Nouveaux outils de cytogénétique moléculaire (MLPA et CGH) utilisés en constitutionnel COUTTON Charles

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimension: px
Commencer à balayer dès la page:

Download "Nouveaux outils de cytogénétique moléculaire (MLPA et CGH) utilisés en constitutionnel COUTTON Charles"

Transcription

1 Nouveaux outils de cytogénétique moléculaire (MLPA et CGH) utilisés en constitutionnel COUTTON Charles EC Génétique Jeudi 12 Janvier 2012

2 Remaniements génomiques Regroupent les duplications, les délétions, les insertions, les inversions et les translocations. Impliquent des régions d une centaine de paires de bases jusqu à plusieurs millions A l origine de: polymorphismes bénins maladies génétiques regroupées sous le nom de maladies ou désordres génomiques

3 Mécanismes Trois principaux mécanismes: NAHR (Non Allelic Homologous Recombination) ou recombinaison homologue non allélique NHEJ (Non Homologous End Joining) ou raccordement d extrémités non homologues FoSTeS (Fork Stalling and Template Switching) Surviennent aussi bien dans les cellules germinales (méiose) que dans les cellules somatiques (mitose / mosaïque) => maladies génétiques / cancers

4 NAHR Dérive d un mécanisme de réparation d une CDB de l ADN Recherche d une matrice contenant une séquence homologue => erreurs possibles si une mauvaise matrice de réparation est utilisée => NAHR Du à des séquences répétées appelées LCR (Low copy repeat) (5 % de notre génome, forte homologie (>90%) A proximité de structures génomiques capables de générer des CDB

5 NAHR Pathogène ou bénin? Bénin +++ Risque pour la descendance

6 NHEJ Mécanisme biochimique de réparation de l ADN Perte d'information : les extrémités de la cassure double brin sont souvent digérées avant d'être recollées Impliqués dans les recombinaisons «physiologiques» V(D)J En pathologie: cancers +++, DMD

7 FoSTeS Lié à la réplication (pas de CDB) Entraine la formation de réarrangements non récurrents complexes En pathologie: Pelizaeus- Merzbacher, Potocki- Lupski (PTLS) Nécessite «que» des micro-homologies de séquences

8 Copy Number Variation Si le réarrangement génomique entraine une variation du nombre de copies (gain / perte) d un segment d ADN de 1 kb et plus, on parle de CNV (Copy Number Variation) Soit polymorphes, soit pathogènes: Intérêt médical Intérêt d étude et de détection

9 CNV et polymorphismes Cohorte d individus «apparemment» sains

10 CNVs et polymorphismes Répertoriés dans des bases de données (DGV) CNVs décrits Représenterait 13 à 20% du génome Situés dans des régions pauvres en gènes ou liés à l environnement (R olfactifs) Si F > 1% : CNP (copy number polymorphism)

11 CNVs et pathologies Phénotype anormal: RM + dysmorphie Répertoriées dans des bases de données (DECIPHER)

12 Méthodes de detection 1956 Premier caryotype «banding» «banding» haute-résolution FISH CGH CGH-array MLPA, QMPSF

13 Choix des techniques Approche globale Approche ciblée FISH Caryotype MLPA CGH-array

14 Choix des techniques Séquençage Paire de bases ATGCACTGATGAATGCATGCAAT MLPA Exon: 50 à 1000 pb CGH-array Gène moyen: pb FISH Caryotype Résolution Sous-bande: pb Bande chromosomique: pb

15 Caryotype / FISH Carotype Résolution entre 3 et 5 Mb Inconvénients: long ; faible résolution; cout Avantages: mécanismes remaniements FISH Résolution: 150Kb Inconvénients: petite duplication, cout, culture, banque de clones Avantages: mécanismes remaniements

16 FISH

17 CGH-array Technique d hybridation comparative génomique sur microréseau (puce à ADN). Technique de quantification relative: mise en évidence de pertes ou de gains de matériel chromosomique (par rapport à une référence).

18 CGH-array Digestion de l'adn génomique par les enzymes AluI et RsaI Obtention de produits de digestion dont la taille varie entre 100 et 500 pb Marquage fluorescent de l'adn digéré Alexa Fluor 5 et Alexa Fluor 3 Purification sur colonne de l'adn digéré et marqué Vérification du marquage au Nanodrop Rejet des échantillons si marquage insuffisant

19 CGH-array Dans chaque spot: Fragment spécifique d ADN simple brin de petite taille (60 pb) Dépôt multiple du même oligonucléotide

20 Hybridation sur lame CGH 4x180K Caisson ozone free Durée 24 h à 65 C CGH-array ADN Témoin ADN Patient

21 Lavages CGH-array

22 CGH-array Scan des lames et extraction des données Mesure des intensités de fluorescence Logiciels d'extraction des données et d'analyse

23 Interprétation CGH-array Patient Témoin Patient Témoin Patient Témoin = Quantité d ADN identique chez le patient et le témoin - fluorescence jaune - ratio de fluorescence log2(2/2) = 0 Log2(R/V)

24 Interprétation CGH-array Patient Témoin Patient Témoin Patient Témoin = Quantité d ADN identique chez le patient et le témoin - fluorescence jaune - ratio de fluorescence log2(2/2) = 0 Quantité d ADN moindre chez le patient par rapport au témoin - délétion Log2(R/V) - fluorescence verte - ratio de fluorescence log2(1/2) = -1

25 Interprétation CGH-array Patient Témoin Patient Témoin Patient Témoin = Quantité d ADN identique chez le patient et le témoin - fluorescence jaune - ratio de fluorescence log2(2/2) = 0 Quantité d ADN supérieure chez le patient par rapport au témoin - duplication - fluorescence rouge - ratio de fluorescence log2(3/2) = 0,58 Log2(R/V) Quantité d ADN moindre chez le patient par rapport au témoin - délétion - fluorescence verte - ratio de fluorescence log2(1/2) = -1

26 Expérience en quatuor: CGH-array

27 CGH-array Patient A en Al5 et B en Al3 (témoin) Délétion? Duplication?

28 CGH-array Patient A en Al5 et B en Al3 (témoin) : courbe rouge Courbe rouge : log2(1/2) = -1 1 copie patient / 2 copies témoins Patient A en Al3 et D en Al5 : courbe verte Courbe verte : log2(2/1) = 1 2 copies témoins / 1 copie patient => Image en miroir Délétion chez A confirmée Pas de miroir pour la duplication CNV n'appartiennent pas à A

29 Expérience en quatuor: CGH-array Avantages du quatuor et dye swap Moindre coût : 4 patients par lame Confirmation de l anomalie qui apparaît en miroir Bonne attribution des CNV Lecture plus facile quand la courbe est bruitée Attention : ne pas associer patients avec clinique strictement identique

