Introduction à l analyse statistique et bioinformatique des puces à ADN

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimension: px
Commencer à balayer dès la page:

Download "Introduction à l analyse statistique et bioinformatique des puces à ADN"

Transcription

1 Formation INSERM 10 février 2004 Introduction à l analyse statistique et bioinformatique des puces à ADN Gaëlle Lelandais 1

2 Première Partie Analyse d une puce à ADN : Le recherche des gènes différentiellement exprimés 2

3 Analyse de l expression différentielle des gènes But : Identification des gènes différentiellement exprimés entre les deux conditions hybridées sur la puce. Cy5 Cy3 Expression différentielle? Une méthode simple : Le «Fold Change» Fixation d un seuil arbitraire C à partir duquel le gène est considéré comme différentiellement exprimé entre les conditions 1 et 2. Exp(Condition1) > C * Exp(Condition2) : Expression différentielle Exp(Condition1) < C * Exp(Condition2) : Même expression 3

4 Définition d une zone de significativité Même échantillon d ARN marqués en Cy3 ou en Cy gènes Réprimés plus de 2 fois Induits plus de 2 fois Nombre de gènes Spots témoins Cy3 Spots témoins Cy5 Distribution des log2(ratios) 4

5 Comment sélectionner les expression significative? Représentation graphique de l intensité de fluorescence pour chaque gène Expression non-significative des gènes Intensité en Cy5 Rapport Cy5/Cy3 > 0,5 et < 2 Gènes réprimés Gènes induits 5 Intensité en Cy3

6 Principales limites de la méthode «Fold Change»! Comment choisir la valeur à partir de laquelle un ratio est significatif?! La variabilité globale des expressions mesurées n est pas prise en compte.! Le niveau d expression des gènes n est pas pris en compte. Utilisation de méthodes reposant sur des modèles statistiques 6

7 Méthode des asymptotes - VARAN Varan pour l analyse de la variabilité des expériences de puces à ADN (ESPCI). N(µ,σ) Rinf0.99 Rsup0.99 µ-2σ log 2 (ICy5/I Cy3) µ+2σ log 2 (ICy5/ICy3) Varan utilise une approche statistique qui définit le domaine expérimental de variabilité et donne une analyse statistique de l expression différentielle dépendante du niveau d expression des gènes. (log 10 (I Cy5 ) + log 10 (I Cy3 ))/2 7

8 Importance des répétitions Répétitions de la même expérience Pour chaque gène, une expression différentielle moyenne entre les deux conditions hybridées sur la puce est mesurée.! Les moyennes sont moins variables que les valeurs individuelles.! Les répétitions permettent d effectuer des tests statistiques. 8

9 Données appariées ou non appariées? Données appariées : Données non appariées : Expérience Puce 1 Condition 1 Exp(1,1) Condition 2 Exp(1,2) Delta Delta1 Réplicats de condition 1 Expression gène X Réplicats de condition 2 Expression gène X Puce 2 Exp(2,1) Exp(2,2) Delta2 1 Exp(1,1) 1 Exp(1,2) Puce 3 Exp(3,1) Exp(3,2) Delta3 2 Exp(2,1) 2 Exp(2,2) Puce 4 Exp(4,1) Exp(4,2) Delta4 3 Exp(3,1) 3 Exp(3,2) Puce 5 Exp(5,1) Exp(5,2) Delta5 4 Exp(4,1) 5 Exp(5,1) Compilation des intensités en une seule valeur! Le nombre de répétitions pour les conditions 1 et 2 n est pas forcément identique.! Exemple des Macroarrays où une seule condition est hybridée par puce. 9

10 Analyse statistique des données appariées Expressions différentielles mesurées pour un gène donné, lors des répétitions d une expérience. Delta L écart à la moyenne est-il significativement différent de 0? Une approche paramétrique : Test de Student sur des données appariées. t = s / _ x n Calcul d une p-value associée, à partir de la distribution de Student à (n-1) degrés de liberté. P = 0.01 : 1 chance sur 100 d observer ce résultat pas le hasard, c est à dire sans effet biologique Conditions d application du test : Le test de Student nécessite que les deux jeux de données comparés soit distribués normalement. Tests non-paramétriques 10

11 Analyse par ré-échantillonnage On cherche à savoir si les moyennes mesurées dans les deux échantillons sont significativement différentes. Sous l hypothèse nulle, les deux échantillons proviennent de la même population, il n y a pas de différence d expression entre les deux groupes. Chacune des mesures de l échantillon 1 peut être remplacée par une mesure de l échantillon 2 et vice-versa. Echantillon 1 Echantillon 2 Test classique de comparaison de moyenne (t-test) Mélange des données Echantillon 1 aléatoire Echantillon 2 aléatoire Test classique de comparaison de moyenne (t-test) 11

