la stimulation de l inflammasome NLRP3 61

63 et son inhibition pourrait inhiber l activité de l inflammasome. Les tentatives d inhibition par cette voie sont très préliminaires. L augmentation de la synthèse de mir déstabilisant TXNIP (mir-17) sous-régule l activité de TXNIP. D un point de vue plus général, les anti-oxydants piégeurs de ROS, comme la NAC, ou les inhibiteurs de ROS mitochondriales, comme le diphénylène iodonium (DPI), peuvent être utilisés pour inhiber les inflammasomes (Bauernfeind et al., 2011b; Lopez-Castejon and Pelegrin, 2012; Sauter et al., 2011). Le parthénolide est une lactone sesquiterpène qui a de multiples propriétés antiinflammatoires. Ce composé est naturellement présent dans la plante Tanacetum parthenium et utilisé comme remède médical naturel. En dehors de son effet sur l activation de NF-κB, le parthénolide inhibe la caspase-1 et NLRP3. L inhibition de la caspase-1 a lieu en réponse à la stimulation de NLRP3, NLRP1 et NLRC4, et résulterait d une alkylation de la caspase-1 sur des résidus Cys. Le parthénolide inhibe également directement NLRP3 en inhibant son activité ATPase, nécessaire pour l activation. Le Bay est un autre inhibiteur de NFκB, qui inhibe également NLRP3 de manière spécifique. Le Bay inhibe l activité ATPase de NLRP3 (Haneklaus et al., 2013; Latz et al., 2013). Quelques composés interagissent directement avec l inflammasome et l inhibent. C est le cas du composé diarylsulfanilurée nommé CRID3 ou CP-456,773 qui empêche la formation des complexes ASC pendant l assemblage des inflammasomes NLRP3 et AIM2. Récemment, l utilisation d un activateur de l inflammasome NLRP3, acaly18, a montré des effets bénéfiques comme anti-infectieux à large spectre et permet de débarrasser l environnement des pathogènes pendant une infection (Lopez-Castejon and Pelegrin, 2012). Des centaines d inhibiteurs de caspase-1 ont été synthétisés et sont basés sur la séquence peptidique de reconnaissance de la caspase-1, mais beaucoup de ces inhibiteurs sont inutilisables in vivo. Des inhibiteurs peptidomimétiques de la caspase-1 ont été développés et certains sont entrés dans des essais cliniques comme pralnacasan, VX-765 ou emricasan, pour le traitement de la polyarthrite rhumatoïde, l arthrose, le psoriasis ou le rejet de greffe (Latz et al., 2013). Les inhibiteurs allostériques sont également attentivement étudiés et ciblent un site allostérique à l interface des dimères de caspases en utilisant des petites molécules. Un composé organique, auranofin, empêche l activation des inflammasome NLRP1 et NLRP3 par l anthrax. Deux inhibiteurs de protéases, ritonavir et disulfiram, inhibent l activation de la caspase-1 et suggèrent l inhibition de la sécrétion d IL-18. Il est possible de cibler les produits de l activité de l inflammasome, IL-1β et IL-18. Le processus de l interaction de l IL-1β avec 62

64 les cellules cibles est finement contrôlée au niveau de la membrane plasmique de la cellule cible et dans l espace extracellulaire où l IL-1β semble liée à des récepteurs solubles IL-1RI et IL-1RII issus des cellules immunitaires activées. Au niveau de la membrane plasmique, l IL-1β peut être régulée de deux manières : (1) par des liaisons exclusives mutuelles aux récepteurs IL-1RI ou IL-1RII et (2) par la compétition de la liaison IL-1RI avec l antagoniste du récepteur à l IL-1 (IL-1Ra). L inhibition thérapeutique d IL-1β est étudiée selon trois voies : (1) en empêchant la liaison de l IL-1β à ses récepteurs en utilisant de l IL-1Ra recombinant (anakinra) ; (2) en utilisant un anticorps monoclonal anti-il-1β (canakinumab) ; et (3) en piégeant l IL-1β grâce à la fusion des domaines de liaison de IL-1RI et IL-1RAcP à la portion Fc de l IgG humaine (rilonacept) (Di Virgilio, 2013; Latz et al., 2013; Lopez- Castejon and Pelegrin, 2012). 63

65 Objectifs de la thèse La découverte des inflammasomes a été d une importance majeure dans les domaines de l immunologie et de la médecine. Leur identification et leur caractérisation ont permis de mieux comprendre les mécanismes moléculaires reliant la stimulation cellulaire (par des pathogènes, des lésions chimiques ou physiques) à l activation de réponses précoces des cellules immunitaires. L ensemble de ces travaux a permis de clarifier les mécanismes responsables de l activation de la pro-caspase-1 et la maturation de l IL-1β et l IL-18. L IL-1β jouant un rôle fondamental dans les maladies inflammatoires chroniques, les désordres métaboliques et le cancer, les inflammasomes deviennent une cible thérapeutique de choix pour le développement de médicaments innovants. Cependant, certains points restent à éclaircir, comme l élucidation d un mécanisme d activation commun à tous les inflammasomes. Il est possible que plusieurs mécanismes soient impliqués et que l activation complète de l inflammasome soit le résultat d événements multiples agissant en synergie. En 2011, seulement quatre inflammasomes étaient identifiés : NLRP1, NLRP3, NLRC4 et AIM2, alors qu aujourd hui, on en dénombre huit. D autres types d inflammasomes peuvent être découverts au cours des prochaines années. L intérêt pour l inflammasome ne se réduit pas à l inflammation, mais concerne également les pathologies métaboliques, la différenciation cellulaire et le cancer. Comprendre la fonction de l inflammasome fournirait une meilleure compréhension de la pathogenèse de nombreuses maladies ainsi que de nouvelles approches pour leur traitement. Le premier objectif de ce travail de thèse a été de mettre en place un modèle cellulaire afin de permettre l étude de modulateurs de l inflammasome en situation d inflammation de faible intensité dans des conditions stériles. Ce modèle cellulaire a alors été utilisé afin d étudier les mécanismes impliqués suite à la stimulation par des signaux reconnus comme activateurs de l inflammasome à savoir : l ATP et des générateurs de ROS en l absence de signaux activateurs de la voie des TLRs. Enfin, ce modèle cellulaire a été appliqué à des produits commerciaux agro-alimentaires, ainsi qu à des composés naturels ou synthétiques afin de déterminer leur profil inflammatoire. Ce manuscrit présente une première partie constituée de rappels bibliographiques où sont décrits les processus moléculaires conduisant à l inflammation, ainsi que les inhibiteurs décrits pouvant être de potentiels futurs traitements thérapeutiques. Les résultats obtenus au 64

66 cours de ce travail de thèse sont divisés en quatre sous-parties : (1) les résultats concernant la mise en place du modèle cellulaire, (2) l étude de l effet de la stimulation par l ATP dans ce modèle, (3) l étude de l effet de la stimulation par des générateurs de ROS, (4) utilisation du modèle pour définir le profil inflammatoire de différents composés. Dans la dernière partie, une discussion générale des résultats précédemment présentés est réalisée. Les conclusions et les perspectives de ce travail sont évoquées à la fin de cette partie. 65

67 MATERIELS ET METHODES 66

68 Toutes les cultures cellulaires sont réalisées dans un incubateur à atmosphère humide contrôlée à 5% CO 2 et dont la température est de 37 C (Sanyo Panasonic, San Diego, USA). Culture de la lignée cellulaire THP-1 La lignée cellulaire monocytaire humaine THP-1 est obtenue auprès de l ATCC (LGC Standard, Molsheim, France). Les monocytes sont décongelés et cultivés en suspension dans du milieu RPMI-1640 (Roswell Park Memorial Institute medium) complémenté avec 10% de sérum de veau fœtal (SVF) et 1% d un cocktail d antibiotiques (Pénicilline, Streptomycine, Amphotéricine B ou PSA) (milieu complet ou MCC). Un renouvellement du milieu est réalisé tous les deux ou trois jours dans des flasques de 75 cm² de surface de culture avec bouchon à membrane filtrante de 0,2 µm. Ce renouvellement est effectué via une centrifugation à 130 x g pendant 5 minutes à température ambiante (TA). Le culot est suspendu dans du milieu frais et les cellules sont comptées sur cellule de Malassez. Cette étape est nommée «passage». Les cellules sont utilisées jusqu au passage 20 et sont maintenues à une densité cellulaire inférieure à 1 million de cellules/ml. Différenciation des monocytes THP-1 Les monocytes THP-1 sont différenciés en macrophages grâce à un traitement par un ester de phorbol : 12-O-Tetradecanoylphorbol 13-acetate (TPA) ou phorbol 12-myristate 13- acetate (PMA) (Sigma-Aldrich, Saint-Quentin-Fallavier, France). Les cellules sont ensemencées en plaques 96 puits ou 6 puits selon les conditions exposées dans le tableau 1. La différenciation est réalisée avec 20 nm de TPA au moment de l ensemencement des cellules en plaques au jour 0 pendant 24 heures à 37 C. Elle est contrôlée au microscope à inversion (Eclipse TS100, Nikon, Champigny sur Marne, France) grâce l adhésion des cellules accompagnée d un changement de morphologie. 67

69 Conditionnement Volume de culture Nombre de cellules par puits Densité cellulaire But de la culture Plaque 96 puits 200 µl Plaque 96 puits 200 µl Plaque 6 puits 3 ml Plaque 6 puits 3 ml cellules/ml cellules/ml cellules/ml cellules/ml Mesure de la production d'il-1β Mesure de la production d IL-1β et extraction d'arn Mesure de la production d'il-1β Extraction d'arn et de protéines, RPE Tableau 1 : Conditions de culture en fonction du but de l'expérience. Traitements appliqués aux THP-1 différenciés Après la mise en culture et la différenciation des THP-1, comme indiqué dans le paragraphe précédent, les cellules sont traitées afin de moduler la production d IL-1β et ceci est représenté dans la figure 7 ci-après. Un «prétraitement» peut être appliqué après la différenciation au jour 1 pour 24 heures à 37 C. Un second traitement peut être appliqué au jour 2 pour une nuit (ou 16 heures) à 37 C. Ces traitements sont ajoutés directement dans le milieu de culture, qui n est pas changé tout au long de l expérience. Les surnageants de culture (SN) sont alors récoltés et conservés à -20 C pour des analyses ultérieures. 68

70 Figure 7 : Modèle cellulaire permettant l'étude de la production d'il-1β. Traitements pro-inflammatoires appliqués Divers traitements pro-inflammatoires sont utilisés et appliqués au jour 2 durant une nuit afin d induire la production d IL-1β dans les SN. Traitements anti-inflammatoires appliqués Plusieurs types de molécules sont testées afin d inhiber la production d IL-1β induite. Ces molécules sont utilisées en «prétraitement» au jour 1 pour 24 heures + une nuit ou en traitement au jour 2 pour une nuit, une heure avant ou en même temps que le stimulus proinflammatoire. Cultures primaires de cellules Macrophages dérivés de la moelle osseuse (BMDMs) Animaux Les BMDMs sont obtenus à partir de souris mâles ou femelles. Nous avons utilisé des souris de la souche C57BL/6 soit «sauvages» ou «Wild Type» (WT) (élevage Janvier, Le Genest Saint Isle, France), soit des souris déficientes pour la protéine ASC, ASC-/- ; soit des souris déficientes pour la protéine NLRP3, NLRP3-/-. Les souris ASC-/- nous ont été fournies 69

71 par le Dr Vishva Dixit (Genentech, San Francisco, USA) et les souris NLRP3-/- par le Pr Jürg Tschopp (Université de Lausanne, Lausanne, Suisse). Pendant toute la durée de l étude, les souris sont maintenues dans des conditions d élevage standards : alimentation et eau ad libitum, température ambiante contrôlée et cycle jour/nuit de 12 heures. L ensemble des expériences a été approuvé par le comité d éthique de l Université de Bourgogne. Obtention et culture de BMDMs Ces cellules sont obtenues à partir de fémurs et tibias de souris sacrifiées grâce à une dose létale d anesthésique (Nesdonal, Merial, Lyon, France). Les os sont prélevés stérilement et les épiphyses sont sectionnées. Les moelles sont extraites et mises en suspension avec une seringue contenant 1 ml de PBS (phosphate buffered saline). Les cellules sont comptées sur cellule de Malassez et centrifugées à 1500 rpm (round per minute ou tour par minute), 4 C, 10 minutes (Centrifuge 5810R, Eppendorf, Le Pecq, France). Le surnageant est éliminé et le culot est repris dans du milieu de différenciation : DMEM (dulbecco s modified eagle medium) contenant 10% SVF, 1% PSA et 50 ng/ml M-CSF murin (macrophage colony-stimulating factor) (Miltenyi Biotec, Paris, France). Les cellules sont ensemencées dans 10 à 15 ml de milieu, à raison de 4 millions cellules/ml dans des boîtes de Pétri de 10 cm de diamètre et incubées à 37 C ; 5% CO 2. L incubation dure six jours avec un contrôle de l adhérence accompagné d un renouvellement du milieu après quatre jours. Les cellules sont utilisées deux jours après et rincées avec 10 ml PBS. Elles sont décollées grâce à 10 ml de PBS froid ne contenant pas de CaCl 2 pendant 15 minutes à 4 C. La suspension cellulaire est récupérée à l aide d un grattoir et centrifugée à 1500 rpm, 4 C, 10 minutes (Centrifuge 5810R, Eppendorf, Le Pecq, France). Le culot est repris dans du milieu de culture complet (DMEM + 10% SVF + 1% PSA) et les cellules sont ensemencées en plaques 96 puits à fond plat à raison de 0,1 million cellules/puits dans 200 µl de milieu complet et incubées à 37 C, 5% CO 2. Cellules mononucléaires de sang périphérique (PBMCs) issues de couches leucocytaires («buffy coat») Ces cellules sont isolées de poches de couches leucocytaires (ou «buffy coat») obtenues de l établissement français du sang (EFS) à partir de volontaires sains. Deux tubes 70

72 de séparation de 50 ml contenant une barrière poreuse (tubes «Blood Sep Filter», Dominique Dutscher, Brumath, France) sont utilisés, dans lesquels sont ajoutés 15 ml de milieu de gradient de densité 1,077 g/ml (Ficoll-Paque PREMIUM, GE Healthcare Life Sciences, Velizy-Villacoublay, France). Une centrifugation à 500 x g pendant quelques secondes est réalisée afin que la solution de Ficoll traverse le filtre. 25 ml de «buffy coat» sont ajoutés et complétés avec 10 ml PBS. Le tout est centrifugé à 800 x g pendant 20 minutes à TA sans frein. On obtient alors au-dessus de la barrière poreuse deux couches séparées par un anneau contenant les cellules mononuclées, qui est récupéré à l aide d une seringue et d une aiguille. Les étapes qui suivent sont réalisées dans la glace. Les cellules sont placées dans un tube de 50 ml auxquelles du PBS est ajouté jusqu à 50 ml. La suspension est centrifugée à 1700 rpm, pendant 3 minutes à 4 C (Centrifuge 5810R, Eppendorf, Le Pecq, France). Ceci constitue le premier lavage. Deux autres lavages sont ensuite réalisés comme décrits ci-après. Le culot cellulaire est resuspendu avec 1 ml de PBS et transvasé dans un tube de 15 ml. La suspension est complétée avec du PBS jusqu à 14 ml et centrifugée. Finalement, le culot est resuspendu avec 1 ml de PBS, la suspension est transvasée dans un tube de 50 ml et complétée à 10 ml avec du PBS. Le mélange est homogénéisé et centrifugé. Le culot est alors resuspendu avec 15 ml de PBS et un comptage sur cellule de Malassez est effectué. Les cellules sont ensemencées en plaques 96 puits à fond rond à raison de 0,09375 million cellules/puits dans 150 µl de milieu complet (RPMI % SVF + 1% PSA) et incubées à 37 C, 5% CO 2. Traitements appliqués aux cellules primaires murines et humaines Les cellules sont directement traitées à l ensemencement et sont «primées» par du LPS d Escherichia coli, souche O128 : B12 à 100 ng/ml pendant 6 heures à 37 C, 5% CO 2. Une seconde stimulation par des traitements pro-inflammatoires seuls ou en présence de traitements anti-inflammatoires est réalisée pendant une nuit à 37 C, 5% CO 2. Une condition contrôle est appliquée et est réalisée par l ajout de solvant dans les mêmes proportions que les traitements. Les SN sont ensuite récoltés et conservés à -20 C pour des analyses ultérieures. Pour les cellules humaines, la récolte nécessite une centrifugation de la plaque à 1700 rpm pendant 3 minutes à TA (Centrifuge 5810R, Eppendorf, Le Pecq, France). 71

73 Test de cytotoxicité La cytotoxicité des molécules qui ont été testées est évaluée grâce à un test colorimétrique basé sur l activité des déshydrogénases mitochondriales des cellules. Ces enzymes étant inactivées peu de temps après la mort cellulaire, leur activité reflète les cellules métaboliquement actives. Un substrat des succinate déshydrogénases de la chaine respiratoire, la molécule XTT (2,3-Bis-(2-Methoxy-4-Nitro-5-Sulfophenyl)-2H-Tetrazolium-5- Carboxanilide) (Sigma-Aldrich, Saint-Quentin-Fallavier, France) de couleur jaune, est réduit en une molécule de couleur orange, le formazan, dont l absorbance peut être mesurée à 490 nm. Un agent couplant, le phenazine methosulfate (PMS) (Sigma-Aldrich, Saint-Quentin- Fallavier, France), est ajouté et améliore la réaction en servant de transporteur intermédiaire d électrons. Préparation des solutions Une solution de XTT à 0,9 mg/ml est préparée dans du milieu de culture complet sans rouge de phénol (MCC (-RP)). A cette concentration, on atteint la valeur seuil limite de la solubilité et la solution doit être vortexée 30 minutes afin d obtenir une solution homogène. La solution peut être chauffée à 37 C pour améliorer la resuspension. Une solution de PMS à 5 mm est préparée dans du PBS. Ces deux préparations sont conservées à -20 C. Procédure expérimentale Le test est réalisé après la récolte des SN sur les tapis cellulaires. Les cellules sont lavées avec du PBS et du MCC (-RP) est ajouté. On ajoute ensuite 20% de ce volume d une solution contenant 0,9 mg/ml de XTT et 0,01 mm de PMS (dilution 1/500 de la solution mère de PMS). Dans les plaques 96 puits, 100 µl de MCC (-RP) + 20 µl de XTT/PMS sont ajoutés ; dans les plaques 6 puits, 1 ml de MCC (-RP) µl de XTT/PMS sont ajoutés. La réaction nécessite une incubation de 4 heures à 37 C, 5% CO 2 au bout desquelles l absorbance à 490 nm est lue avec une contre-lecture à 660 nm grâce à un lecteur de plaques (Infinite M200 PRO, Tecan, Lyon, France). 72

74 Traitement des résultats Les absorbances à 660 nm sont soustraites de celles des absorbances à 490 nm et les moyennes des réplicats sont calculées. Les résultats sont exprimés en pourcentage du contrôle «solvant» de la condition d intérêt. Mesure de la production d IL-1β La quantité d IL-1β produite est mesurée par la technique ELISA (Enzyme-linked immunosorbent assay) avec un kit «Mouse» ou «Human IL-1 beta ELISA Ready-SET- Go!» (ebioscience, Paris, France). Les protocoles sont identiques pour les deux kits, seule la préparation des standards varie. Préparation des solutions et «coating» des plaques Préalablement, le tampon de lavage («wash buffer») et le tampon de dilution («assay diluent») sont préparés et conservés à 4 C. Le «wash buffer» est constitué de PBS 1X auquel on ajoute 0,05% de tween 20. L «assay diluent» est préparé grâce à la solution fournie dans le kit à la concentration 5X diluée 5 fois avec de l eau distillée (H 2 Od). Le «coating» est réalisé à l aide d un «coating buffer» et d un anticorps dit «de capture». Le «coating buffer» est préparé grâce à la solution fournie dans le kit à la concentration 10X diluée 10 fois avec H 2 Od. La solution de «coating» finale est réalisée avec ce tampon et l ajout de l anticorps de capture fourni dans le kit à la concentration 250X dilué 250 fois. 100 µl de cette solution sont répartis dans les puits d une plaque à barrettes modulaires de surface présentant une capacité d adsorption moyenne (POLYSORP, Nunc, Thermo Scientific, Langenselbold, Allemagne). La plaque est enveloppée dans une feuille d aluminium et incubée à 4 C pendant une nuit minimum. La solution STOP de H 3 PO 4 à 1 M est également préparée et conservée à TA. Cette solution est préparée à partir d une solution d acide à 14,6 M (Sigma-Aldrich, Saint-Quentin-Fallavier, France) diluée 14,6 fois dans H 2 Od. Procédure expérimentale La solution de «coating» est enlevée par retournement de la plaque. 5 lavages avec 300 µl de «wash buffer» sont réalisés au bout desquels la plaque est séchée sur un papier absorbant. Les puits sont bloqués avec 200 µl d «assay diluent» pendant 1 heure à TA. 5 73

75 lavages sont réalisés comme décrit précédemment. Les standards sont préparés à partir d une solution mère fournie dans le kit à 1 µg/ml. Pour l IL-1β murine, 10 µl de cette solution mère sont ajoutés à 10 ml d «assay diluent», on a alors une solution à 1000 pg/ml. Des dilutions en série de ½ sont réalisées dans le tampon de dilution «assay diluent» jusqu à 7,8 pg/ml afin de constituer la gamme étalon. Pour l IL-1β humaine, 5 µl de cette solution mère sont ajoutés à 10 ml de «assay diluent», on a alors une solution à 500 pg/ml. Des dilutions en série de ½ sont réalisées dans le tampon de dilution «assay diluent» jusqu à 3,9 pg/ml afin de constituer la gamme étalon. 100 µl de standards de 7,8 à 500 pg/ml pour le kit murin et de 3,9 à 250 pg/ml pour le kit humain, 100 µl de tampon pur «assay diluent» pour le «blanc» et le point 0 pg/ml et 100 µl d échantillons purs ou dilués dans le tampon «assay diluent» sont déposés pour 2 heures à TA. La plaque est lavée 5 fois comme décrit précédemment. 100 µl d anticorps de détection sont déposés après dilution de la solution 250X fournie dans le kit diluée 250 fois dans le «assay diluent». La plaque est incubée 1 heure à TA. 5 lavages sont réalisés. 100 µl d enzyme HRP sont déposés après dilution de la solution 250X fournie dans le kit diluée 250 fois dans le «assay diluent». La plaque est incubée 30 minutes à TA. 7 lavages d une minute chacun sont réalisés et la plaque est séchée sur un papier absorbant. 100 µl de «substrate solution» fournie dans le kit sont déposés pour 30 minutes à TA à l obscurité. 50 µl de solution STOP sont ajoutés. L absorbance est alors lue à 450 nm grâce à un lecteur de plaques (Infinite M200 PRO, Tecan, Lyon, France). Traitement des résultats La moyenne des absorbances des réplicats est calculée, à laquelle celle du blanc est soustraite. La courbe étalon est réalisée grâce à la régression linéaire du logarithme de la moyenne de l absorbance des standards en fonction du logarithme de la concentration en pg/ml. La concentration des échantillons est alors déterminée grâce à l équation générée et la quantité d IL-1β produite dans les échantillons est calculée. Mesure de la concentration en sous-unité p20 de la caspase-1 La quantité de la sous-unité p20 de la protéine caspase-1 présente dans les SN est mesurée par la technique ELISA avec un kit «Human Caspase-1/ICE Quantikine ELISA Kit» (R&D Systems, Lille, France). 74

76 Préparation des solutions et de la gamme de standards Préalablement, le tampon de lavage («wash buffer») est préparé grâce à la solution fournie dans le kit à la concentration 25X, diluée 25 fois avec H 2 Od et conservé à 4 C. Les standards sont préparés à partir d une solution mère fournie sous forme de poudre et reconstituée à 4000 pg/ml avec H 2 Od. 100 µl de cette solution sont prélevés et ajoutés à 900 µl de «calibrator diluent RD5-5», on a alors une solution à 400 pg/ml. Des dilutions en série de ½ sont réalisées ensuite dans le «calibrator diluent RD5-5» jusqu à 6,25 pg/ml afin de constituer la gamme étalon. Extemporanément, une solution appelée «substrate solution» est préparée à partir d un mélange à volume égal des solutions «color reagent A» et «color reagent B» fournies dans le kit. Les autres solutions du kit ainsi que les plaques 96 puits fournies sont prêtes à l emploi. Procédure expérimentale 50 µl d «assay diluent RD1W» sont ajoutés dans les puits. 100 µl de standards de 6,25 à 400 pg/ml, 100 µl de «calibrator diluent RD5-5» pur pour le «blanc» et le point 0 pg/ml et 100 µl d échantillons sont déposés pour 1h30 à TA. 3 lavages avec 300 µl de «wash buffer» sont réalisés au bout desquels la plaque est séchée sur un papier absorbant. 100 µl de la solution «antiserum» fournie sont déposés. La plaque est incubée 30 minutes à TA. 3 lavages sont réalisés comme décrit précédemment. 100 µl de la solution «conjugate» fournie sont déposés pour 30 minutes à TA. 3 lavages sont réalisés comme décrit précédemment. 200 µl de «substrate solution» préalablement préparée sont déposés pour 20 minutes à TA à l obscurité. 50 µl de la solution «stop solution» fournie sont ajoutés. L absorbance est alors lue à 450 nm avec une contre-lecture à 540 nm grâce à un lecteur de plaques (Infinite M200 PRO, Tecan, Lyon, France). Traitement des résultats Les absorbances à 540 nm sont soustraites des absorbances à 450 nm et les moyennes des réplicats sont calculées. La moyenne du blanc est ensuite soustraite et la courbe étalon est réalisée grâce à la régression linéaire du logarithme de la moyenne de l absorbance des standards en fonction du logarithme de la concentration en pg/ml. La concentration des échantillons est alors déterminée grâce à l équation générée et la quantité de sous-unité p20 de la caspase-1 produite dans les échantillons est calculée. 75

77 Mesure de la concentration en nitrites, méthode de Griess La quantité de NO dans les SN est déterminée par un test mesurant la quantité de nitrites (NO - 2 ), qui est un métabolite stable issu de la réaction du NO avec l oxygène moléculaire. L ion nitrite forme avec l acide sulfanilique (solution B) un sel de diazonium, qui est révélé par une coloration rose avec l ajout d α-naphthylamine (solution A). Préparation des solutions Le réactif de Griess, permettant la détection des nitrites, est un mélange 50/50 de deux solutions (A et B) préparées préalablement et conservées à 4 C. La solution A est réalisée avec du N-1-Naphtylène-diamine-hypochloride à 1 g/l dans H 2 Od. La solution B est préparée avec du p-aminobenzène-sulfonamide (ou sulfanilamide) à 10 g/l dans H 3 PO 4 5%. Une solution de sodium nitrite NaNO 2 à 10 mm dans H 2 Od est préparée pour réaliser la gamme étalon et est conservée à -20 C (Sigma-Aldrich, Saint-Quentin-Fallavier, France). Procédure expérimentale Une gamme étalon est préparée à partir de la solution de nitrites à 10 mm dans le MCC. Des dilutions en série sont réalisées pour obtenir des solutions dont la concentration est de 5 ; 10 ; 20 ; 50 et 100 µm. Le réactif de Griess est préparé en mélangeant à volume égal les solutions A et B. 100 µl de standards, 100 µl de MCC seul pour le «blanc» et le point 0 µm et 100 µl d échantillons sont déposés dans les puits d une plaque 96 puits. 100 µl de réactif de Griess sont ajoutés dans chaque puits et incubés 15 minutes à TA. L absorbance est alors lue à 550 nm avec une contre-lecture à 690 nm grâce à un lecteur de plaques (Infinite M200 PRO, Tecan, Lyon, France). Traitement des résultats Les absorbances à 690 nm sont soustraites des absorbances à 550 nm et les moyennes des réplicats sont calculées. La moyenne du blanc est ensuite soustraite et la courbe étalon est réalisée grâce à la régression linéaire de la soustraction des moyennes d absorbance en fonction de la concentration en nitrites en µm. La concentration en nitrites des échantillons est alors déterminée grâce à l équation générée. 76

78 Western blotting Extraction des protéines Pour chaque condition, un puits d une plaque 6 puits contenant 1 x 10 6 cellules THP-1 est ensemencé et traité comme décrit précédemment. Après récolte des SN, le tapis cellulaire est lavé avec 1 ml de PBS. La lyse des cellules est réalisée avec 100 µl de tampon RIPA (Tris- HCl 50 mm ; NaCl 150 mm ; EDTA 1 mm ; Triton X-100 1% ; désoxycholate de sodium 1% ; SDS (sodium dodecyl sulfate) 0,1%) contenant 1% d inhibiteurs de protéases (Sigma- Aldrich, Saint-Quentin-Fallavier, France) durant 15 minutes à 4 C. Le tapis cellulaire est alors gratté à l aide d un grattoir et 150 µl de tampon RIPA supplémentaires sont ajoutés afin de récupérer la totalité du lysat cellulaire dans un tube. Le lysat est ensuite soniqué (Vibra- Cell 72434, Bioblock Scientific, Fisher Scientific, Illkirch, France) puissance 40 jusqu à l apparition d un blanc laiteux dans la solution. Une centrifugation à rpm pendant 15 minutes à 4 C (Centrifuge 5417R, Eppendorf, Le Pecq, France) est réalisée et le surnageant est récolté et conservé à -20 C en attendant le dosage de la quantité de protéines extraites. Mesure de la quantité de protéines, méthode BCA Les concentrations protéiques sont mesurées en plaques 96 puits grâce à un kit faisant appel à la méthode BCA (acide bicinchoninique) (Pierce BCA Protein Assay Kit, Thermo Scientific, Courtaboeuf, France). Cette méthode combine la réduction de l ion cuivrique Cu 2+ en ion cuivreux Cu 1+ par les protéines dans un milieu alcalin (réaction de Biuret) et la détection hautement spécifique du cation cuivreux grâce à un réactif colorigène contenant le BCA. Le complexe pourpre produit est formé par la chélation de deux molécules de BCA avec un ion cuivreux. Préparation des solutions Le réactif contenant le BCA permettant la détection de Cu 1+ est un mélange 50/1 de deux solutions (A et B respectivement) fournies dans le kit et conservées à TA. Le mélange est réalisé au moment du dosage. Une solution de tampon RIPA contenant 1% d inhibiteurs de protéases ayant servi à l extraction des protéines est préparée afin de réaliser la gamme étalon dans les mêmes conditions que les échantillons. 77