30 CGH-array Détection d anomalies au niveau de régions pauvres en bandes Délétion 4q21.22q22.3 ~ 15.2 Mb

31 CGH-array Détection facilité des anomalies complexes Délétion Inv dup del (8p) Duplication

32 CGH-array Détection de petits remaniements Duplication de 30 Kb

33 CGH-array Détection de faibles mosaïques Duplication 1qcenq24.2 de 35 Mb en mosaïque à 23 %

34 CGH-array Différents type de puces CGH-array (en f des cibles) BAC/PAC: robuste, sensible, contrôle aisé, faible résolution ( Kb), limite de la banque Oligonucléotides: résolution: < 30kb moy. Longs: CNV seulement; excellente spécificité Courts: détection des CNV + SNPS (LOH) cdna: étude du niveau d expression Puces ciblées Hyperdense sur un région d intérêt (< 1 kb) Limitées à des régions précises (résolution std) Choix de la plate-forme dépend aussi du cout et des outils d analyse bio-informatique.

35 Choix des techniques Approche globale Approche ciblée FISH Caryotype MLPA CGH-array

36 Denaturation Hybridation MLPA

37 Ligation MLPA

38 Ligation MLPA

39 MLPA Amplification

40 MLPA Séparation électrophorétique Patient Témoin Une différence relative de la hauteur ou surface d un pic indique une variation du nombre de copie de la séquence cible. Triple X

41 MLPA Normalisation Permets une quantification relative des signaux de chaque sonde: par rapport aux sondes contrôles (c) par rapport à un témoin négatif (sain) obtenir un ratio apprécier le nombre de copie de la région cible Exemple c c Témoin

42 MLPA et 22q11 Région 22q11 Témoin Délétion 22q11 Comparaison Patient

43 MLPA / CGH-array MLPA CGH-array Hybridation sondes / cibles Analyse des signaux Quantification

44 MLPA / CGH-array Avantages MLPA Pas de culture (ADN) Multiplexage Spécificité 100% Sensibilité 100% Coût Rapide (48h) Tous types de tissus CGH-array Pas de culture (ADN) Analyse pangénomique Haute résolution Haut débit Automatisable Tous types de tissus

45 CGH-array et RM Patients avec RM + dysmorphie: Le caryotype seul: 3 à 5% de diagnostic Caryotype + FISH: 8 à 10% de diagnostic CGH-array: 9 à 13% d anomalies supplémentaires par rapport au caryotype => 12 à 18% de diagnostic CGH-array en première intention en post-natal?

46 MLPA et 22q11 La MLPA détecte 100% des anomalies impliquées LA FISH ne détecte «que» 95% des anomalies Stachon et al AJMG

47 MLPA / CGH-array Limites MLPA Ne détecte pas les remaniements équilibrés Anomalie de la ploïdie Analyse ciblée Mécanisme de l anomalie Faux positifs Pas automatisable Ne détecte pas les remaniements équilibrés Anomalie de la ploïdie Prix Mécanisme de l anomalie Éthique CGH-array Interprétation complexe

48 Ethique Perte d un gène suppresseur de tumeur (TP53) Impliqué dans le syndrome de Li-Fraumeni => attitude?

49 Interprétation Que faire quand on trouve des délétions ou des duplications? Est-ce un CNV (Copy Number Variation) bénin? Est-ce un CNV responsable de la maladie? Bases de données Vérification de la variation chez le cas index Analyse des parents

50 Interprétation

51 Interprétation Anomalies héritées = polymorphismes?? - L expressivité variable : une même maladie s exprime de manière différente chez plusieurs personnes porteuses de la même anomalie génomique. - La pénétrance incomplète : elle consiste en l absence d expression de la maladie chez une personne porteuse d une même anomalie génétique. - La récessivité ou hétérozygote composite : un gène inclus dans la région délétée peut avoir son deuxième allèle porteur d une mutation révélant ainsi une maladie récessive autosomique. - L empreinte parentale : elle consiste en l expression différentielle de régions génomiques selon qu elles sont héritées du père ou de la mère du patient. - La régulation épigénétique : la méthylation ou l acétylation différentielles de certaines régions génomiques entraînent une modification du niveau d expression des gènes.

52 Interprétation Van Ommen GJ Array CGH Nat Genet 37:333-4, 2005 CNV Normal Analyser les parents de novo Inconnu Hérité Connu Anomalie causale Polymorphisme (CNP) Anomalie causale Critères de Lee Guidelines :Vermeesch et al, Shaffer et al

53 Interprétation

54 Interprétation Anomalie de novo dans une région dépourvue de gènes et non répertoriée dans les bases de données => interprétation?

55 Interprétation

56 Interprétation L association de plusieurs CNVs apparemment bénins et/ou l association avec d autres facteurs comme des facteurs environnementaux peut favoriser l apparition d une maladie. Depuis quelques années, certains CNVs ont été clairement identifiés comme facteurs de prédisposition ou de susceptibilité à des maladies complexes multifactorielles (cancers, neuro-dégénératives etc ).

57 Interprétation CNVs et prénatal Signes d'appel écho ne justifiant pas à eux seuls l'img CNV inconnus Hérités? CNV dans les gènes de prédisposition aux cancers Technique longue et coûteuse

58 Séquençage haut-débit Séquenceurs nouvelles génération Séquençage d un grand nombre de fragments d ADN au hasard («shotgun») Séquences générées alignées sur séquence de référence Application en cancéro / constitutionnel Efficacité validée mais recherche fondamentale Niveau de résolution meilleure que puces

Analyse Chromosomique sur Puce à ADN Applications en Prénatal

Analyse Chromosomique sur Puce à ADN Applications en Prénatal Analyse Chromosomique sur Puce à ADN Applications en Prénatal Véronique Satre, Charles Coutton, Gaëlle Vieville, Françoise Devillard et Florence Amblard Maladies génétiques Anomalies chromosomiques Cytogénétique

Plus en détail

«Biotechnologies et nouvelles stratégies diagnostiques du retard mental.» Colloque médical du Jeudi 26 Avril 2012

«Biotechnologies et nouvelles stratégies diagnostiques du retard mental.» Colloque médical du Jeudi 26 Avril 2012 «Biotechnologies et nouvelles stratégies diagnostiques du retard mental.» Colloque médical du Jeudi 26 Avril 2012 COUTTON Charles Etude du Génome Cytogénétique Cytogénétique moléculaire Biologie moléculaire