12 Résultat d une analyse par rééchantillonage Le mélange des données est réalisé de très nombreuses fois afin d obtenir une distribution des Rapports Critiques sous l hypothèse Ho. Fréquence RC obtenu à partir des échantillons initiaux RC données mélangée Estimation de la proportion des Rapports Critiques aléatoires supérieurs au Rapport Critique réel. Plus cette proportion est petite, moins l hypothèse Ho est fausse. 12

13 Tests multiples Les analyses précédentes portent sur l étude d un gène, permettant de conclure à l expression différentielle du gène au risque 1% par exemple. Ce risque 1% signifie : «Il y a 1 chance sur 100 pour que l expression de ce gène ne soit pas réellement différentielle entre les conditions 1 et 2 : c est un faux positif». Lors de l analyse complète d une puce à ADN, le même test est réalisé pour tous les gènes de la puce (parfois plusieurs milliers). Si pour chaque gène il existe un risque 1% de se tromper, lors de l analyse de 1000 gènes, en moyenne 10 gènes faux positifs seront conservés. Il faut estimer le taux de faux positifs! Utilisation du logiciel d analyse SAM (Significant Analysis of Microarrays)!Assignation d un score à chaque gène sur la base des variations d expression mesurées entre les différentes répétitions.!estimation du taux de faux positif associé. 13

14 Deuxième Partie Analyse de plusieurs expériences de puces à ADN : Profils d expression et classification des gènes 14

15 La constitution de «séries d expériences» Plusieurs expériences de puces à ADN Constitution d une série d expériences Exp 1 Exp 2 Exp 3.. Exp m Gène 1 Val(1,1) Val(1,2) Val(1,3).. Val(1,m) Gène 2 Val(2,1) Val(2,2) Val(2,3).. Val(2,m) Gène n Val(n,1) Val(n,2) Val(n,3).. Val(n,m) L évolution de la quantité des transcrits est suivie en fonction de diverses conditions expérimentales. 15

16 Avant de comparer des expériences entre elles La représentation «BoxPlot» permet une comparaison rapide des distribution des log2(ratio) Hypothèse : Les variations de distribution observées ne représentent pas de réelles variations biologiques Centrage Réduction 16

17 Pourquoi étudier des séries d expériences? Superposition des profils d expression : log2(ratio) log2(ratio) Exemple des gènes codants les protéines Histones : Profil moyen Numéro de l expérience Numéro de l expérience (série «Elutriation», Spellman et al., 1998) Les gènes dont les profils d expression sont similaires sont de bons candidats pour être régulés par les mêmes facteurs ou intervenir dans le même processus biologique. 17

18 La recherche des gènes dont les profils d expression sont similaires A chaque gène est associé un profil d expression Il s agit alors de trier ces profils en fonction de leur ressemblance Utilisation de méthodes statistiques Deux étapes principales : (1) Calcul des distances entre tous les profils pris deux à deux. (2) Tri des profils en fonction de la distance qui les sépare. 18

19 Une série d expérience, deux classifications possibles Série d expérience Exp 1 Exp 2 Exp 3 Gène 1 log2(1,1) log2(1,2) log2(1,3) Gène 2 log2(2,1) log2(2,2) log2(2,3) Gène 3 log2(3,1) log2(3,2) log2(3,3) Gène 4 log2(4,1) log2(4,2) log2(4,3) Classement des gènes Classement des expériences Exemple : Regroupement de gènes corégulés Exemple : Classification des tumeurs 19

20 Le calcul de la distance entre deux profils Distance Euclidienne Corrélation de Pearson log2(ratio) log2(ratio) Numéro de l expérience Numéro de l expérience! La distance euclidienne est dépendante de l échelle des profils! La mesure d une corrélation permet de définir des profils corrélés et anti-corrélés. Profil 1 x log2(ratio) x x Numéro de l expérience x x x Profil 2 20

21 La représentation géométrique élémentaire d une série d expériences Exemple : Exp 1 Exp 2 Expérience 2 Gène 1 Val(1,1) Val(1,2) Val(2,2) Gène 2 Val(2,1) Val(2,2) Val(1,2) Expérience 1 Généralisation : Val(1,1) Val(2,1) n gènes, 2 expériences n gènes, 3 expériences Nuage de point? Les proximités géométriques traduisent des associations statistiques. 21

22 Les deux grandes familles de méthodes Gène Configuration du nuage de points dans un espace à n dimensions Nuage de point Visualisation dans le plan le plus informatif Méthodes factorielles Constitution de groupes Méthodes de classification 22

23 Une méthode factorielle : L Analyse en Composante Principale (ACP) Difficulté de visualiser les distances entre les gènes lorsque la représentation géométrique d une série requiert un espace à plus de 2 ou 3 dimensions. Recherche d un sous-espace qui ajuste au mieux le nuage de point de façon à ce que les proximités qui y sont mesurées reflètent au mieux les proximités réelles. Exemple : Espace à 2 dimensions Espace à 1 dimensions Axe 2 Projection Axe 1 Axe 2 Axe 1 Axe le plus informatif 23