79 Procédure expérimentale Une gamme étalon est préparée à partir de la solution de d albumine bovine sérique (BSA) à 2 mg/ml fournie dans le kit. Des dilutions en série sont réalisées dans le tampon d extraction pour obtenir des solutions dont la concentration est de 25 ; 125 ; 250 ; 500 ; 750 ; 1000 ; 1500 ; 2000 µg/ml. 25 µl de standards, 25 µl de tampon d extraction pour le «blanc» et le point 0 µg/ml et 25 µl d échantillons dilués 1/10 dans le tampon d extraction sont déposés dans les puits d une plaque 96 puits. 200 µl de réactif BCA sont ajoutés dans chaque puits et incubés 30 minutes à 37 C. L absorbance est alors lue à 562 nm grâce à un lecteur de plaques (Infinite M200 PRO, Tecan, Lyon, France). Traitement des résultats Les moyennes des réplicats sont calculées et la moyenne du blanc est soustraite aux moyennes des absorbances des standards et des échantillons. La courbe étalon est réalisée grâce à la régression linéaire de la soustraction des moyennes d absorbance en fonction de la concentration en BSA en µg/ml. La concentration des échantillons est alors déterminée grâce à l équation générée. Séparation des protéines en SDS-PAGE (PolyAcrylamid Gel Electrophoresis) 30 µg de protéines sont repris dans un tampon dénaturant (Tris-HCl 250 mm, glycérol 40%, β-mercaptoéthanol 20%, SDS 10%, ph 6,8 ; quelques cristaux de bleu de bromophénol) et bouillis à 95 C pendant 5 minutes. Un gel de séparation de 8 à 14% (selon le poids moléculaire de la protéine cible) d acrylamide/bisacrylamide (rapport : 37,5/1) et d épaisseur 1 à 1,5 mm est d abord coulé puis un gel de concentration de 4% est coulé dans un système d électrophorèse MiniPROTEAN (Bio-Rad, Hercules, USA). Les échantillons protéiques et 5 µl de marqueur de poids moléculaires (Precision Plus Protein Standards, Bio-Rad, Hercules, USA) sont déposés et concentrés dans le gel à 4% (Tris-HCl 125 mm, SDS 0,1%, acrylamide/bisacrylamide 4%, ph 6,8) à 100 V pendant 1 heure puis séparés à 70 V dans le gel de séparation (Tris HCl 375 mm, SDS 0,1%, acrylamide/bisacrylamide de 8 à 14%, ph 8,8). 78

80 Transfert des protéines sur membrane Après leur séparation, les protéines sont transférées sur membrane PVDF (Polyvinylidène difluoride, Polyscreen Dupont) ou nitrocellulose (Bio-Rad, Hercules, USA) en milieu liquide dans un tampon de transfert Tris/Glycine/Acide borique sous l action d un champ électrique de 50 V pendant 1 à 2 heures. Immunoblotting Les membranes obtenues sont ensuite incubées durant une nuit sous agitation dans une solution de saturation (PBS contenant 0,1% de tween 20 et 5% de lait délipidé). Les membranes sont ensuite incubées avec les anticorps primaires dirigés spécifiquement contre les protéines étudiées et dilués dans une solution de PBS tween 20 0,1%, de lait délipidé 5% sous agitation pendant 2 heures à TA. Les membranes sont lavées 3 fois pendant 10 minutes avec du PBS contenant 0,1% de tween 20, puis incubées pendant 1 heure à TA en présence de l anticorps secondaire couplé à la peroxydase HRP (Santa Cruz Biotechnology, Inc., Heidelberg, Allemagne) dilué au 1/10000 en PBS tween 20 0,1%, lait délipidé 5%. Les membranes sont lavées 3 fois comme décrit précédemment et sont révélées par chimioluminescence. La révélation est réalisée à l aide d un substrat à base de luminol (Western Blotting Luminol Reagent, Santa Cruz Biotechnology, Inc., Heidelberg, Allemagne) et dans un imageur capturant le signal (ChemiDoc XRS+, Bio-Rad, Hercules, USA). Le temps d exposition de la membrane varie en fonction du signal obtenu de 1 à 15 minutes. Stripping Il est possible de révéler plusieurs protéines sur la même membrane (cas de la β- actine, par exemple, afin de normaliser le signal). Dans ce cas, les membranes sont lavées 3 fois comme décrit précédemment et incubées avec un tampon dit de «stripping» en milieu acide (Glycine-HCl 25 mm, SDS 1%, ph 2) (permettant de dissocier l anticorps primaire de son antigène) pendant 30 minutes à TA sous agitation. Après 3 lavages supplémentaires, les membranes sont à nouveau saturées et incubées avec d autres anticorps primaires. 79

81 Traitement des résultats Les conditions d intérêt sont testées en triplicat. Les bandes protéiques des protéines d intérêt et de la β-actine ayant migré sont captées par l imageur et intégrées par le logiciel associé Image Lab (Bio-Rad, Hercules, USA), permettant ainsi une analyse par densitométrie. Pour chaque échantillon, un ratio de la densité de la bande correspondant à la protéine d intérêt par rapport à celle de la β-actine est calculé. Les moyennes des réplicats sont calculées grâce à ces ratios et l analyse statistique est réalisée. RT-qPCR Extraction d ARNs totaux à partir de cellules L extraction des ARNs totaux des cellules a été réalisée grâce à une solution de TRIzol Reagent (Invitrogen, Life Technologies, Saint-Aubin, France) et au moyen du kit d extraction (RNeasy Mini Kit, QIAGEN, Courtaboeuf, France). Pour chaque condition, 1 x 10 6 cellules THP-1 sont ensemencées et traitées comme décrit dans le paragraphe précédent. Après récolte des SN, le tapis cellulaire est lavé 2 fois avec 1 ml de PBS et lysé avec 1 ml de TRIzol pendant 5 minutes à TA. La suspension est alors prélevée et relarguée 5 fois avant d être prélevée dans un tube et conservée à -80 C en attendant l extraction. Au moment de l extraction, la suspension décongelée est reprise par 200 µl de chloroforme et agitée vigoureusement au vortex pendant 15 secondes. Après 2 minutes à TA, elle est centrifugée à g pendant 15 minutes à 4 C. Trois phases apparaissent alors (de haut en bas) : aqueuse contenant les ARNs, interphase contenant les ADNs et organique contenant les protéines. La phase aqueuse est transférée dans un nouveau tube et un volume équivalent en éthanol pur y est ajouté lentement. La solution est vortexée et 700 µl sont transférés sur la colonne du kit RNeasy afin de fixer les ARNs sur la colonne de silice. La colonne est centrifugée à 8000 g pendant 15 secondes à TA et l opération est répétée jusqu à ce qu il n y ait plus de solution avec évacuation de l éluât. Les échantillons sont rincés puis élués de la colonne au moyen du tampon RW1 fourni dans le kit, puis lavés 2 fois avec du tampon RPE également fourni. La colonne est transférée dans un nouveau tube Eppendorf stérile et les ARNs sont élués avec 30 µl de H 2 O «RNase-free» fournie. La qualité des ARNs purifiés est vérifiée par analyse électrophorétique sur gel d agarose 1% préparé dans un tampon Tris/Borate/EDTA (TBE). Les ARNs sont visualisés sur gel après 80

82 coloration au bromure d éthidium (BEt) (Biosolve Chemicals, Dieuze, France) et exposition sur un banc à UV. Dosage des ARNs totaux Les ARNs totaux extraits sont dosés par spectrophotométrie avec un spectrophotomètre (NanoDrop 1000, Thermo Scientific, Wilmington, USA). La mesure de l absorbance est effectuée sur un intervalle allant de 220 à 350 nm de longueur d onde, dont la longueur d onde 260 nm correspondant à l absorption maximale des acides nucléiques. Une unité d absorbance à 260 nm correspond à 40 ng d ARNs totaux/µl. Les ratios 260/280 et 260/230 sont également donnés par l appareil afin de mesurer la pureté des échantillons. Transcription inverse (RT) La RT est la synthèse d ADNc simple brin à partir des ARNs totaux extraits. Le principe repose sur l utilisation d oligo-dt qui se lient aux ARNs et servent d amorces pour une ADN polymérase ARN-dépendante. En présence de désoxyribonucléotides triphosphate (dntp), les amorces sont élonguées ce qui permet la synthèse d ADNc représentatifs de l ensemble des ARNs. La réaction est réalisée grâce à un kit (SuperScript III Reverse Transcriptase, Invitrogen, Life Technologies, Saint-Aubin, France) dans un volume total de 10 µl. Le mélange contient 1 μg d ARN, 2 µl de Random Primers 50 µg/ml (Promega, Charbonnières-les-Bains, France), 0,5 µl de dntp 10 mm (Promega, Charbonnières-les- Bains, France) et le volume est complété à 6,5 µl avec H 2 Od. Le mélange est chauffé à 65 C pendant 5 minutes, puis mis sur la glace pendant au moins une minute. A ce mélange est ajouté 3,5 µl d un mix contenant 2 µl du tampon First-Strand 5X, 0,5 µl de DTT, 0,5 µl de RNaseOUT Recombinant Ribonuclease Inhibitor (Invitrogen, Life Technologies, Saint- Aubin, France) et 0,5 µl de la SuperScript III Reverse Transcriptase (Invitrogen, Life Technologies, Saint-Aubin, France). La réaction de RT est réalisée selon le protocole suivant : 30 minutes à 50 C et 15 minutes à 70 C. Les produits sont conservés à -20 C en attendant leur utilisation pour la PCR (polymérisation en chaîne à temps réel). Réaction de polymérisation en chaîne en temps réel Le principe de la réaction de la PCR quantitative repose sur la quantification du taux d ARNm, après RT en ADNc par une reverse transcriptase, grâce à la fluorescence émise par 81

83 un fluorophore qui s intercale entre les brins de l ADN néosynthétisé au cours de la réaction de PCR. Le fluorophore utilisé au cours de cette réaction est le SYBR Green et est fluorescent uniquement lorsqu il est lié à de l ADN double brin. Les amorces utilisées pour chacun des gènes amplifiés ont été choisies grâce à la base de données humaine qprimerdepot (National Institute of Health). Le gène de ménage utilisé code pour la phosphoprotéine ribosomale acide PO (36B4) et les gènes étudiés ainsi que les amorces utilisées sont présentés dans le tableau 2. Cette méthode de PCR en temps réel nécessite le calibrage de la réaction et de l appareil par l amplification d une gamme de dilution des ADNc. Des dilutions en série sont réalisées à partir d un mélange de tous les produits de RT dilués. Gène Amorce sens Amorce anti-sens Taille de l amplicon (paires de bases) Position Asc CCGGTGCTGGTCTATAAAGTG TCTACCTGGAGACCTACGGC Caspase-1 CACATCACAGGAACAGGCAT GCTTTCTGCTCTTCCACACC Il-1β CCTGAAGCCCTTGCTGTAGT AGCTGATGGCCCTAAACAGA Nf-κb1 TTGCTGGTCCCACATAGTTG ATGTATGTGAAGGCCCATCC Nlrp3 TGCACTGGAATCTGCTTCTC AAAGAGATGAGCCGAAGTGG Nod2 TAGAAGGAAGGCAGCCAATC GATGAAATCAGGTTGCCGAT Tlr4 AACTCTGGATGGGGTTTCCT AGAACTGCAGGTGCTGGATT Tableau 2 : Amorces utilisées pour la RT-qPCR. Préparations des échantillons Les produits de la réaction de la RT sont complétés à 100 µl avec H 2 Od. A partir de ces échantillons, une gamme de dilution a été réalisée pour servir de standard pour la réaction de qpcr. Un volume de 25 µl de chacun des échantillons est prélevé et mélangé avec un volume total équivalent en H 2 Od pour constituer le premier point de gamme dilué ½. Des dilutions en série de ½ sont réalisées dans H 2 Od jusqu à 1/32 afin de constituer la gamme étalon. Les 75 µl de produit de RT restant pour chaque échantillon sont complétés avec 225 µl de H 2 Od à 300 µl. Réaction de qpcr Chaque échantillon est analysé en duplicat dans des plaques 96 puits (Applied Biosystems, Life Technologies, Saint-Aubin, France). Le volume réactionnel dans chaque puits est de 12,5 µl et est constitué de la manière suivante : 6,25 µl de RT² SYBR Green Fluor qpcr Mastermix (QIAGEN, Courtaboeuf, France), 2,5 µl d ADNc préparés comme 82

84 décrit dans le paragraphe précédent (standards et échantillons dilués), 320 µm de chaque amorce (Eurogentec, Angers, France) et un volume d eau Milli-Q en quantité suffisante pour 12,5 µl. La réaction de qpcr est réalisé grâce à un thermocycleur (StepOnePlus Real-Time PCR System, Applied Biosystems, Life Technologies, Saint-Aubin, France) et débute par une étape de chauffage à 95 C pendant 10 minutes, puis est suivie de 40 cycles comprenant une dénaturation de 15 secondes à 95 C et une hybridation-élongation de 1 minute à 60 C. Après le dernier cycle de PCR, la température est rapidement élevée à 95 C ce qui dénature l ADN double brin, puis la température est redescendue à 55 C, ce qui provoque la renaturation de l ADN. La température est alors augmentée lentement de 55 C à 95 C par paliers de 0,5 C toutes les 10 secondes et la fluorescence est lue en continu. Lors de la dernière étape, lorsque la température augmente, l ADN double brin se dissocie peu à peu et les molécules de SYBR Green sont progressivement libérées, diminuant la fluorescence détectée. La température à laquelle 50% de l ADN double brin est dénaturé correspond à la température de fusion (Tm : melting temperature) du produit synthétisé et est spécifique à chaque produit. Pour l amplification spécifique d un gène donné, un seul pic doit être observé sur la courbe de fusion. L utilisation de standards de réaction permet d établir la droite d étalonnage indiquant l efficacité de la réaction pour chaque couple d amorces, essentielle à la quantification. Ce facteur correspond à la proportion moyenne des molécules d ADN cible se dupliquant à chaque cycle d amplification. Pour que la PCR soit interprétable, l efficacité doit être comprise entre 85 et 105%. La droite d étalonnage représente les valeurs de Ct («cycle threshold» ou cycle seuil) obtenues expérimentalement en fonction du logarithme des concentrations en ADNc fixées, issues de la série de dilutions des standards. La valeur de Ct est inversement proportionnelle au logarithme de la concentration initiale en ADNc. Le Ct est le nombre de cycles nécessaires pour que la fluorescence atteigne le seuil de détection de l appareil. Les échantillons sont amplifiés et les valeurs de Ct obtenues à partir des échantillons de concentrations inconnues vont ainsi être traduites en concentrations en ADNc grâce à la droite standard. Traitement des résultats Afin d assurer la qualité et la fiabilité des résultats, les conditions d intérêt sont testées en triplicat et sur trois expériences indépendantes (soient neuf points par condition au total). 83

85 L efficacité doit être dans la plage citée plus haut et l écart entre les duplicats doit être de moins de 1 Ct. L analyse est ensuite effectuée avec le logiciel REST (QIAGEN, Courtaboeuf, France). Ce logiciel a été développé par une équipe anglaise (Pfaffl et al., 2002) et permet de comparer les expressions relatives de deux groupes en se basant sur des tests statistiques de randomisation, s affranchissant ainsi des hypothèses sur la distribution des données. Les résultats sont présentés sous forme de boîtes à moustaches. Analyse par spectroscopie de Résonance Paramagnétique Electronique (RPE) La mise en évidence des espèces radicalaires formées suite à un traitement par le peroxyde d hydrogène (H 2 O 2 ) dans les SN de THP-1 est rendue possible grâce à la spectroscopie de résonance paramagnétique électronique (RPE), associée à la technique de «spin trapping». En effet, la RPE est une des seules méthodes d identification et de quantification directe des radicaux libres. Toutefois, en raison de l importante réactivité de ces espèces et de leur demi-vie très brève, de nombreux composés radicalaires ne peuvent être identifiés par RPE qu après stabilisation par le froid ou par des composés piégeurs appelés «spin-trap». Dans ce travail expérimental, le radical hydroxyle ( OH), radical libre oxygéné extrêmement réactif, dont la demi-vie en milieu biologique est évaluée à 10-9 secondes, peut être mis en évidence grâce à la 5,5 -dimethyl-1-pyrroline-n-oxide (DMPO) (ALEXIS Biochemicals, Enzo Life Sciences, Inc., Villeurbanne, France), «spin trap» de type nitrone, avec lequel il forme un adduit de demi-vie longue (30 minutes) : la DMPO-OH, dont le spectre caractéristique se présente sous la forme d un quadruplet d amplitude 1 : 2 : 2 : 1 (Figure 8). 84

86 Préparation des solutions Figure 8 : Spectre caractéristique du radical DMPO-OH. Préalablement, une solution de mère catalase à UI/ml (Sigma-Aldrich, Saint- Quentin-Fallavier, France) est préparée dans de l H 2 O stérile, aliquotée et conservée à -20 C. La catalase est une enzyme héminique anti-oxydante, qui catalyse la dégradation de l H 2 O 2 en O 2 et H 2 O. Elle est utilisée comme contrôle : en effet, si l adjonction de catalase en excès inhibe l amplitude du signal DMPO-OH, la formation de celui-ci peut donc être attribuable à une interaction entre la DMPO et l H 2 O 2, et non à une autre voie telle que la dégradation d un signal DMPO-OH, par exemple. Extemporanément, une solution mère d H 2 O 2 (Sigma- Aldrich, Saint-Quentin-Fallavier, France) à 1 M est préparée dans du PBS, et des dilutions en série permettent d obtenir des solutions à 2,5 et à 25 mm. Procédure expérimentale Les cellules sont utilisées 48 heures après leur ensemencement dans des plaques 6 puits, cet intervalle de temps correspondant au moment où la seconde stimulation est normalement administrée. Les SN sont prélevés afin de travailler dans un volume final de 1 ml dans les puits contenant des cellules. Des puits «contrôle» ne contenant pas de cellules sont réalisés avec 1 ml de SN prélevé. 10 µl de la solution mère de catalase ou 10 µl d H 2 O stérile (= Catalase 0 UI/ml) ; ainsi que 10 µl d H 2 O 2 à différentes concentrations (2,5 et 25 mm) ou de PBS (= H 2 O 2 0 µm) ; et 17 µl de la solution de DMPO sont ajoutés. Les plaques sont incubées à 37 C pendant exactement 15 minutes et chaque condition est réalisée en triplicat. 500 µl de SN sont prélevés dans un tube Eppendorf et immédiatement plongés dans l azote liquide jusqu au moment de l analyse par RPE. 85

87 Le SN est décongelé et, exactement 45 secondes après la fin de la décongélation, 40 µl d échantillon sont introduits dans un capillaire en quartz, qui est ensuite placé dans la cavité High-Sensitivity (HS) du spectromètre de RPE (EMX 100, X-band, Bruker, Wissembourg, France). Les spectres sont enregistrés à TA, avec les paramètres d acquisition suivants : puissance, 20 mw ; fréquence de la micro-onde, 9,64 GHz ; modulation d amplitude, 0,819 G ; modulation de fréquence, 100 khz ; gain, 6, ; scan rate 1,19 G/s. Analyse des résultats L amplitude des deux raies centrales du spectre RPE de la DMPO-OH est mesurée et les résultats, rapportés au gain, sont exprimés en unités arbitraires (UA ou AU). La moyenne des trois points par condition est calculée et est proportionnelle à la quantité de radical hydroxyle piégé. Les différentes conditions sont ainsi comparées entre elles. Analyses statistiques A part pour la RT-qPCR (Paragraphes «Influence de l ATP sur la régulation de l expression de gènes impliqués dans l inflammation» et «Influence de l H 2 O 2 sur la régulation de l expression de gènes impliqués dans l inflammation»), l ensemble des résultats est présenté sous forme de valeurs moyennes +/- écart-type. L analyse statistique des résultats est réalisée à l aide du logiciel SigmaPlot (Systat Software Inc., San Jose, USA). Les différences entre les traitements ont été jugées statistiquement différentes pour une valeur de p<0,05, déterminée par les tests non paramétriques de Mann-Whitney ou de Kruskal-Wallis (ANOVA On Ranks), suivi d un test post hoc de Dunn s. 86

88 RESULTATS 87

89 Cellules adhérées [%] Mise en place d un modèle cellulaire TLR-indépendant permettant l étude de l inflammasome Effet d un ester de phorbol, le TPA, sur la différenciation des monocytes THP-1 en macrophages Influence du TPA sur l adhésion cellulaire L effet de 20 nm de TPA a tout d abord été rapidement confirmé sur des cellules THP-1 en plaques 6 puits. Une cinétique d adhésion a été réalisée entre 16 et 72 heures après l ensemencement (jour 0). Les cellules ayant adhéré sont comptées après décollement du support. Les résultats sont présentés dans la figure 9 ci-après Temps [heures] Figure 9 : Cinétique d adhérence des cellules après un traitement avec 20 nm TPA. Les cellules sont ensemencées à raison de 0,6 millions de cellules/puits en plaques 6 puits dans 3 ml avec 20 nm TPA et incubées à 37 C entre 16 et 72 heures. Les cellules ayant adhéré sont comptées après une étape de trypsination. Les résultats présentés sont les pourcentages des cellules adhérées par rapport au nombre de cellules ensemencées au jour 0 en fonction du temps. Le pourcentage d adhésion est d au moins 90% dès 16 heures et jusqu à 40 heures, puis on observe une diminution au-delà, jusqu à environ 65% à 72 heures. Il faut cependant noter que le décollement via une trypsination est difficile. L expérience a donc été confortée, après 24 heures d incubation, grâce au comptage des cellules non adhérées dans les surnageants de culture. En moyenne (n=12), 2,6% des cellules n ont pas adhéré. 88

90 L adhésion des THP-1 induite par le TPA s accompagne d un changement de forme des cellules. En effet, les cellules non traitées ont une forme sphérique régulière et sont parfois regroupées en grappes (objectif x4 : Figure 10 A ; objectif x10 : Figure 10 C) ; alors que les cellules traitées changent rapidement de morphologie et adoptent une forme amiboïde (objectif x4 : Figure 10 B ; objectif x10 : Figure 10 D). A B C D THP-1 sans TPA THP-1 + TPA 20 nm Figure 10 : La différenciation des THP-1 s'accompagne d'un changement de morphologie. Les cellules non traitées par le TPA sont ensemencées à raison de 3 millions de cellules dans un flacon de culture de 75 cm² dans 15 ml. Les cellules différenciées par 20 nm TPA sont ensemencées à raison de 0,6 millions de cellules/puits en plaques 6 puits dans 3 ml. Quel que soit le conditionnement, les cellules sont incubées à 37 C. Trois grossissements ont été utilisés afin de visionner la morphologie des cellules non différenciées (THP-1 sans TPA : A et C) ou différenciées par 20 nm de TPA pendant 24 heures (THP-1 + TPA 20 nm : B et D). Objectif x4 : A et B ; Objectif x10 : C et D ; Objectif x20 : encarts. Les prises de vue ont été réalisées 24 heures après l ensemencement. L influence de différentes doses de TPA (5 ; 10 ; 20 ; 50 et 100 nm) sur l adhésion des cellules THP-1 a également été étudiée en plaques 96 puits (5000 cellules/puits). Quelle que soit la concentration en TPA, les cellules ont toutes adhéré et présentent toutes une forme amiboïde caractéristique (résultats non présentés). 89

91 IL-1β [pg/surnageant] IL-1β [pg/lysat] Influence du TPA sur la production d IL-1β Cinétique de la réponse inflammatoire La production d IL-1β dans les surnageants et les lysats cellulaires de THP-1 a été mesurée entre 48,5 et 72 heures après un traitement avec 20 nm de TPA. Les résultats sont exposés dans la figure 11 ci-après. A 10,0 9,0 8,0 7,0 6,0 5,0 4,0 3,0 2,0 1,0 0,0 TPA 0 nm TPA 20 nm Temps [h] B 10,0 9,0 8,0 7,0 6,0 5,0 4,0 3,0 2,0 1,0 0,0 TPA 0 nm TPA 20 nm Temps [h] Figure 11 : Cinétique de la production d'il-1β entre 48,5 et 72 heures. Les cellules sont ensemencées à raison de 5000 cellules/puits en plaques 96 puits dans 200 µl, directement traitées (carrés) ou non (losanges) avec 20 nm TPA et incubées à 37 C. A différents temps entre 48,5 et 72 heures, les surnageants de culture sont récoltés et une lyse «douce» est réalisée via 3 cycles de congélation de 30 minutes/décongélation de 30 minutes. Les dosages IL-1β sont réalisés sur les surnageants (A) et les lysats cellulaires (B) et les résultats présentés sont les moyennes des réplicats (entre 3 et 4) +/- écart-type pour chaque condition. Le seuil de détection du kit est de 0,9332 pg dans le surnageant et 0,12 pg dans le lysat et indiqué en pointillés noirs. Lorsque les macrophages ne sont pas stimulés par du TPA, l IL-1β mesurée dans les surnageants de culture se situe sous le seuil de détectabilité du kit (indiqué en pointillés noirs sur le graphique), qui est de 4 pg/ml, soit 0,9332 pg total dans le surnageant (Figure 11 A). L ajout de TPA à 20 nm seul induit la sécrétion d IL-1β (Figure 11 A), dont la quantité totale produite est relativement stable de 48,5 à 54 heures (entre 1,1 et 1,6 pg/surnageant, soit entre 0,22 et 0,32 fg/cellule) et augmente 72 heures après l ensemencement, où l on obtient 6,4 pg pour 5000 cellules, soit 1,3 fg/cellule (p=0,029 ; test de Mann-Whitney). A l aide du même kit, la quantité d IL-1β mature ou immature (IL-1β et pro-il-1β) présente dans les lysats cellulaires a été dosée. Ceci permet d étudier le pool intracellulaire de protéine non clivée disponible. Une lyse «douce» a été réalisée via 3 cycles de congélation de 30 minutes/décongélation de 30 minutes. En l absence de TPA, la quantité d IL-1β mesurée dans les lysats cellulaires se situe sous le seuil de détectabilité du kit, qui est de 4 90

92 IL-1β [pg/surnageant] pg/ml, soit 0,12 pg total dans le lysat (indiqué en pointillés noirs) (Figure 11 B). L ajout de TPA 20 nm au jour 0 permet d obtenir un niveau basal intracellulaire compris entre 0,5 et 1 pg (soit entre 0,1 et 0,2 fg/cellule), qui n est pas modifié quel que soit le temps d incubation (p=0,052 ; ANOVA On Ranks) (Figure 11 B). Influence de la concentration en TPA sur le niveau basal de production d IL-1β Différentes concentrations en TPA, de 5 à 100 nm, ont également été testées afin de juger de la production basale d IL-1β. Les mesures ont été réalisées après 64 heures de culture et les quantités totales en pg dans le surnageant de culture en fonction du temps sont présentées dans la figure ,0 9,0 8,0 7,0 6,0 5,0 4,0 3,0 2,0 1,0 0, TPA [nm] Figure 12 : Influence du TPA sur la production d'il-1β dans les surnageants de culture. Les cellules sont ensemencées à raison de 5000 cellules/puits en plaques 96 puits dans 200 µl et directement traitées avec différentes concentrations de TPA. Les dosages sont réalisés sur les surnageants de culture récoltés au jour 3 après incubation à 37 C. Les résultats présentés sont les moyennes des réplicats (entre 3 et 4) +/- écart-type pour chaque condition. Le seuil de détection du kit est de 0,9332 pg dans le surnageant et indiqué en pointillés noirs. La quantité d IL-1β produite dans les surnageants de culture ne devient détectable qu à partir d un traitement par 20 nm de TPA et le niveau basal de production augmente progressivement avec l augmentation de la concentration en TPA, allant de 2,3 à 6,5 pg pour 5000 cellules, soit 0,46 fg à 1,3 fg/cellule. Cependant, la significativité n est pas atteinte (p=0,05 ; ANOVA On Ranks, Méthode de Dunn s). Ainsi, le modèle doit utiliser des THP-1 différenciées avec au minimum 20 nm de TPA. 91

93 Effet du LPS sur la production d IL-1β par les THP-1 La nécessité de la stimulation de la voie TLR4 a été explorée grâce à l ajout de LPS. Ainsi, la stimulation par du LPS a été testée 24 heures après l ensemencement et pour 24 heures. Les surnageants ont été récoltés au jour 3 ; soient 64 heures après l ensemencement. Influence du LPS sur la production d IL-1β par des monocytes L influence de 100 ng/ml LPS sur la production d IL-1β par les THP-1 non différenciées (monocytes) a été étudiée. Il est à noter que l ajout de LPS ne permet pas la différenciation d un point de vue de l adhérence et du changement morphologique des cellules THP-1 (résultats non présentés). Après 24 heures d incubation avec le LPS ajouté après 24 heures d ensemencement, la quantité d IL-1β produite dans les surnageants de culture par les THP-1 non différenciées se situe sous le seuil de détectabilité du kit (indiqué en pointillés noirs) (Figure 13 A, première colonne). Au contraire, dans les lysats cellulaires, il est possible de détecter l équivalent de 0,27 pg d IL-1β dans les cellules, soit 0,27 fg/cellule (Figure 13 B, première colonne). 92

94 IL-1β [pg/surnageant] IL-1β [pg/lysat] A 100,0 90,0 80,0 70,0 60,0 50,0 40,0 30,0 20,0 10,0 0,0 TPA B TPA LPS MCC H 2 O LPS LPS MCC H 2 O LPS 10,0 9,0 8,0 7,0 6,0 5,0 4,0 3,0 2,0 1,0 0,0 Figure 13 : Influence du LPS sur la production d IL-1β par les monocytes et les macrophages. Les cellules sont ensemencées à raison de 1000 cellules/puits en plaques 96 puits dans 200 µl et directement traitées ou non avec 20 nm TPA et incubées à 37 C. Au jour 1, 100 ng/ml LPS (LPS) ou son solvant (H 2 O) ou son équivalent volume en milieu de culture complet (MCC) sont ajoutés pour 24 heures. Au jour 2, du milieu de culture est ajouté pour une nuit (16 heures). Au jour 3, les surnageants (A) et les lysats cellulaires (B) sont récoltés puis les dosages sont réalisés. Les résultats présentés sont les moyennes des réplicats (entre 6 et 8) +/- écart-type pour chaque condition. Le seuil de détection du kit est de 0,9332 pg dans le surnageant et de 0,12 pg dans le lysat et indiqué en pointillés noirs. Influence du LPS sur la production d IL-1β par des monocytes en différenciation L effet du LPS à différentes doses (1 à 1000 ng/ml) sur des monocytes en différenciation a été testé en l ajoutant en même temps que le TPA. Les surnageants ont été récoltés au jour 3 et l IL-1β produite quantifiée (Figure 14). 93