Plus en détail

La CGH-array : une nouvelle technique de diagnostic en cytogénétique

La CGH-array : une nouvelle technique de diagnostic en cytogénétique La CGH-array : une nouvelle technique de diagnostic en cytogénétique Olivier Pichon (Ingénieur) Laboratoire de cytogénétique de Nantes, Service de Génétique Médicale Les techniques classiques de cytogénétique

Plus en détail

PRINCIPES DE BASES DE L ANALYSE DES CHROMOSOMES HUMAINS

PRINCIPES DE BASES DE L ANALYSE DES CHROMOSOMES HUMAINS PRINCIPES DE BASES DE L ANALYSE DES CHROMOSOMES HUMAINS II. Outils CONTEXTE CLINIQUE Jonction entre chromosomique et moléculaire Dr G. Lefort II. TECHNIQUE 1) Le caryotype conventionnel en bandes Nécessite

Plus en détail

PRINCIPES DE BASES DE L ANALYSE DES CHROMOSOMES HUMAINS

PRINCIPES DE BASES DE L ANALYSE DES CHROMOSOMES HUMAINS PRINCIPES DE BASES DE L ANALYSE DES CHROMOSOMES HUMAINS Dr Sylvie Taviaux Laboratoire de cytogénétique Hôpital Arnaud de Villeneuve CHU Montpellier S-taviaux@chu-montpellier.fr Septembre 2014 PRINCIPES

Plus en détail

PRINCIPALES TECHNIQUES UTILISEES EN GENOMIQUE

PRINCIPALES TECHNIQUES UTILISEES EN GENOMIQUE PRINCIPALES TECHNIQUES UTILISEES EN GENOMIQUE Définitions généralités Quelques chiffres 46 chromosomes 22 paires d autosomes (n=44) 1 paire de gonosomes (n=2) : XX/F et XY/H 300 bandes cytogénétiques =

Plus en détail

Différents types de chromosomes en Giemsa

Différents types de chromosomes en Giemsa Différents types de chromosomes en Giemsa Marquage Giemsa simple - Comptage d une mitose: 45, 46 ou 47 - Reconnaissance des groupes et certains chromosomes dans les groupes, mais pas dans leur structure,

Plus en détail

Aujourd hui, il y a plus de consortium, ce qui permet des avancées plus rapides.

Aujourd hui, il y a plus de consortium, ce qui permet des avancées plus rapides. GFMOM 20/01/2012 Cours 2 partie 2 T. Bourgeron II. LA CYTOGENETIQUE Nous allons étudier les anomalies chromosomiques des plus grossières aux plus fines. Ces anomalies peuvent être retrouvées dans la population

Plus en détail

Objectif : identifier la mutation responsable de la maladie parmi les millions de polymorphisme.

Objectif : identifier la mutation responsable de la maladie parmi les millions de polymorphisme. Identification de gènes morbides Analyses mutationnelles Maladies monogéniques Objectif : identifier la mutation responsable de la maladie parmi les millions de polymorphisme. Plan : Variations du nombre

Plus en détail

UE1 Chromosomes Caryotypes anomalies 2009/2010. Les chromosomes, le caryotype et ses anomalies

UE1 Chromosomes Caryotypes anomalies 2009/2010. Les chromosomes, le caryotype et ses anomalies Les chromosomes, le caryotype et ses anomalies 1 I. Intérêt de l établissement du caryotype II. Structure t du chromosome métaphasique 1. Le centromère 2. Les télomères III. Le caryotype 1. Le rangement

Plus en détail

Principe des études moléculaires en génétique médicale Méthodes d analyse des microlésions du génome

Principe des études moléculaires en génétique médicale Méthodes d analyse des microlésions du génome Mercredi 23 Octobre LECLERCQ Barbara L2 GM Pr Krahn 10 pages Principe des études moléculaires en génétique médicale Méthodes d analyse des microlésions du génome Plan A. Introduction B. Techniques courantes

Plus en détail

Chromosome et caryotype

Chromosome et caryotype Chromosome et caryotype Définition et généralités L étude du caryotype «classique» humain est l étude des chromosomes à un stade maximum de condensation (chromosomes mitotiques en métaphase). Caryotype

Plus en détail

Tumeurs du sein triple négatif: Biologie moléculaire et projets de recherche

Tumeurs du sein triple négatif: Biologie moléculaire et projets de recherche 64 ème réunion du GERM Tumeurs du sein triple négatif: Biologie moléculaire et projets de recherche Tumeurs du sein triple négatif (TN) 12-17% des cancers du sein Contexte familial porteuses des mutations

Plus en détail

Du microscope. aux microarrays. le "saut de puce" de la cytogénétique

Du microscope. aux microarrays. le saut de puce de la cytogénétique Du microscope le "saut de puce" aux microarrays de la cytogénétique ARL 13 mars 2008 Dr Danielle Martinet Spéc. FAMH en analyses de génétique médicale Laboratoire de cytogénétique constitutionnelle Service

Plus en détail

Techniques d'étude en cytogénétique

Techniques d'étude en cytogénétique 22/10 ROUBIN Alexandre L2 CR : Victor CHABBERT Génétique médicale H ZATTARA 16 pages Techniques d'étude en cytogénétique Plan : A. Introduction B. Cytogénétique conventionnelle C. Cytogénétique moléculaire

Plus en détail

CGH array. Alain AURIAS INSERM U509 Institut Curie-Paris

CGH array. Alain AURIAS INSERM U509 Institut Curie-Paris CGH array Alain AURIAS INSERM U509 Institut Curie-Paris Caryotype normal Environ 300 bandes Résolution: 10Mb Ewing Translocation réciproque avec gène de fusion 11 22 EWS FLI1 Nouvelle protéine chimérique,

Plus en détail

UE 7.3S1 Génétique humaine fonctionnelle et désordres

UE 7.3S1 Génétique humaine fonctionnelle et désordres UE 7.3S1 Génétique humaine fonctionnelle et désordres Master 1 ISSM 2010/11 Dr C. NEMOS, Département HEC Faculté de Médecine 1 I. Génétique humaine fonctionnelle A. Introduction à la génétique humaine

Plus en détail

Translocations réciproques. Translocations réciproques. Ségrégation méïotique. Ségrégation alterne : équilibrée (2 types de gamètes)

Translocations réciproques. Translocations réciproques. Ségrégation méïotique. Ségrégation alterne : équilibrée (2 types de gamètes) Anomalies de structure Réarrangements du matériel chromosomique Un seul ou plusieurs Anomalies Translocations robertsoniennes et réciproques équilibrées Mécanismes de déséquilibre Héritées ou de novo Equilibrées

Plus en détail

Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013

Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013 Sélectionner les propositions exactes Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013 QCM 1 La plupart des techniques de biologie moléculaire repose sur le principe de complémentarité

Plus en détail

Combinaison variable avec potentiel de croissance vraisemblablement génétiquement préétabli

Combinaison variable avec potentiel de croissance vraisemblablement génétiquement préétabli Facteurs Maternels Facteurs fœtaux Facteurs placentaires Facteurs externes Combinaison variable avec potentiel de croissance vraisemblablement génétiquement préétabli Combien et lesquels? Quand? Comment?