24 Analyse en Composante Principale (ACP) Espace à n dimensions ACP Représentation dans la plan Exemple : Résultats d une ACP sur la cinétique d expression d une protéine chimère (Devaux et al., 2001) 24

25 Le pour et le contre des méthodes Avantages Inconvénients ACP Aucun paramètre à choisir Calcul coûteux en temps de calcul 25

26 Une méthode de classification : Les k-means (1) Principe général : Centre de classe 1 (centre de gravité) Centre de classe 2 (centre de gravité) Groupe 1 d1 d2 Groupe 2 Comparaison des distances : d1 < d2 Nouvel élément à classer 26

27 Les k-means (2) Les différentes étapes de l algorithme : Tirage aléatoire des centres Constitution des classes Partitions finales Calcul des nouveaux centres 27

28 Le pour et le contre des méthodes Avantages Inconvénients ACP Aucun paramètre à choisir Calcul coûteux en temps de calcul Les k-means k Algorithme très rapide Bien adapté aux jeux de données importants Nécessité d un travail préalable pour choisir le nombre de groupes optimal 28

29 Une seconde méthode de classification : Le regroupement hiérarchique Il s agit d une méthode ascendante qui fournit une hiérarchie de partition. d(min) Matrice de distance initiale Matrice de distance recalculée Matrice de distance recalculée g1 g2 g3 g4 1,2 g3 g4 1,2,3 g4 g1 d1 d2 d3 1,2 d' d ' 1,2,3 d ' g2 d1 d4 d5 g3 d' d6 g4 d ' g3 d2 d4 d6 g4 d ' d6 g4 d3 d5 d6 g1 g2 g3 g4 g1 g2 g3 g4 g1 g2 g3 g4 A chaque étape, une partition est obtenue en agrégeant deux à deux les éléments les plus proches. 29

30 Le regroupement hiérarchique Le choix de la distance pour chaque cluster : - Simple linkage - Average linkage - Complete linkage 30

31 La visualisation du résultat : «Eisengramme» 31

32 Le pour et le contre des méthodes Avantages Inconvénients ACP Aucun paramètre à choisir Calcul coûteux en temps de calcul Les k-means k Algorithme très rapide Bien adapté aux jeux de données importants Nécessité d un travail préalable pour choisir le nombre de groupes optimal Le regroupement hiérarchique Existence d une hiérarchie de partition Difficulté à traiter des jeux de données importants (coûteux en ressources mémoires) 32

33 Avant la classification : le pré-traitement des données brutes (1) La gestion des valeurs manquantes : Exp 1 Exp 2 Exp 3.. Exp m Gène 1 Val(1,1) Val(1,2) Val(1,3).. Val(1,m) Gène 2 X Val(2,2) Val(2,3).. Val(2,m) Gène 3 Val(3,1) Val(3,2) X.. Val(3,m) Gène n Val(n,1) Val(n,2) Val(n,3).. Val(n,m) 33 Valeurs manquantes! Suppression des profils avec trop de valeurs manquantes (plus de 80%)! Calculs à partir de valeurs moyennes! Calculs en fonction des plus proches voisins (KNN imput)

34 Avant la classification : le pré-traitement des données brutes (2) Le filtrage des profils invariants : Il a pour but de supprimer les gènes dont l expression ne varie pas dans une série d expériences. log2(ratio) Valeur moyenne des profils à conserver Profil variant Moyenne + δ Expérience Zone d invariance Profil invariant à supprimer Moyenne - δ 34

35 Avant la classification : le pré-traitement des données brutes (3) Le centrage : Il consiste à soustraire la moyenne du profil à chacune des valeurs. Le réduction : Elle consiste à diviser chaque valeur par l écart type. Centrage Réduction 35

36 La classification est un problème difficile! Série d expérience Calcul des distances Tri des profils Tri des profils Tri des profils Différents résultats possibles Nécessité d une validation des groupes 36

37 Après la classification : la validation des résultats Regarder la superposition des profils d expression des gènes classés ensemble : Classification certainement réalisée sur un artéfact expérimental Bonne homogénéité des profils! Utilisation de plusieurs méthodes en modifiant les paramètres.! Confrontation des groupes obtenus avec les données bibliographiques. 37

38 Recherche des cibles d un facteur de transcription Séquence consensus commune à toutes les cibles d un même facteur de transcription Comment trouver ces séquences à partir d une liste de gènes corégulés? 38

39 Recherche de motifs dans les régions promotrices Comptage de mots :! Sites dédiés à l analyse des séquences régulatrices : RSA tools - INCLUSIVE - Plusieurs algorithmes sont disponibles : Consensus, Gibbs sampler Diad detector, Oligo analysis Recherche de motifs (banques de données) :! Saccharomyces cerevisae promotor database - Eucaryotic promotor database - Transfac - COMPEL - Signal scan - Représentation des motifs trouvés :! Weblogo - 39