95 IL-1β [pg/surnageant] 70,0 60,0 H2O PBS 50,0 40,0 30,0 20,0 10,0 0, LPS [ng/ml] Figure 14 : Influence du LPS sur la production d'il-1β par des monocytes en cours de différenciation. Les cellules sont ensemencées à raison de 5000 cellules/puits en plaques 96 puits dans 200 µl et incubées à 37 C. A l ensemencement, 20 nm TPA et différentes concentrations en LPS sont directement ajoutés. Au jour 2, différents solvants (H 2 O : losanges ; PBS : carrés) sont ajoutés pour 16 heures et les dosages sont réalisés sur les surnageants de culture récoltés au jour 3. Les résultats sont présentés sous forme de moyennes des réplicats (entre 4 et 8 selon les conditions) et de leur écarttype. Le niveau basal de production d IL-1β mesuré dans cette expérience est de 38,6 +/- 5,9 pg/surnageant (solvant H 2 O) et de 22,8 +/- 3 pg/surnageant (solvant PBS) et est statistiquement différent (p=<0,001 ; test de Mann-Whitney). Quel que soit le solvant utilisé, les faibles concentrations de LPS (1 et 10 ng/ml) ne modifient pas le niveau basal. En présence d H 2 O, 1000 ng/ml de LPS induisent significativement l IL-1β à 54 pg/surnageant, soit 10,8 fg/cellule (p<0,05 ; ANOVA On Ranks, Méthode de Dunn s). En présence de PBS, l induction est significative dès 100 ng/ml de LPS (36,8 pg/surnageant, soit 7,4 fg/cellule ; p<0,05 ; ANOVA On Ranks, Méthode de Dunn s). Cela représente une induction maximale de 1,4 pour H 2 O et 1,9 pour le PBS. Il est à noter que pour les faibles doses de LPS (1 et 10 ng/ml), il existe une différence significative liée au solvant (p<0,05 ; test de Mann-Whitney), alors que pour les fortes doses de LPS (100 et 1000 ng/ml), cette différence est atténuée voire annihilée par l induction d IL- 1β par LPS. Influence du LPS sur la production d IL-1β par des macrophages Comme décrit précédemment, l ajout de TPA à 20 nm permet la différenciation et ainsi une production basale d IL-1β. Dans cette expérience, le pool extracellulaire d IL-1β produit est de 45,1 pg dans le surnageant, soit 45,1 fg/cellules (Figure 13 A, deuxième 94

96 colonne). Le pool intracellulaire est de 5,03 pg d IL-1β équivalent, soit 5,03 fg/cellule (Figure 13 B, deuxième colonne). L ajout du solvant du LPS (H 2 O), pendant 24 heures et 24 heures après le TPA, augmente le niveau basal d IL-1β à 73,1 pg dans le surnageant de culture (soit 73,1 fg/cellule) (p<0,01 ; test de Mann-Whitney). Le traitement par LPS 100 ng/ml dans les mêmes conditions ne modifie pas cette sécrétion. Dans les lysats cellulaires, quel que soit le traitement appliqué, milieu de culture, solvant du LPS ou LPS à 100 ng/ml, la production d IL-1β équivalent n est pas modifiée. Ainsi, le stimulus LPS, 24 heures après l ensemencement, ne permet pas d induire plus d IL-1β par rapport au niveau basal. Influence des concentrations de TPA et de LPS sur la production d IL-1β par des macrophages Le LPS à 100 ng/ml n influençant pas la production d IL-1β par les macrophages dans les conditions décrites précédemment, l influence du TPA sur la production d IL-1β LPSinduite a été étudiée. Pour cela, un effet dose du TPA, combiné à un effet dose du LPS a été réalisé, et la production d IL-1β dans les surnageants de culture a été mesurée au jour 3, soit 2 jours et une nuit après l ensemencement (Figure 15). 95

97 IL-1β [pg/surnageant] 45,0 40,0 TPA 5nM TPA 20nM TPA 50nM TPA 100nM 35,0 30,0 25,0 20,0 15,0 10,0 5,0 0, LPS [ng/ml] Figure 15 : Influence de la concentration en TPA et de la concentration en LPS sur la production d IL-1β. Les cellules sont ensemencées à raison de 5000 cellules/puits en plaques 96 puits dans 200 µl et traitées avec différentes concentrations en TPA (5 nm : losanges ; 20 nm : triangles ; 50 nm : croix ; et 100 nm : cercles) et incubées à 37 C. Au jour 1, différentes concentrations en LPS de 0 à 1000 ng/ml sont ajoutés pour 24 heures. Au jour 2, du milieu de culture est ajouté pour une nuit (16 heures). Au jour 3, les surnageants sont récoltés puis les dosages sont réalisés. Les résultats présentés sont les moyennes des quadruplicats +/- écart-type pour chaque condition. Le seuil de détection du kit est de 0,9332 pg dans le surnageant et de 0,12 pg dans le lysat et indiqué en pointillés noirs. Comme décrit précédemment (Paragraphe «Influence de la concentration en TPA sur le niveau basal de production d IL-1β»), la quantité d IL-1β produite dans les surnageants de culture n est détectable qu à partir d un traitement par TPA à 20 nm et le niveau basal de production augmente progressivement avec l augmentation de la concentration en TPA. Après différenciation des cellules avec 20 nm TPA (Figure 15), le LPS n a aucun effet sur l induction d IL-1β quelle que soit la dose testée (p=0,4 ; ANOVA On Ranks). A partir de 50 nm de TPA, on observe une augmentation de la production d IL-1β proche de la significativité dès 10 ng/ml LPS avec un niveau basal de 3,2 pg et un niveau stimulé après LPS 10 ng/ml de 5,7 pg dans le surnageant, soit de 0,64 à 1,14 fg/cellule (p=0,057 ; test de Mann-Whitney). Avec 100 nm de TPA, le LPS induit une production d IL-1β proche de la significativité dès 1 ng/ml augmentant le niveau basal de 6,5 pg à 10,9 pg/surnageant, soit de 1,3 à 2,18 fg/cellule (p=0,057 ; test de Mann-Whitney). Induction d IL-1β inflammasome-dirigée, utilisation de modulateurs caractérisés de l inflammasome NLRP3 Le but du modèle cellulaire mis en place est l étude de modulateurs de l inflammasome. Dans le cadre d une induction d IL-1β TLR4-indépendante, la stimulation 96

98 IL-1β [fg/cellule] IL-1β [fg/cellule] IL-1β [fg/cellule] IL-1β [fg/cellule] par des inducteurs reconnus de l inflammasome (MSU, doxorubicine et nigéricine) a été testée. Ces produits ont été ajoutés 48 heures après l ensemencement et pendant 16 heures. Les surnageants ont été récoltés 64 heures après l ensemencement (Figure 16). A 250,0 200,0 B 250,0 200,0 150,0 150,0 100,0 ** 100,0 50,0 50,0 0, , MSU [µg/ml] Doxorubicine [µm] C 250,0 D 250,0 200,0 200,0 150,0 150,0 100,0 100,0 50,0 50,0 0, , Nigéricine [µm] Glybenclamide [µm] Figure 16 : Influence de modulateurs connus de l'inflammasome sur la production d'il-1β par les macrophages. En fonction des expériences, les cellules sont ensemencées entre 5000 et cellules/puits en plaques 96 puits dans 200 µl ou à raison de 0,6 millions de cellules/puits en plaques 6 puits dans 3 ml, différenciées avec 20 nm TPA et incubées à 37 C pendant 48 heures. Au jour 2, différentes concentrations d inducteurs connus de l inflammasome sont ajoutés pour 16 heures : cristaux d acide urique (MSU) (A), doxorubicine (B) et nigéricine (C) ; ou d inhibiteur sont testés dans les mêmes conditions : glybenclamide en présence de nigéricine 10 µm (D). Les dosages sont réalisés sur les surnageants de culture récoltés au jour 3. Les résultats sont issus d expériences indépendantes et présentés sous forme de moyennes des réplicats (entre 2 et 9 selon les conditions) et de leur écart-type. Dans le cadre d une induction d IL-1β par le MSU (Figure 16 A), les concentrations de 100 et 200 µg/ml augmentent la production d IL-1β par rapport aux faibles concentrations d un facteur environ 30 (p=0,003 ; test de Mann-Whitney). La doxorubicine est un inducteur moins puissant que le MSU (Figure 16 B). En effet, à la plus forte concentration testée (100 µm), la sécrétion d IL-1β par les THP-1 est 2,5 fois plus importante que sans traitement (p=0,054 ; test de Mann-Whitney). Enfin, la nigéricine est le meilleur inducteur parmi les 97

99 trois testés (Figure 16 C). La sécrétion d IL-1β augmente de manière dose-dépendante. A la plus forte concentration de nigéricine (10 µm), la production d IL-1β est induite d environ 136 fois (p<0,05 ; ANOVA On Ranks, Méthode de Dunn s). L utilisation d un inhibiteur connu de l inflammasome NLRP3, la glybenclamide, en présence de la nigéricine à 10 µm, a montré une diminution de la production d IL-1β induite de manière dose-dépendante (Figure 16 D). L inhibition de l induction de la sécrétion d IL-1β dans les surnageants de culture est significative dès 200 µm de glybenclamide (p<0,05 ; ANOVA On Ranks, Méthode de Dunn s) avec une inhibition d environ 74% par rapport au niveau induit par la nigéricine à 10 µm. A la plus forte concentration testée (400 µm), la production d IL-1β est de 19,4 fg/cellule, soit une inhibition d environ 88%. 98

100 Etude de l effet de l ATP sur des macrophages THP-1 en absence d activation de la voie TLR Effet de l ATP sur la production d IL-1β par les THP-1 L ATP est un activateur connu et référencé de l inflammasome au même titre que le MSU, la doxorubicine et la nigéricine, testés précédemment. Le traitement par l ATP met en jeu la voie purinergique et ses récepteurs de type P2, dont certains mécanismes d action ne sont pas encore élucidés. Dans le cadre du modèle cellulaire mis en place, l effet de l ATP sur la production d IL-1β via l activation de l inflammasome NLRP3 a été étudié, ainsi que l implication de la voie purinergique et de ses récepteurs P2X et P2Y. Influence de l ATP sur la production d IL-1β par les macrophages et leur viabilité cellulaire Des cellules THP-1 ont été ensemencées et différenciées avec 20 nm de TPA pendant 48 heures à 37 C, puis les cellules ont été stimulées par différentes concentrations en ATP pendant 16 heures au jour 2 à 37 C. Les surnageants ont été récoltés au jour 3, soit 64 heures après l ensemencement et l IL-1β a été quantifiée (Figure 17 A et B). La viabilité cellulaire a été estimée par la méthode XTT sur les tapis cellulaires (Figure 17 C et D). 99

101 Viabilité cellulaire [%] Viabilité cellulaire [%] IL-1β [fg/cellule] IL-1β [fg/cellule] A 200,0 150,0 B 10,0 8,0 6,0 100,0 4,0 50,0 2,0 0,0 0, , ATP [mm] ATP [mm] C 120 D ,5 1 ATP [mm] ATP [mm] Figure 17 : Influence de l ATP sur la production d IL-1β par les macrophages et leur viabilité cellulaire. Les cellules sont ensemencées à raison de 5000 cellules/puits en plaques 96 puits dans 200 µl, différenciées avec 20 nm TPA et incubées à 37 C. Au jour 2, les cellules sont traitées avec différentes concentrations en ATP (de l ordre du mm (A et C) et du µm (B et D)) pour 16 heures et les surnageants sont récoltés et dosés en IL-1β (A et B). La cytotoxicité est évaluée sur les tapis cellulaires par la méthode XTT et la viabilité est calculée par rapport à la condition non traitée (C et D). Les résultats présentés sont les moyennes des réplicats (entre 3 et 10) +/- écart-type pour chaque condition. Chaque graphique représente les résultats issus de 2 expériences indépendantes. L ATP a été testé à des concentrations d ordres de grandeurs différents (mm : Figure 17 A et C ; µm : Figure 17 B et D). Concernant la production d IL-1β induite par des concentrations en ATP en mm, on observe une induction significative dès 1 mm (p=<0,001 ; test de Mann-Whitney) (Figure 17 A). En effet, on augmente la sécrétion d IL-1β d un facteur environ 2 avec un niveau basal de 39,2 fg/cellule et un niveau stimulé après 1 mm d ATP à 75,6 fg/cellule. Cette induction augmente régulièrement avec l accroissement de la concentration en ATP jusqu à 5 mm (Figure 17 A). A la plus forte concentration testée, 10 mm, on observe une diminution importante de la production d IL-1β dans les surnageants de culture avec un niveau de sécrétion inférieur à celui de base non stimulé (à 10 mm, on obtient 14,5 fg/cellule d IL-1β). L augmentation progressive de la concentration en ATP de 1 à 10 mm concorde avec une diminution progressive de la viabilité cellulaire (Figure 17 C). 100

102 Concernant la production d IL-1β induite par des concentrations en ATP inférieures à 1 mm, on a une induction significative dès 300 µm (p<0,05 ; ANOVA On Ranks, Méthode de Dunn s) (Figure 17 B). En effet, on augmente la sécrétion d IL-1β d un facteur environ 5 avec un niveau basal de 1,5 fg/cellule et un niveau stimulé après 300 µm d ATP à 8,2 fg/cellule dans les surnageants de culture. Cette induction est approximativement identique à 1000 µm, soit 1 mm. Concernant la viabilité cellulaire, l augmentation progressive de la concentration en ATP de 1 à 1000 µm concorde avec une diminution faible et régulière de la viabilité cellulaire (Figure 17 D), dont le minimum est atteint à 1000 µm avec environ 90% de cellules viables. La suite de l étude du rôle de l ATP et de la voie purinergique dans l activation de l inflammasome NLRP3 sera réalisée principalement avec 1 mm ATP, donnant lieu à une induction significative de la production d IL-1β dans les surnageants de culture et à une cytotoxicité faible. Cinétique de la production d IL-1β ATP-induite par les THP-1 Des cellules THP-1 ont été ensemencées et différenciées avec 20 nm de TPA pendant 48 heures à 37 C, puis les cellules ont été stimulées ou non avec l ATP à 1 mm au jour 2 à 37 C. L IL-1β a été dosée dans les surnageants de culture prélevés à différents temps (entre 30 minutes et 24 heures) après la stimulation (Figure 18). 101

103 IL-1β [fg/cellule] 40,0 35,0 30,0 ATP 0mM ATP 1mM 25,0 20,0 15,0 10,0 5,0 0, Temps [h] Figure 18 : Cinétique de la production d'il-1β après traitement par ATP 1 mm au jour 2. Les cellules sont ensemencées à raison de 5000 cellules/puits en plaques 96 puits dans 200 µl, différenciées avec 20 nm TPA et incubées à 37 C. Au jour 2, les cellules sont traitées (carrés) ou non (losanges) avec 1 mm ATP pour différents temps au bout desquels les surnageants sont récoltés et les dosages d IL-1β sont réalisés. Les résultats présentés sont les moyennes des réplicats (entre 3 et 4) +/- écart-type pour chaque condition. Comme décrit précédemment (Paragraphe «Cinétique de la réponse inflammatoire»), l absence de stimulation (ATP 0 mm : losanges) donne lieu à une production d IL-1β basale dans les surnageants de culture relativement stable de 30 minutes à 6 heures (entre 7,4 et 10,2 fg/cellule) et qui augmente après 24 heures à 14,9 fg d IL-1β par cellule (p<0,05 ; ANOVA On Ranks, méthode de Dunn s). On observe une augmentation de la sécrétion d IL-1β ATP-induite (ATP 1 mm : carrés) proche de la significativité dès 6 heures d incubation (p=0,057 ; test de Mann- Whitney). En effet, cette production est de 9,8 fg/cellule après 30 minutes ; de 18,4 fg/cellule après 6 heures ; puis 26,8 fg/cellule après 24 heures d incubation avec l ATP à 1 mm. Il est à noter que dès 4 heures d incubation avec l ATP à 1 mm, il existe une faible augmentation de la production d IL-1β. La suite de l étude du rôle de l ATP et de la voie purinergique dans l activation de l inflammasome NLRP3 sera réalisée principalement avec 1 mm ATP pendant 16 heures au jour 2, donnant lieu à une induction significative de la production d IL-1β dans les surnageants de culture. Des études statistiques seront systématiquement réalisées. 102

104 IL-1β ATP-induite [fg/cellule] Influence des concentrations de TPA et de LPS sur la production d IL-1β ATP-induite par des macrophages Comme décrit précédemment (Paragraphe «Influence des concentrations de TPA et de LPS sur la production d IL-1β par des macrophages»), il est possible de sensibiliser l effet pro-inflammatoire du LPS en augmentant la concentration en TPA. Afin d étudier cet effet de sensibilisation par le TPA et l effet d un prétraitement par le LPS, un effet dose du TPA combiné à un effet dose du LPS a été réalisé, et la production d IL-1β ATP-induite dans les surnageants de culture a été mesurée au jour 3 (Figure 19). En résumé, les THP-1 ont été ensemencées et différenciées avec différentes doses de TPA, puis traitées avec des doses croissantes de LPS 24 heures après l ensemencement, puis traitées avec 1 mm ATP à 48 heures pendant 1 nuit. 16,0 14,0 TPA 5nM TPA 20nM TPA 50nM TPA 100nM 12,0 10,0 8,0 6,0 4,0 2,0 0, LPS [ng/ml] Figure 19 : Sensibilisation de l effet pro-inflammatoire de l ATP sur les macrophages THP-1. Les cellules sont ensemencées à raison de 5000 cellules/puits en plaques 96 puits dans 200 µl, différenciées avec différentes concentrations en TPA (5 nm : losanges ; 20 nm : triangles ; 50 nm : croix ; et 100 nm : cercles) et incubées à 37 C. Au jour 1, les cellules sont traitées avec différentes concentrations en LPS et incubées 24 heures à 37 C. Au jour 2, les cellules sont traitées avec ATP 1 mm pour 16 heures et les surnageants sont récoltés et dosés en IL-1β. Les résultats présentés sont les moyennes des réplicats (entre 3 et 4) +/- écart-type pour chaque condition. Le seuil de détection du kit est de 0,9332 pg dans le surnageant, soit 0,18664 fg/cellule, et indiqué en pointillés noirs. Le seuil de détectabilité du kit est indiqué en pointillés noirs sur la figure 19. Comme décrit précédemment (Paragraphes «Influence de la concentration en TPA sur le niveau basal de production d IL-1β» et «Influence des concentrations de TPA et de LPS sur la production d IL-1β par des macrophages»), la quantité d IL-1β produite dans les surnageants de culture après 1 mm ATP ne devient détectable qu à partir d un traitement par TPA à 20 nm (TPA 20 nm : triangles ; TPA 50 nm : croix ; et TPA 100 nm : cercles). 103

105 Le niveau «basal» de référence dans cette expérience est celui obtenu après une stimulation par ATP 1 mm seul (prétraitement LPS 0 ng/ml) (résultats non présentés). Après 20 nm TPA, la quantité d IL-1β totale ATP-induite est de 0,7 fg/cellule ; de 2,3 fg/cellule après 50 nm TPA ; et de 3,4 fg/cellule après 100 nm TPA dans les surnageants de culture. Quelle que soit la concentration en TPA, le traitement par ATP 1 mm induit en l absence de LPS la production d IL-1β dans les surnageants de culture d un facteur compris entre 1,4 et 3,8. Toutefois cela n atteint pas la significativité (pour TPA 20 nm : p=0,4 ; pour TPA 50 nm et 100 nm : p=0,057 ; test de Mann-Whitney). Après différenciation des cellules avec 20 nm TPA (Figure 19, triangles), on observe un faible effet exacerbant du LPS sur la réponse inflammatoire ATP-induite. En effet, le niveau de production d IL-1β augmente d un facteur 2,3 après un prétraitement avec 100 ng/ml LPS (p=0,057 ; test de Mann-Whitney) et ce niveau atteint un palier jusqu à la dose maximale testée, 1000 ng/ml LPS. L effet exacerbant dû au prétraitement par LPS sur la réponse inflammatoire ATPdépendante, est amplifié par le traitement par 50 nm (Figure 19, croix) et 100 nm TPA (Figure 19, cercles). Cependant, entre ces deux concentrations, il n y a pas de différence significative (test de Mann-Whitney). On note que la production d IL-1β ATP-dépendante augmente régulièrement avec l augmentation de la concentration en LPS. Aux faibles concentrations en LPS (de 0 à 10 ng/ml), la réponse IL-1β ATP-dépendante augmente avec la concentration en LPS (pour TPA 50 nm (croix) : de 2,3 à 9 fg/cellule ; et pour TPA 100 nm (cercles) : de 3,4 à 10,3 fg/cellule). Aux plus fortes concentrations testées (100 et 1000 ng/ml), cette réponse est stable et atteint un palier à environ 13 fg/cellule pour TPA 50 et 100 nm. L effet exacerbant d un prétraitement par LPS sur la réponse inflammatoire ATP-induite est proche de la significativité à 1 ng/ml (p=0,057 ; test de Mann-Whitney) et significativement différent dès 10 ng/ml (p=0,029 ; test de Mann-Whitney). Influence des solvants sur la production d IL-1β ATP-induite par les THP-1 Le solvant recommandé pour la stimulation ATP est H 2 O. Cependant, dans le cadre du modèle, des doubles stimulations ont été testées et d autres solvants introduits simultanément à la stimulation ATP. Ainsi, l influence de divers solvants sur la production d IL-1β ATPinduite a été étudiée. Des cellules THP-1 ont été ensemencées et différenciées avec 20 nm TPA pendant 48 heures à 37 C, puis les cellules ont été stimulées par 1 mm ATP en présence 104

106 de différents solvants pendant 16 heures au jour 2 à 37 C. Les surnageants ont été récoltés au jour 3, soient 64 heures après l ensemencement, et l IL-1β a été quantifiée. Les résultats sont présentés en quantités d IL-1β produite par cellule en fonction du solvant (Figure 20 A) ou en facteurs d induction d IL-1β ATP-dépendante en fonction de différentes concentrations en solvants (Figure 20 B, C et D). Pour la figure 20 A, trois solvants ont été testés : milieu de culture (MCC) ; H 2 O et PBS. De plus, trois conditions de traitement ont été étudiées : le solvant seul (barre d histogramme noire) ; l ATP à 1 mm préparé dans le solvant indiqué (barre d histogramme grise claire) ; 50% du volume distribué en ATP 1 mm préparé dans H 2 O + 50% du volume en solvant indiqué (barre d histogramme grise foncée). 105

107 Facteur d'induction Facteur d'induction IL-1β [fg/cellule] Facteur d'induction A 25,0 20,0 solvant ATP 1mM ATP 1mM + solvant B 3,0 2,5 2,0 15,0 1,5 10,0 1,0 5,0 0,0 MCC H2O PBS 0,5 0,0 0 0,2 0,4 0,6 0,8 1 NaCl [%] C 4,0 D 3,0 3,5 3,0 2,5 2,5 2,0 2,0 1,5 1,5 1,0 0,5 1,0 0,5 0, , DMSO [%] Ethanol [%] Figure 20 : Influence des solvants sur la production d IL-1β ATP-induite. Les cellules sont ensemencées à raison de 5000 cellules/puits en plaques 96 puits dans 200 µl, différenciées avec 20 nm TPA et incubées à 37 C. Au jour 2, les cellules sont traitées avec ATP 1 mm en présence de différents solvants et incubées pendant 16 heures à 37 C. Les surnageants sont récoltés et l IL-1β est dosée. A : au jour 2, différents solvants sont ajoutés seuls (noir) ; ou ATP 1 mm en solution dans ces différents solvants est ajouté (gris clair) ; ou ATP 1 mm en H 2 O + différents solvants (1 : 1 ; v : v) (gris foncé) sont ajoutés pour 16 heures à 37 C. B : ATP 1 mm / NaCl à différentes concentrations (1 : 1 ; v : v) sont ajoutés et l induction d IL-1β par ATP est calculée. C : ATP 1 mm / DMSO à différentes concentrations (1 : 1 ; v : v) sont ajoutés et l induction d IL-1β par ATP est calculée. D : ATP 1 mm / éthanol à différentes concentrations (1 : 1 ; v : v) sont ajoutés et l induction d IL-1β par ATP est calculée. Les résultats sont issus de plusieurs expériences indépendantes et présentés sous forme de moyennes des réplicats (entre 3 et 4 par condition par expérience) +/- écart-type. Concernant la figure 20 A, les niveaux de base non stimulés ne sont pas différents quels que soient les solvants testés (milieu de culture (MCC), H 2 O ou PBS) (barre d histogramme noire) (p=0,143 ; ANOVA On Ranks). Pour les conditions où l ATP est en présence de milieu de culture (MCC) ou en présence d H 2 O, le profil global de stimulation est identique. En effet, que l ATP soit préparé dans le solvant indiqué ou préparé dans l H 2 O et ajouté à volume égal avec le solvant indiqué, la production d IL-1β ATP-induite est identique (pour MCC, p=0,114 ; et pour H 2 O, p=0,933 ; test de Mann-Whitney). Concernant l induction d IL-1β ATP-dépendante, la sécrétion d IL-1β augmente de manière significative en présence de MCC et de H 2 O (p<0,01 ; test de Mann-Whitney), mais également dans le cas où l ATP est 106

108 préparé dans du PBS (p=0,004 ; test de Mann-Whitney). Le facteur d induction moyen pour toutes ces conditions est d environ 2,3. Cependant, quand l ATP est préparé dans son solvant (H 2 O) et ajouté à volume égal avec du PBS, il n y a plus de stimulation de la réponse inflammatoire par l ATP (p=0,083 ; test de Mann-Whitney) et cette condition diffère de celle où l ATP est préparé dans du PBS (p=0,004 ; test de Mann-Whitney). Dans les figures 20 B, C et D, le traitement a été réalisé par 1 mm d ATP préparé dans son solvant (H 2 O) et ajouté à volume égal avec le solvant indiqué (NaCl : B ; DMSO : C ; et Ethanol : D). Les facteurs d induction d IL-1β ATP-dépendante sont représentés en fonction de la concentration en solvant. En l absence de solvant, le facteur d induction est de 2,2 fois le niveau de base de production d IL-1β. Quelle que soit la concentration en NaCl testée (Figure 20 B), de 0 à 0,9%, il n y a pas de modification de l induction d IL-1β ATP-dépendante. En présence de DMSO (Figure 20 C), pour les faibles concentrations (0,052 et 0,52%), l induction de la production d IL-1β ATP-dépendante n est pas modifiée. Cependant, il est à noter qu à 0,1% DMSO, on a une augmentation de l induction de 2,2 à 3,1 (p=0,008 ; test de Mann-Whitney). Pour les plus fortes concentrations testées (1,6 et 2,6%), la production d IL- 1β n est plus induite par l ATP 1 mm et est inférieure à la condition contrôle sans solvant (p=0,004 ; test de Mann-Whitney). En présence d éthanol (Figure 20 D), l induction par ATP 1 mm n est pas modifiée dans le cas de faibles concentrations (de 0 à 0,28%) par rapport à la condition contrôle sans solvant (x2,2). Pour les plus fortes concentrations testées (de 0,69 à 2,8%), la production d IL- 1β est moins induite par ATP 1 mm. A 0,69 et 0,85% d éthanol, le facteur d induction est de 1,6, mais reste significativement différent par rapport à la condition basale ; à 2,8% d éthanol, le facteur d induction n est plus que d environ 1,4. Ces diminutions sont significativement différentes de la condition contrôle sans solvant (pour 0,69% : p=0,01 ; pour 0,85% : p=0,011 ; et pour 2,8% : p=0,002 ; test de Mann-Whitney). Dans le cas d un traitement simple par l ATP, le solvant H 2 O sera utilisé, mais du milieu de culture ou du PBS pourront également être utilisés. Dans le cas d une double stimulation, dû à un risque d inhibition de l induction d IL-1β ATP-dépendante, le second traitement ne devra pas être réalisé en PBS, ni à de fortes concentrations en DMSO (au-delà de 0,52%) ou en éthanol (au-delà de 0,85%). 107

109 Effet de l ATP sur la régulation de la voie IL-1β : implication de l inflammasome NLRP3 La voie menant à la production d IL-1β implique l activation d un inflammasome produisant alors une caspase-1 active. Afin de mieux comprendre le rôle de l ATP dans l activation de l inflammasome, le modèle cellulaire THP-1 a été utilisé pour étudier l expression des gènes et des protéines impliqués. De plus, l effet de l inhibition de protéines constituant l inflammasome NLRP3 a été étudié. Influence de l ATP sur la régulation de l expression de gènes impliqués dans l inflammation Des cellules THP-1 ont été ensemencées en plaques 6 puits à raison de 1 million de cellules par puits et différenciées avec 20 nm TPA pendant 48 heures à 37 C et puis les cellules ont été stimulées par 1 mm d ATP pendant 16 heures au jour 2 à 37 C. Les surnageants ont été récoltés et l IL-1β a été quantifiée (Figure 21 A). Les tapis cellulaires ont été lysés et les ARNs extraits puis rétro-transcrits. L analyse de l expression de gènes en relation avec la voie IL-1β a été réalisée sur les ADNc via qpcr (Figure 21 B). 108

110 Expression relative IL-1β [fg/cellule] A 8,0 7,0 6,0 5,0 4,0 3,0 2,0 1,0 0,0 ATP 0mM ATP 1mM B ,5 0,25 Nlrp3 Il-1β Nf-κb Nod2 Tlr4 Asc Casp-1 Figure 21 : Influence de l ATP sur la régulation de l expression de gènes impliqués dans l inflammation. Les cellules sont ensemencées à raison de 1 million de cellules/puits en plaques 6 puits dans 3 ml, différenciées avec 20 nm TPA et incubées à 37 C. Au jour 2, les cellules sont traitées ou non avec 1 mm ATP et incubées 16 heures à 37 C au bout desquelles les surnageants sont récoltés et dosés en IL-1β (A). Les tapis cellulaires sont lysés grâce à une solution de trizol et les ARNs sont extraits et rétro-transcrits. L analyse de l expression de gènes impliqués dans l inflammation est réalisée via qpcr et le logiciel REST (QIAGEN, Courtaboeuf, France). Les résultats sont issus de 3 expériences indépendantes chacune en triplicats et présentés sous forme de boîtes à moustache de l expression relative de chaque gène d intérêt par rapport au gène de référence de la 36B4 (B). Comme décrit précédemment (Paragraphe «Effet de l ATP sur la production d IL-1β par les THP-1»), l ATP induit de manière significative la production d IL-1β dans les surnageants de culture (x2,9), augmentant le niveau basal de 1,5 fg/cellule à 4,4 fg/cellule (p=0,003 ; test de Mann-Whitney) (Figure 21 A). L analyse de l expression génique normalisée grâce au gène de référence codant pour la protéine 36B4 est résumée dans la figure 21 B et a été réalisée grâce au logiciel REST (QIAGEN, Courtaboeuf, France). Ainsi, après 16 heures de stimulation par l ATP 1 mm au jour 2, l expression des gènes codant pour les protéines caspase-1 et NF-κB n est pas 109