Plus en détail

Revisiter le diagnostic étiologique dans la déficience intellectuelle

Revisiter le diagnostic étiologique dans la déficience intellectuelle Lyon Neuroscience Research Center Revisiter le diagnostic étiologique dans la déficience intellectuelle Damien Sanlaville Service de Génétique, Pr Edery Plateforme ACPA, NGS CHU de Lyon Pas de conflit

Plus en détail

Marc DELPECH. CORATA La Rochelle le 21 mai 2008

Marc DELPECH. CORATA La Rochelle le 21 mai 2008 Marc DELPECH CORATA La Rochelle le 21 mai 2008 En 24 ans les progrès ont été considérables Premières utilisation des techniques de génétique moléculaire en diagnostic : 1984 Une palette de techniques très

Plus en détail

Recherche et médecine personnalisée : le point de vue de l oncogénéticien. Dr Dugast catherine

Recherche et médecine personnalisée : le point de vue de l oncogénéticien. Dr Dugast catherine Recherche et médecine personnalisée : le point de vue de l oncogénéticien Dr Dugast catherine cc Dépistage de masse K sein chez mère 60 ans, nulliparité? Antécédent de hodgkin à 15 ans???? Quel est mon

Plus en détail

Types, fréquences et mécanismes de formation des anomalies chromosomiques

Types, fréquences et mécanismes de formation des anomalies chromosomiques Types, fréquences et mécanismes de formation des anomalies chromosomiques Collège National des Enseignants et Praticiens de Génétique Médicale Damien Sanlaville Service de Cytogénétique Constitutionnelle,

Plus en détail

Les microarrays: technologie pour interroger le génome

Les microarrays: technologie pour interroger le génome Les microarrays: technologie pour interroger le génome Patrick DESCOMBES patrick.descombes@frontiers-in-genetics.org Plate forme génomique NCCR Frontiers in Genetics Université de Genève http://genomics.frontiers-in-genetics.org

Plus en détail

Biopuces en pathologie Cardio-vasculaire

Biopuces en pathologie Cardio-vasculaire Biopuces en pathologie Cardio-vasculaire Pr M.Doco-Fenzy Service de Génétique 2009 - UE10 1 Définition des outils 2 Applications Waka Lin 2004 Support membrane de nylon Lame de verre, revêtement chimique

Plus en détail

Immunogénétique COURS 1. Silvina GONZALEZ-RIZZO Laboratoire de Biologie Marine sgonzale@univ-ag.fr

Immunogénétique COURS 1. Silvina GONZALEZ-RIZZO Laboratoire de Biologie Marine sgonzale@univ-ag.fr Immunogénétique COURS 1 Silvina GONZALEZ-RIZZO Laboratoire de Biologie Marine sgonzale@univ-ag.fr PRESENTATION CM1 Définitions Rappels des concepts Chromosomes Anomalies chromosomiques CM2 Mutations géniques

Plus en détail

Caryotype humain : Technique - Indications

Caryotype humain : Technique - Indications Caryotype humain : Technique - Indications Collège National des Enseignants et Praticiens de Génétique Médicale Dr Cédric Le Caignec Service de génétique médicale, CHU Nantes, France Date de création du

Plus en détail

LA TECHNIQUE DE CGH-ARRAY OU ACPA

LA TECHNIQUE DE CGH-ARRAY OU ACPA LA TECHNIQUE DE CGH-ARRAY OU ACPA Les syndromes avec Anomalies du Développement (AD), associés ou non à une Déficience Intellectuelle (DI), englobent des pathologies extrêmement hétérogènes mais majoritairement

Plus en détail

Anomalies chromosomiques

Anomalies chromosomiques Master bioinformatique, Université de Rouen Janvier 2013 Sylvain Mareschal [@etu.univ-rouen.fr] Anomalies chromosomiques Speicher & Carter (2005) Nat Rev Genet. Oct;6(10):782-92. The new cytogenetics:

Plus en détail

Le séquençage haut-débit

Le séquençage haut-débit Nouveaux outils en biologie Le séquençage haut-débit DES d hématologie 16 janvier 2015 Paris Alice Marceau-Renaut Laboratoire d hématologie CHRU Lille NGS = Next-Generation Sequencing Whole-genome Whole-exome

Plus en détail

Plateforme de Recherche de Mutations

Plateforme de Recherche de Mutations Plateforme de Recherche de Mutations Jean-Marc Aury contact: pfm@genoscope.cns.fr 29 janvier 2009 Introduction Présentation des données produites par le GSFLX : type, qualité, Méthodes de détection de

Plus en détail

Approches génomiques des cancers Exemple des leucémies aiguës. Jean Soulier Laboratoire d Hématologie, Hôpital Saint-Louis

Approches génomiques des cancers Exemple des leucémies aiguës. Jean Soulier Laboratoire d Hématologie, Hôpital Saint-Louis Approches génomiques des cancers Exemple des leucémies aiguës Jean Soulier Laboratoire d Hématologie, Hôpital Saint-Louis Leucémies aiguës : prolifération de progéniteurs immatures Leucémies aiguës lymphoblastiques

Plus en détail

L'hybridation fluorescente (FISH)

L'hybridation fluorescente (FISH) L'hybridation fluorescente (FISH) fluorescent in situ hybridization DR Thierry PALUKU THEY-THEY LABO GENETIQUE ET PATHO MOLECULAIRE JUIN 2007 Définition repérer la présence d'anomalies chromosomiques par

Plus en détail

Les cancers du sein de type BRCA1. Incidence, particularités, traitement

Les cancers du sein de type BRCA1. Incidence, particularités, traitement Les cancers du sein de type BRCA1 Incidence, particularités, traitement 1 LES LESIONS DE L ADN et L INSTABILITE GENETIQUE SONT DES CARACTERISTIQUES DU CANCER 2 Voies de reparation de l ADN et protéines

Plus en détail

LES ANOMALIES CHROMOSOMIQUES DE STRUCTURES

LES ANOMALIES CHROMOSOMIQUES DE STRUCTURES LES ANOMALIES CHROMOSOMIQUES DE STRUCTURES GENERALITES Anomalies chromosomiques sont de deux types Anomalies de nombres : aneuploïdies, les plus fréquentes (95%) Trisomies : 3 exemplaires d un chromosome