40 Liens vers les autres données à «grande échelle» KEGG : Kyoto Encyclopedia of Genes and Genomes 40

41 Les méthodes de regroupement - Conclusion Il n y a pas de méthode universelle! Il n y a pas de paramètres universels (distance, première analyse, )! La meilleure solution est d utiliser plus qu une seule méthode Si vous ne devez utiliser qu un seul logiciel de regroupement :! Genesis (http://genome.tugraz.at/)! J-express (http://www.ii.uib.no/~bjarted/jexpress/)!mev (http://www.tigr.org/software/tm4/mev.html) Pour mieux comprendre les méthodes de regroupement : Master Thesis d Alexander Sturn, Janvier 2001, 82 pages 41

42 Les outils développés à l ENS 42

43 La bioinformatique et le «transcriptome» à l ENS Stéphane LE CROM - Gaëlle LELANDAIS - Sophie LEMOINE 43

Le support de la formation est en ligne. http://transcriptome.ens.fr/sgdb/contact/20060206_ens.php

Le support de la formation est en ligne. http://transcriptome.ens.fr/sgdb/contact/20060206_ens.php Le support de la formation est en ligne http://transcriptome.ens.fr/sgdb/contact/20060206_ens.php Recherche de gènes significatifs Sortir une liste de cibles sur 1 manip 1. Ouvrir le fichier de résultats

Plus en détail

Outils Statistiques du Data Mining

Outils Statistiques du Data Mining Outils Statistiques du Data Mining Pr Roch Giorgi roch.giorgi@univ-amu.fr SESSTIM, Faculté de Médecine, Aix-Marseille Université, Marseille, France http://sesstim-orspaca.org http://optim-sesstim.univ-amu.fr

Plus en détail

L essentiel sur les tests statistiques

L essentiel sur les tests statistiques L essentiel sur les tests statistiques 21 septembre 2014 2 Chapitre 1 Tests statistiques Nous considérerons deux exemples au long de ce chapitre. Abondance en C, G : On considère une séquence d ADN et

Plus en détail

Influence du nombre de réplicats dans une analyse différentielle de données RNAseq

Influence du nombre de réplicats dans une analyse différentielle de données RNAseq Influence du nombre de réplicats dans une analyse différentielle de données RNAseq Statisticiens: Sophie Lamarre Steve Van Ginkel Sébastien Déjean - Magali San Cristobal Matthieu Vignes Biologistes: Stéphane

Plus en détail

How To Analyse Data from micro-array experiments: A Simple Tutorial

How To Analyse Data from micro-array experiments: A Simple Tutorial How To Analyse Data from micro-array experiments: A Simple Tutorial Serge Smidtas Supelec Source de données L analyse commence lorsque les MicroArray ont été scannées. Des images, des logiciels (Genepix,

Plus en détail

Etude du transcriptome et du protéome en Neurooncologie

Etude du transcriptome et du protéome en Neurooncologie Etude du transcriptome et du protéome en Neurooncologie Principes, aspects pratiques, applications cliniques François Ducray Neurologie Mazarin, Unité Inserm U711 Groupe hospitalier Pitié-Salpêtrière Etude

Plus en détail

Tests de comparaison de moyennes. Dr Sahar BAYAT MASTER 1 année 2009-2010 UE «Introduction à la biostatistique»

Tests de comparaison de moyennes. Dr Sahar BAYAT MASTER 1 année 2009-2010 UE «Introduction à la biostatistique» Tests de comparaison de moyennes Dr Sahar BAYAT MASTER 1 année 2009-2010 UE «Introduction à la biostatistique» Test de Z ou de l écart réduit Le test de Z : comparer des paramètres en testant leurs différences

Plus en détail

metarnaseq: un package pour la méta-analyse de données RNA-seq

metarnaseq: un package pour la méta-analyse de données RNA-seq metarnaseq: un package pour la méta-analyse de données RNA-seq Guillemette Marot, Florence Jaffrézic, Andrea Rau 28/06/13 Overview 1 Introduction 2 Analyse statistique d une seule étude 3 Méta-analyse

Plus en détail

Extraction d informations stratégiques par Analyse en Composantes Principales

Extraction d informations stratégiques par Analyse en Composantes Principales Extraction d informations stratégiques par Analyse en Composantes Principales Bernard DOUSSET IRIT/ SIG, Université Paul Sabatier, 118 route de Narbonne, 31062 Toulouse cedex 04 dousset@irit.fr 1 Introduction

Plus en détail

Christelle REYNES EA 2415 Epidémiologie, Biostatistique et Santé Publique Université Montpellier 1. 8 Juin 2012