111 modifiée. Certains gènes sont sur-régulés par la stimulation par l ATP, c est le cas de ceux codant pour les protéines NLRP3 et NOD2. En effet, il se produit une augmentation significative d un facteur 1,466 pour le gène Nlrp3 (p=0,009 ; test d hypothèse) et d un facteur 1,729 pour le gène Nod2 (p=0,005 ; test d hypothèse). Le traitement par l ATP induit pour certains gènes une sous-régulation, c est le cas de ceux codant pour les protéines TLR4 et ASC. En effet, on observe une diminution significative de 22,2% pour le gène Tlr4 (p=0,035 ; test d hypothèse) et de 21,4% pour le gène Asc (p=0,009 ; test d hypothèse). Il est à noter que pour le gène codant pour la protéine IL-1β, l expression relative est augmentée d un facteur 2,228 mais la significativité n est pas atteinte (p=0,053 ; test d hypothèse). Influence de l ATP sur la régulation de l expression des protéines liées à l inflammasome NLRP3 Des cellules THP-1 ont été ensemencées en plaques 6 puits à raison de 1 million de cellules par puits et différenciées avec 20 nm de TPA pendant 48 heures à 37 C, puis les cellules ont été stimulées par 1 mm d ATP pendant 16 heures au jour 2 à 37 C. Les surnageants ont été récoltés et l IL-1β a été quantifiée (Figure 22 A). Les tapis cellulaires ont été lysés et l analyse de l expression des protéines de l inflammasome NLRP3 a été réalisée via western blotting (Figure 22 B et C). 110

112 Expression relative IL-1β [fg/cellule] A 8,0 7,0 6,0 5,0 4,0 3,0 2,0 1,0 0,0 ATP 0mM ATP 1mM B C 2,0 1,5 IL-1B ASC CASPASE-1 bande 41kDa NLRP3 CASPASE-1 bande 48kDa 1,0 0,5 0,0 ATP 0mM ATP 1mM Figure 22 : Influence de l ATP sur l expression de protéines impliquées dans l inflammation. Les cellules sont ensemencées à raison de 1 million de cellules/puits en plaques 6 puits dans 3 ml, différenciées avec 20 nm TPA et incubées à 37 C. Au jour 2, les cellules sont traitées ou non avec 1 mm ATP et incubées 16 heures à 37 C au bout desquelles les surnageants sont récoltés et dosés en IL-1β (A). Les tapis cellulaires sont lysées grâce à des cycles de congélation/décongélation afin d extraire et quantifier les protéines. L analyse de l expression de protéines impliquées dans l inflammation est réalisée via western blotting (B) et le logiciel Image Lab (Bio-Rad, Hercules, USA). Les protéines 111

113 d intérêt sont IL-1β (barre d histogramme pointillée), NLRP3 (barre d histogramme grise), ASC (barre d histogramme rayée verticalement) et CASPASE-1 (2 bandes détectées à 48 kda : barre d histogramme blanche et à 41 kda : barre d histogramme noire) (C). Les résultats sont représentatifs d une expérience en triplicats et sous forme d un histogramme des moyennes +/- écart-type de l expression relative de chaque protéine d intérêt par rapport à la protéine de référence β-actine. Comme décrit précédemment (Paragraphes «Effet de l ATP sur la production d IL-1β par les THP-1» et «Influence de l ATP sur la régulation de l expression de gènes impliqués dans l inflammation»), l ATP induit de manière significative la production d IL-1β dans les surnageants de culture d un facteur 3,5, augmentant le niveau basal de 1,1 fg/cellule à 3,8 fg/cellule (p=0,024 ; test de Mann-Whitney) (Figure 22 A). La figure 22 B représente les signaux obtenus pour les bandes migrant aux poids moléculaires indiqués et correspondant aux protéines étudiées, à savoir : IL-1β, NLRP3, ASC et caspase-1. La β-actine est utilisée afin de normaliser l expression pour chaque échantillon. L expérience a été réalisée avec trois échantillons par condition, qui sont : niveau basal non stimulé (H 2 O ou ATP 0 mm) et niveau stimulé (ATP 1 mm). L analyse par densitométrie des bandes détectées est réalisée et présentée dans la figure 22 C. Après une stimulation par l ATP 1 mm, l expression de la protéine caspase-1 est très faible et n est pas modifiée (deux dernières colonnes). En effet, pour la caspase-1, quelle que soit la bande considérée (barre d histogramme blanche pour celle à 48 kda et barre d histogramme noire pour celle à 41 kda), le niveau basal d expression est de 0,019 et 0,011, respectivement pour 48 et 41 kda ; puis de 0,015 et 0,008 après stimulation, respectivement pour 48 et 41 kda. Pour ASC (barre d histogramme rayée verticalement), une diminution de l expression est observée après 1 mm d ATP (de 0,056 à 0,033). Au contraire, on observe une augmentation de l expression des protéines IL-1β et NLRP3. En effet, sans stimulation l expression de l IL-1β est de 0,47 et augmente à 1,12 après 1 mm d ATP (barre d histogramme pointillée). Pour NLRP3, le niveau basal d expression est de 0,06 et augmente à 0,37 (barre d histogramme grise). Il est à noter que la significativité n est pas atteinte que ce soit pour ASC, IL-1β ou NLRP3 (test de Mann- Whitney). Influence de l inhibition des protéines de l inflammasome NLRP3 sur la régulation de la voie IL-1β après induction par ATP Des cellules macrophagiques murines (BMDMs : Figure 23 C) ou humaines (THP-1 : Figure 23 A, B et D) ont été utilisées et stimulées par 1 mm d ATP pendant 16 heures à 37 C en présence ou non d un inhibiteur de pan-caspase à différentes concentrations et différents dosages ont été réalisés (Figure 23). 112

114 IL-1β [fg/cellule] IL-6 [fg/cellule] IL-1β [fg/cellule] p20 Caspase-1 [fg/cellule] A 16,0 B 0,25 14,0 12,0 0,20 10,0 8,0 6,0 0,15 0,10 4,0 2,0 0,05 0, Z-VAD [nm] 0,00 ATP 0mM ATP 1mM ATP 1mM + Z-VAD 5µM C 0,7 0,6 WT ASC -/- NLRP3 -/- D 0,6 0,5 0,5 0,4 0,4 0,3 0,3 0,2 0,2 0,1 0,1 0,0 LPS 10ng/ml LPS 100ng/ml 0 ATP 0mM ATP 1mM ATP 1mM + Z-VAD 50µM Figure 23 : Influence de l ATP sur la voie IL-1β, implication du complexe inflammasome NLRP3. Pour les THP-1 (A ; B ; D), les cellules sont ensemencées entre 5000 et cellules/puits en plaques 96 puits dans 200 µl, différenciées avec 20 nm TPA et incubées à 37 C pendant 48 heures. Pour les BMDMs (C), les cellules sont ensemencées à raison de cellules/puits en plaques 96 puits dans 200 µl, directement traitées avec LPS 10 ou 100 ng/ml et incubées à 37 C pendant 6 heures. Ensuite, les cellules sont traitées avec ATP 1 mm et incubées pendant 16 heures à 37 C au bout desquelles les surnageants sont récoltés (traitement ATP au jour 2 pour les THP-1 et au jour h pour les BMDMs). A : différentes concentrations en Z-VAD, un inhibiteur de pan-caspase, sont ajoutées simultanément à la stimulation ATP et l IL- 1β produite est mesurée dans les surnageants de culture. B : 5 µm de Z-VAD sont ajoutés ou non simultanément à l ATP et la sous-unité p20 de la caspase-1 est quantifiée dans les surnageants. C : BMDMs issus de souris WT (barre d histogramme noire), déficientes pour la protéine ASC (barre d histogramme grise claire) et déficientes pour la protéine NLRP3 (barre d histogramme grise foncée) sont stimulés avec ATP 1 mm et l IL-1β produite est mesurée dans les surnageants de culture. D : 50 µm de Z-VAD sont ajoutés ou non simultanément à l ATP et l IL-6 produite dans les surnageants est mesurée. Les résultats sont issus d expériences indépendantes et présentés sous forme de moyennes des réplicats (entre 3 et 16 en fonction des conditions) +/- écart-type. Le pan-inhibiteur de caspases Z-VAD a été utilisé afin d établir une éventuelle implication d un inflammasome dans la production d IL-1β ATP-induite (Figure 23 A). Pour cela, des THP-1 ont été traitées avec l ATP 1 mm et différentes concentrations en Z-VAD. On observe alors une diminution de la production en IL-1β ATP-dépendante dans les surnageants de culture progressivement avec l augmentation de la concentration en Z-VAD atteignant un palier dès 5 µm. Dans cette expérience, le traitement par l ATP 1 mm induit l IL-1β de 3,4 à 11,3 fg/cellule (résultats non présentés, p=<0,001 ; test de Mann-Whitney) et 113

115 ce taux basal est de nouveau atteint dès le traitement par 5 µm Z-VAD (p=<0,001 ; test de Mann-Whitney). L effet inhibiteur est significatif dès 500 nm Z-VAD avec une production d IL-1β de 6,6 fg/cellule dans les surnageants (p=0,005 ; test de Mann-Whitney). Cette concentration est proche de la valeur EC50, qui est exactement de 466,9 nm et calculée grâce à une régression logistique à quatre paramètres. L implication d un inflammasome activé et donc de la caspase-1 a également été étudiée grâce au dosage de la sous-unité p20 de la caspase-1 (Figure 23 B), qui est libérée sous forme de tétramère avec la sous-unité p10 lors de l activation de l inflammasome. Ainsi, des THP-1 ont été stimulées par 1 mm d ATP en présence ou non de Z-VAD à 5 µm. D une part, on ne montre pas d induction de la sous-unité p20 de la caspase-1 dans les surnageants de culture après stimulation par ATP. En effet, sans ATP la quantité de sous-unité p20 disponible dans les surnageants est de 0,074 et de 0,076 après l ATP 1 mm. D autre part et curieusement, l ajout de Z-VAD à 5 µm augmente de manière significative la quantité de sous-unité p20 de la caspase-1 dans les surnageants, allant de 0,076 à 0,208 fg/cellule (p=0,029 ; test de Mann-Whitney), soit une induction de 2,7. Afin d établir un lien entre la production d IL-1β ATP-induite et l activation de l inflammasome NLRP3, des cellules macrophagiques murines issues de souris sauvages (WT, barre d histogramme noire) et déficientes pour deux protéines de l inflammasome NLRP3 (ASC-/-, barre d histogramme grise claire ; et NLRP3-/-, barre d histogramme grise foncée) ont été utilisées (Figure 23 C). Des études réalisées précédemment au laboratoire (résultats non présentés) ont montré qu un prétraitement de ces cellules par LPS est nécessaire afin d obtenir une production basale d IL-1β. Ainsi, deux concentrations en LPS ont été utilisées en prétraitement (10 et 100 ng/ml), puis une stimulation par l ATP 1 mm a été réalisée. On montre alors que pour les souris sauvages (WT, barre d histogramme noire), on a une production d IL-1β ATP-induite de 0,1 et 0,52 fg/cellule dans le cas d un prétraitement par LPS 10 et 100 ng/ml respectivement. Ces mêmes conditions sont appliquées à des macrophages murins déficients pour la protéine ASC (ASC-/-, barre d histogramme grise claire) ou déficients pour la protéine NLRP3 (NLRP3-/-, barre d histogramme grise foncée). On observe alors une abolition totale de la production d IL-1β ATP-dépendante montrant l implication directe des protéines ASC et NLRP3 dans l effet pro-inflammatoire de l ATP. 114

116 L IL-1β stimule notamment la libération d autres cytokines telles que l IL-6. Afin d observer si les effets inflammatoires de l ATP et de la Z-VAD influencent également l IL-6, des THP-1 sont stimulées par 1 mm d ATP simultanément ou non à 50 µm Z-VAD et l IL-6 produite dans les surnageants de culture est quantifiée (Figure 23 D). Le niveau basal d IL-6 est de 0,11 fg/cellule et est inférieur à celui d IL-1β produit. En effet, pour ces surnageants, l IL-1β a également été quantifiée (résultats non présentés) et le niveau basal est de 3,4 fg/cellule, soit environ 30 fois celui de l IL-6. Le traitement des cellules par 1 mm d ATP provoque une induction d IL-6 de 3,8 fois, proche de la significativité (p=0,057 ; test de Mann-Whitney) et l ajout de Z-VAD résulte en une quantité d IL-6 produite dans les surnageants non détectable, donc une inhibition totale de l induction ATP-dépendante. Globalement, le profil de la sécrétion d IL-6 est identique à celui de l IL-1β suite à un traitement des cellules par ATP et Z-VAD. Implication de la voie purinergique dans la production d IL-1β ATPinduite Comme décrit précédemment, l ATP active la voie purinergique et ses récepteurs de type P2 mais certains points de ce mécanisme ne sont pas encore élucidés. Afin d établir une relation entre la stimulation ATP et cette voie dans le cadre du modèle cellulaire mis en place, différents inhibiteurs pharmacologiques ont été utilisés en prétraitement (Figure 24 B, C et D) ou en co-traitement (Figure 24 A). Leur influence sur la production d IL-1β ATP-induite a été étudiée (Figure 24). 115

117 IL-1β [fg/cellule] IL-1β [fg/cellule] IL-1β [fg/cellule] IL-1β [fg/cellule] A 18,0 16,0 14,0 12,0 10,0 8,0 6,0 4,0 2,0 0, Glybenclamide [µm] B 18,0 16,0 14,0 12,0 10,0 8,0 6,0 4,0 2,0 0,0 ATP 1mM ATP 0,3mM A [µm] C 18,0 16,0 14,0 12,0 10,0 8,0 6,0 4,0 2,0 0, oatp (µm] D 18,0 16,0 14,0 12,0 10,0 8,0 6,0 4,0 2,0 0, U73122 [µm] Figure 24 : Influence d inhibiteurs de la voie purinergique sur la production d IL-1β ATP-induite. Les cellules sont ensemencées à raison de 5000 cellules/puits en plaques 96 puits dans 200 µl, différenciées avec 20 nm TPA et incubées à 37 C. Au jour 2, les cellules sont traitées avec ATP 300 µm (barre d histogramme noire) ou 1 mm (barre d histogramme grise). Différents inhibiteurs de la voie purinergique à différentes concentrations sont ajoutés au jour 1, soit 24 heures avant ATP (B : A ; C : oatp ; D : U73122), ou au jour 2 en même temps que ATP (A : glybenclamide). 16 heures après la stimulation ATP, les surnageants sont récoltés et dosés en IL-1β. Les résultats sont issus de plusieurs expériences indépendantes et présentés sous forme de moyennes des réplicats (entre 4 et 11 en fonction des conditions) +/- écart-type. La glybenclamide est un inhibiteur de l efflux de K+ et agit en aval de P2X7R et en amont de l inflammasome NLRP3. Cet inhibiteur a été utilisé à différentes concentrations simultanément à l ATP (Figure 24 A). Aux faibles concentrations testées (entre 25 et 100 µm), il n y a pas de modification de la production d IL-1β ATP-induite. On note, cependant, que dès 200 µm on a une augmentation significative de la production d IL-1β ATPdépendante dans les surnageants de culture (p<0,05 ; ANOVA On Ranks, Méthode de Dunn s), allant de 7 à 14,8 fg/cellule. La molécule A est un inhibiteur spécifique de P2X7R. Elle a été utilisée en prétraitement sur des THP-1 stimulées avec ATP (Figure 24 B). Quelle que soit la dose testée 116

118 (de 1 à 300 µm) avec l ATP 300 µm ou l ATP 1 mm, il n y a pas de modification de la production d IL-1β ATP-induite. Ces deux inhibiteurs (glybenclamide et A740003) écartent l implication de P2X7R dans la stimulation par ATP. L hypothèse de l implication d autres récepteurs purinergiques de type P2X et P2Y est émise et testée via deux autres inhibiteurs pharmacologiques : oatp, inhibiteur à large spectre des récepteurs P2X ; et U73122, inhibiteur de la phospholipase C, bloquant la signalisation induite par les récepteurs P2Y. Les cellules THP-1 sont alors prétraitées avec oatp à différentes concentrations (100 et 500 µm) et traitées avec 1 mm ATP (Figure 24 C). On constate une diminution de la production d IL-1β ATP-induite graduellement avec l augmentation de la concentration en oatp. L inhibition par oatp est significative dès 100 µm avec une production ATP-induite de 10,6 fg/cellule, diminuée à 7,5 fg/cellule (p=0,029 ; test de Mann-Whitney). L application d une régression logistique à quatre paramètres permet de déterminer l EC50 qui est de 164,4 µm. Un prétraitement avec U73122 à différentes concentrations (de 1,25 à 10 µm) diminue également la production d IL-1β ATP-induite (Figure 24 D). Cette inhibition est significative dès 1,25 µm donnant lieu à un taux d IL-1β produit de 1,3 fg/cellule alors que le niveau basal est de 13,6 fg/cellule (p=0,004 ; test de Mann-Whitney). Implication du stress oxydatif sur la production d IL-1β ATP-induite L influence du stress oxydatif et particulièrement des ROS a été montrée dans l activation de l inflammasome NLRP3. Dans le cadre du modèle cellulaire mis en place, l influence d un piégeur de ROS, la NAC, a été testée sur la production d IL-1β basale (losanges) et ATP-induite (carrés) (Figure 25). 117

119 IL-1β [fg/cellule] 25,0 20,0 ATP 0mM ATP 1mM 15,0 10,0 5,0 0, NAC [mm] Figure 25 : Effets de la NAC sur la production d IL-1β. Les cellules sont ensemencées à raison de 5000 cellules/puits en plaques 96 puits dans 200 µl, différenciées avec 20 nm TPA et incubées à 37 C. Au jour 1, les cellules sont traitées avec différentes concentrations en NAC et incubées 24 heures à 37 C. Au jour 2, les cellules sont traitées avec ATP 1 mm (carrés) ou non (losanges) et incubées 16 heures à 37 C. Les surnageants sont ensuite récoltés et dosés en IL-1β. Les résultats sont issus de 3 expériences indépendantes en triplicats au minimum et présentés sous forme de moyennes des réplicats (entre 11 et 12 en fonction des conditions) +/- écart-type. Les cellules THP-1 ont été prétraitées avec différentes concentrations en NAC (entre 0,3 et 30 mm) puis traitées (carrés) ou non (losanges) avec 1 mm d ATP. Sans stimulation par l ATP, la production d IL-1β est de 3,1 fg/cellule. L ajout de NAC à 0,3 mm ne modifie pas cette production, mais l ajout de 3 mm de NAC augmente de manière significative la sécrétion basale d IL-1β à 6,3 fg/cellule (p=0,013 ; test de Mann-Whitney). A la plus forte concentration testée (30 mm), la NAC inhibe significativement le taux de base d IL-1β à 0,5 fg/cellule (p=<0,001 ; test de Mann-Whitney). Sans NAC, la stimulation par l ATP 1 mm augmente significativement la production d IL-1β à 13 fg/cellule (p=<0,001 ; test de Mann-Whitney). A 0,3 mm de NAC, il n y a pas de modification de la production en IL-1β dans les surnageants de culture. L ajout de 3 mm de NAC augmente significativement l IL-1β à 19,9 fg/cellule (p=0,001 ; test de Mann- Whitney) et la diminue très significativement après 30 mm de NAC à 0,2 fg/cellule (p=<0,001 ; test de Mann-Whitney). 118

120 Etude de l effet de générateurs d espèces radicalaires sur des macrophages THP-1 en l absence d activation de la voie TLR Influence de H 2 O 2 sur la génération de ROS L ajout d H 2 O 2 dans les milieux de culture a un effet pro-inflammatoire et génère des ROS, notamment le radical hydroxyle OH. Afin de mettre en évidence ce radical, la technique de RPE couplée à la technique du spin-trapping a été utilisée. Dans un premier temps, la production d OH a été examinée lorsque l H 2 O 2 est ajoutée dans du milieu chauffé à 37 C. Dans un second temps, l analyse a été répétée avec des surnageants de macrophages dans lesquels l H 2 O 2 avait été ajoutée. Dans les deux cas, deux concentrations d H 2 O 2 ont été testées (25 et 250 µm) et comparées à des contrôles où l H 2 O 2 n avait pas été ajoutée (Figure 26 A). Deux systèmes anti-oxydants ont également été utilisés afin de tenter d influencer le signal induit par H 2 O 2 en RPE et la production d IL-1β (Figure 26 B et C) : la catalase (Figure 26 A et B) et la NAC (Figure 26 C). 119

121 IL-1β [fg/celule] IL-1β [fg/cellule] A B 14,0 12,0 10,0 8,0 6,0 4,0 2,0 0, Catalase [UI/ml] C 14,0 12,0 H2O2 0µM H2O2 125µM 10,0 8,0 6,0 4,0 2,0 0,0 0 0, NAC [mm] Figure 26 : Influence de complexes anti-oxydants sur l effet pro-inflammatoire d H 2 O 2 via la génération de ROS. Les cellules sont ensemencées à raison de 5000 cellules/puits en plaques 96 puits dans 200 µl (B et C) ou à raison de 1 million de cellules/puits en plaques 6 puits (A), différenciées avec 20 nm TPA et incubées à 37 C. Au jour 2, les cellules sont traitées avec différentes concentrations d H 2 O 2 en présence ou non de différents complexes anti-oxydants. A : des traitements par H 2 O 2 25 µm (barre d histogramme bleue) et 250 µm (barre d histogramme violette) ou non (barre d histogramme grise et blanche) sont appliqués simultanément à la catalase 1000 UI/ml (CAT) (barre d histogramme grise, bleue foncée et violette) ou non (barre d histogramme blanche, bleue claire et rose) et ajoutés à du milieu complet seul (barre d histogramme unie) ou avec 1 million de cellules (barre d histogramme hachurée) pendant 15 minutes à 37 C. Les espèces radicalaires formées sont mises en évidence par RPE associée à la technique de spin trapping. B et C : Les cellules sont ensemencées à raison de 5000 cellules/puits en plaques 96 puits dans 200 µl, différenciées avec 20 nm TPA et incubées à 37 C. Au jour 1, les cellules sont traitées avec différentes concentrations en PEG-Catalase (B) ou NAC (C) et incubées 24 heures à 37 C. Au jour 2, les 120

122 cellules sont traitées avec H 2 O µm (barre d histogramme grise) ou non (barre d histogramme noire) et incubées 16 heures à 37 C. Les surnageants sont ensuite récoltés et dosés en IL-1β. Les résultats sont issus de plusieurs expériences indépendantes et présentés sous forme de moyennes des réplicats (entre 3 et 4 par condition par expérience) +/- écart-type. Dans la figure 26 A, on observe que la présence de cellules (barre d histogramme hachurée) ne modifie pas le signal DMPO-OH par rapport à l absence de cellules THP-1 (barre d histogramme unie). En absence de traitement par H 2 O 2 (barre d histogramme blanche), la hauteur du signal est d environ 3,4 et n est pas modifié par la présence de catalase (hauteur d environ 3,3) (barre d histogramme grise). L ajout d H 2 O 2 augmente la hauteur du signal à environ 5,6 pour 25 µm (barre d histogramme bleue claire) et 4,8 pour 250 µm (barre d histogramme rose). Un co-traitement par 1000 UI/ml de catalase (barre d histogramme bleue foncée et violette), dont l activité enzymatique est censée dégrader 15 mmol d H 2 O 2 en 15 minutes (temps de réaction), a été utilisé. Quelle que soit la concentration en H 2 O 2 testée (25 µm et 250 µm), la totalité devrait donc théoriquement être dégradée. Cependant à 250 µm, il n y a pas de modification de la hauteur du signal en présence de catalase (barre d histogramme violette), qui est d environ 4,5. On remarque cependant qu à 25 µm d H 2 O 2, on observe une diminution du signal à environ 4,4 par la catalase (barre d histogramme bleue foncée). Il est à noter que toutes ces modifications n atteignent pas la significativité (test de Mann-Whitney). Concernant la production d IL-1β, la catalase, en fonction des concentrations testées (de 12,5 à 50 UI/ml), induit un profil en «dents de scie» (Figure 26 B). En effet, l ajout d H 2 O µm provoque l augmentation du niveau basal de 0,8 à 8,9 fg/cellule (p=0,029 ; test de Mann-Whitney). Cette induction est significativement diminuée pour les concentrations en catalase de 12,5 et 50 UI/ml à 4,3 et 3 fg/cellule respectivement (p=0,029 ; test de Mann-Whitney). A 25 UI/ml, la sécrétion d IL-1β n est pas modifiée (10,6 fg/cellule). Les cellules THP-1 ont également été prétraitées avec différentes concentrations de NAC (entre 0,3 et 30 mm) (Figure 26 C) puis traitées (barre d histogramme grise) ou non (barre d histogramme noire) avec 125 µm H 2 O 2. Sans stimulation par l H 2 O 2, la production d IL-1β est de 1,2 fg/cellule. Comme observé précédemment (Paragraphe «Implication du stress oxydatif sur la production d IL-1β ATP-induite»), l ajout de NAC seule de 0,3 à 3 mm augmente de manière significative la production basale d IL-1β à 2,4 et 3,4 fg/cellule respectivement (p=0,034 et p=0,015 respectivement ; test de Mann-Whitney). A la plus forte concentration testée (30 mm), la NAC inhibe significativement le taux de base d IL-1β à 0,3 fg/cellule (p=0,015 ; test de Mann-Whitney). L ajout de 125 µm H 2 O 2 augmente la 121

123 production d IL-1β à 6,8 fg/cellule et la significativité est atteinte (p=<0,001 ; test de Mann- Whitney). L augmentation de la concentration en NAC induit une diminution progressive de la production d IL-1β H 2 O 2 -dépendante. En effet, à 0,3 mm, il n y a pas de modification de la production en IL-1β dans les surnageants de culture (8,8 fg/cellule ; p=0,263 ; test de Mann- Whitney). Dès l ajout de 3 mm de NAC, on observe une diminution significative de la sécrétion en IL-1β avec un taux de 3,1 fg/cellule (p=0,01 ; test de Mann-Whitney). Cette inhibition de l induction d IL-1β par H 2 O 2 est maximale avec 30 mm de NAC, condition pour laquelle seulement 0,2 fg d IL-1β par cellule est détectée (p=<0,001 ; test de Mann-Whitney). Effet de générateurs de ROS sur la production d IL-1β par les THP-1 L activation de l inflammasome NLRP3 nécessite l intervention des ROS, qui ont été reconnues comme un signal secondaire commun dans le mécanisme d activation. Le processus par lequel ces ROS agissent fait l objet d hypothèses diverses (intervention de l ADN mitochondrial, rôle de la protéine de réponse au stress TXNIP ou encore implication du système anti-oxydant). Dans le cadre du modèle cellulaire mis en place, le rôle de générateurs d espèces radicalaires sur la production d IL-1β via l activation de l inflammasome NLRP3 a été étudié et l élucidation du mécanisme mis en jeu a été tentée. Influence de générateurs de ROS sur la production d IL-1β par les macrophages et leur viabilité cellulaire Des cellules THP-1 ont été ensemencées et différenciées avec 20 nm de TPA pendant 48 heures à 37 C et puis les cellules ont été stimulées par différentes concentrations en H 2 O 2 (Figure 27 A et C) ou tbhp (tert-butyl hydroperoxyde) (Figure 27 B et D) pendant 16 heures au jour 2 à 37 C. Les surnageants ont été récoltés au jour 3 et l IL-1β a été quantifiée (Figure 27 A et B). La viabilité cellulaire a été estimée par la méthode XTT sur les tapis cellulaires (Figure 27 C et D). 122

124 Viabilité cellulaire [%] Viabilité cellulaire [%] IL-1β [fg/cellule] IL-1β [fg/cellule] A 25, cellules cellules B 25,0 20,0 20,0 15,0 15,0 10,0 10,0 5,0 5,0 0,0 0 31,3 62, , H 2 O 2 [µm] tbhp [µm] C cellules cellules D H 2 O 2 [µm] tbhp [µm] Figure 27 : Influence de générateurs de ROS sur la production d IL-1β par les macrophages et leur viabilité cellulaire. Les cellules sont ensemencées entre 5000 (barre d histogramme et courbe noires) et cellules/puits (barre d histogramme grise) en plaques 96 puits dans 200 µl, différenciées avec 20 nm TPA et incubées à 37 C. Au jour 2, les cellules sont traitées avec différentes concentrations en H 2 O 2 (A et C) ou tbhp (B et D) (de l ordre du µm) pour 16 heures et les surnageants sont récoltés et dosés en IL-1β (A et B). La cytotoxicité est évaluée sur les tapis cellulaires par la méthode XTT et la viabilité est calculée par rapport à la condition non traitée (C et D). Les résultats présentés sont les moyennes des réplicats (entre 4 et 8) +/- écart-type pour chaque condition. A et B : les résultats sont issus d une expérience représentative pour chaque traitement. C et D : les résultats sont issus de 2 expériences indépendantes pour chaque traitement. La stimulation des cellules THP-1 par l H 2 O 2 donne lieu à un profil inflammatoire en forme de «cloche» (Figure 27 A). En effet, à 5000 cellules par puits (barre d histogramme noire), on induit la production d IL-1β dès 62,5 µm d H 2 O 2, augmentant le niveau basal de 3,2 à 15 fg/cellule (p=0,029 ; test de Mann-Whitney) et le maximum d induction est atteint avec 125 µm à 15,9 fg/cellule (p=0,029 ; test de Mann-Whitney). A 250 µm, l IL-1β est également induite, mais de manière moins importante que pour les valeurs d H 2 O 2 plus faibles, on produit 7,2 fg d IL-1β par cellule (p=0,029 ; test de Mann-Whitney). Il est à noter que pour les concentrations en H 2 O 2 encadrant celles précédemment citées, on augmente légèrement la production d IL-1β mais que la significativité n est pas atteinte (p=0,057 ; test de Mann-Whitney). Avec cellules par puits (barre d histogramme grise), on observe un 123

125 profil inflammatoire similaire mais déplacé concernant les concentrations en H 2 O 2. En effet, l induction d IL-1β est significative dès 250 µm avec une augmentation du niveau de base de 0,3 à 1,5 fg/cellule (p=0,029 ; test de Mann-Whitney). Le maximum de production est atteint à 500 µm avec 7,5 fg d IL-1β par cellule (p=0,029 ; test de Mann-Whitney) ; puis pour les concentrations supérieures testées (1000 et 2000 µm), on a une induction plus faible mais significative de la production d IL-1β dans les surnageants de culture (p=0,029 ; test de Mann-Whitney). Il est à noter qu en fonction des conditions d ensemencement, le niveau basal d IL-1β produit n est pas le même, il est plus élevé avec 5000 cellules par puits (3,2 fg/cellule) qu avec cellules par puits (0,3 fg/cellule). Dans les deux conditions, l EC50 a été calculée grâce à une régression logistique à quatre paramètres. Elle est de 41,6 µm H 2 O 2 à 5000 cellules et de 335,7 µm H 2 O 2 à cellules. Concernant la cytotoxicité (Figure 27 C), le profil obtenu en fonction des concentrations en H 2 O 2 est globalement identique pour les deux densités d ensemencement. Cependant, avec cellules (carrés), la chute de la viabilité cellulaire est plus importante qu avec 5000 cellules (losanges). En effet, avec cellules, la toxicité est d environ 15% avec 125 µm et augmente à 40% à 250 µm puis atteint un maximum dès 500 µm avec seulement environ 15 à 20% de cellules viables. Avec 5000 cellules, la chute de la viabilité cellulaire est moins importante avec un maximum de toxicité d environ 20% atteint dès 250 µm. Aux concentrations induisant fortement de l IL-1β (62,5 et 125 µm), la toxicité est respectivement de 1,5 et 9%. Dans la suite du travail, pour une stimulation de la production d IL-1β par l H 2 O 2, avec 5000 cellules par puits, 125 µm seront utilisés ; avec cellules par puits, 250 µm seront utilisés. Le tbhp, un générateur de ROS plus stable, a été testé car H 2 O 2 a tendance à se dégrader au cours du temps (Figure 27 B). Le profil global d induction d IL-1β en fonction des concentrations en tbhp testées est identique à celui d H 2 O 2, en forme de «cloche». En effet, on augmente progressivement la production d IL-1β dans les surnageants de culture avec l augmentation de la concentration en tbhp et un maximum d induction est atteint à 100 µm, augmentant le niveau basal de 3,2 à 19,1 fg/cellule (p=0,029 ; test de Mann-Whitney). A 200 µm, concentration la plus forte testée, on observe le début d une diminution de l induction de l IL-1β par tbhp, avec seulement 15,5 fg/cellule. Quelle que soit la concentration testée de 12,5 à 200 µm tbhp, l induction d IL-1β est significative (p=0,029 ; 124