Plus en détail

Professeur Joël LUNARDI

Professeur Joël LUNARDI Biochimie - Biologie moléculaire Chapitre 9 : Applications médicales Professeur Joël LUNARDI MED@TICE PCEM1 - Année 2006/2007 Faculté de Médecine de Grenoble - Tous droits réservés. Chapitre 9. APPLICATIONS

Plus en détail

Cytogénétique et biologie moléculaire

Cytogénétique et biologie moléculaire Cytogénétique et biologie moléculaire apport au diagnostic, à l évaluation pronostique et au suivi des hémopaties malignes C Bastard, DESC, 21 septembre 2009 Pourquoi est-ce possible? Parce que les anomalies

Plus en détail

Le monde des bio-puces

Le monde des bio-puces Le monde des bio-puces D1 Le «dogme central» de la biologie moléculaire Transcription Epissage Traduction ADN ARNpm ARNm Protéines Génome Transcriptome Protéome D2 Puces à ADN Techniques de génomique fonctionnelle

Plus en détail

Méthodes diagnostiques en génétique moléculaire

Méthodes diagnostiques en génétique moléculaire Méthodes diagnostiques en génétique moléculaire P. Latour Praticien Hospitalier Responsable UF 3427 Neurogénétique Moléculaire Laboratoire de Neurochimie Pr Renaud HCL Centre de Biologie Est DES Neurologie

Plus en détail

L'ADN peut être copié au travers des générations cellulaires successives de manière fidèle, c'est la réplication de l'adn.

L'ADN peut être copié au travers des générations cellulaires successives de manière fidèle, c'est la réplication de l'adn. 24/09/2014 REBOUL Nicolas L2 CR : Hamza BERGUIGUA Génétique Médicale Dr Martin KRAHN 8 pages Introduction à la Génétique Médicale : Les champs de la Génétique Médicale, La place de la Génétique Médicale

Plus en détail

POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA

POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA POPULATION D ADN COMPLEXE - ADN génomique ou - copie d ARNm = CDNA Amplification spécifique Détection spécifique Clonage dans des vecteurs Amplification in vitro PCR Hybridation moléculaire - hôte cellulaire

Plus en détail

DIAGNOSTIC PRÉNATAL NON INVASIF : LE SANG MATERNEL

DIAGNOSTIC PRÉNATAL NON INVASIF : LE SANG MATERNEL 6 LE TEST DIAGNOSTIC PRÉNATAL NON INVASIF : LE SANG MATERNEL Source : les cellules trophoblastiques Fetal cell Cell isolation Détection 5-6SA Disparition rapide après accouchement Pas de persistance après

Plus en détail

DNA-seqciblé : principales méthodes d'enrichissement

DNA-seqciblé : principales méthodes d'enrichissement DNA-seqciblé : principales méthodes d'enrichissement DU de séquençage haut-débit Module 1 : Séquençage nouvelle génération - Technologies & applications 17 octobre 2013 Amélie PITON piton@igbmc.fr 1 Introduction

Plus en détail

La médecine personnalisée Daniel Locker Professeur honoraire Université Orléans

La médecine personnalisée Daniel Locker Professeur honoraire Université Orléans La médecine personnalisée Daniel Locker Professeur honoraire Université Orléans Introduction En 1992, l introduction d'un anticorps monoclonal, l herceptine, pour le traitement du cancer du sein a donné

Plus en détail

Interprétation des résultats et troubleshooting

Interprétation des résultats et troubleshooting Interprétation des résultats et troubleshooting Le Service de séquençage du Centre d innovation Génome Québec et Université McGill utilise des appareils 3730xl DNA Analyzer d Applied Biosystems. Cette

Plus en détail

Premières expériences de diagnostic des formes héréditaires de cancer du sein et de l ovaire sur séquenceur Illumina GAIIx

Premières expériences de diagnostic des formes héréditaires de cancer du sein et de l ovaire sur séquenceur Illumina GAIIx Premières expériences de diagnostic des formes héréditaires de cancer du sein et de l ovaire sur séquenceur Illumina GAIIx 1 / 35 2 / 35 Contexte 3 / 35 Risque cumulé de cancer à 70 ans Cancer du sein

Plus en détail

Interactions génétique environnement. Environnement. Spermatozoïdes physiologiquement non fécondants. Causes? Suivi des enfants

Interactions génétique environnement. Environnement. Spermatozoïdes physiologiquement non fécondants. Causes? Suivi des enfants Interactions génétique environnement Environnement Spermatozoïdes physiologiquement non fécondants Causes? ICSI Conceptus génétique infections Suivi des enfants Démarche diagnostique : Evaluation du risque

Plus en détail

Génotypage par Séquençage (GBS) : Création d une carte génétique haute densité de Tournesol Population INEDI (RILs PSC8 x XRQ)

Génotypage par Séquençage (GBS) : Création d une carte génétique haute densité de Tournesol Population INEDI (RILs PSC8 x XRQ) Génotypage par Séquençage (GBS) : Création d une carte génétique haute densité de Tournesol Population INEDI (RILs PSC8 x XRQ) Baptiste Mayjonade (IE-CDD SUNRISE) Génétique et génomique des réponses aux

Plus en détail

Polymorphisme chromosomique chez Gerbillus nigeriae :

Polymorphisme chromosomique chez Gerbillus nigeriae : Polymorphisme chromosomique chez Gerbillus nigeriae : Vers un moyen de reconnaître ses chromosomes? Philippe GAUTHIER Karmadine HIMA Gauthier DOBIGNY Gerbillus nigeriae : un «bio-indicateur sahélien» ravageur

Plus en détail

La Génétique en Pratique

La Génétique en Pratique La Génétique en Pratique Deux volets /Trois échelles Clinique :-les syndromes - le conseil génétique Biologie :-Cellulaire -Moléculaire CELLULAIRE=Cytogénétique Structure du chromosome CELLULAIRE=Caryotype

Plus en détail

LES MARQUEURS MOLECULAIRES

LES MARQUEURS MOLECULAIRES LES MARQUEURS MOLECULAIRES Il y a différents types de marqueurs : o Les caractères phénotypiques : limités, observations sur l arbre entier et sur différentes années o Les marqueurs biochimiques o Les

Plus en détail

TRANSLOCATIONS. Marguerite Prieur, retraitée Necker Enfants Malades ATC 2008 Nantes

TRANSLOCATIONS. Marguerite Prieur, retraitée Necker Enfants Malades ATC 2008 Nantes TRANSLOCATIONS Marguerite Prieur, retraitée Necker Enfants Malades ATC 2008 Nantes Translocations Définition: passage d un segment chromosomique sur un autre chromosome 2 points de cassure : remaniements

Plus en détail

Lettres: A, T, G, C. Mots: à 3 lettres (codons) Phrase: gène (information pour synthétiser une protéine). Ponctuation

Lettres: A, T, G, C. Mots: à 3 lettres (codons) Phrase: gène (information pour synthétiser une protéine). Ponctuation 2- Les molécules d ADN constituent le génome 2-1 La séquence d ADN représente l information génétique Lettres: A, T, G, C Mots: à 3 lettres (codons) Phrase: gène (information pour synthétiser une protéine).