Christelle REYNES EA 2415 Epidémiologie, Biostatistique et Santé Publique Université Montpellier 1. 8 Juin 2012 Extraction et analyse des mesures haut-débit pour l identification de biomarqueurs : problèmes méthodologiques liés à la dimension et solutions envisagées EA 2415 Epidémiologie, Biostatistique et Santé

Plus en détail

Formation INSERM : Les Biopuces. Méthodes bioinformatique d analyse des puces à ADN - 1 ère partie

Formation INSERM : Les Biopuces. Méthodes bioinformatique d analyse des puces à ADN - 1 ère partie Formation INSERM : Les Biopuces Méthodes bioinformatique d analyse des puces à ADN - 1 ère partie ENS - 9 février 2004 Laboratoire de Génétique Moléculaire - CNRS Laboratoire de Biologie Moléculaire du

Plus en détail

Classification Exemple : Enquête d opinion sur les OGM. Pauline Le Badezet Alexandra Lepage

Classification Exemple : Enquête d opinion sur les OGM. Pauline Le Badezet Alexandra Lepage Classification Exemple : Enquête d opinion sur les OGM Pauline Le Badezet Alexandra Lepage SOMMAIRE Introduction Méthodologie Méthode de partitionnement Classification Ascendante Hiérarchique Interprétation

Plus en détail

Gènes Diffusion - EPIC 2010

Gènes Diffusion - EPIC 2010 Gènes Diffusion - EPIC 2010 1. Contexte. 2. Notion de génétique animale. 3. Profil de l équipe plateforme. 4. Type et gestion des données biologiques. 5. Environnement Matériel et Logiciel. 6. Analyses

Plus en détail

Méthodes statistiques pour l analyse de puce à ADN. Tristan Mary-Huard Institut National Agronomique Paris-Grignon

Méthodes statistiques pour l analyse de puce à ADN. Tristan Mary-Huard Institut National Agronomique Paris-Grignon Méthodes statistiques pour l analyse de puce à ADN Tristan Mary-Huard Institut National Agronomique Paris-Grignon 4 questions Comment récupérer un signal utilisable pour chaque gène? Normalisation Comment

Plus en détail

TP 1 M1 Informatique Apprentissage Automatique. Premières classifications : apprentissage et évaluation

TP 1 M1 Informatique Apprentissage Automatique. Premières classifications : apprentissage et évaluation Premières classifications : apprentissage et évaluation L objectif de ce TP est double : prise en main de la bibliothèque scikit-learn de Python, dédiée à l apprentissage automatique, sensibilisation à

Plus en détail

fonction processus biologiques criblage

fonction processus biologiques criblage Transcriptome 1 Transcriptome : ensemble des ARNm ou transcrits présents dans une population de cellules dans des conditions données. Plan Introduction Acquisition des données Description des données Transformation,

Plus en détail

INTRODUCTION AU DATA MINING

INTRODUCTION AU DATA MINING INTRODUCTION AU DATA MINING 6 séances de 3 heures mai-juin 2006 EPF - 4 ème année - Option Ingénierie d Affaires et de Projets Bertrand LIAUDET TP DE DATA MINING Le TP et le projet consisteront à mettre

Plus en détail

3. COMPARAISON DE PLUS DE DEUX GROUPES

3. COMPARAISON DE PLUS DE DEUX GROUPES 3. COMPARAISON DE PLUS DE DEUX GROUPES La comparaison de moyennes de plus de deux échantillons se fait généralement par une analyse de variance (ANOVA) L analyse de variance suppose l homogénéité des variances

Plus en détail

Programmation avancée

Programmation avancée Programmation avancée Chapitre 1 : Complexité et les ABR (arbres binaires de recherche) 1 1 IFSIC Université de Rennes-1 M2Crypto, octobre 2011 Plan du cours 1 2 3 4 5 6 7 8 9 10 Algorithmes Définition

Plus en détail

Activité 1 : échantillonnage

Activité 1 : échantillonnage Activité échantillonnage, intervalle de fluctuation, prise de décision (à partir d un même thème) Les trois activités qui suivent s inspirent du document «ressources pour la classe de première générale

Plus en détail

Première STMG1 2014-2015 progression. - 1. Séquence : Proportion d une sous population dans une population.

Première STMG1 2014-2015 progression. - 1. Séquence : Proportion d une sous population dans une population. Première STMG1 2014-2015 progression. - 1 Table des matières Fil rouge. 3 Axes du programme. 3 Séquence : Proportion d une sous population dans une population. 3 Information chiffrée : connaître et exploiter

Plus en détail

Master de génétique UE génomique fonctionnelle Université Denis Diderot Janvier 2009. Normalisation. Stéphane Le Crom (lecrom@biologie.ens.