126 IL-1β [fg/cellule] test de Mann-Whitney). L application d une régression logistique à quatre paramètres a permis la détermination de l EC50 à 34 µm. Concernant la cytotoxicité du tbhp (Figure 27 D), on diminue faiblement la viabilité cellulaire avec l augmentation de sa concentration. En effet, jusqu à 25 µm la toxicité est d environ 0 à 5% ; puis de 10% pour 50 et 100 µm et atteint finalement un maximum de 20% environ à 200 µm. Dans la suite du travail, pour une stimulation de la production d IL-1β par tbhp, avec 5000 cellules par puits, 100 µm seront utilisés. Cinétique de la production d IL-1β H 2 O 2 -induite par les THP-1 La cinétique de production d IL-1β par des cellules THP-1 différenciées (20 nm TPA pendant 48 heures), stimulées avec H 2 O µm. L IL-1β a été dosée dans les surnageants de culture entre 30 minutes et 24 heures (Figure 28). 7,0 6,0 H2O2 0µM H2O2 125µM 5,0 4,0 3,0 2,0 1,0 0, Temps [h] Figure 28 : Cinétique de la production d IL-1β après traitement par 125 µm H 2 O 2 au jour 2. Les cellules sont ensemencées à raison de 5000 cellules/puits en plaques 96 puits dans 200 µl, différenciées avec 20 nm TPA et incubées à 37 C. Au jour 2, les cellules sont traitées (carrés) ou non (losanges) avec 125 µm H 2 O 2 pour différents temps au bout desquels les surnageants sont récoltés et les dosages d IL-1β sont réalisés. Les résultats présentés sont les moyennes des quadruplicats +/- écart-type pour chaque condition. Comme décrit précédemment (Paragraphes «Cinétique de la réponse inflammatoire» et «Cinétique de la production d IL-1β ATP-induite par les THP-1»), l absence de stimulation (H 2 O 2 0 µm : losanges) donne lieu à une production d IL-1β basale dans les surnageants de culture relativement stable de 30 minutes à 6 heures au cours du jour 2 (entre 0,2 et 0,3 fg/cellule) et qui augmente après 24 heures à 1,3 fg d IL-1β par cellule (p=0,029 ; test de Mann-Whtiney). 125

127 En présence d H 2 O µm (carrés), le profil de sécrétion d IL-1β H 2 O 2 -induite se présente sous forme de paliers. En effet, entre 30 minutes et 2 heures, la production d IL-1β dans les surnageants de culture est stable à environ 0,2-0,3 fg/cellule, puis elle augmente progressivement entre 2 heures et 6 heures et atteint un second palier dès 6 heures jusqu à 24 heures à environ 5-5,4 fg/cellule. L induction d IL-1β est significative dès 4 heures avec une augmentation de 17,5 fois le niveau à 2 heures (de 0,2 à 3,5 fg/cellule, p=0,029 ; test de Mann-Whitney). Entre 4 et 6 heures, on a également une augmentation significative de la production d IL-1β à 5 fg/cellule (p=0,029 ; test de Mann-Whitney). A 24 heures, le taux d IL-1β produite est de 5,4 fg/cellule et n est pas différent de celui à 6 heures. Si l on compare la stimulation par H 2 O µm (carrés) par rapport aux cellules non stimulées (losanges), on a une induction significative de 11,7 fois de la production d IL-1β par H 2 O 2 dès 4 heures avec une augmentation du niveau de base de 0,3 à 3,5 fg/cellule (p=0,029 ; test de Mann-Whitney). Le facteur d induction augmente à 25 fois après 6 heures et atteint finalement 4,2 fois le niveau de base après 24 heures d H 2 O µm. La suite de l étude du rôle de générateurs d espèces radicalaires dans l activation de l inflammasome NLRP3 sera réalisée principalement avec 125 µm d H 2 O 2 pendant 16 heures au jour 2, donnant lieu à une induction significative et maximale de la production d IL-1β dans les surnageants de culture. Influence des concentrations de TPA et de LPS sur la production d IL-1β H 2 O 2 -induite par des macrophages Comme décrit précédemment (Paragraphes «Influence des concentrations en TPA et en LPS sur la production d IL-1β par des macrophages» et «Influence des concentrations de TPA et de LPS sur la production d IL-1β ATP-induite par des macrophages»), il est possible de sensibiliser l effet pro-inflammatoire du LPS en augmentant la concentration en TPA. Afin d étudier cet effet de sensibilisation par le TPA et le LPS, un effet dose du TPA combiné à un effet dose du LPS a été testé sur la production d IL-1β H 2 O 2 -induite dans les surnageants de culture (Figure 29). En résumé, les THP-1 ont été ensemencées et différenciées avec différentes doses de TPA pendant 24 heures, puis prétraitées avec différentes doses de LPS pendant 24 heures supplémentaires, puis traitées avec 125 µm H 2 O 2 pendant 1 nuit. 126

128 IL-1β H 2 O 2 -induite [fg/cellule] 12,0 TPA 5nM TPA 20nM TPA 50nM TPA 100nM 10,0 8,0 6,0 4,0 2,0 0, LPS [ng/ml] Figure 29 : Sensibilisation de l effet pro-inflammatoire d H 2 O 2 sur les macrophages THP-1. Les cellules sont ensemencées à raison de 5000 cellules/puits en plaques 96 puits dans 200 µl, différenciées avec différentes concentrations en TPA (5 nm : losanges ; 20 nm : triangles ; 50 nm : croix ; et 100 nm : cercles) et incubées à 37 C. Au jour 1, les cellules sont traitées avec différentes concentrations en LPS et incubées 24 heures à 37 C. Au jour 2, les cellules sont traitées avec H 2 O µm pour 16 heures et les surnageants sont récoltés et dosés en IL-1β. Les résultats présentés sont les moyennes des réplicats (entre 3 et 4) +/- écart-type pour chaque condition. Le seuil de détection du kit est de 0,9332 pg dans le surnageant, soit 0,18664 fg/cellule, et indiqué en pointillés noirs. Le seuil de détectabilité du kit est indiqué en pointillés noirs sur la figure 29. Comme décrit précédemment (Paragraphes «Influence de la concentration en TPA sur le niveau basal de production d IL-1β», «Influence des concentrations de TPA et de LPS sur la production d IL-1β par des macrophages» et «Influence des concentrations de TPA et de LPS sur la production d IL-1β ATP-induite par des macrophages»), la quantité d IL-1β produite dans les surnageants de culture après 125 µm H 2 O 2 ne devient détectable qu à partir d un traitement par TPA à 20 nm (TPA 20 nm : triangles ; TPA 50 nm : croix ; et TPA 100 nm : cercles). Le niveau «basal» de référence dans cette expérience est celui après une stimulation par H 2 O µm seul sans prétraitement par le LPS (résultats non présentés). Après 20 nm TPA, la quantité d IL-1β totale H 2 O 2 -induite est de 0,3 fg/cellule ; de 1,7 fg/cellule après 50 nm TPA ; et de 3,5 fg/cellule après 100 nm TPA. Cependant, à 20 nm TPA, en l absence de LPS, il n y a pas d induction de la production d IL-1β par H 2 O µm. Pour les deux plus fortes doses en TPA testées (50 et 100 nm), en absence de LPS, le traitement par H 2 O 2 induit la sécrétion d IL-1β d un facteur environ 2,7-2,8 mais la significativité n est pas atteinte (pour TPA 50 nm : p=0,1 ; et pour TPA 100 nm : p=0,057 ; test de Mann-Whitney). Après différenciation avec 20 nm TPA (triangles), on a une induction significative de la production en IL-1β dans les surnageants de culture à partir d un prétraitement par LPS

129 ng/ml (p=0,029 ; test de Mann-Whitney). Après différenciation des THP-1 par TPA 50 nm (croix), le LPS exacerbe la réponse inflammatoire provoquée par l ajout de 125 µm H 2 O 2. En effet, dès 1 ng/ml LPS, on augmente la production d IL-1β dans les surnageants de culture d un facteur 1,9 proche de la significativité (p=0,057 ; test de Mann-Whitney). Ce profil est identique après différenciation par TPA 100 nm (cercles) et la significativité est atteinte (p=0,029 ; test de Mann-Whitney). Par ailleurs, dès 10 ng/ml LPS, il n y a pas de différence significative entre TPA 50 (croix) et 100 nm (cercles) (test de Mann-Whitney). Pour ces deux dernières conditions, on note qu aux faibles concentrations en LPS (de 0 à 10 ng/ml), la production d IL-1β H 2 O 2 -dépendante augmente régulièrement avec l augmentation de la concentration en LPS (pour TPA 50 nm (croix) : de 3,2 à 7,3 fg/cellule ; et pour TPA 100 nm (cercles) : de 3,5 à 6,6 fg/cellule). Aux plus fortes concentrations testées (10, 100 et 1000 ng/ml LPS), cette réponse est stable et atteint un palier à environ 7-8 fg/cellule pour TPA 50 et 100 nm. Influence des solvants sur la production d IL-1β H 2 O 2 -induite par les THP- 1 Dans le cadre du modèle, des doubles stimulations ont été testées et d autres solvants introduits simultanément à la stimulation H 2 O 2. Ainsi, l influence de divers solvants sur la production d IL-1β H 2 O 2 -induite a été étudiée. Des cellules THP-1 ont été ensemencées et différenciées avec 20 nm TPA pendant 48 heures à 37 C, puis les cellules ont été stimulées par 125 µm H 2 O 2 en présence de différents solvants pendant 16 heures au jour 2 à 37 C. Les surnageants ont été récoltés au jour 3, soient 64 heures après l ensemencement, et l IL-1β a été quantifiée. Les résultats présentent la quantité d IL-1β produite par cellule en fonction du solvant (Figure 30 A) ou les facteurs d induction en fonction de différentes concentrations en solvants (Figure 30 B, C et D). Pour la figure 30 A, deux solvants ont été testés : H 2 O et PBS. De plus, deux conditions de traitement des cellules ont été étudiées : le solvant seul (barre d histogramme noire) et H 2 O µm préparé dans le solvant indiqué (barre d histogramme grise). 128

130 Facteur d'induction Facteur d'induction IL-1β [fg/cellule] Facteur d'induction A 25,0 20,0 solvant H2O2 125µM B 6,0 5,0 4,0 15,0 3,0 10,0 2,0 1,0 5,0 0,0 H2O PBS 0,0 0 0,2 0,4 0,6 0,8 1 NaCl [%] C 8,0 D 14,0 7,0 6,0 5,0 4,0 3,0 2,0 1,0 12,0 10,0 8,0 6,0 4,0 2,0 0, , DMSO [%] Ethanol [%] Figure 30 : Influence des solvants sur la production d IL-1β H 2 O 2 -induite. Les cellules sont ensemencées à raison de 5000 cellules/puits en plaques 96 puits dans 200 µl, différenciées avec 20 nm TPA et incubées à 37 C. Au jour 2, les cellules sont traitées avec 125 µm H 2 O 2 en présence de différents solvants et incubées pendant 16 heures à 37 C. Les surnageants sont récoltés et l IL-1β est dosée. A : au jour 2, différents solvants sont ajoutés seuls (barre d histogramme noire) ; ou H 2 O µm en solution dans ces différents solvants est ajouté (barre d histogramme grise) sont ajoutés pour 16 heures à 37 C. B : H 2 O µm / NaCl à différentes concentrations (1 : 1 ; v : v) sont ajoutés et l induction d IL-1β par H 2 O 2 est calculée. C : H 2 O µm / DMSO à différentes concentrations (1 : 1 ; v : v) sont ajoutés et l induction d IL-1β par H 2 O 2 est calculée. D : H 2 O µm / éthanol à différentes concentrations (1 : 1 ; v : v) sont ajoutés et l induction d IL-1β par H 2 O 2 est calculée. Les résultats sont issus de plusieurs expériences indépendantes et présentés sous forme de moyennes des réplicats (entre 3 et 4 par condition par expérience) +/- écart-type. Globalement, les niveaux de base non stimulés ne sont pas différents quels que soient les solvants testés (H 2 O ou PBS, barre d histogramme noire, Figure 30 A) (p=0,343 ; test de Mann-Whitney). En présence d H 2 O, on a une induction significative de la production d IL- 1β par H 2 O 2 dans les surnageants de culture (p=0,029 ; test de Mann-Whitney). En effet, en présence d H 2 O, on augmente le niveau de base de 3,2 à 9,8 fg/cellule. En présence de PBS, on augmente le taux basal d IL-1β de 4,3 à 18,1 fg/cellule mais la significativité n est pas atteinte (p=0,057 ; test de Mann-Whitney). Dans les figures 30 B, C et D, le traitement a été réalisé par 125 µm H 2 O 2 préparé dans son solvant (PBS) et ajouté à volume égal avec le solvant indiqué (NaCl : B ; DMSO : 129

131 C ; et Ethanol : D). Les facteurs d induction d IL-1β H 2 O 2 -dépendante sont représentés en fonction de la concentration en solvant. En l absence de solvant, le facteur d induction est de 4,2 fois le niveau de base de production d IL-1β. Quelle que soit la concentration en NaCl testée (Figure 30 B), de 0 à 0,9%, il n y a pas de modification de l induction d IL-1β H 2 O 2 - dépendante. Cependant, à 0,41%, on diminue l induction de la production d IL-1β à un facteur de 2,9 et cette différence est proche de la significativité (p=0,057 ; test de Mann- Whitney). En présence de DMSO (Figure 30 C), pour les faibles concentrations (0,1 et 0,52%), il n y a pas de modification de l induction d IL-1β H 2 O 2 -dépendante. Cependant, à 0,3% de DMSO, on a une diminution de l induction de 4,2 à 2,3 (p=0,029 ; test de Mann-Whitney). Pour les plus fortes concentrations testées (1,6 et 2,6%), il n y a plus d induction de la production d IL-1β par 125 µm H 2 O 2 (facteur compris entre 0,9 et 1,3). Globalement, quelles que soient les concentrations en éthanol testées (de 0,23 à 2,8%) (Figure 30 D), il n y a pas de modification de la production d IL-1β H 2 O 2 -induite par rapport à la condition contrôle sans solvant. Néanmoins, à 0,69% éthanol, l induction de la sécrétion d IL-1β H 2 O 2 -dépendante est significativement diminuée de 4,2 à 2,7 (p=0,034 ; test de Mann-Whitney). Influence de générateurs de ROS sur la production d IL-1β à «grande échelle» La mise au point de l induction de la production d IL-1β par H 2 O 2 a été réalisée en plaques 96 puits contenant 5000 à cellules par puits dans 200 µl («petite échelle»). La transposition de ce modèle a été testée en plaques 6 puits en utilisant différentes densités cellulaires dans 3 ml par puits («grande échelle»). Le but est de collecter un nombre suffisant de cellules par condition afin de réaliser des études moléculaires. Pour cela, des THP-1 différenciées ont été traitées par différentes concentrations en générateurs de ROS (H 2 O 2 et tbhp) pendant 16 heures. La quantité d IL-1β a été mesurée dans les surnageants de culture et la viabilité cellulaire estimée par la méthode du XTT (Figure 31). 130

132 IL-1β [fg/cellule] Viabilité cellulaire [%] IL-1β [fg/cellule] Viabilité cellulaire [%] IL-1β [fg/cellule] Viabilité cellulaire [%] A 14,0 12, , ,0 6,0 4,0 2,0 0, H 2 O 2 [µm] B 14,0 12, , ,0 6,0 4,0 2,0 0, tbhp [µm] C H2O2 0µM H2O2 500µM Cytotoxicité H2O2 500µM 14,0 12, ,0 8,0 6,0 4,0 2,0 0, Densité cellulaire [cellules/puits] Figure 31 : Influence de générateurs de ROS sur la production d IL-1β par les macrophages et leur viabilité cellulaire à «grande échelle». 131

133 Les cellules sont ensemencées entre et 1 million de cellules/puits en plaques 6 puits dans 3 ml, différenciées avec 20 nm TPA et incubées à 37 C. Au jour 2, les cellules sont traitées (barre d histogramme noire) ou non (barre d histogramme grise) avec différentes concentrations de l ordre du µm en H 2 O 2 (A et C) ou tbhp (barre d histogramme noire) (B) pour 16 heures et les surnageants sont récoltés et dosés en IL-1β. La cytotoxicité est évaluée sur les tapis cellulaires par la méthode XTT et la viabilité est calculée par rapport à la condition non traitée (courbe grise). Les résultats présentés sont issus de plusieurs expériences indépendantes. Pour H 2 O 2, à raison de 1 million de cellules en plaques 6 puits (Figure 31 A), on augmente la production d IL-1β basale de 0,3 à 5 fg/cellule dès 500 µm (barre d histogramme noire). Le maximum d induction est atteint avec 1000 µm H 2 O 2 à 5,5 fg/cellule et la production H 2 O 2 -induite diminue à partir de 1500 µm avec 3,1 fg/cellule. Si l on considère la viabilité cellulaire suite à ces traitements (courbe grise), dès 500 µm H 2 O 2 on atteint environ 65% de cellules viables. La toxicité augmente avec l augmentation de la concentration en H 2 O 2 jusqu à atteindre environ 80% à 1500 µm. L effet pro-inflammatoire induit par H 2 O 2 précédemment observé n est donc pas reproduit dans le cadre d une culture cellulaire dans un plus grand volume (3 ml). Pour tbhp en plaques 6 puits à raison de 1 million de cellules par puits (Figure 31 B), on augmente la production d IL-1β dès 400 µm de 2,1 à 13,3 fg/cellule (barre d histogramme noire). Ce taux d induction atteint un palier puisqu à 1000 et 1600 µm, la sécrétion d IL-1β est de 11,6 et 12,4 fg/cellule respectivement. L évaluation de la viabilité cellulaire (courbe grise) ne montre pas d effet pour les plus faibles concentrations testées (25 et 100 µm). Elle est d environ 60% à 400 µm tbhp et diminue à environ 15% pour 1000 et 1600 µm tbhp. L effet pro-inflammatoire induit par tbhp précédemment observé n est donc pas non plus reproduit dans le cadre d une culture cellulaire dans un plus grand volume (3 ml). Concernant H 2 O 2, un compromis entre une induction d IL-1β suffisante et une cytotoxicité faible est difficile dans un grand volume. Un traitement par 500 µm d H 2 O 2 est appliqué sur différentes densités cellulaires (Figure 31 C). En absence de traitement par H 2 O 2 (barre d histogramme grise), la production d IL-1β diminue progressivement avec l augmentation de la densité cellulaire de 3,8 à 0,7 fg/cellule pour et 1 million de cellules/puits respectivement. Après traitement par 500 µm d H 2 O 2 (barre d histogramme noire), on a une induction nette d IL-1β H 2 O 2 -dépendante à partir de cellules/puits, augmentant le niveau de base d IL-1β de 2,5 à 12,8 fg/cellule. Le facteur d induction est alors de 5,1 et augmente progressivement jusqu à la densité de cellules/puits à 13,4. A partir de cellules/puits, ce facteur d induction diminue graduellement avec l augmentation de la densité cellulaire et atteint 11 pour 1 million de cellule/puits. La toxicité provoquée par 500 µm d H 2 O 2 en fonction de la densité cellulaire est présentée sur la figure 132

134 31 C (courbe grise). Le nombre de cellules viables augmente progressivement avec l augmentation de la densité cellulaire, variant de 25 à 85% pour et 1 million de cellules/puits respectivement. Influence de l H 2 O 2 sur la régulation de la voie IL-1β : implication de l inflammasome NLRP3 L influence d H 2 O 2 sur la production d IL-1β dans les surnageants de culture a montré un effet pro-inflammatoire de ce dernier via la production de ROS dans le milieu de culture. Entre la stimulation des THP-1 par H 2 O 2 et la production d IL-1β, l implication de l inflammasome NLRP3 est suspectée. Afin d élucider le mécanisme par lequel H 2 O 2 agit et son rôle dans l activation de l inflammasome, des études géniques ont été réalisées sur le modèle cellulaire mis en place, ainsi que l influence de l inhibition de protéines constituant l inflammasome NLRP3. Influence de l H 2 O 2 sur la régulation de l expression de gènes impliqués dans l inflammation Des cellules THP-1 ont été ensemencées en plaques 96 puits à raison de cellules par puits et différenciées avec 20 nm de TPA durant 48 heures, puis les cellules ont été stimulées par 250 µm H 2 O 2 pendant 16 heures à 37 C. Les surnageants ont été récoltés et l IL-1β a été quantifiée (Figure 32 A). Les tapis cellulaires de 40 puits ont été lysés et réunis pour constituer un seul échantillon. Les ARNs ont été extraits puis rétro-transcrits pour chaque échantillon. L analyse de l expression de gènes en relation avec la voie IL-1β a été réalisée sur les ADNc via qpcr (Figure 32 B). 133

135 Expression relative IL-1β [fg/cellule] A 6,0 5,0 4,0 3,0 2,0 1,0 0,0 H2O2 0µM H2O2 250µM B ,5 0,25 Nlrp3 Il-1β Nf-κb Tlr4 Asc Casp-1 Figure 32 : Influence d H 2 O 2 sur la régulation de l expression de gènes impliqués dans l inflammation. Les cellules sont ensemencées à raison de cellules/puits en plaques 96 puits dans 200 µl, différenciées avec 20 nm TPA et incubées à 37 C. Au jour 2, les cellules sont traitées ou non avec 250 µm H 2 O 2 et incubées 16 heures à 37 C au bout desquelles les surnageants sont récoltés et dosés en IL-1β (A). Les tapis cellulaires sont lysées grâce à une solution de trizol et les ARNs sont extraits et rétro-transcrits. L analyse de l expression de gènes impliqués dans l inflammation est réalisée via RT-qPCR et le logiciel REST (QIAGEN, Courtaboeuf, France). Afin d obtenir une quantité suffisante d ARN, 40 puits sont rassemblés pour constituer un point et 4 puits par point sont dosés en IL-1β. Les résultats sont issus de 3 expériences indépendantes en triplicats chacune et présentés sous forme de boîte à moustache de l expression relative de chaque gène d intérêt par rapport au gène de référence de la 36B4 (B). Comme décrit précédemment (Paragraphe «Effet de générateurs de ROS sur la production d IL-1β par les THP-1»), on observe une induction significative de la production d IL-1β dans les surnageants de culture des cellules traitées par 250 µm d H 2 O 2, augmentant de manière significative le niveau basal de 0,3 à 3,8 fg/cellule (p=<0,001 ; test de Mann- Whitney) (Figure 32 A). L analyse de l expression génique relative au gène de référence codant pour la protéine 36B4 est présentée dans la figure 32 B. Après stimulation des cellules par H 2 O 2, 134

136 l expression des gènes codant pour les protéines NLRP3, NF-κB, TLR4 et caspase-1 n est pas significativement modifiée. Il est à noter que pour le gène codant pour la protéine ASC, l expression relative est diminuée de 17,7%, mais que la significativité n est pas atteinte (p=0,067 ; test d hypothèse). Il en est de même pour le gène codant pour la protéine IL-1β, dont l expression relative est augmentée d un facteur 2,01 mais ne permet pas d atteindre la significativité (p=0,053 ; test d hypothèse). Influence de l inhibition des protéines de l inflammasome NLRP3 sur la régulation de la voie IL-1β après induction par H 2 O 2 Des cellules macrophagiques murines (BMDMs : Figure 33 C) ou humaines (THP-1 : Figure 33 A, B et D) ont été utilisées et stimulées par différentes concentrations en H 2 O 2 en présence ou non d un inhibiteur de pan-caspase, Z-VAD, à différentes concentrations et différents dosages ont été réalisés (Figure 33). 135

137 IL-1β [fg/cellule] IL-6 [fg/cellule] IL-1β [fg/cellule] p20 Caspase-1 [fg/cellule] A 20,0 B 0,25 15,0 0,20 0,15 10,0 0,10 5,0 0,05 0, Z-VAD [nm] 0,00 H2O2 0µM H2O2 250µM H2O2 250µM + Z-VAD 5µM C 0,07 0,06 WT ASC -/- NLRP3 -/- D 0,3 0,2 0,05 0,2 0,04 0,03 0,02 0,01 0 H2O2 0µM H2O2 125µM H2O2 250µM H2O2 500µM H2O2 1000µM 0,1 0,1 0,0 H2O2 0µM H2O2 125µM H2O2 125µM + Z-VAD 50µM Figure 33 : Influence d H 2 O 2 sur la voie IL-1β, implication de la caspase-1. Pour les THP-1 (A ; B ; D), les cellules sont ensemencées entre 5000 et cellules/puits en plaques 96 puits dans 200 µl, différenciées avec 20 nm TPA et incubées à 37 C pendant 48 heures. Pour les BMDMs (C), les cellules sont ensemencées à raison de cellules/puits en plaques 96 puits dans 200 µl, directement traitées avec LPS 10 ng/ml et incubées à 37 C pendant 6 heures. Ensuite, les cellules sont traitées avec différentes concentrations en H 2 O 2 et incubées pendant 16 heures à 37 C au bout desquels les surnageants sont récoltés (traitement H 2 O 2 au jour 2 pour les THP-1 et au jour h pour les BMDMs). A : différentes concentrations en Z-VAD, un inhibiteur de pan-caspase, sont ajoutées simultanément à la stimulation H 2 O µm et l IL-1β produite est mesurée dans les surnageants de culture. B : 5 µm de Z-VAD sont ajoutés ou non simultanément à H 2 O µm et la sous-unité p20 de la caspase-1 est quantifiée dans les surnageants. C : BMDMs issus de souris WT (barre d histogramme noire), déficientes pour la protéine ASC (barre d histogramme grise claire) et déficientes pour la protéine NLRP3 (barre d histogramme grise foncée) sont stimulés avec différentes concentrations en H 2 O 2 et l IL-1β produite est mesurée dans les surnageants de culture. D : 50 µm de Z-VAD sont ajoutés ou non simultanément à H 2 O µm et l IL-6 produite dans les surnageants est mesurée. Les résultats sont issus d expériences indépendantes et présentés sous forme de moyennes des réplicats (entre 3 et 16 en fonction des conditions) +/- écart-type. Le Z-VAD, un pan-inhibiteur de caspases dont la caspase-1, a été utilisé en cotraitement à différentes concentrations afin d établir une éventuelle implication d un inflammasome dans la production d IL-1β H 2 O 2 -induite (Figure 33 A). On observe alors une diminution de la production en IL-1β H 2 O 2 -dépendante dans les surnageants de culture dès 2 µm de Z-VAD. En effet, le traitement par 125 µm d H 2 O 2 induit l IL-1β de 1,2 à 10,9 fg/cellule (résultats non présentés, p=<0,001 ; test de Mann-Whitney) et ce taux induit atteint alors 3,5 fg/cellule après traitement par 2 µm de Z-VAD (p=0,004 ; test de Mann-Whitney). 136

138 L application d une régression logistique à quatre paramètres a permis de déterminer l EC50 à 941,9 nm. Il est à noter que cette valeur est environ 2 fois plus importante que celle en présence d ATP 1 mm (Paragraphe «Etude de l inhibition des protéines de l inflammasome NLRP3 sur la régulation de la voie IL-1β après induction par ATP»). L implication d un inflammasome activé libérant la caspase-1 a également été étudiée grâce au dosage de la sous-unité p20 de la caspase-1 (Figure 33 B). Les THP-1 ont été stimulées par 250 µm d H 2 O 2 et co-traitées ou non avec 5 µm de Z-VAD. Après stimulation par l H 2 O 2, il n y a pas de modification de la quantité de sous-unité p20 de la caspase-1 dans les surnageants de culture. De plus, et curieusement, l ajout de Z-VAD à 5µM augmente de manière significative la quantité de sous-unité p20 de la caspase-1 dans les surnageants, allant de 0,06 à 0,18 fg/cellule (p=0,029 ; test de Mann-Whitney), soit une induction d un facteur 3. Afin d établir un possible lien entre la production d IL-1β par l H 2 O 2 et l activation de l inflammasome NLRP3, des cellules macrophagiques murines (BMDMs) issues de souris sauvages (WT, barre d histogramme noire) et déficientes pour deux protéines de l inflammasome NLRP3 (ASC-/-, barre d histogramme grise claire ; et NLRP3-/-, barre d histogramme grise foncée) ont été utilisées (Figure 33 C). Les cellules ont été prétraitées par 10 ng/ml de LPS afin de les activer puis un effet dose H 2 O 2 a été réalisé. On montre que pour les souris sauvages (WT, barre d histogramme noire), il y a une induction de la production IL- 1β par le LPS de 0 à 0,033 fg/cellule (p=0,029 ; test de Mann-Whitney). L ajout de H 2 O 2 n augmente pas cette production induite, mais curieusement présente un effet antiinflammatoire proche de la significativité dès 500 µm (p=0,057 ; test de Mann-Whitney) et significatif à 1000 µm d H 2 O 2 (p=0,029 ; test de Mann-Whitney). En effet, à 500 µm, la production n est plus que de 0,02 fg/cellule et 0,008 fg/cellule pour 1000 µm d H 2 O 2. Ces mêmes conditions sont appliquées à des macrophages murins déficients pour la protéine ASC (ASC-/-, barre d histogramme grise claire). On montre qu il n y a plus d induction par le LPS et que l ajout d H 2 O 2 n a pas d effet. Dans les macrophages murins déficients pour la protéine NLRP3 (NLRP3-/-, barre d histogramme grise foncée), on montre une augmentation significative de la production d IL-1β LPS-induite par les fortes concentrations en H 2 O 2, 500 et 1000 µm (p=0,029 ; test de Mann-Whitney). Afin de voir si les effets inflammatoires d H 2 O 2 et de la Z-VAD sur l IL-1β influencent également l IL-6, des THP-1 sont stimulées par 125 µm H 2 O 2 simultanément ou 137