Plus en détail

Etude du transcriptome et du protéome en Neurooncologie

Etude du transcriptome et du protéome en Neurooncologie Etude du transcriptome et du protéome en Neurooncologie Principes, aspects pratiques, applications cliniques François Ducray Neurologie Mazarin, Unité Inserm U711 Groupe hospitalier Pitié-Salpêtrière Etude

Plus en détail

1953 : double hélice d ADN

1953 : double hélice d ADN 1953 : double hélice d ADN 1956 : nombre de chromosomes dans le caryotype humain (46) Années 70 : boîte à outils : couper, coller, cloner, premières techniques de séquençage d ADN technique du Southern

Plus en détail

leucémie lymphoïde chronique

leucémie lymphoïde chronique la leucémie lymphoïde chronique S.Taoussi, M.T. Abad Service hématologie, EHS ELCC Blida Ce travail a été réalisé au laboratoire hématologie du CAC Blida avec le soutien du CMNG et du laboratoire de recherche

Plus en détail

ATELIER EPIGENETIQUE

ATELIER EPIGENETIQUE Juin 2012 ATELIER EPIGENETIQUE Utilisation de la Q-PCR pour analyser des données de ChIP ou de MeDIP Emmanuèle Mouchel-Vielh I. La PCR quantitative: principe et généralités II. Interprétation des résultats

Plus en détail

A- Exploiter des animations pour repérer une mutation et étudier son mécanisme de réparation.

A- Exploiter des animations pour repérer une mutation et étudier son mécanisme de réparation. THEME 1A : Expression, stabilité et variation du patrimoine génétique Chapitre 2 : Variabilité Génétique et Mutation de l ADN TP-3-: Réparation de l ADN, mutations et polyallélisme Les mutations de l ADN

Plus en détail

INDICATIONS de la CGH ARRAY en DIAGNOSTIC PRENATAL (ACPA) Réseau Naître et Grandir en LR 5 ème Journée Régionale d Echographie Jean CHIESA

INDICATIONS de la CGH ARRAY en DIAGNOSTIC PRENATAL (ACPA) Réseau Naître et Grandir en LR 5 ème Journée Régionale d Echographie Jean CHIESA INDICATIONS de la CGH ARRAY en DIAGNOSTIC PRENATAL (ACPA) Réseau Naître et Grandir en LR 5 ème Journée Régionale d Echographie Jean CHIESA 09 Octobre 2015 5 Mb Principe de la CGH array Nanotechnologie

Plus en détail

Dépistage Prénatal Non Invasif

Dépistage Prénatal Non Invasif Dépistage Prénatal Non Invasif Dr Mélanie JIMENEZ POCQUET Biologiste - Cytogéneticien L ABOcaryo+ L ABO+ - Chambray les Tours Les patientes connectées Les forums La presse Le presse DPNI : pourquoi

Plus en détail

CYTOGENETIQUE MOLECULAIRE

CYTOGENETIQUE MOLECULAIRE CYTOGENETIQUE MOLECULAIRE I)Introduction Le caryotype est l'examen génétique le plus prescrit, car il permet une analyse globale du génome. Il permet de détecter 15% des anomalies. Mais il possède un faible

Plus en détail

Chapitre 10 L isolement et la manipulation de gènes. Injection d ADN étranger dans une cellule animale

Chapitre 10 L isolement et la manipulation de gènes. Injection d ADN étranger dans une cellule animale Chapitre 10 L isolement et la manipulation de gènes Injection d ADN étranger dans une cellule animale Comment amplifier un gène d intérêt? Amplification in vivo à l aide du clonage d ADN L ensemble formé

Plus en détail

I. TOUITOU (Mise ligne 15/10/08 LIPCOM-RM) Faculté de Médecine Montpellier-Nîmes

I. TOUITOU (Mise ligne 15/10/08 LIPCOM-RM) Faculté de Médecine Montpellier-Nîmes er cycle PCEM MI5 Génétique moléculaire et clinique Année Universitaire 008-009 Comment apprécier la composante héréditaire des maladies?. Excès de cas familiaux - Les études familiales - - La plupart

Plus en détail

Obtention de données génétiques à grande échelle

Obtention de données génétiques à grande échelle Obtention de données génétiques à grande échelle Stéphanie FERREIRA Ph.D. Campus de l Institut Pasteur de Lille 1, rue du Professeur Calmette 59000 LILLE Tel : 03 20 87 71 53 Fax : 03 20 87 72 64 contact@genoscreen.fr

Plus en détail

Diagnostic prénatal des maladies génétiques

Diagnostic prénatal des maladies génétiques Diagnostic prénatal des maladies génétiques Collège National des Enseignants et Praticiens de Génétique Médicale C. Coutton, V. Satre, F. Amblard et F. Devillard Date de création du document 2010-2011

Plus en détail

CHAPITRE A BASES GENETIQUES

CHAPITRE A BASES GENETIQUES CHAPITRE A BASES GENETIQUES TOUT CE QUE VOUS AVEZ TOUJOURS VOULU SAVOIR SUR LA GÉNÉTIQUE..SANS JAMAIS AVOIR OSÉ LE DEMANDER Nos séquences d ADN se perdent dans la nuit des temps ce qui compte le plus :

Plus en détail

Approche pratique de la transgénèse :

Approche pratique de la transgénèse : Approche pratique de la transgénèse : Recherche et analyse fine d une modification génétique dans le génome murin octobre 2006 1) 2) 3) 7) 8) 9) 10) 11) 12) 13) 14) Plan / Introduction Extraction et Préparation

Plus en détail

Quelques notions de génomique fonctionnelle: l exemple des puces à ADN

Quelques notions de génomique fonctionnelle: l exemple des puces à ADN Quelques notions de génomique fonctionnelle: l exemple des puces à ADN Frédéric Devaux Laboratoire de génétique moléculaire Ecole Normale Supérieure Le «dogme central» de la biologie moléculaire Transcription