Master de génétique UE génomique fonctionnelle Université Denis Diderot Janvier 2009. Normalisation. Stéphane Le Crom (lecrom@biologie.ens. Master de génétique UE génomique fonctionnelle Université Denis Diderot Janvier 2009 Normalisation Stéphane Le Crom (lecrom@biologie.ens.fr) Laboratoire de Génétique Moléculaire du Développement - INSERM

Plus en détail

Table des matières. PREMIÈRE PARTIE Étapes initiales des études marketing 7

Table des matières. PREMIÈRE PARTIE Étapes initiales des études marketing 7 Table des matières Préface Public 1 Structure de l ouvrage 1 Caractéristiques de l ouvrage 3 Contenu 3 Pédagogie 4 Remarques sur l adaptation française 4 Ressources numériques 5 Biographie 6 PREMIÈRE PARTIE

Plus en détail

Heidi WECHTLER. Octobre 2005

Heidi WECHTLER. Octobre 2005 Heidi WECHTLER Le support aux analyses de données Séminaire GREGOR Octobre 2005 Support aux analyse de données du GREGOR Le poste Chargée d étude statistiques au GREGOR, bureau B126 (wechtler.iae@univ-paris1.fr)

Plus en détail

Chapitre 3 : Principe des tests statistiques d hypothèse. José LABARERE

Chapitre 3 : Principe des tests statistiques d hypothèse. José LABARERE UE4 : Biostatistiques Chapitre 3 : Principe des tests statistiques d hypothèse José LABARERE Année universitaire 2010/2011 Université Joseph Fourier de Grenoble - Tous droits réservés. Plan I. Introduction

Plus en détail

Anomalies chromosomiques et tumeurs d Ewing

Anomalies chromosomiques et tumeurs d Ewing Anomalies chromosomiques et tumeurs d Ewing Sylvain Blachon IRISA/INRIA Rennes - projet SITCON 21 Octobre 2008 Sylvain Blachon (IRISA/INRIA Rennes - projet SITCON) Anomalies chromosomiques et tumeurs d

Plus en détail

Introduction à l analyse des données. Olivier Godechot

Introduction à l analyse des données. Olivier Godechot Introduction à l analyse des données Olivier Godechot Introduction. Les données statistiques : de très nombreuses variables. Aucune n est parfaite La perception d un phénomène appréhendée comme la combinaison

Plus en détail

Analyse simultanée de variables quantitatives et qualitatives. à l aide de l analyse factorielle multiple

Analyse simultanée de variables quantitatives et qualitatives. à l aide de l analyse factorielle multiple Analyse simultanée de variables quantitatives et qualitatives à l aide de l analyse factorielle multiple Jérôme Pagès Laboratoire de mathématiques appliquées Agrocampus France Analyse Factorielle Multiple

Plus en détail

LES TYPOLOGIES DE PARCOURS METHODES ET USAGES. Yvette Grelet, Patrick Rousset CEREQ grelet@mrsh.unicaen.fr rousset@cereq.fr

LES TYPOLOGIES DE PARCOURS METHODES ET USAGES. Yvette Grelet, Patrick Rousset CEREQ grelet@mrsh.unicaen.fr rousset@cereq.fr LES TYPOLOGIES DE PARCOURS METHODES ET USAGES Yvette Grelet, Patrick Rousset CEREQ grelet@mrsh.unicaen.fr rousset@cereq.fr 1 PLAN Première partie : un exemple traité «en vraie grandeur» : les 26500 jeunes

Plus en détail

La classification 2012-2013. Fabien Chevalier Jérôme Le Bellac

La classification 2012-2013. Fabien Chevalier Jérôme Le Bellac La classification 2012-2013 Fabien Chevalier Jérôme Le Bellac Introduction : Classification : méthode d analyse de données Objectif : Obtenir une représentation schématique simple d'un tableau de données

Plus en détail

Introduction à l analyse quantitative

Introduction à l analyse quantitative Introduction à l analyse quantitative Vue d ensemble du webinaire Le webinaire sera enregistré. Les diapositives et tous les autres documents seront envoyés aux participants après la séance. La séance

Plus en détail

Interprétation d une analyse de variance avec mesures répétées

Interprétation d une analyse de variance avec mesures répétées Approche quantitative Interprétation d une analyse de variance avec mesures répétées «Les faits sont têtus. Il est plus facile de s arranger avec les statistiques.» Mark Twain L objectif de ce document

Plus en détail

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq

Homéoallèles. Analyse différentielle. Normalisation. NGS Transcriptomique Python R. Blé RNA-seq Présenté par Xi LIU ATCGCGCTAGCTGGTGTATCGCATCGCGCTAGCTGGTGTATCGCGCTAGCTGGTGTATCGCGCTAGCCTGGTGTATCGCCATCGCGCTAGCTGGCGCTAGCTGAATCGCGCATATG 17 Septembre 2013 Homéoallèles Génome Normalisation Analyse différentielle

Plus en détail

Examen de Génomique et Protéomique Fonctionnelle M2 BBSG (Mastères Recherche et Pro) 2 février 2006 Durée 3h. Partie1. Génomique fonctionnelle