139 non à 50 µm de Z-VAD et l IL-6 produite dans les surnageants de culture est quantifiée. On montre alors que le niveau basal d IL-6 est de 0,094 fg/cellule, soit 22 fois inférieur à celui d IL-1β produit (2,1 fg/cellule pour ces surnageants, résultats non présentés). L ajout de H 2 O 2 ou de Z-VAD résulte en une quantité d IL-6 produite dans les surnageants non détectable. Implication de la voie purinergique sur la production d IL-1β H 2 O 2 -induite Le mécanisme par lequel H 2 O 2 induit la production d IL-1β fait appel à un inflammasome et donne lieu à l activation de la caspase-1, mais la voie menant à cette activation n est pas connue. Afin d éclairer le mécanisme d action de l H 2 O 2, des inhibiteurs pharmacologiques de récepteurs purinergiques ont été utilisés en prétraitement (Figure 34 B, C et D) ou en co-traitement (Figure 34 A). Leur influence sur la production d IL-1β H 2 O 2 - induite a été étudiée (Figure 34). 138

140 IL-1β [fg/cellule] IL-1β [fg/cellule] IL-1β [fg/cellule] IL-1β [fg/cellule] A 25,0 20,0 B 25,0 20,0 15,0 15,0 10,0 10,0 5,0 5,0 0, , Glybenclamide [µm] A [µm] C 25,0 D 25,0 20,0 20,0 15,0 15,0 10,0 10,0 5,0 5,0 0, , oatp [µm] U73122 [µm] Figure 34 : Influence d inhibiteurs de la voie purinergique sur la production d IL-1β H 2 O 2 -induite. Les cellules sont ensemencées à raison de 5000 cellules/puits en plaques 96 puits dans 200 µl, différenciées avec 20 nm TPA et incubées à 37 C. Au jour 2, les cellules sont traitées avec 125 µm H 2 O 2. Différents inhibiteurs de la voie purinergique à différentes concentrations sont ajoutés au jour 1, soit 24 heures avant H 2 O 2 (B : A ; C : oatp ; D : U73122), ou au jour 2 en même temps que H 2 O 2 (A : glybenclamide). 16 heures après la stimulation H 2 O 2, les surnageants sont récoltés et dosés en IL-1β. Les résultats sont issus de plusieurs expériences indépendantes et présentés sous forme de moyennes des réplicats (entre 4 et 12 en fonction des conditions) +/- écart-type. La glybenclamide inhibe l efflux de K+ en agissant entre P2X7R et l inflammasome NLRP3. Cet inhibiteur a été utilisé à différentes concentrations simultanément à l H 2 O 2. En présence de glybenclamide, il n y a pas de modification de la production d IL-1β H 2 O 2 - induite (Figure 34 A). L inhibiteur spécifique de P2X7R, A740003, a également été testé en prétraitement sur des THP-1 stimulées avec H 2 O 2. Quelle que soit la dose utilisée (de 1 à 300 µm), il n y a pas de diminution de la production d IL-1β H 2 O 2 -induite (Figure 34 B). L implication d autres récepteurs purinergiques de type P2X et P2Y a été testée via oatp, un inhibiteur des récepteurs P2X ; et U73122, un inhibiteur des récepteurs P2Y. Les cellules sont prétraitées avec oatp à différentes concentrations (entre 100 et 500 µm) et traitées avec 125 µm H 2 O 2 (Figure 34 C). On constate une diminution significative de la 139

141 production d IL-1β H 2 O 2 -induite par 500 µm d oatp, diminuée de 10,5 à 4,3 fg/cellule (p=0,029 ; test de Mann-Whitney). Un prétraitement avec l U73122 à différentes concentrations, de 1,25 à 10 µm, (Figure 34 D) diminue également la production d IL-1β H 2 O 2 -dépendante. Dès 1,25 µm d U73122, le maximum d inhibition est atteint diminuant la sécrétion d IL-1β H 2 O 2 -induite de 16,3 à 1,1 fg/cellule (p=0,017 ; test de Mann-Whitney). 140

142 Application du modèle : détermination du profil inflammatoire potentiel de produits Dans le cadre du modèle cellulaire mis en place, différents types de produits ont été testés quant à leur activité inflammatoire sur des THP-1 différenciées. L activité proinflammatoire a été déterminée suite au traitement des cellules par le produit d intérêt seul. L activité anti-inflammatoire d un prétraitement ou d un co-traitement des cellules avec le produit d intérêt a été déterminée suite à traitement pro-inflammatoire de référence (généralement l ATP 1 mm ou l H 2 O µm). La quantité d IL-1β synthétisée par les cellules a été évaluée au jour 3. Etude de l effet inflammatoire de produits alimentaires Produits commerciaux issus de l industrie agroalimentaire Des produits d origine commerciale de l industrie agroalimentaire ont été testés quant à leur activité inflammatoire sur le modèle THP-1 mis en place. L activité pro- et antiinflammatoire a ainsi été déterminée pour les produits «Tabletree» et «OMU Milk». Le produit «Tabletree» vient d une société canadienne du même nom et est un jus de cerises noires avec du miel et de la cannelle. 141

143 IL-1β [fg/cellule] IL-1β [fg/cellule] A 7,0 6,0 5,0 4,0 3,0 2,0 1,0 0,0 B 7,0 6,0 5,0 4,0 3,0 2,0 1,0 0,0 ATP 1mM H2O2 125µM Figure 35 : Influence du «Tabletree» sur la production d IL-1β. Les cellules sont ensemencées à raison de 5000 cellules/puits en plaques 96 puits dans 200 µl, différenciées avec 20 nm TPA et incubées à 37 C. Au jour 2, les cellules sont traitées avec différentes concentrations en «Tabletree» seul (A) ou avec ATP 1 mm (B, barre d histogramme noire) ou 125 µm H 2 O 2 (B, barre d histogramme grise claire). Après 16 heures d incubation à 37 C, les surnageants sont récoltés et dosés en IL-1β. Les résultats sont issus de plusieurs expériences indépendantes et présentés sous forme de moyennes des réplicats (entre 3 et 4) +/- écart-type. CTL - : solvant ; CTL + : stimulus proinflammatoire ; TT : «Tabletree» ; TTm : extrait méthanolique du «Tabletree» ; TTs : extrait méthanolique de la matière sèche du «Tabletree». L étude du potentiel effet pro-inflammatoire du produit est exposée dans la figure 35 A. Le produit commercial (TT) ne modifie pas de manière significative la production basale d IL-1β. Il est à noter cependant, qu en présence de 1% TT dans le milieu de culture, on diminue le niveau de base de 0,4 à 0,04 fg/cellule et la significativité est proche (p=0,057 ; test de Mann-Whitney). A 10%, concentration la plus forte possible pour le test, on augmente la production d IL-1β dans les surnageants de culture, mais la significativité n est pas atteinte (p=0,057 ; test de Mann-Whitney). Cet effet pro-inflammatoire doit être dû à la présence d autres ingrédients dans le jus, notamment le sucre. Afin de s en affranchir, les activités antiinflammatoires seront testées avec des plus faibles concentrations. Les extraits méthanoliques (TTm et TTs) ne modifient également pas de manière significative la production d IL-1β 142

144 basale. Il est à noter que l extrait méthanolique issu de la matière sèche (TTs) a une tendance à diminuer la sécrétion d IL-1β. En effet, on diminue le taux de 0,4 à 0,09 fg/cellule (p=0,057 ; test de Mann-Whitney). L étude du potentiel effet anti-inflammatoire du produit est exposée dans la figure 35 B. En présence d ATP 1 mm (barre d histogramme noire) ou d H 2 O µm (barre d histogramme grise), on a une induction significative de la production d IL-1β (CTL +, p=0,029 ; test de Mann-Whitney). Globalement, l ajout du produit commercial «Tabletree» (TT) n a pas d effet sur la production d IL-1β ATP- ou H 2 O 2 -induite, quelle que soit la concentration testée. De plus, les extraits méthanoliques (TTm et TTs) ne modifient pas significativement la production d IL-1β ATP-dépendante. L extrait méthanolique issu de la matière sèche (TTs) n a pas d effet non plus sur la production d IL-1β H 2 O 2 -induite. Cependant, l extrait méthanolique issu du produit commercial (TTm) inhibe significativement l induction d IL-1β H 2 O 2 -dépendante (p=0,029 ; test de Mann-Whitney). En effet, on diminue le taux d IL-1β H 2 O 2 -induit de 4,8 à 2,8 fg/cellule, soit une inhibition d environ 42%. Le produit «OMU Milk» vient d une société japonaise du même nom et est une solution contenant des peptides, dont la nisine, qui est un peptide anti-bactérien utilisé comme conservateur alimentaire. 143

145 IL-1β [fg/cellule] IL-1β [fg/cellule] A B 9,0 8,0 7,0 6,0 5,0 4,0 3,0 2,0 1,0 0,0 9,0 8,0 7,0 6,0 5,0 4,0 3,0 2,0 1,0 0, OMU Milk [µg/ml] ATP 1mM H2O2 125µM CTL - CTL + CTL + + OMU 32,7 µg/ml Figure 36 : Influence d «OMU Milk» sur la production d IL-1β. Les cellules sont ensemencées à raison de 5000 cellules/puits en plaques 96 puits dans 200 µl, différenciées avec 20 nm TPA et incubées à 37 C. Au jour 2, les cellules sont traitées avec différentes concentrations d «OMU Milk» seul (A) ou avec ATP 1 mm (B, barre d histogramme noire) ou 125 µm H 2 O 2 (B, barre d histogramme grise claire). Après 16 heures d incubation à 37 C, les surnageants sont récoltés et dosés en IL-1β. Les résultats sont issus de plusieurs expériences indépendantes et présentés sous forme de moyennes des réplicats (entre 3 et 4) +/- écart-type. CTL - : solvant ; CTL + : stimulus pro-inflammatoire ; OMU : produit «OMU Milk». L étude du potentiel effet pro-inflammatoire du produit est exposée dans la figure 36 A. Différentes concentrations en «OMU Milk» ont été testées de 1 à 65,4 µg/ml, dont la plus forte correspond au produit pur. Globalement, quelle que soit la dose testée, il n y a pas de modification significative de la production d IL-1β basale dans les surnageants de culture. Il est à noter qu à 10 µg/ml, on augmente cette production de 2,3 à 5,4 fg/cellule et qu on approche la significativité (p=0,057 ; test de Mann-Whitney). L étude du potentiel effet anti-inflammatoire du produit est exposée dans la figure 36 B. En présence d ATP 1 mm (barre d histogramme noire) ou H 2 O µm (barre d histogramme grise), on a une induction significative de la production d IL-1β (CTL +, p=0,029 ; test de Mann-Whitney). L ajout du produit commercial «OMU Milk» pur montre 144

146 une tendance à augmenter la production d IL-1β ATP- ou H 2 O 2 -induite, mais cette augmentation n est pas significative. Etude d extraits réalisés à partir de dattes Dans le cadre d une collaboration avec l université de Bejaia (Algérie), un travail sur des extraits de dattes (Phœnix dactylifera) a été réalisé pour caractériser leurs activités biologiques. Les fruits ont été récoltés à maturité et la pulpe lyophilisée deux fois. Dix variétés de dattes ont été étudiées pour leurs propriétés anti-oxydantes et anti-inflammatoires. Concernant les propriétés anti-inflammatoires, le modèle cellulaire mis en place a été utilisé. Les THP-1 ont été différenciées avec 20 nm TPA pendant 24 heures, prétraitées avec différentes doses des extraits (dose maximale de 214 µg/ml, correspondant à 50 µg de fruits lyophilisés final) au jour 1 pendant 24 heures, puis traitées avec 10 µm de nigéricine au jour 2 pendant 16 heures à 37 C. Les surnageants de culture ont alors été récoltés au jour 3 et l IL- 1β produite quantifiée. Les résultats obtenus ont permis d établir un classement des dix variétés, de la plus anti-inflammatoire à la moins anti-inflammatoire : Halwa > Ghazi > Thaouri > Mech-Degla > Sebt-Mira > Degla-Beida > Deglet-Nour > Deglet-Ziane > Itima > Arechti. L effet antiinflammatoire des deux variétés les plus actives (Halwa et Ghazi) a été confirmé en utilisant le stimulus pro-inflammatoire d ATP 1 mm. L ensemble de ces résultats est présenté dans l article ci-après. 145

147 146

148 147

149 148

150 149

151 150

152 151

153 152

154 153

155 154

156 155

157 156

158 157

159 158

160 159

161 160

162 161

163 162

164 163

165 164

166 165

167 166

168 167

169 168

170 169

171 170

172 171

173 Etude de l effet inflammatoire de composés synthétiques Dans le cadre d une collaboration avec l institut de biologie, de chimie médicale et de biotechnologie d Athènes (Grèce), un travail sur des analogues de purines a été réalisé pour caractériser leurs activités biologiques et tenter d élucider leur mode d action. Les analogues testés sont des esters de nitrate construits autour du squelette purine et différent par la position, la longueur ou la structure de la chaîne liant le groupement ONO 2. Leur capacité à produire des nitrites a été testée ainsi que leur activité pro- et anti-inflammatoire grâce au modèle cellulaire THP-1. Les THP-1 ont été différenciées avec 20 nm TPA, puis traitées au jour 2 pendant 16 heures avec 100 µg/ml de chaque analogue MK seul, ou en présence de 1 mm ATP ou 125 µm H 2 O 2. Les surnageants de culture ont alors été récoltés au jour 3 et l IL- 1β produite quantifiée. Les surnageants ont également servi au dosage des nitrites produits. Les résultats obtenus ont permis de mettre en évidence des profils inflammatoires différents en fonction des MKs. Seul l analogue MK128 a montré une activité antiinflammatoire forte en présence des deux stimuli pro-inflammatoires. Cette activité est liée à sa capacité à produire des nitrites dans le milieu de culture. L ensemble de ces résultats est présenté dans l article ci-après. 172

174 173

175 174

176 175

177 176

178 177

179 178

180 179

181 180

182 181

183 182

184 183

185 184

186 185

187 186

188 187

189 188

190 189

191 190

192 191

193 192

194 193

195 194

196 D autres produits MKs ont été testés. Ils ont en commun avec ceux insérés dans la publication le squelette purine (pour le produit MK133) ou leur fonction ester de nitrate (pour les produits MK55 et MK56). Leur structure chimique est présentée dans la figure 37. MK133 possède un acide lipoïque branché sur le squelette purine. N H MK55 O H N ONO 2 MK56 N O H N ONO 2 MK133 O N N N S S N HN N Figure 37 : Structure chimique des analogues MK55, MK56 et MK133. Leur activité pro- (Figure 38 A) et anti-inflammatoire (Figure 38 B et C) grâce au modèle cellulaire THP-1, ainsi que leur capacité à produire des nitrites (Figure 38 D) a été testée. 195

197 Nitrites [µm] A B *** * ** C D ** MK MK55 MK56 MK133 Figure 38 : Influence des analogues MK sur la production de nitrites et d IL-1β par les macrophages. Les cellules sont ensemencées à raison de 5000 cellules/puits en plaques 96 puits dans 200 µl, différenciées avec 20 nm TPA et incubées à 37 C pendant 48 heures. Au jour 2, les cellules sont traitées avec différents analogues MK à 100 µg/ml seuls (A et D) ou en présence d ATP 1 mm (B) ou H 2 O µm (C) et incubées pendant 16 heures à 37 C. Les surnageants sont alors récoltés et la quantité d IL-1β (A, B et C) et de nitrites (D) sont mesurées. Les résultats sont présentés sous forme de moyennes des réplicats (entre 4 et 12 en fonction des conditions) +/- écart-type. Seuls, certains des composés MKs présentent une induction significative de la production d IL-1β basale (Figure 38 A). En effet, MK55 augmente le niveau de base de 2,6 à 6,8 fg/cellule (p=0,001 ; test de Mann-Whitney) et MK56 induit une production de 4,8 fg/cellule (p=0,004 ; test de Mann-Whitney). En présence d ATP 1 mm (Figure 38 B), on augmente la production basale d un facteur 4,5 (p=<0,001 ; test de Mann-Whitney). L ajout de MK55 provoque l exacerbation de l effet pro-inflammatoire de l ATP, augmentant la sécrétion de 6,6 à 10,3 fg/cellule (p=0,024 ; test de Mann-Whitney). En présence d H 2 O µm (Figure 38 C), l induction de la production d IL-1β est de 4,5 fois le niveau de base (p=<0,001 ; test de Mann-Whitney). Seul l ajout de MK133 modifie significativement cette induction et l inhibe d environ 58% (p=0,003 ; test de Mann-Whitney). Quel que soit le 196

198 IL-1β [fg/cellule] Nitrites [µm] composé considéré, il n y a pas de production de nitrites dans les surnageants de culture (Figure 38 D). Pour finir, un autre donneur de NO utilisé en thérapeutique, autre que la trinitrine présentée dans l article, l isosorbide dinitrate (ISD) (Figure 39), a été testé grâce au modèle cellulaire mis en place. A B 4,5 4,0 3,5 3,0 2,5 2,0 1,5 1,0 0,5 0,0 16,0 14,0 12,0 10,0 8,0 6,0 4,0 2,0 0,0 ATP 1mM H2O2 125µM ,5 Isosorbide dinitrate [µm] ATP 1mM H2O2 125µM Isosorbide dinitrate [µm] Figure 39 : Influence d ISD sur la production de nitrites et d IL-1β par les macrophages. Les cellules sont ensemencées à raison de 5000 cellules/puits en plaques 96 puits dans 200 µl, différenciées avec 20 nm TPA et incubées à 37 C pendant 48 heures. Au jour 2, les cellules sont traitées avec différentes concentrations en ISD et incubées pendant 16 heures à 37 C. Les surnageants sont alors récoltés et la quantité nitrites (A) et d IL-1β (B) sont mesurées. Les résultats sont présentés sous forme de moyennes des réplicats (entre 4 et 12 en fonction des conditions) +/- écart-type. En présence d ISD (Figure 39 A), on constate une augmentation de la production en nitrites graduellement avec l augmentation de la concentration en ISD (en présence d ATP : barre d histogramme grise foncée ; en présence d H 2 O 2 : barre d histogramme grise claire). Il est à noter que cette production est faible par rapport à la trinitrine (TNT) : par exemple, pour 100 µm TNT, on produit environ 5 µm de nitrites. L activité anti-inflammatoire de l ISD a 197

199 également été testée (Figure 39 B). Que ce soit en présence d ATP 1 mm (losanges) ou en présence d H 2 O µm (carrés), l ISD ne présente pas d effet anti-inflammatoire. Il est à noter cependant qu en présence d ATP, on a une induction significative de la production d IL-1β ATP-dépendante pour les concentrations 25 ; 100 et 211,5 µm ISD, multipliant la sécrétion par 1,3 ; 1,6 et 1,4 respectivement (p=0,028 ; p=0 004 et p=0,008 respectivement ; test de Mann-Whitney). 198

200 DISCUSSION 199

201 Mise en place d un modèle cellulaire TLR-indépendant permettant l étude de l inflammasome Différenciation des THP-1 par le TPA Au cours de ce travail de thèse, nous avons pu mettre en place un modèle expérimental d étude de la modulation de l inflammation. En effet, l utilisation de la lignée humaine monocytaire THP-1 nous a permis de mettre au point un modèle cellulaire ne faisant pas appel à la stimulation de la voie des TLRs et étant principalement basé sur des stimulations dépendantes de l inflammasome. Notre étude s est centrée sur la lignée cellulaire THP-1 et sur sa capacité à produire de l IL-1β notamment suite à un traitement par l ester de phorbol : le TPA. Dans une première partie, nous nous sommes intéressés à la différenciation des monocytes en macrophages induite par l ajout de TPA. Cette différenciation est décrite depuis plusieurs années dans la littérature et s accompagne d un changement de morphologie et d une adhérence des cellules (Tsuchiya et al., 1982). Dans notre étude, ces caractéristiques relatives à la différenciation ont été constatées visuellement au microscope par l observation de leur changement de forme. L adhérence des cellules a pu être également évaluée grâce au comptage des cellules adhérées au support ou par comptage des cellules flottantes dans le surnageant. Nos données sont conformes à celles retrouvées dans la littérature, les cellules se caractérisant par l acquisition d une forme amiboïde et plus de 90% d adhésion après 20 nm de TPA (Park et al., 2007). Il a été en outre montré que la différenciation par le TPA induisait la sur-régulation d un cluster de différenciation (CD) caractéristique, le CD11b, un marqueur impliqué dans les phénomènes d adhésion (Kohro et al., 2004; Schwende et al., 1996). La technique d immunohistochimie pour détecter CD11b aurait pu être réalisée afin de compléter nos conclusions. Nous avons constaté, conformément à la littérature, que l absence de traitement par le TPA ne permettait pas de détecter de l IL-1β dans les surnageants de culture, ni même dans les lysats cellulaires (Kohro et al., 2004; Park et al., 2007). L IL-1β mature étant excrétée et le kit ELISA utilisé n étant pas spécifique de la forme immature ou mature, le dosage dans les lysats cellulaires nous a permis de révéler la pro-il-1β immature induite par le traitement. Les 200

202 THP-1 sous forme de monocytes (non traités par le TPA) ne sont donc pas capables de produire des taux de pro-il-1β et d IL-1β détectables. Ces niveaux de base de production d IL-1β ne deviennent détectables qu après une stimulation par une concentration d au moins 20 nm TPA. L étude de Park et al. (2007) a montré que l IL-1β pouvait être produite en quantités suffisantes dans les cellules dès 16 nm de TPA. La différenciation des THP-1 par le TPA est donc une étape fondamentale, nécessaire pour produire des taux d IL-1β détectable. A travers les nombreuses expériences réalisées, nous avons observé des différences assez importantes entre les niveaux de base d IL-1β produite, lorsqu ils sont rapportés à la quantité d IL-1β par cellule dans des THP-1 différenciées. En effet, à 5000 cellules/puits, nous avons constaté une production d IL-1β supérieure (3,2 fg/cellule) à celle obtenue avec 1 million de cellules/puits (0,7 fg/cellule). Quelles que soient les conditions d ensemencement (plaques 6 et 96 puits séparément), nous avons retrouvé cette corrélation inverse entre le nombre de cellules et la production d IL-1β par cellule basale. En outre, lorsqu on considère la production totale dans les surnageants de culture, l IL-1β était produite dans des quantités équivalentes. En effet, en plaques 96 puits, nous avons observé une réponse inflammatoire donnant lieu à la production d environ pg d IL-1β totale dans le surnageant (dans environ 230 µl), alors qu en plaques 6 puits, nous avons mesuré environ pg d IL-1β totale dans le surnageant (dans environ 3,5 ml). Ainsi, en concentrations totales en IL-1β dans le surnageant, les concentrations basales d IL-1β produite étaient quatre fois plus importantes en plaques 6 puits qu en plaques 96 puits. Nos résultats mettent ainsi en évidence un probable effet de communication entre les cellules, qui «s économisent» lorsqu elles atteignent une forte densité cellulaire afin de produire une réponse pro-inflammatoire globale suffisante. Stimulation des THP-1 par le LPS Dans le cadre du modèle cellulaire, nous avons testé la stimulation par le LPS ultra pur, afin d activer la voie TLR4 et d induire une inflammation. Il existe une controverse quant à l utilisation de ligands des TLRs afin d activer la caspase-1 et la sécrétion d IL-1β. En effet, il a été suggèré que l IL-1β produite dans les THP-1, suite à une stimulation par le LPS, résulterait plutôt de la contamination par des ligands non LPS comme les peptidoglycanes, tels que le MDP, alors que le LPS seul serait inefficace comme activateur de la sécrétion d IL- 1β (Martinon et al., 2004). Dans notre modèle THP-1, la stimulation par le LPS seul n a pas permis d induire la différenciation des monocytes en macrophages, ni une production d IL-1β 201

203 mature dans les surnageants. Nous montrons toutefois que le stimulus LPS seul permet la constitution d un pool intracellulaire d IL-1β non mature, mais qu il ne permet pas d activer une réponse inflammatoire par des monocytes. La différenciation des THP-1 en macrophages est cependant nécessaire pour induire la production d IL-1β. Le traitement par le TPA induit l expression caractéristique de CD14, un co-récepteur de TLR4 (Kohro et al., 2004; Schwende et al., 1996), ce qui sous-entend que, sans traitement par TPA, les THP-1 ne sont pas capables de répondre au stimulus LPS, et ne peuvent alors pas induire une production d IL-1β. Dans notre travail, l utilisation de LPS ultra pur reconstitué avec une eau sans endotoxine exclut l intervention d autres composants bactériens comme le suggère Martinon et al.. Ainsi nos résultats montrent que l ajout de LPS sur des THP-1 en cours de différenciation permet une réponse pro-inflammatoire LPS-dépendante, confirmant l induction de la voie de signalisation LPS-dépendante et donc de TLR4/CD14. Nos résultats sont en accord avec les études de Kohro et al. et Schwende et al., et contredisent toutefois celle de Martinon et al.. Notre hypothèse aurait pu être vérifiée grâce à la technique de RTqPCR afin de mesurer l expression du gène codant pour la protéine CD14 dans ces différentes conditions. L étude de Park et al. (2007) a montré notamment que l augmentation des concentrations en TPA diminuait progressivement l expression de CD14. Ce récepteur CD14 agissant en synergie avec celui du LPS, cela implique que les fortes concentrations en TPA sont susceptibles d atténuer l effet pro-inflammatoire du LPS. Dans notre cas, l ajout de LPS jusqu à 1000 ng/ml, à la plus faible dose de TPA (20 nm) induisant de l IL-1β, ne modifie pas la production d IL-1β. Nous avons également montré que plus la concentration en TPA était importante, plus la production d IL-1β était induite par le LPS. L analyse de l expression du marqueur CD14 par RT-qPCR aurait également pu compléter notre étude de l effet dose de TPA afin de confirmer sa sur-expression associée à l augmentation de la concentration en TPA. Dans notre modèle d étude, nous montrons finalement que la stimulation par le LPS est possible, mais non nécessaire, afin d obtenir une induction d IL-1β significative. Stimulation des THP-1 par des modulateurs de l inflammasome NLRP3 Le but de la mise en place de ce modèle était d étudier la modulation de l inflammasome NLRP3. L activation de l inflammasome NLRP3 requiert deux signaux : le premier constitue l étape dite d amorçage donnant lieu à la production de pro-il-1β et le 202

204 deuxième constitue l activation même de l inflammasome NLRP3. L amorçage est essentiel pour l activation de NLRP3. Pour les THP-1, le premier signal de l activation de l inflammasome NLRP3 peut être réalisé par l agent de différenciation PMA, qui va induire des taux élevés d IL-1β grâce à la libération d ATP endogène (Netea et al., 2009). Afin d étudier les mécanismes d action mis en jeu par des agents pro- ou anti-inflammatoires, nous avons voulu nous affranchir de la voie de signalisation de TLR4. Nous avons ainsi montré que des activateurs référencés de l inflammasome NLRP3 étaient suffisants pour induire une production d IL-1β par des THP-1 différenciées, sans stimulation par le LPS. De plus, les trois activateurs utilisés peuvent être classés en fonction de leur capacité à induire une production d IL-1β. Ainsi, la doxorubicine est moins pro-inflammatoire que le MSU, la nigéricine est l agent pro-inflammatoire le plus puissant testé. L utilisation d un inhibiteur référencé de l inflammasome NLRP3, la glybenclamide, nous a montré que l induction de l IL-1β nigéricine-dépendante pouvait être modulée et, aux doses les plus fortes, totalement inhibée. Le modèle mis en place nous permet donc d étudier des modulateurs de l inflammasome sans stimulation par le LPS et de tenter d expliquer leur mode d action. 203

205 Etude de l effet de signaux inflammatoires précoces sur des macrophages THP-1 en absence d activation de la voie TLR De nombreux travaux scientifiques font apparaître que l ATP est impliqué dans les mécanismes secondaires d activation de l inflammasome. De plus, il constitue un signal de danger, libéré par les cellules dans des conditions pro-inflammatoires et peut être considéré comme un messager lié à l inflammation chronique. Notre hypothèse de travail a donc été que l ATP est un médiateur commun à l ensemble des activateurs de l inflammasome. Production d IL-1β ATP-dépendante Nous avons tout d abord fixé les conditions de stimulation des cellules THP-1 par l ATP, afin de se rapprocher des signaux inflammatoires chroniques. En effet, dans ce cas, les concentrations extracellulaires en ATP sont de l ordre de plusieurs centaines de micromolaires et nous avons tenté de recréer ces conditions in vitro (Pellegatti et al., 2008). Dans le cadre de notre modèle, nous induisons de l IL-1β de manière significative à partir de 300 µm d ATP extracellulaire. L augmentation de la concentration en ATP augmente progressivement l induction d IL-1β, puis elle s effondre lorsque l ATP est ajouté à très forte concentration, probablement en raison de phénomènes de toxicité. Nous montrons donc qu à des fortes concentrations de l ordre de 10 mm, l ATP extracellulaire induit une cytotoxicité notable. Cet effet de concentrations déca-millimolaires d ATP extracellulaire a déjà été observé sur d autres types de macrophages, et semble faire appel à un mécanisme de gonflement de la cellule et de destruction de ces organites, laissant penser à un mécanisme de nécrose plutôt que d apoptose (Murgia et al., 1992). L utilisation de 1 mm d ATP dans la suite de l étude nous a permis d obtenir une induction suffisante de la production d IL-1β afin d évaluer les mécanismes mis en jeu. Cette condition expérimentale nous semble en outre proche de celle d un signal pro-inflammatoire chronique. De plus, notre étude cinétique sur la production d IL-1β ATP-induite révèle que la maturation et la sécrétion d IL-1β dans les surnageants de culture se produit dès 4 heures et devient stable entre 6 et 24 heures. Cela nous a permis de déterminer le temps de stimulation par l ATP le plus approprié afin d avoir une 204

206 sécrétion stable et suffisante que l on peut moduler par la suite. Il est à noter cependant que, comme nous l avons démontré pour la production d IL-1β basale par des THP-1 différenciées, il est possible d augmenter la réponse IL-1β ATP-induite en augmentant la concentration en TPA et celle de LPS. Production d IL-1β dépendante de générateurs de ROS Afin d identifier le signal commun nécessaire pour l activation de l inflammasome NLRP3, nous avons également étudié des générateurs d espèces radicalaires, qui sont impliqués dans le mécanisme d action de l ATP (Cruz et al., 2007). Les espèces radicalaires sont connues pour être des signaux de danger tout comme l ATP, et sont donc également considérées comme des signaux liés à l inflammation chronique. Nous avons ainsi utilisé deux générateurs d espèces radicalaires de l oxygène, l H 2 O 2 et le tbhp. Notre étude a permis de mettre en évidence le lien direct entre les ROS générées et la production d IL-1β inflammasome-dépendante. En effet, via l ajout d H 2 O 2 dans le milieu de culture, on a pu montrer par la technique de RPE couplée à celle du «spin trapping» la production de radicaux libres oxygénés, notamment le radical hydroxyle, nécessaires à l effet pro-inflammatoire d H 2 O 2. L induction de la production d IL-1β par des générateurs de ROS dans les cellules THP-1 a montré un effet «en forme de cloche» introduisant la complexité du signal entre une induction suffisante et une cytotoxicité faible. En effet, quel que soit le générateur utilisé, à 5000 cellules/puits, nous montrons que l induction d IL-1β est maximale à environ 100 µm et que des concentrations supérieures induisent moins, voire plus du tout, d IL-1β ce qui dénote l apparition d une toxicité cellulaire. A cellules/puits, pour l H 2 O 2, «l effet cloche» est également observé mais l induction maximale d IL-1β est décalée à une concentration deux fois supérieure à celle observée pour 5000 cellules/puits. Tous ces résultats suggèrent l existence d un équilibre du système redox au sein de la cellule. De plus, l utilisation d un anti-oxydant, la NAC nous montre selon la concentration testée un effet pro- ou anti-inflammatoire pour la production basale ou pour la production d IL-1β ATP-induite. L intervention des ROS dans la production d IL-1β est donc complexe mais nécessaire, et repose sur un équilibre entre le système pro- et anti-oxydant influençant directement le système inflammatoire. Ce système redox est très réactif et est régulé de manière très fine en fonction des stimuli environnementaux, en faveur d une exacerbation ou d une inhibition de la réponse inflammatoire. En effet, dans le cas d une inhibition faible de la 205