Plus en détail

Séquençage haut débit (Next Generation Sequencing) 12/03/2012 Pascal Le Bourgeois, M1BBT, EM8BTGM 1

Séquençage haut débit (Next Generation Sequencing) 12/03/2012 Pascal Le Bourgeois, M1BBT, EM8BTGM 1 Séquençage haut débit (Next Generation Sequencing) 1 Pyroséquençage (454) Margulies M. et al. (2005). Genome sequencing in microfabricated high-density picolitre reactors. Nature 437:376-80 Pas de banques

Plus en détail

TD Révision BIO57. Connaissance et Technique du gène

TD Révision BIO57. Connaissance et Technique du gène TD Révision BIO57 Connaissance et Technique du gène Novembre 2007 Cécile BAUDOT cecile.baudot@medecine.univ-mrs.fr INSERM 910 «Génétique Médicale et Génomique Fonctionnelle» Maladies Neuromusculaires Le

Plus en détail

Le séquençage à haut débit Mars 2011

Le séquençage à haut débit Mars 2011 Atelier Epigénétique Université Pierre et Marie Curie Le séquençage à haut débit Mars 2011 Stéphane Le Crom (lecrom@biologie.ens.fr) Institut de Biologie de l École normale supérieure (IBENS) de la Montagne

Plus en détail

It was generally thought that genes were almost always present in two copies in a genome.

It was generally thought that genes were almost always present in two copies in a genome. COPY NUMBER VARIATION (CNV) It was generally thought that genes were almost always present in two copies in a genome. However, recent discoveries have revealed that large segments of DNA, ranging in size

Plus en détail

Polymorphismes de l ADN

Polymorphismes de l ADN Introduction Polymorphismes de l ADN Présentation et mise en évidence Recherche de gènes responsables de maladies génétiques : Analyse de pedigrees où la maladie est présente Sur quel chromosome? À quel

Plus en détail

SERVICE DE GYNECOLOGIE OBSTETRIQUE - CLINIQUE DE FERTILITE. Clinique de Fertilité ULB ERASME HOPITAL ERASME

SERVICE DE GYNECOLOGIE OBSTETRIQUE - CLINIQUE DE FERTILITE. Clinique de Fertilité ULB ERASME HOPITAL ERASME Clinique de Fertilité ULB ERASME Introduction Pour des couples à haut risque de mettre au monde un enfant atteint d une maladie génétique, l approche classique par les examens anténatals conventionnels

Plus en détail

Sarcome indifférencié

Sarcome indifférencié Cytogénétique classique peu informative, et délicate à mettre en œuvre pour la plupart des tumeurs solides n = 54 n = 97 Sarcome indifférencié Sarcome indifférencié Cancer du sein Cytogénétique 24 couleurs

Plus en détail

Laboratoire Cerba. Congrès SHIP Marseille 15 Octobre 2010

Laboratoire Cerba. Congrès SHIP Marseille 15 Octobre 2010 Diagnostic prénatal non invasif à partir du sang maternel > J.M. COSTA Laboratoire Cerba Congrès SHIP Marseille 15 Octobre 2010 Diagnostic prénatal in utero en France : quelques chiffres clés Toutes indications

Plus en détail

GENETIQUE MEDICALE - Principe des études moléculaires en Génétique Médicale, Méthodes d analyse des microlésions du Génome

GENETIQUE MEDICALE - Principe des études moléculaires en Génétique Médicale, Méthodes d analyse des microlésions du Génome 29/10/2014 Crévits Léna L2 Génétique médicale Dr Martin Krahn 14 pages Principe des études moléculaires en Génétique Médicale - Méthodes d analyse des microlésions du Génome Plan A. Rappels et généralités

Plus en détail

Cancers gynécologiques (endomètre ovaire) d origine génétique

Cancers gynécologiques (endomètre ovaire) d origine génétique Cancers gynécologiques (endomètre ovaire) d origine génétique Anne Fajac Service Histologie-Biologie Tumorale, Hôpital Tenon Prédisposition héréditaire au cancer Mutation constitutionnelle Cancer héréditaire

Plus en détail

-anomalies chromosomiques: nombre, structure -recombinaison de chromosomes

-anomalies chromosomiques: nombre, structure -recombinaison de chromosomes La cytogénétique est l'étude des phénomènes génétiques au niveau de la cellule, plus précisément au niveau des chromosome sans la nécessité d'extraire l'adn : -anomalies chromosomiques: nombre, structure

Plus en détail

Organisation du Génome humain Notions essentielles

Organisation du Génome humain Notions essentielles Organisation du Génome humain Notions essentielles Biologie Moléculaire et Médecine; Kaplan et Delpech; Flammarion «How to sequence a genome» (film): www.genome.gov/25019885 Human Genome Project: http://www.genome.gov/hgp/

Plus en détail

Génome humain Polymorphismes Marqueurs génétiques. Dr Chrystelle COLAS Département de Génétique GH Pitié Salpêtrière.

Génome humain Polymorphismes Marqueurs génétiques. Dr Chrystelle COLAS Département de Génétique GH Pitié Salpêtrière. Génome humain Polymorphismes Marqueurs génétiques Dr Chrystelle COLAS Département de Génétique GH Pitié Salpêtrière Génome humain Génome Humain () Homme Cellules Noyaux 46 Chromosomes Protéines Gènes ADN

Plus en détail

Détermination de gènes candidats par séquençage d exome dans une famille présentant des calcifications idiopathiques des noyaux gris centraux

Détermination de gènes candidats par séquençage d exome dans une famille présentant des calcifications idiopathiques des noyaux gris centraux Service de Neurologie U614 Génétique médicale et fonctionnelle des cancers et des maladies neuropsychiatriques Pr Frébourg Dr Campion Pr Hannequin Détermination de gènes candidats par séquençage d exome

Plus en détail

Bases de données des mutations

Bases de données des mutations Bases de données des mutations CFMDB CFTR2 CFTR-France / Registre Corinne THEZE, Corinne BAREIL Laboratoire de génétique moléculaire Montpellier Atelier Muco, Lille, 25-27 septembre 2014 Accès libre http://www.genet.sickkids.on.ca/app

Plus en détail

Génie génétique. Définition : Outils nécessaires : Techniques utilisées : Application du génie génétique : - Production de protéines

Génie génétique. Définition : Outils nécessaires : Techniques utilisées : Application du génie génétique : - Production de protéines Génie génétique Définition : Ensemble de méthodes d investigation et d expérimentation sur les gènes. Outils nécessaires : ADN recombinant, enzyme de restriction, vecteur, banque ADNc, sonde nucléique...