Examen de Génomique et Protéomique Fonctionnelle M2 BBSG (Mastères Recherche et Pro) 2 février 2006 Durée 3h. Partie1. Génomique fonctionnelle Examen de Génomique et Protéomique Fonctionnelle M2 BBSG (Mastères Recherche et Pro) 2 février 2006 Durée 3h L examen comporte deux parties, l une axée sur la génomique fonctionnelle et l autre sur la

Plus en détail

Clermont Ferrand - Janvier 2003

Clermont Ferrand - Janvier 2003 DISDAMIN: Algorithmes de Data Mining Distribués Valerie FIOLET (1,2) - Bernard TOURSEL (1) 1 Equipe PALOMA - LIFL - USTL - LILLE (FRANCE) 2 Service Informatique - UMH - MONS (BELGIUM) Clermont Ferrand

Plus en détail

L ANALYSE EN COMPOSANTES PRINCIPALES (A.C.P.) Pierre-Louis GONZALEZ

L ANALYSE EN COMPOSANTES PRINCIPALES (A.C.P.) Pierre-Louis GONZALEZ L ANALYSE EN COMPOSANTES PRINCIPALES (A.C.P.) Pierre-Louis GONZALEZ INTRODUCTION Données : n individus observés sur p variables quantitatives. L A.C.P. permet d eplorer les liaisons entre variables et

Plus en détail

Utilisation des diagrammes de Voronoï et des algorithmes génétiques pour l'étude des complexes protéine-protéine.

Utilisation des diagrammes de Voronoï et des algorithmes génétiques pour l'étude des complexes protéine-protéine. Utilisation des diagrammes de Voronoï et des algorithmes génétiques pour l'étude des complexes protéine-protéine. Anne Poupon Biologie et Bioinformatique des Systèmes de Signalisation INRA - Nouzilly France

Plus en détail

Why Software Projects Escalate: The Importance of Project Management Constructs

Why Software Projects Escalate: The Importance of Project Management Constructs Why Software Projects Escalate: The Importance of Project Management Constructs Why Software Projects Escalate: The Importance of Project Management Constructs 1. Introduction 2. Concepts de la gestion

Plus en détail

Statistique et analyse de données pour l assureur : des outils pour la gestion des risques et le marketing

Statistique et analyse de données pour l assureur : des outils pour la gestion des risques et le marketing Statistique et analyse de données pour l assureur : des outils pour la gestion des risques et le marketing Gilbert Saporta Chaire de Statistique Appliquée, CNAM ActuariaCnam, 31 mai 2012 1 L approche statistique

Plus en détail

Analyse de la variance Comparaison de plusieurs moyennes

Analyse de la variance Comparaison de plusieurs moyennes Analyse de la variance Comparaison de plusieurs moyennes Biostatistique Pr. Nicolas MEYER Laboratoire de Biostatistique et Informatique Médicale Fac. de Médecine de Strasbourg Mars 2011 Plan 1 Introduction

Plus en détail

MÉTHODES DE CLASSIFICATION

MÉTHODES DE CLASSIFICATION MÉTHODES DE CLASSIFICATION Pierre-Louis GONZALEZ MÉTHODES DE CLASSIFICATION Objet Opérer des regroupements en classes homogènes d un ensemble d individus. Données Les données se présentent en général sous

Plus en détail

Introduction à Rcommander

Introduction à Rcommander Introduction à Rcommander Pauline Scherdel Septembre 2014 Table des matières 1 Introduction à Rcmdr sous R 2 2 Interagir avec R 3 3 Installer et charger le package Rcmdr sous R 3 4 Importation des données

Plus en détail

UNIVERSITÉ PARIS OUEST NANTERRE LA DÉFENSE U.F.R. SEGMI Année universitaire 2013 2014 MATHS/STATS. 1 Généralités sur les tests statistiques 2

UNIVERSITÉ PARIS OUEST NANTERRE LA DÉFENSE U.F.R. SEGMI Année universitaire 2013 2014 MATHS/STATS. 1 Généralités sur les tests statistiques 2 UNIVERSITÉ PARIS OUEST NANTERRE LA DÉFENSE U.F.R. SEGMI Année universitaire 2013 2014 Master d économie Cours de M. Desgraupes MATHS/STATS Document 4 : Les tests statistiques 1 Généralités sur les tests

Plus en détail

IUT STID, LP Bio-informatique. Traitement de données «Biopuces» Devoir du 17 novembre 2011

IUT STID, LP Bio-informatique. Traitement de données «Biopuces» Devoir du 17 novembre 2011 Université de Perpignan IUT de Carcassonne Nathalie Villa-Vialaneix Année 2011/20112 IUT STID, LP Bio-informatique Traitement de données «Biopuces» Devoir du 17 novembre 2011 Consignes Les réponses sont

Plus en détail

Analyse de données longitudinales continues avec applications

Analyse de données longitudinales continues avec applications Université de Liège Département de Mathématique 29 Octobre 2002 Analyse de données longitudinales continues avec applications David MAGIS 1 Programme 1. Introduction 2. Exemples 3. Méthodes simples 4.