207 production de ROS, une réponse «pro-oxydative» serait conduite par la cellule afin de rétablir l équilibre oxydatif. L induction de ROS activerait alors l inflammasome et ainsi augmenterait la production d IL-1β par les cellules. Cet équilibre ne serait plus rétabli après une forte inhibition de la production de ROS et donnerait alors lieu à un effet antiinflammatoire. Nous avons tenté de transposer les conditions exposées précédemment en plaques 6 puits afin d induire une production d IL-1β par les générateurs de ROS, dans le but d étudier les mécanismes d action impliqués. Le compromis entre une induction suffisante et une faible cytotoxicité a été difficile. La solution s en approchant le plus correspond à celle où la densité cellulaire est de 1 million de cellules par puits traitées par 500 µm d H 2 O 2 ou 400 µm de tbhp, malgré une toxicité importante. Cependant, afin d éviter une influence éventuelle de la toxicité cellulaire sur nos résultats, dans le cas où un nombre important de cellules a été nécessaire, nous avons rassemblé plusieurs puits d une plaque 96 puits. Ainsi, la suite de l étude portant sur le rôle de générateurs d espèces radicalaires dans l activation de l inflammasome NLRP3 a principalement été réalisée avec 5000 cellules stimulées par 125 µm d H 2 O 2. Ces conditions donnent lieu à une induction significative de la production d IL- 1β dans les surnageants de culture et à une cytotoxicité faible. Dans le cas où cellules par puits sont ensemencées, la concentration en H 2 O 2 permettant le meilleur compromis entre une induction d IL-1β et une cytotoxicité la moins importante est de 250 µm. Il est à noter que, comme nous l avons démontré pour la production d IL-1β ATP-induite, il est possible d augmenter la réponse d IL-1β ATP-induite en augmentant la concentration de TPA et en augmentant la concentration en LPS. Nous avons pu mettre en évidence une augmentation du signal DMPO-OH après un traitement par l H 2 O 2, indiquant la production du radical hydroxyle. Les tentatives d inhibition par la catalase de ce signal ainsi que celle de la production d IL-1β H 2 O 2 - dépendante sont peu concluantes et suggèrent l intervention d un autre facteur, comme par exemple d autres radicaux libres oxygénés. Ces résultats, couplés à ceux de la RPE suggèrent que la catalase n est peut-être pas le meilleur inhibiteur dans la production d IL-1β H 2 O 2 - dépendante dans le cadre du modèle cellulaire mis en place. L utilisation d un piégeur de ROS, tel que la NAC le confirme. En effet, quelle que soit la concentration en NAC testée, nous montrons une inhibition dose-dépendante de la production d IL-1β H 2 O 2 -induite. De 206

208 plus, la sensibilité de la sonde nous amène à nous demander si quelques micromolaires d H 2 O 2 suffiraient pour induire un signal différent du signal de base. Modulation de l inflammasome par ATP et H 2 O 2 Nous avons souhaité mieux appréhender l implication d un complexe inflammasome et en particulier de NLRP3, impliqué dans les maladies métaboliques, dans la production d IL-1β suite à une stimulation par l H 2 O 2 ou l ATP. Pour ce faire, nous avons réalisé une étude d expression génique en relation avec la voie de signalisation de l inflammasome NLRP3. Nous montrons tout d abord qu il n y a pas d induction du gène Tlr4 codant pour le récepteur au LPS. Il a été montré dans la littérature que la stimulation par le LPS induit l expression de TLR4 (Jiang et al., 2000; Visintin et al., 2001). Ainsi, nous montrons que nos deux stimulations ne sont pas contaminées par des endotoxines et que les résultats observés sont bien attribuables à l ATP ou à l H 2 O 2. Que ce soit pour l ATP ou l H 2 O 2, dans ces deux conditions, nous observons une sur-expression du gène codant pour l IL-1β d un facteur 2 environ, en limite de significativité. Cette limite est due aux variations inter-expériences et la significativité pourrait être atteinte en augmentant le nombre à 4 ou 5 au lieu de 3 en triplicates. Ensuite, les deux activateurs provoquent une sous-régulation d environ 20% du gène codant pour la protéine adaptatrice ASC, qui a un rôle central dans les inflammasomes. Ces résultats nous permettent de conclure l implication d un inflammasome. L utilisation d un inhibiteur de caspases suggère l intervention d une caspase-1 active, confirmant l implication d un inflammasome. Toutefois, la caspase-1 n est pas sur-régulée d un point de vue génique et protéique. Curieusement, l ajout de l inhibiteur de l activation de la caspase-1 a montré une augmentation d un facteur 3 de la quantité de sous-unité p20 de la caspase-1. Ces résultats nous emmènent vers l hypothèse d une rétro-régulation très active de l activité de la caspase- 1. En effet, dans notre cas, la même quantité de caspase-1 serait produite mais l inhibiteur empêche son activation comme le suggère son mécanisme d action (Slee et al., 1996). Cela provoquerait alors la synthèse de nouvelles protéines actives, qui vont elles aussi être inhibées par le Z-VAD en excès. Ainsi, le système s emballerait afin de contrecarrer cette inactivation. Cette hypothèse aurait pu être démontrée grâce à la mesure de l activité de la caspase-1. Cependant, les outils actuellement disponibles nécessitent un nombre important de cellules et donc un volume de culture important (plaque 6 puits) dans lequel la stimulation par l H 2 O 2 207

209 n est pas possible. Nous aurions pu l appliquer dans le cas d une stimulation par l ATP et d une inhibition par Z-VAD à différentes concentrations. De plus, la détermination de la quantité de sous-unité p20 dans ces surnageants aurait pu converger vers cette hypothèse en diminuant l excès d inhibiteur et en diminuant ainsi la sur-production de caspase-1. Concernant la stimulation par l ATP, nous montrons que l inflammasome NLRP3 est directement impliqué grâce à l observation d une sur-expression du gène codant pour la protéine NLRP3, confirmée par l étude de l expression protéique. Nous confirmons également la diminution de l expression de la protéine ASC. De plus, l utilisation de macrophages déficients pour les protéines ASC et NLRP3 confirme l implication directe de cet inflammasome. L ensemble de ces résultats sont en accord avec ceux retrouvés dans la littérature (Mariathasan et al., 2006). Concernant la stimulation par H 2 O 2, nous avons montré l implication d un inflammasome via l intervention d une caspase-1 active dans la production d IL-1β grâce à l inhibiteur Z-VAD. L étude génique nous a permis d exclure une induction de l inflammasome NLRP3. Une nouvelle étude génique aurait pu être réalisée afin de mettre en cause un autre inflammasome dans la production d IL-1β H 2 O 2 -dépendante. L utilisation de macrophages murins sauvages et déficients pour NLRP3 suite à une stimulation par l H 2 O 2 a donné lieu à des résultats surprenants. En effet, nous avons montré un effet anti-inflammatoire de l H 2 O 2 dans les cellules sauvages et l effet inverse (proinflammatoire) dans les cellules déficientes pour NLRP3. Cela suggèrerait que dans ce modèle, NLRP3 serait inhibé par les ROS et présenterait un rôle anti-oxydant protecteur pour les cellules. Il a été décrit qu il existait une inhomogénéité dans l état oxydoréducteur basal entre les différents types de cellules myéloïdes. De manière générale, l adaptation des cellules primaires à une croissance continue in vitro se manifeste par une sur-expression des systèmes anti-oxydants, en raison notamment des conditions environnementales non physiologiques. Ainsi, les THP-1 et les macrophages auraient un potentiel réducteur plus fort, avec une surrégulation des systèmes anti-oxydants, contrairement aux monocytes fraichement isolés (Carta et al., 2011; Rubartelli, 2012). En fonction de ces données, les ROS auraient dû être rapidement éliminées par les BMDMs et les THP-1, qui auraient dû se comporter de la même manière. Nos résultats ont montré des réponses contradictoires sur deux points. Premièrement, de par ce fort potentiel anti-oxydant, les BMDMs ne devraient pas montrer de modulation de la production d IL-1β avec ou sans NLRP3 et les taux d IL-1β devraient être constants quelle que soit la concentration en H 2 O 2 testée. Deuxièmement, en raison de leur fort potentiel 208

210 oxydoréducteur, les THP-1 nécessitent un stress oxydatif important, tel que 5 mm d H 2 O 2 pour 1 million de cellules comme le suggère l étude de Carta et al. (2011). Or, nous avons montré que, pour ce nombre de cellules, il est très difficile de faire un compromis entre une induction d IL-1β et une cytotoxicité faible même pour des doses en H 2 O 2 plus faibles comme 500 µm. Nos résultats ne sont donc pas accord avec la bibliographie. De nombreuses études montrent que l IL-6 est induite par l IL-1β (Gallucci et al., 1998; Nadlonek et al., 2013). Aussi, nous nous sommes penchés sur l hypothèse d une régulation commune de cette voie IL-1β-dépendante et nous avons étudié l influence de nos stimulateurs sur la synthèse d IL-6 et l inhibition de la caspase-1 dans chaque cas. Conformément à la littérature, nous confirmons que l ATP induit la production d IL-6 (Douillet et al., 2006; Hanley et al., 2004; Kruse et al., 2012). Nous montrons également qu elle est inhibée par l inhibition de la caspase-1 et est donc régulée de manière similaire à l IL-1β. Il est à noter que nous avons observé des taux de base d IL-6 30 fois inférieurs à ceux d IL-1β. Les ROS et l H 2 O 2 sont également capables d induire la production d IL-6 (Junn et al., 2000; Yoshida et al., 1999; Yu et al., 2005; Zhang et al., 2001). Cependant, nous montrons que dans notre modèle, la production d IL-6 n est pas induite par l H 2 O 2. Implication de la voie purinergique L étude de l implication de la voie purinergique a été réalisée et a permis de lier les activateurs ATP et H 2 O 2 à la production d IL-1β. Il est bien connu que l ATP agit via la voie purinergique afin d activer l inflammasome NLRP3 (Mariathasan et al., 2006). Il a également été montré que d autres récepteurs de cette voie, tels que P2X et P2Y, jouent un rôle prépondérant (Riteau et al., 2012). Nos résultats sont en accord avec ceux de la littérature et nous montrons que l ATP interagit avec des récepteurs de type P2X et P2Y mais, contrairement à la bibliographie, pas avec le récepteur P2X7. Ces résultats suggèrent qu après son ajout dans le milieu de culture, l ATP est dégradé en ses métabolites secondaires, comme l ADP par exemple, qui interagit uniquement avec les récepteurs P2Y. Cette dégradation serait rendue possible par la présence d ecto-atpases à la surface des THP-1. L ATP n agirait pas directement mais via les produits secondaires de sa dégradation par des protéases présentes à la surface des cellules. L utilisation d inhibiteurs pharmacologiques des ecto- ATPases, tels que ARL67156, aurait permis d étayer cette hypothèse. La détermination des ratios ATP/ADP aurait pu compléter nos conclusions, de même qu une stimulation des 209

211 cellules avec de l ADP ou de l AMP afin de voir leur influence sur la production d IL-1β. Une étude cinétique de la quantité d ATP présent dans le milieu de culture depuis l ajout à la récolte des surnageants aurait pu également conforter notre hypothèse. L étude de Riteau et al. (2012) a montré que de l ATP endogène pouvait être produit suite à un stimulus pro-inflammatoire de type «cristaux» et favoriserait l activation de l inflammasome. En outre, des données de la littérature ont suggéré que le stimulus par l H 2 O 2 provoquait la libération d ATP (Kim and Lee, 2013; Tsai et al., 2007). Nous avons donc étudié l implication de la voie purinergique dans la production d IL-1β H 2 O 2 - dépendante. Nos résultats ont révélé que l inhibition des récepteurs de type P2X et P2Y, à l exception de P2X7R, inhibait également la production d IL-1β. Ces données suggèrent ainsi qu après ajout d H 2 O 2 dans le milieu de culture, de l ATP endogène est produit et excrété par les cellules THP-1 et sert de signal secondaire commun dans l activation de l inflammasome, comme il a été décrit par Riteau et al. (2012). Cette hypothèse aurait pu être vérifiée grâce à la quantification de l ATP produit dans les surnageants de culture après stimulation par H 2 O 2. L utilisation de l apyrase, une enzyme dégradant l ATP, permettrait d inhiber ce signal secondaire et aurait pu permettre de renforcer notre hypothèse. Finalement l ATP, que nous pensions être un signal secondaire nécessaire pour l activation de l inflammasome NLRP3 donnant lieu à la production d IL-1β, fait intervenir un autre signal intermédiaire, qui est la génération de ROS. Nous montrons que l ATP et les ROS empruntent des voies d activation différentes mais menant toutes les deux à l activation d une caspase-1 et à la production d IL-1β via l intervention des voies purinergiques. Ainsi, une boucle d activation semble expliquer leur mécanisme en synergie. En effet, l ATP provoque l activation de l inflammasome NLRP3 grâce à la production de ROS, qui vont alors agir sur un autre inflammasome et donner lieu à la production d IL-1β. Les ROS provoqueraient également la production d ATP endogène, qui serait excrété via des canaux de type connexine ou panx-1 ou P2X7R et qui agirait à son tour sur les canaux purinergiques pour activer l inflammasome NLRP3. 210

212 Application du modèle : détermination du profil inflammatoire potentiel de produits Les extraits naturels L utilisation du modèle de stimulation cellulaire que nous avons mis en place permet de tester diverses molécules ou produits d origine commerciale ou synthétique. Aujourd hui, le développement de compléments alimentaires à base de produits naturels ayant des propriétés biologiques intéressantes présente un fort intérêt et un enjeu commercial important. Nous avons ainsi pu mettre en évidence une activité anti-inflammatoire de certains extraits de dattes, notamment pour les variétés Halwa et Ghazi. Ce travail est exposé dans la première publication. Le mécanisme d action supposé pour ces extraits fait appel à une activité inhibitrice de l inflammasome via le piégeage de ROS, car les produits testés présentent également une activité anti-oxydante. Cette hypothèse doit être vérifiée et la mesure de la production de ROS dans le milieu extracellulaire à l aide d une sonde de type H 2 DCFDA pourrait permettre de mesurer la modulation des radicaux libres dans les surnageants de culture après le traitement par ces deux extraits. De plus, l implication d un inflammasome pourrait être déterminée grâce au dosage de la sous-unité p20 de la caspase-1 dans les surnageants de culture pour les extraits les plus actifs. La mesure de l activité enzymatique de la caspase-1 pourrait également confirmer cela. Cependant, le kit à disposition nécessite une grande quantité de cellules (minimum 2 millions de cellules par échantillon) et par conséquent, une culture dans un grand volume (plaque 6 puits dans 3 ml) avec l utilisation de quantités importantes de produits (150 µl par condition) ce qui est limitant dans cette étude. Les donneurs de NO Si l on considère l intérêt que suscite l inhibition de l inflammasome en tant que modulateur de l inflammation, les générateurs de NO semblent également intéressants (Rochette et al., 2013b). En effet, des traitements thérapeutiques sont déjà utilisés et font appel à ce type de molécules, telles que la TNT (également nommée glycérol trinitrate) ou l ISD. Ces molécules ont été utilisées comme donneurs de NO de référence dans notre modèle 211

213 afin de corréler cette activité avec une activité anti-inflammatoire. Nous avons montré que, dans nos conditions, la production de NO par l isosorbide dinitrate, évaluée par les nitrites qui sont des produits secondaires stables du NO, est très faible par rapport à la trinitrine (TNT ou GTN). En effet, à la plus forte dose testée possible, la production de nitrites est d environ 3,5 µm alors que 100 µm de TNT produisent environ 5 µm de nitrites. Cette production est trop faible et ne permet pas d inhiber l IL-1β induite. La trinitrine est un meilleur donneur de NO que l isosorbide dinitrate. Elle est la substance active du traitement nommé «Natispray», qui a notamment été utilisé dans notre étude. TNT présente également une activité antiinflammatoire dès la dose de 100 µm dans le cadre de notre modèle. En thérapeutique, sa posologie pour prévenir ou traiter l angine de poitrine et l œdème aigu du poumon est de 1,32 µmol, soit 0,264 µm (dans 5 litres de sang). L utilisation de cette molécule comme traitement thérapeutique indique que sa tolérance vis-à-vis de l Homme est acceptable. Cependant, la dose active de TNT dans notre modèle (100 µm) est très supérieure à celle utilisée chez les patients. L intérêt d un nouveau donneur de NO plus efficace apparaît donc. Le composé MK128 présenté dans le deuxième article de la partie résultats pourrait répondre à ces conditions. En effet, dans notre modèle, la TNT est efficace à 100 µm donnant lieu à une production de NO d environ 5 µm. Pour produire cette même quantité de NO, seulement 7 µm de MK128 sont nécessaires ; son activité anti-inflammatoire est presque maximale dès 100 µm et son EC50 est trois fois moins importante que celle de la trinitrine. L utilisation de cette molécule en tant que régulateur de l inflammasome est donc une piste à explorer et des études in vivo pourraient être envisagées. Les composés MKs non donneurs de NO Dans la série des composés MKs, le MK133, qui ne fait partie de ceux étudiés dans la deuxième publication exposée dans la partie résultats, présente également un intérêt. En effet, il présente une activité anti-inflammatoire en présence d H 2 O 2 seulement. Cependant, il n induit pas la production de nitrites. Son activité peut être attribuée à la présence d un acide lipoïque branché au squelette purine. En effet, l effet anti-oxydant et anti-inflammatoire de l acide α-lipoïque est bien connu (Rochette et al., 2013a). Ainsi, MK133 pourrait agir en piégeant les molécules d H 2 O 2 les empêchant d induire la production d IL-1β. Ceci pourrait être confirmé grâce à la mesure de la production de ROS extracellulaires via la sonde H 2 DCFDA. De plus, l utilisation d un autre générateur de ROS comme le tbhp pourrait confirmer cette hypothèse. 212

214 Conclusions et perspectives L ensemble des résultats obtenus au cours de cette thèse ont permis de répondre aux trois objectifs initialement fixés : (1) la mise en place d un modèle cellulaire permettant l étude de modulateurs de l inflammasome dans des conditions stériles, (2) l étude des mécanismes impliqués suite à la stimulation par ATP et des générateurs de ROS dans ce modèle cellulaire mis en place et (3) l application de ce modèle à divers composés afin de caractériser leur activité inflammatoire. Nous montrons dans ce travail une nouvelle approche mécanistique de la stimulation par ATP et H 2 O 2, qui est proposée dans la figure 40 ci-après et reprend les éléments présentés dans la discussion. Figure 40 : Mécanisme supposé de l'activation des inflammasomes par l ATP et H 2 O 2. L ATP extracellulaire est dégradé par des ecto-atpases en ses métabolites secondaires, tels que ADP et AMP, qui vont alors agir sur les récepteurs purinergiques de type P2X et P2Y, à l exception de P2X7R. Cela va alors provoquer l activation de l inflammasome NLRP3 et la production de ROS, qui vont agir sur un autre inflammasome. Tous les inflammasomes activés vont ensuite donner lieu à la production d IL-1β mature. Un générateur de ROS (H 2 O 2 ) provoque également la production d ATP endogène, qui est excrété grâce à des canaux de type connexine, panx-1 ou P2X7R et agit à son tour via ses métabolites secondaires sur les récepteurs purinergiques afin d activer l inflammasome NLRP3. L utilisation du modèle cellulaire pour des composés d origines variées est possible et nous a permis de confirmer l existence d une nouvelle catégorie d inhibiteurs de 213

27/02/2012. Rôle de l immunité innée. Etapes de l immunité innée. Auto-Immune Immunité acquise. Auto-Inflammatoire t Immunité innée

27/02/2012. Rôle de l immunité innée. Etapes de l immunité innée. Auto-Immune Immunité acquise. Auto-Inflammatoire t Immunité innée Qu est ce qu une Maladie auto-inflammatoire? Maladie inflammatoire De l immunité CONTINUUM Auto-Inflammatoire t Immunité innée IL1 Auto-Immune Immunité acquise Hereditaires (monogeniques) - Fièvres récurrentes:

Plus en détail

Réponses aux pathogènes, immunité anti-infectieuse

Réponses aux pathogènes, immunité anti-infectieuse Réponses aux pathogènes, immunité anti-infectieuse Ghislaine Sterkers et Marie-Anne Gougerot-Pocidalo I-Introduction... 2 II-Systèmes immunitaires impliqués dans la défense anti-infectieuse... 3 II-1.Immunité

Plus en détail

CONTRÔLE DU MÉTABOLISME ET DE LA PROLIFÉRATION PAR LES MICROARN ET LES ACTEURS DU CYCLE CELLULAIRE

CONTRÔLE DU MÉTABOLISME ET DE LA PROLIFÉRATION PAR LES MICROARN ET LES ACTEURS DU CYCLE CELLULAIRE UNIVERSITE MONTPELLIER 1 UFR MEDECINE THÈSE Présentée pour obtenir le grade de DOCTEUR DE L UNIVERSITE MONTPELLIER I Discipline : Biochimie et Biologie Moléculaire École doctorale : Sciences Chimiques

Plus en détail

Techniques Immunologiques appliquées au diagnostic

Techniques Immunologiques appliquées au diagnostic Département de Biologie Laboratoire de Biochimie - Immunologie Université Mohammed V-Agdal Faculté des Sciences Filière SVI Semestre 4 (S4) 2004-2005 Module de Biologie Humaine M 16.1 Élément d Immunologie

Plus en détail

Stage de formation 17 & 18 mars 2014. NetBioDyn et la modélisation des réactions immunitaires. Conférences. Ateliers. Institut français de l Éducation

Stage de formation 17 & 18 mars 2014. NetBioDyn et la modélisation des réactions immunitaires. Conférences. Ateliers. Institut français de l Éducation Stage de formation 17 & 18 mars 2014 Conférences Institut français de l Éducation Ateliers École normale supérieure de Lyon (site Monod) nihil est sine ratione NetBioDyn et la modélisation des réactions

Plus en détail

28 Complément et inflammation

28 Complément et inflammation 28 Complément et inflammation Introduction Le complément est un système de protéines sériques qui comporte une trentaine de constituants, solubles et membranaires. Il est impliqué dans la réponse innée

Plus en détail

Chapitre 2: Les mécanismes de

Chapitre 2: Les mécanismes de Chapitre 2: Les mécanismes de l immunité I-Les anticorps: agents du maintien de l intégrité du milieu extracellulaire 1- La réaction antigène- anticorps et l élimination du complexe immun Les anticorps:

Plus en détail

La leucémie lymphoïde chronique (LLC)

La leucémie lymphoïde chronique (LLC) La leucémie lymphoïde chronique (LLC) La plus fréquente des hémopathies : 3 nouveaux cas / 100000 habitants / an Pas de facteur favorisant connu Adultes âgés (>65 ans), sexratio = 2/1 Accumulation de lymphocytes

Plus en détail

L immunité innée: de la Clinique à la Science Fondamentale

L immunité innée: de la Clinique à la Science Fondamentale L immunité innée: de la Clinique à la Science Fondamentale RALANDISON Stéphane Association des Praticiens en Rhumatologie à Madagascar Soirée Rhumato, 28 février 2013 Introduction Habitudes pratiques:

Plus en détail

F Andrianjafison, ON Rakotomalala, MMO Razanaparany, H Rakotoharivelo, OH Rakotonirainy, S Ralandison

F Andrianjafison, ON Rakotomalala, MMO Razanaparany, H Rakotoharivelo, OH Rakotonirainy, S Ralandison F Andrianjafison, ON Rakotomalala, MMO Razanaparany, H Rakotoharivelo, OH Rakotonirainy, S Ralandison Après-Midi Rhumato, février 2014, CHU JRB Antananarivo Maladies inflammatoires : désordres inflammatoires

Plus en détail

Captation, Apprêtement et Présentation de l antigène. Laurence Guglielmi laurence.guglielmi@univ-montp1.fr

Captation, Apprêtement et Présentation de l antigène. Laurence Guglielmi laurence.guglielmi@univ-montp1.fr Captation, Apprêtement et Présentation de l antigène Laurence Guglielmi laurence.guglielmi@univ-montp1.fr 1 Cellules Présentatrices d Antigène (CPA) Cellules dendritiques Monocytes / Macrophages Lymphocytes

Plus en détail

LE MODELE CELLULAIRE THP-1 : ADAPTATION A L ETUDE DE MODULATEURS DE L ACTIVITE INFLAMMATOIRE PRECOCE IMPLIQUANT L INFLAMMASOME

LE MODELE CELLULAIRE THP-1 : ADAPTATION A L ETUDE DE MODULATEURS DE L ACTIVITE INFLAMMATOIRE PRECOCE IMPLIQUANT L INFLAMMASOME UNIVERSITE DE BOURGOGNE ECOLE DOCTORALE ENVIRONNEMENTS - SANTE UFR SCIENCES DE LA VIE - DIJON THÈSE Pour obtenir le grade de DOCTEUR DE L UNIVERSITE DE BOURGOGNE Discipline : Biologie cellulaire LE MODELE

Plus en détail

Le système du Complément

Le système du Complément Le système du Complément Marie-Agnès Dragon-Durey, Jean Yves Cesbron, Alain Chevailler, Christian Drouet, Béatrice Uring-Lambert I-Introduction... 2 II-Les voies d activation du Complément... 2 II-1.La

Plus en détail

TABLE DES MATIERES AVANT-PROPOS.. 17 ABREVIATIONS.. 19 RESUME... 21 ABSTRACT 22 INTRODUCTION. 23 ETUDE BIBLIOGRAPHIQUE. 29

TABLE DES MATIERES AVANT-PROPOS.. 17 ABREVIATIONS.. 19 RESUME... 21 ABSTRACT 22 INTRODUCTION. 23 ETUDE BIBLIOGRAPHIQUE. 29 TABLE DES MATIERES AVANT-PROPOS.. 17 ABREVIATIONS.. 19 RESUME..... 21 ABSTRACT 22 INTRODUCTION. 23 ETUDE BIBLIOGRAPHIQUE. 29 LA RETINOPATHIE DIABETIQUE.. 31 I-LE DIABETE SUCRE ET SES COMPLICATIONS 31 1-Le

Plus en détail

Evaluation et prise en charge des processus de récupération en mémoire dans la maladie d Alzheimer

Evaluation et prise en charge des processus de récupération en mémoire dans la maladie d Alzheimer Evaluation et prise en charge des processus de récupération en mémoire dans la maladie d Alzheimer Benjamin Boller To cite this version: Benjamin Boller. Evaluation et prise en charge des processus de

Plus en détail

ABSENCE DE MEMOIRE IMMUNOLOGIQUE

ABSENCE DE MEMOIRE IMMUNOLOGIQUE Immunite innee Ancienne chez tous les organismes multicellulaires Rapide premiere ligne de defense Immediate pas besoin d activation prealable Forte Elimine la majorite des pathogenes / microorganismes

Plus en détail

Conception d un convertisseur de puissance pour véhicules électriques multi-sources

Conception d un convertisseur de puissance pour véhicules électriques multi-sources Conception d un convertisseur de puissance pour véhicules électriques multi-sources Ahmed Boucherit To cite this version: Ahmed Boucherit. Conception d un convertisseur de puissance pour véhicules électriques

Plus en détail

Système de diffusion d information pour encourager les PME-PMI à améliorer leurs performances environnementales

Système de diffusion d information pour encourager les PME-PMI à améliorer leurs performances environnementales Système de diffusion d information pour encourager les PME-PMI à améliorer leurs performances environnementales Natacha Gondran To cite this version: Natacha Gondran. Système de diffusion d information

Plus en détail

CELLULES DENDRITIQUES ET F.BENABADJI (ANAP AVRIL 2011)

CELLULES DENDRITIQUES ET F.BENABADJI (ANAP AVRIL 2011) CELLULES DENDRITIQUES ET ALLERGIE RESPIRATOIRE F.BENABADJI (ANAP AVRIL 2011) LE SYSTEME IMMUNITAIRE Système inné Système ancien de défense Pathogenrecognition receptors(prr) codés par des cellules germinales

Plus en détail

Pour une sociologie du réalisme politique : Le cas du Parti socialiste

Pour une sociologie du réalisme politique : Le cas du Parti socialiste Pour une sociologie du réalisme politique : Le cas du Parti socialiste Pierre-Alexis Tchernoïvanoff To cite this version: Pierre-Alexis Tchernoïvanoff. Pour une sociologie du réalisme politique : Le cas

Plus en détail

Espace Charles Louis HAVAS 1, rue des Huissiers - 92220 NEUILLY Métro ligne 1, station Pont de Neuilly

Espace Charles Louis HAVAS 1, rue des Huissiers - 92220 NEUILLY Métro ligne 1, station Pont de Neuilly 1 Vendredi 25 janvier 2008 : Espace Charles Louis HAVAS 1, rue des Huissiers - 92220 NEUILLY Métro ligne 1, station Pont de Neuilly 2 Immunité et exposition aux rayonnements ionisants Professeur Michel

Plus en détail

BICH 4943 Thèmes choisis APOPTOSE. Aspects moléculaires et cellulaires. Généralités. 2008 Apoptose Diapo 1

BICH 4943 Thèmes choisis APOPTOSE. Aspects moléculaires et cellulaires. Généralités. 2008 Apoptose Diapo 1 BICH 4943 Thèmes choisis APOPTOSE Aspects moléculaires et cellulaires Généralités 2008 Apoptose Diapo 1 1 Importance physiologique Développement Formation des membres Neurones du systèmes nerveux Contrôle

Plus en détail

La socialisation par les sports collectifs : une approche conative auprès des enseignants d éducation physique et sportive

La socialisation par les sports collectifs : une approche conative auprès des enseignants d éducation physique et sportive La socialisation par les sports collectifs : une approche conative auprès des enseignants d éducation physique et sportive Guy Verschave To cite this version: Guy Verschave. La socialisation par les sports

Plus en détail

Savoir nager, une richesse culturelle : Analyse comparative de l enseignement de la natation à Canton, Dakar et Paris

Savoir nager, une richesse culturelle : Analyse comparative de l enseignement de la natation à Canton, Dakar et Paris Savoir nager, une richesse culturelle : Analyse comparative de l enseignement de la natation à Canton, Dakar et Paris Valérie Schwob To cite this version: Valérie Schwob. Savoir nager, une richesse culturelle

Plus en détail

Immunité anti-tumorale

Immunité anti-tumorale Immunité anti-tumorale Professeur M GUENOUNOU Laboratoire d Immunologie & Microbiologie UFR de Pharmacie 51100 REIMS 1- Cellules tumorales - Une tumeur est une prolifération clonale issue d une cellule

Plus en détail

Chapitre I La réaction inflammatoire, une manifestation de l immunité innée. - I - Approche globale des réactions immunitaires

Chapitre I La réaction inflammatoire, une manifestation de l immunité innée. - I - Approche globale des réactions immunitaires Chapitre I La réaction inflammatoire, une manifestation de l immunité innée - I - Approche globale des réactions immunitaires Mécanismes de défense de l organisme en réponse à la pénétration de microorganismes

Plus en détail

Sorthong Banjongsawat. To cite this version: HAL Id: tel-00771422 https://tel.archives-ouvertes.fr/tel-00771422

Sorthong Banjongsawat. To cite this version: HAL Id: tel-00771422 https://tel.archives-ouvertes.fr/tel-00771422 La Thaïlande, pays aux deux visages : Approches sémiologiques d une identité culturelle ambiguë à travers le miroir de la presse et autres discours publics Sorthong Banjongsawat To cite this version: Sorthong

Plus en détail

Résultats à long terme de la photo-kératectomie thérapeutique dans les dystrophies cornéennes

Résultats à long terme de la photo-kératectomie thérapeutique dans les dystrophies cornéennes Résultats à long terme de la photo-kératectomie thérapeutique dans les dystrophies cornéennes épithéliales Badreddine Chanaoui To cite this version: Badreddine Chanaoui. Résultats à long terme de la photo-kératectomie

Plus en détail

CHAPITRE 5.3 : LES ACTEURS DE L IMMUNITÉ

CHAPITRE 5.3 : LES ACTEURS DE L IMMUNITÉ CHAPITRE 5.3 : LES ACTEURS DE L IMMUNITÉ Les mécanismes de reconnaissance et d élimination des molécules du non soi font intervenir un système diffus d organes, de tissus, de cellules et de molécules qui

Plus en détail

Les récepteurs de l immunité innée. Emmanuel Hermann Faculté de Pharmacie de Lille 2 Immunologie 2008-2009 3ème année FCB

Les récepteurs de l immunité innée. Emmanuel Hermann Faculté de Pharmacie de Lille 2 Immunologie 2008-2009 3ème année FCB Les récepteurs de l immunité innée Emmanuel Hermann Faculté de Pharmacie de Lille 2 Immunologie 2008-2009 3ème année FCB L immunité innée est une réponse immédiate qui survient chez tout individu en l

Plus en détail

Mort cellulaire. Il existe plusieurs formes de mort cellulaire : nécrose, apoptose, autophagie, nécroapoptose,

Mort cellulaire. Il existe plusieurs formes de mort cellulaire : nécrose, apoptose, autophagie, nécroapoptose, Mort cellulaire Quelques généralités Il existe plusieurs formes de mort cellulaire : nécrose, apoptose, autophagie, nécroapoptose, Rôles physiologiques variés : morphogenèse, élaboration du système immunitaire,

Plus en détail

Les cytokines et leurs récepteurs. Laurence Guglielmi laurence.guglielmi@univ-montp1.frli

Les cytokines et leurs récepteurs. Laurence Guglielmi laurence.guglielmi@univ-montp1.frli Les cytokines et leurs récepteurs Laurence Guglielmi laurence.guglielmi@univ-montp1.frli l i@ i 1 Les cytokines et leurs récepteurs 2 mécanismes principaux d interactions cellulaires : - contact membranaire

Plus en détail

EXERCICES : MECANISMES DE L IMMUNITE : pages 406 407 408 409 410

EXERCICES : MECANISMES DE L IMMUNITE : pages 406 407 408 409 410 EXERCICES : MECANISMES DE L IMMUNITE : pages 406 407 408 409 410 EXERCICE 1 PAGE 406 : EXPERIENCES A INTERPRETER Question : rôles respectifs du thymus et de la moelle osseuse dans la production des lymphocytes.