Plus en détail

Capacités et attitudes Activités Compétences Tâche complexe Extraire et organiser des Informations

Capacités et attitudes Activités Compétences Tâche complexe Extraire et organiser des Informations Constat : la méiose produit des gamètes génétiquement différents qui parfois comportent des anomalies qui peuvent empêcher l embryon de se développer ou de se développer normalement et entraîner alors

Plus en détail

Deux plateformes IBiSA et 3 plateaux techniques regroupés depuis 2010. Responsable scientifique Denis Milan. Coordination des nouveaux investissements

Deux plateformes IBiSA et 3 plateaux techniques regroupés depuis 2010. Responsable scientifique Denis Milan. Coordination des nouveaux investissements RNA-seq Olivier Bouchez Nathalie Marsaud Mercredi 28 mars 2012 Plateforme GeT : Génome et Transcriptome Deux plateformes IBiSA et 3 plateaux techniques regroupés depuis 2010 Responsable scientifique Denis

Plus en détail

TEST MMR POUR TUMEURS COLIQUES EN PRATIQUE COURANTE? Karen LEROY Hôpital Henri Mondor, Créteil

TEST MMR POUR TUMEURS COLIQUES EN PRATIQUE COURANTE? Karen LEROY Hôpital Henri Mondor, Créteil TEST MMR POUR TUMEURS COLIQUES EN PRATIQUE COURANTE? Karen LEROY Hôpital Henri Mondor, Créteil 47 Définition du phénotype MSI (MicroSatellite Instability) Environ 15% des cancers colo-rectaux présentent

Plus en détail

Mise en place du NGS en routine diagnostic - Validation, Organisation, Développements

Mise en place du NGS en routine diagnostic - Validation, Organisation, Développements Mise en place du NGS en routine diagnostic - Validation, Organisation, Développements Atelier sur le Diagnostic Moléculaire de la Mucoviscidose 2014 - Lille Stratégie analytique Préparation library (1,5

Plus en détail

Génétique classique Génétique inverse. Le clonage positionnel De la pathologie au gène. Applications du clonage positionnel. I- Cartographie génomique

Génétique classique Génétique inverse. Le clonage positionnel De la pathologie au gène. Applications du clonage positionnel. I- Cartographie génomique Le clonage positionnel De la pathologie au gène Définition Cartographie génomique Etapes du clonage positionnel Génétique classique Génétique inverse traitement diagnostic phénotypique ( AC ) fonction

Plus en détail

Titre de la leçon? Les mutations

Titre de la leçon? Les mutations Titre de la leçon? Les mutations I. La drépanocytose Globules rouges d un sujet normal Globules rouges d un sujet atteint de drépanocytose Circulation des globules rouges dans les capillaires (sujet atteint

Plus en détail

ED Biologie moléculaire. E. Turpin J. Lehmann-Che 5-6 novembre 2007

ED Biologie moléculaire. E. Turpin J. Lehmann-Che 5-6 novembre 2007 ED Biologie moléculaire E. Turpin J. Lehmann-Che 5-6 novembre 2007 PCR 1983: Kary Mullis Amplification in vitro par une méthode enzymatique d'un fragmentd'adn en présence de deux oligonucléotides spécifiques

Plus en détail

Clonage de Vénus et transformation de E.Coli.

Clonage de Vénus et transformation de E.Coli. Clonage de Vénus et transformation de E.Coli. Samueal Joseph, Romain Laverrière, Elias Laudato, Noé Mage Assisstants : Gisele Dewhurst, Charlotte Gehin, Miwa Umebayashi Résumé [1] L expérience consiste

Plus en détail

OneSeq : détection simultanée de CNV et de SNV en attendant le séquençage génome entier

OneSeq : détection simultanée de CNV et de SNV en attendant le séquençage génome entier OneSeq : SNV CNV détection simultanée de CNV et de SNV en attendant le séquençage génome entier Nicolas Chatron 1,2, Marc Le Lorc h 3, Eudeline Alix 1, Matthieu Egloff 3, Didier Goidin 4, Jean-Philippe

Plus en détail

Médecine personnalisée, de quoi parle-t on? Dominique Stoppa-Lyonnet

Médecine personnalisée, de quoi parle-t on? Dominique Stoppa-Lyonnet Médecine personnalisée, de quoi parle-t on? Dominique Stoppa-Lyonnet Octobre 2014 Médecine «génomique» personnalisée La médecine «génomique» personnalisée repose sur l identification de sous-groupes de

Plus en détail

Université Bordeaux Segalen - PACES 2011-2012 ED UE9s Mars 2012

Université Bordeaux Segalen - PACES 2011-2012 ED UE9s Mars 2012 Sélectionner les propositions exactes Université Bordeaux Segalen - PACES 2011-2012 ED UE9s Mars 2012 QCM 1. La température de fusion (Tm) d une molécule d ADN : A. est mise en évidence par l augmentation

Plus en détail

Avancées génétiques dans le bilan du retard mental

Avancées génétiques dans le bilan du retard mental Avancées génétiques dans le bilan du retard mental Pluradys, 4 Juin 2010 Pr Olivier-Faivre Centre de Référence Maladies Rares Anomalies du Développement et Syndromes Malformatifs de l Est Epidémiologie

Plus en détail

Petit guide de nomenclature cytogénétique Marguerite Prieur, Catherine Turleau Laboratoire de cytogénétique. Hôpital Necker Enfants Malades.

Petit guide de nomenclature cytogénétique Marguerite Prieur, Catherine Turleau Laboratoire de cytogénétique. Hôpital Necker Enfants Malades. Petit guide de nomenclature cytogénétique Marguerite Prieur, Catherine Turleau Laboratoire de cytogénétique. Hôpital Necker Enfants Malades. Paris Révision 2005 Isabelle Luquet (Reims) et Christine Terré

Plus en détail

TUTORAT UE spécifiques 2010-2011

TUTORAT UE spécifiques 2010-2011 FACULTE de PHARMACIE TUTORAT UE spécifiques 2010-2011 Méthodes d étude et d analyse du génome Eric Badia, Bernard Carcy Séance préparée par Alexandre Leboucher (ATM²), Astrid Robert (ATP) QCM n 1: Synthèse

Plus en détail

«AFFECTIVITE, SEXUALITE, HANDICAP» Présentation de

«AFFECTIVITE, SEXUALITE, HANDICAP» Présentation de 10 e colloque francophone de Noirlac 19 et 20 novembre 2008 «AFFECTIVITE, SEXUALITE, HANDICAP» Présentation de Mme M-C. de BLOIS (Maître de Conférence des Universités Praticien Hospitalier Généticienne

Plus en détail