Plus en détail

La réaction INFLAMMATOIRE

La réaction INFLAMMATOIRE cause traumatique cause infectieuse Réparation des tissus lésés Signal de DANGER Défense naturelle La réaction INFLAMMATOIRE réponse à une agression aiguë (qq minutes, jours) chronique (qq semaines, années)

Plus en détail

THÈSE / UNIVERSITÉ DE RENNES 1 Sous le sceau de l Université Européenne de Bretagne. Pour le grade de DOCTEUR DE L UNIVERSITÉ DE RENNES 1

THÈSE / UNIVERSITÉ DE RENNES 1 Sous le sceau de l Université Européenne de Bretagne. Pour le grade de DOCTEUR DE L UNIVERSITÉ DE RENNES 1 ANNÉE 2014 THÈSE / UNIVERSITÉ DE RENNES 1 Sous le sceau de l Université Européenne de Bretagne Pour le grade de DOCTEUR DE L UNIVERSITÉ DE RENNES 1 Mention : Biologie et Science de la Santé Ecole doctorale

Plus en détail

La structure de la révolution numérique : philosophie de la technologie

La structure de la révolution numérique : philosophie de la technologie La structure de la révolution numérique : philosophie de la technologie Stéphane Vial To cite this version: Stéphane Vial. La structure de la révolution numérique : philosophie de la technologie. Philosophy.

Plus en détail

Résumé. Delphine Théard

Résumé. Delphine Théard Delphine Théard Département de Biologie Cellulaire, section Biologie Cellulaire des Membranes, Centre Medical Universitaire de Groningue, Université de Groningue, 9713 AV Groningue, Pays-Bas - 135 - Résumé

Plus en détail

Mort cellulaire. Lara Chalabreysse

Mort cellulaire. Lara Chalabreysse Mort cellulaire Lara Chalabreysse 1 1/ Apoptose 2 Définition Forme de mort cellulaire Eliminer les cellules indésirables Étapes coordonnées programmées Gènes dédiés à cette tache Implications Développement

Plus en détail

Rôle du complexe protéique NPHP1/NPHP4/RPGRIP1L impliqué dans la

Rôle du complexe protéique NPHP1/NPHP4/RPGRIP1L impliqué dans la Rôle du complexe protéique NPHP1/NPHP4/RPGRIP1L impliqué dans la néphronophtise et les ciliopathies associées, dans la morphogenèse épithéliale, la polarité cellulaire et la ciliogenèse Helori-Mael Gaudé

Plus en détail

CHAP 1: CIBLES DES MEDICAMENTS

CHAP 1: CIBLES DES MEDICAMENTS CHAP 1: CIBLES DES MEDICAMENTS GÉNÉRALITÉS Le Code de la Santé Publique française définit le médicament comme «une substance ou composition présentée comme possédant des propriétés curatives ou préventives

Plus en détail

Les bases de la transduction du signal des lymphocytes T

Les bases de la transduction du signal des lymphocytes T Frédéric VELY frederic.vely@ap-hm.fr MCU-PH Laboratoire d Immunologie - Hôpital de la Conception Lab of NK cells and Innate Immunity - Centre d Immunologie de Marseille-Luminy Les bases de la transduction

Plus en détail

APOPTOSE I- CONCEPTS DE L APOPTOSE II- MECANISMES MOLECULAIRES III- APOPTOSE ET PATHOLOGIES IV- PERSPECTIVES THERAPEUTIQUES. A.

APOPTOSE I- CONCEPTS DE L APOPTOSE II- MECANISMES MOLECULAIRES III- APOPTOSE ET PATHOLOGIES IV- PERSPECTIVES THERAPEUTIQUES. A. APOPTOSE I- CONCEPTS DE L APOPTOSE A. Définition B. Circonstances de survenue de l apoptose 1 ) Apoptose physiologique 2 ) Apoptose pathologique C. Modifications morphologiques et biochimiques D. Déroulement

Plus en détail

Géraldine Guérillot. To cite this version: HAL Id: tel-00873627 https://tel.archives-ouvertes.fr/tel-00873627

Géraldine Guérillot. To cite this version: HAL Id: tel-00873627 https://tel.archives-ouvertes.fr/tel-00873627 La réception des discours de développement durable et d actions de responsabilité sociale des entreprises dans les pays du Sud : le cas d un don d ordinateurs au Sénégal dans le cadre d un projet tripartite

Plus en détail

Stress osmotique et activation des MAP Kinases ERK1/2 chez les hépatocytes de turbot, Scophthalmus maximus

Stress osmotique et activation des MAP Kinases ERK1/2 chez les hépatocytes de turbot, Scophthalmus maximus Stress osmotique et activation des MAP Kinases ERK1/2 chez les hépatocytes de turbot, Scophthalmus maximus : implication des voies de signalisation intracellulaire du processus de RVD. Audrey Fouchs Confrontées

Plus en détail

COUSIN Fabien KERGOURLAY Gilles. 19 octobre 2007. de l hôte par les. Master 2 MFA Responsable : UE Incidence des paramètres environnementaux

COUSIN Fabien KERGOURLAY Gilles. 19 octobre 2007. de l hôte par les. Master 2 MFA Responsable : UE Incidence des paramètres environnementaux COUSIN Fabien KERGOURLAY Gilles 19 octobre 2007 Inhibition des défenses de l hôte par les bactéries pathogènes Master 2 MFA Responsable : UE Incidence des paramètres environnementaux Gwennola ERMEL I Détection

Plus en détail

NetBioDyn et la modélisation des réactions immunitaires

NetBioDyn et la modélisation des réactions immunitaires stage de formation 5 & 6 février 2015 atelier n 2 NetBioDyn et la modélisation des réactions immunitaires Nathalie Noris contact nathalie.davoust-nataf@ens-lyon.fr informations et ressources http://acces.ens-lyon.fr/acces/ressources/immunite-et-vaccination

Plus en détail

ANATOMIE PATHOLOGIQUE ET INFLAMMATION CONCEPTION D ENSEMBLE

ANATOMIE PATHOLOGIQUE ET INFLAMMATION CONCEPTION D ENSEMBLE ANATOMIE PATHOLOGIQUE ET INFLAMMATION CONCEPTION D ENSEMBLE 1. Définition L'inflammation ou réaction inflammatoire est la réponse des tissus vivants, vascularisés, à une agression. 2. Causes des réactions

Plus en détail

La dentinogénèse imparfaite, diagnostic et prise en charge

La dentinogénèse imparfaite, diagnostic et prise en charge La dentinogénèse imparfaite, diagnostic et prise en charge Marielle Calvez To cite this version: Marielle Calvez. La dentinogénèse imparfaite, diagnostic et prise en charge. Other [q-bio.ot]. 2013.

Plus en détail

Mécanismes d activation de l inflammasome NLRP3 par les micro- et les nano- particules dans un modèle d inflammation pulmonaire chez la souris

Mécanismes d activation de l inflammasome NLRP3 par les micro- et les nano- particules dans un modèle d inflammation pulmonaire chez la souris Mécanismes d activation de l inflammasome NLRP3 par les micro- et les nano- particules dans un modèle d inflammation pulmonaire chez la souris Ludivine Baron To cite this version: Ludivine Baron. Mécanismes

Plus en détail

Les nouvelles tours de Londres comme marqueurs des mutations d une métropole globale

Les nouvelles tours de Londres comme marqueurs des mutations d une métropole globale Les nouvelles tours de Londres comme marqueurs des mutations d une métropole globale Manuel Appert To cite this version: Manuel Appert. Les nouvelles tours de Londres comme marqueurs des mutations d une

Plus en détail

Immunologie de la grossesse

Immunologie de la grossesse Immunologie de la grossesse LI UE8S : Unité fœtoplacentaire Dr ANDRÉ Gwenaëlle 1 Introduction Immunité Ensemble des mécanismes permettant Reconnaître et tolérer «le soi» Reconnaître et rejeter «le non

Plus en détail

Isorce Nathalie Baier Céline. M1 BE 2008 M. Naquet M. Galland

Isorce Nathalie Baier Céline. M1 BE 2008 M. Naquet M. Galland Isorce Nathalie Baier Céline M1 BE 2008 M. Naquet M. Galland Introduction : Voie NF κb Dérégulation : cancers Rôle de NF κb et de l inflammation dans : les différentes étapes de la tumeur du colon Conclusion

Plus en détail

Ihsane Tou. Adaptation de la couche transport des systèmes de communication hybrides satellite/terrestre

Ihsane Tou. Adaptation de la couche transport des systèmes de communication hybrides satellite/terrestre Adaptation de la couche transport des systèmes de communication hybrides satellite/terrestre Ihsane Tou To cite this version: Ihsane Tou. Adaptation de la couche transport des systèmes de communication

Plus en détail

Le rejet aigu cellulaire

Le rejet aigu cellulaire Le rejet aigu cellulaire CUEN: 3/12/2013 Philippe Grimbert Plan Les antigènes de transplantation Le mécanisme du rejet L incidence et les outils du diagnostique Le traitement 1 Rejet aigu cellulaire Représente

Plus en détail

Si active. Fragment ( si fragment ) Dans le cas de complexe, on écrit le complexe sous un seul nom. Ex : complexe des molécules 1, 4 et 2 : C 1,4,2

Si active. Fragment ( si fragment ) Dans le cas de complexe, on écrit le complexe sous un seul nom. Ex : complexe des molécules 1, 4 et 2 : C 1,4,2 Le complément I_ Généralités A. Découverte Les anticorps ont été découverts en 1890. La fixation d'anticorps ne suffit pas à détruire l'antigène. Pfeiffer et Bordet ont démontré qu'un système complémentaire

Plus en détail

Chapitre 7 : IMMUNOLOGIE

Chapitre 7 : IMMUNOLOGIE Chapitre 7 : IMMUNOLOGIE (*) Introduction Définition : SYSTEME IMMUNITAIRE (SI) : C est un ensemble d organes, de cellules et de tissus dont la fonction est la défense du corps humain, c est à dire le

Plus en détail

Chapitre II L immunité adaptative

Chapitre II L immunité adaptative Chapitre II L immunité adaptative 1 -I -La réponse adaptative humorale 1) Exemple du virus de la grippe 2 2) Les caractéristiques de cette réponse 3 Conclusion L immunité adaptative n est pas immédiate

Plus en détail

Révisions/Questions Epreuve d Immunologie Fondamentale juin 2005

Révisions/Questions Epreuve d Immunologie Fondamentale juin 2005 Révisions/Questions Epreuve d Immunologie Fondamentale juin 2005 (D après Carpino, N., et al. (2004) Immunity 20:37) Exercice I (noté sur 14 points) Les lymphocytes T jouent un rôle central dans la reconnaissance

Plus en détail

La voix en images : comment l évaluation objectivée par logiciel permet d optimiser la prise en charge vocale

La voix en images : comment l évaluation objectivée par logiciel permet d optimiser la prise en charge vocale La voix en images : comment l évaluation objectivée par logiciel permet d optimiser la prise en charge vocale Stéphanie Perriere To cite this version: Stéphanie Perriere. La voix en images : comment l

Plus en détail

Mécanismes d'action de l'immunothérapie spécifique de l allergène

Mécanismes d'action de l'immunothérapie spécifique de l allergène Mécanismes d'action de l'immunothérapie spécifique de l allergène Cyrille Hoarau, Frédéric Bérard I-Introduction... 2 II-Principe et modalités de l'immunothérapie spécifique de l'allergène... 2 II-1.Principe

Plus en détail

Immunité et grossesse

Immunité et grossesse MODULE de MAIEUTIQUE Unité foetoplacentaire (Coordonateur Pr Janky) Immunité et grossesse Dr. Nadia Prisant 1 Points essentiels : Le système immunitaire, à travers ses deux principales composantes, l immunité

Plus en détail

Éviter une réponse inappropriée

Éviter une réponse inappropriée Une réponse immunitaire "efficace" Quelques rappels : Mécanismes de protection Implication du système immunitaire dans l homéostasie de l organisme Élimination de cellules en apoptose Relations potentielles

Plus en détail

Macromolécules et la Cellule

Macromolécules et la Cellule Macromolécules et la Cellule Macromolécules Campbell chapitre 5 Macromolécules Définition: Molécule géante formée par l assemblage de plusieurs petites molécules organiques Macromolécules Définition:

Plus en détail

Choix méthodologiques pour une analyse de conversation en situation de jeux vidéo

Choix méthodologiques pour une analyse de conversation en situation de jeux vidéo Choix méthodologiques pour une analyse de conversation en situation de jeux vidéo Isabel Colón de Carvajal To cite this version: Isabel Colón de Carvajal. Choix méthodologiques pour une analyse de conversation

Plus en détail

Vieillissement immunitaire et risque infectieux. Dr F.Rachidi-Berjamy Capacité de gériatrie 23 Mai 2014

Vieillissement immunitaire et risque infectieux. Dr F.Rachidi-Berjamy Capacité de gériatrie 23 Mai 2014 Vieillissement immunitaire et risque infectieux Dr F.Rachidi-Berjamy Capacité de gériatrie 23 Mai 2014 Introduction L immunité = la résistance aux maladies, et spécifiquement infectieuses La physiologie

Plus en détail

Professeur François BERGER

Professeur François BERGER UE2 : Biologie cellulaire Chapitre 1 : L apoptose ou mort cellulaire programmée Professeur François BERGER Année universitaire 2010/2011 Université Joseph Fourier de Grenoble - Tous droits réservés. Plan

Plus en détail

Camille Istin. Contribution à l étude du registre des délibérations de la Société libre des pharmaciens. Seine-Inférieure (1815-1830)

Camille Istin. Contribution à l étude du registre des délibérations de la Société libre des pharmaciens. Seine-Inférieure (1815-1830) Contribution à l étude du registre des délibérations de la Société libre des pharmaciens de Rouen et de Seine-Inférieure (1815-1830) Camille Istin To cite this version: Camille Istin. Contribution à l

Plus en détail

LES MÉCANISMES MOLÉCULAIRES DE LA CARCINOGENÈSE

LES MÉCANISMES MOLÉCULAIRES DE LA CARCINOGENÈSE LES MÉCANISMES MOLÉCULAIRES DE LA CARCINOGENÈSE TOUT D ABORD UN PETIT HISTORIQUE 1910: Peyton ROUS découvre le virus qui porte son nom 1976: les oncogènes de certains virus ont une contrepartie cellulaire

Plus en détail

Table des matières. Remerciements, x Avant-Propos, xi Abréviations, xii Guide de l utilisateur, xvi

Table des matières. Remerciements, x Avant-Propos, xi Abréviations, xii Guide de l utilisateur, xvi Table des matières v Remerciements, x Avant-Propos, xi Abréviations, xii Guide de l utilisateur, xvi 1 L immunité innée, 1 Les obstacles externes à l infection, 1 Les cellules phagocytaires tuent les micro-organismes,

Plus en détail

Polynucléaires, monocytes et macrophages.

Polynucléaires, monocytes et macrophages. Polynucléaires, monocytes et macrophages. Marianne Gougerot-Pocidalo, Lionel Prin, Sylvie Chollet-Martin I-Introduction... 2 II-Facteurs chimio-attractants... 2 III-Origine et devenir des polynucléaires

Plus en détail

Delphine Graniou. To cite this version: HAL Id: dumas-00836052 http://dumas.ccsd.cnrs.fr/dumas-00836052

Delphine Graniou. To cite this version: HAL Id: dumas-00836052 http://dumas.ccsd.cnrs.fr/dumas-00836052 Le point de vue des femmes sur la mise en place d un dépistage national organisé du cancer du col de l utérus. Étude qualitative auprès de femmes de Haute-Normandie Delphine Graniou To cite this version:

Plus en détail

Aspects psycho-sociaux des interruptions volontaires de grossesse chez les mineures

Aspects psycho-sociaux des interruptions volontaires de grossesse chez les mineures Aspects psycho-sociaux des interruptions volontaires de grossesse chez les mineures Aude Le Borgne To cite this version: Aude Le Borgne. Aspects psycho-sociaux des interruptions volontaires de grossesse

Plus en détail

TISSU SANGUIN ET SYSTEME IMMUNITAIRE - BASES GENERALES Inflammation. Titre du cours

TISSU SANGUIN ET SYSTEME IMMUNITAIRE - BASES GENERALES Inflammation. Titre du cours 31/10/2013 HAMEL Audrenne L2 Tissu sanguin et système immunitaire-bases générales G. KAPLANSKI 14 pages Titre du cours Plan PARTIE 1 : la réaction inflammatoire aiguë A. La phase vasculaire B. La phase

Plus en détail

Impact des biothérapies sur l'immunité anti-infectieuse

Impact des biothérapies sur l'immunité anti-infectieuse Impact des biothérapies sur l'immunité anti-infectieuse XXII ème JRPI 13 10 2015 Pr M. Labalette Biothérapies Déficit immunitaire secondaire Susceptibilité aux infections (1 er effet secondaire des biothérapies)

Plus en détail

Évaluations formatives. 1. Donnez la différence entre le système de défense spécifique et non spécifique?

Évaluations formatives. 1. Donnez la différence entre le système de défense spécifique et non spécifique? Évaluations formatives Module 1 Introduction 1. Donnez la différence entre le système de défense spécifique et non spécifique? Le système de défense spécifique est en fait le système immunitaire. C est

Plus en détail

Étude rétrospective sur l efficacité et la tolérance de l ivermectine per os chez 27 nourrissons atteints de gale récalcitrante

Étude rétrospective sur l efficacité et la tolérance de l ivermectine per os chez 27 nourrissons atteints de gale récalcitrante Étude rétrospective sur l efficacité et la tolérance de l ivermectine per os chez 27 nourrissons atteints de gale récalcitrante Céline Bécourt To cite this version: Céline Bécourt. Étude rétrospective

Plus en détail

Question 2 : Décrivez deux fonctions effectrices des anticorps. Illustrez par un schéma.

Question 2 : Décrivez deux fonctions effectrices des anticorps. Illustrez par un schéma. Bio II - Ex. IV Question 1 : Lors d une réponse inflammatoire (ex. blessure de la peau avec une aiguille souillée par des bactéries), A) préciser les rôles respectifs des neutrophiles, des mastocytes,

Plus en détail

Atelier Pansements. Hélène Bachelet Isabelle Maachi Bénedicte Schmit

Atelier Pansements. Hélène Bachelet Isabelle Maachi Bénedicte Schmit Atelier Pansements Hélène Bachelet Isabelle Maachi Bénedicte Schmit PROCESSUS DE CICATRISATION Etapes de la cicatrisation Le traitement d une plaie n est pas standardisé mais personnalisé Quelque soit

Plus en détail

L'inflammation et sa pathologie propre

L'inflammation et sa pathologie propre 21.10.2013 LY Claudia L3 Appareil locomoteur Pr ROUDIER 12 pages L'inflammation et sa pathologie propre Plan A. La réaction inflammatoire I. Étapes de la réaction inflammatoire II. Évolution III. Maladies

Plus en détail

CHAPITRE 1 : LE SIDA UNE MALADIE QUI TOUCHE LE SYSTEME IMMUNITAIRE

CHAPITRE 1 : LE SIDA UNE MALADIE QUI TOUCHE LE SYSTEME IMMUNITAIRE INTRODUCTION Les défenses immunitaires sont capables d identifier et d éliminer les cellules et molécules étrangères à l organisme ou celles qui le sont devenues comme les cellules cancéreuses. Les macrophages

Plus en détail

TP 1 Anticorps et diagnostic de l infection

TP 1 Anticorps et diagnostic de l infection Anticorps et diagnostic de l infection OBJECTIFS Savoir ce qu est un anticorps, son origine et son utilisation en sérodiagnostic. Connaître la structure schématique d une immunoglobuline G (IgG). 1. Les

Plus en détail

Série : STL Spécialité biotechnologies SESSION 2014 BACCALAURÉAT TECHNOLOGIQUE

Série : STL Spécialité biotechnologies SESSION 2014 BACCALAURÉAT TECHNOLOGIQUE BACCALAURÉAT TECHNLGIQUE Série : STL Spécialité biotechnologies SESSIN 2014 CBSV : sous épreuve coefficient 4 Biotechnologies : sous épreuve coefficient 4 Durée totale de l épreuve: 4 heures Les sujets

Plus en détail

Chapitre II La régulation de la glycémie

Chapitre II La régulation de la glycémie Chapitre II La régulation de la glycémie Glycémie : concentration de glucose dans le sang valeur proche de 1g/L Hypoglycémie : perte de connaissance, troubles de la vue, voire coma. Hyperglycémie chronique

Plus en détail

Les associations d usagers dans le domaine de la périnatalité : un engagement fondé sur la connaissance?

Les associations d usagers dans le domaine de la périnatalité : un engagement fondé sur la connaissance? Les associations d usagers dans le domaine de la périnatalité : un engagement fondé sur la connaissance? Madeleine Akrich, Maire Leane, Celia Roberts To cite this version: Madeleine Akrich, Maire Leane,

Plus en détail

Techniques d études des réponses immunitaires

Techniques d études des réponses immunitaires Techniques d études des réponses immunitaires I. Principes (d après Hernandes-Fuentes M. P. et al. (2003) J. Immunol. Methods 196:247 ; éléments du polycopié de TP : The 2 nd PSU International Teaching

Plus en détail

To cite this version: HAL Id: dumas-00846453 http://dumas.ccsd.cnrs.fr/dumas-00846453

To cite this version: HAL Id: dumas-00846453 http://dumas.ccsd.cnrs.fr/dumas-00846453 Proposition d aide au sevrage tabagique en péri-opératoire chez des patients vasculaires au CHU de Rouen : évaluation de la satisfaction des patients et de l impact à distance de l hospitalisation Bérengère

Plus en détail

La régulation de la glycémie

La régulation de la glycémie La régulation de la glycémie INTRODUCTION GENERALE La glycémie est le taux de glucose plasmatique. Chez un sujet normal, la glycémie oscille autour d une valeur moyenne comprise entre 0.8 g.l -1 et 1.2

Plus en détail

Le peptide signal est éliminé de la plupart des protéines solubles après la translocation

Le peptide signal est éliminé de la plupart des protéines solubles après la translocation Le peptide signal est éliminé de la plupart des protéines solubles après la translocation Quand l extrémité Ct de la protéine a traversé la membrane, le peptide signal est éliminé par coupure par une signal

Plus en détail

Anti-TNFα : nouveaux médicaments, nouveaux dopants?

Anti-TNFα : nouveaux médicaments, nouveaux dopants? Anti-TNFα : nouveaux médicaments, nouveaux dopants? M. MAROT*, J.-Y. PETIT, A. ORTEGA*, A. PINEAU*, Y. MAUGARS,* M. POTIRON-JOSSE* Communication présentée par le Professeur des Universités, laboratoire

Plus en détail

Chapitre 1. La cellule : unité morphologique et fonctionnelle

Chapitre 1. La cellule : unité morphologique et fonctionnelle Chapitre 1. La cellule : unité morphologique et fonctionnelle 1. Historique de la biologie : Les premières cellules eucaryotes sont apparues il y a 3 milliards d années. Les premiers Homo Sapiens apparaissent

Plus en détail

Activation de la protéine p53 par l irradiation laser dans l ultraviolet lointain

Activation de la protéine p53 par l irradiation laser dans l ultraviolet lointain Activation de la protéine p53 par l irradiation laser dans l ultraviolet lointain Catherine Chapel 1, Evelyne May 2, Monique Vacher 3 et D. Courant 1 1 DSV/DRR/SRBF, CEA, Fontenay aux Roses 2 CNRS UPR

Plus en détail

La sclérose en plaques

La sclérose en plaques LT Mφ La sclérose en plaques une maladie auto-immune? LT Système immunitaire Mφ Facteurs génétiques étiques SEP Facteurs environnementaux nementaux Données épidémiologiques 60.000 patients en France Sujets

Plus en détail

Protester sur le web chinois (1994-2011)

Protester sur le web chinois (1994-2011) Protester sur le web chinois (1994-2011) Séverine Arsène To cite this version: Séverine Arsène. Protester sur le web chinois (1994-2011). Le Temps des médias, 2012, pp.99-110. HAL Id: hal-00773738

Plus en détail

Activité 29 : Les mécanismes de l immunité acquise permettant l élimination d antigènes circulants et la destruction des cellules infectées

Activité 29 : Les mécanismes de l immunité acquise permettant l élimination d antigènes circulants et la destruction des cellules infectées Activité 29 : Les mécanismes de l immunité acquise permettant l élimination d antigènes circulants et la destruction des cellules infectées Partie I : A l aide des informations du logiciel Immunologie

Plus en détail

Rapport final LA VOIE DE SECRETION D UNE CELLULE HUMAINE. Différentes techniques de visualisation des compartiments cellulaires

Rapport final LA VOIE DE SECRETION D UNE CELLULE HUMAINE. Différentes techniques de visualisation des compartiments cellulaires Loïc Martin 6 avril 2012 Rapport final LA VOIE DE SECRETION D UNE CELLULE HUMAINE Différentes techniques de visualisation des compartiments cellulaires Travail effectué, à l'université de Genève, Sciences

Plus en détail

Chapitre 3 : La réaction inflammatoire. Les inflammations. En savoir plus : Les médiateurs chimiques

Chapitre 3 : La réaction inflammatoire. Les inflammations. En savoir plus : Les médiateurs chimiques Chapitre 3 : La réaction inflammatoire. Les inflammations En savoir plus : Les médiateurs chimiques Les médiateurs de l inflammation De multiples médiateurs chimiques, provenant du plasma ou des cellules,

Plus en détail

Chapitre 10 : La réaction inflammatoire, un exemple de réponse innée.

Chapitre 10 : La réaction inflammatoire, un exemple de réponse innée. Chapitre 10 : La réaction inflammatoire, un exemple de réponse innée. Lorsqu un agent infectieux (bactérie, virus, champignon microscopique ) pénètre dans l organisme et commence à s y multiplier, on observe

Plus en détail

To cite this version: HAL Id: tel-00844758 https://tel.archives-ouvertes.fr/tel-00844758

To cite this version: HAL Id: tel-00844758 https://tel.archives-ouvertes.fr/tel-00844758 Mobiliser une analyse de l activité comme aide à la conception et à l évaluation d un Environnement Virtuel pour l Apprentissage Humain : un exemple en implantologie dentaire Jérémy Cormier To cite this

Plus en détail

Cellules présentatrices d'antigènes et allergie : phénotype, propriétés, fonctions

Cellules présentatrices d'antigènes et allergie : phénotype, propriétés, fonctions DESC d Immunologie Clinique et Allergologie 2014 Module 0 «Immunologie» Cellules présentatrices d'antigènes et allergie : phénotype, propriétés, fonctions Circulation et domiciliation des cellules immunitaires

Plus en détail

Cours n 4 : UE bio cellulaire : L apoptose :

Cours n 4 : UE bio cellulaire : L apoptose : Cours n 4 : UE bio cellulaire : L apoptose : I. Introduction : Chez l homme, environ 10 8 cellules (sur 10 14 cellules au total) engagent un programme de mort cellulaire chaque jour. Le phénomène d apoptose

Plus en détail