Plus en détail

Master 1 de Psychologie du Travail et des Organisations : Recueil et analyse des données - Corrigés des T.D. ( 2014/2015) -

Master 1 de Psychologie du Travail et des Organisations : Recueil et analyse des données - Corrigés des T.D. ( 2014/2015) - Dominique Ferrieux - Université Paul Valéry - Montpellier III Master de Psychologie du Travail et des Organisations : Recueil et analyse des données - Corrigés des T.D. ( /) - Deuxième partie : Plans :

Plus en détail

Prof.É.D.Taillard. Classification automatique @Prof. E. Taillard 1 EIVD, Informatique logiciel, 4 e semestre

Prof.É.D.Taillard. Classification automatique @Prof. E. Taillard 1 EIVD, Informatique logiciel, 4 e semestre INFORMATIQUE ORIENTATION LOGICIELS CLASSIFICATION AUTOMATIQUE Prof.É.D.Taillard Classification automatique @Prof. E. Taillard EIVD, Informatique logiciel, 4 e semestre CLASSIFICATION AUTOMATIQUE But :

Plus en détail

Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure

Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure Analyse de données transcriptomiques : de leur visualisation à l intégration d information extérieure Marie Verbanck Laboratoire de Mathématiques Appliquées, Agrocampus OUEST Soutenance de thèse - 4 septembre

Plus en détail

Distance et classification. Cours 4: Traitement du signal et reconnaissance de forme

Distance et classification. Cours 4: Traitement du signal et reconnaissance de forme Distance et classification Cours 4: Traitement du signal et reconnaissance de forme Plan Introduction Pré-traitement Segmentation d images Morphologie mathématique Extraction de caractéristiques Classification

Plus en détail

Anaïs BARDET. Inférence d'un réseau de régulation génétique par la méthode des réseaux bayésiens

Anaïs BARDET. Inférence d'un réseau de régulation génétique par la méthode des réseaux bayésiens Master 1 Biologie Informatique Université Paris 7 - Denis Diderot Rapport de stage de Master 1 par : Anaïs BARDET Inférence d'un réseau de régulation génétique par la méthode des réseaux bayésiens Stage

Plus en détail

Identification de nouveaux membres dans des familles d'interleukines

Identification de nouveaux membres dans des familles d'interleukines Identification de nouveaux membres dans des familles d'interleukines Nicolas Beaume Jérôme Mickolajczak Gérard Ramstein Yannick Jacques 1ère partie : Définition de la problématique Les familles de gènes

Plus en détail

Traitement statistique. des petits échantillons. Application avec JMP - 3 jours (*)

Traitement statistique. des petits échantillons. Application avec JMP - 3 jours (*) Traitement statistique Application avec JMP - 3 jours (*) Référence : STA-N1-SPECHAJMP Durée : 3 jours soit 21 heures (*) : La durée proposée est une durée standard. Elle peut être adaptée selon les besoins,

Plus en détail

Analyse des données d expression de gènes issues de puces à ADN : démarche et outils statistiques

Analyse des données d expression de gènes issues de puces à ADN : démarche et outils statistiques Département de Biostatistique Unité INSERM U900 Analyse des données d expression de gènes issues de puces à ADN : démarche et outils statistiques Eléonore GRAVIER 27 Mai 2010 15ème Journées des Statisticiens

Plus en détail

Principe des études moléculaires en génétique médicale Méthodes d analyse des microlésions du génome

Principe des études moléculaires en génétique médicale Méthodes d analyse des microlésions du génome Mercredi 23 Octobre LECLERCQ Barbara L2 GM Pr Krahn 10 pages Principe des études moléculaires en génétique médicale Méthodes d analyse des microlésions du génome Plan A. Introduction B. Techniques courantes

Plus en détail

Analyse des Données. Questions de cours. Exercice n o 1. Examen terminal - Durée 3h

Analyse des Données. Questions de cours. Exercice n o 1. Examen terminal - Durée 3h I.U.T de Caen STID 2ème année Département STID Année Universitaire 2002-2003 Responsable de cours : Alain LUCAS Seule la calculatrice type collège est autorisée. Seul le cours est autorisé. On rappelera

Plus en détail

Regroupement (clustering) Bruno Pinaud (basé sur le support de Sofian Maabout)

Regroupement (clustering) Bruno Pinaud (basé sur le support de Sofian Maabout) 1 Regroupement (clustering) Bruno Pinaud (basé sur le support de Sofian Maabout) C est quoi? Regroupement (Clustering): construire une collection d objets Similaires au sein d un même groupe Dissimilaires

Plus en détail

Master 2 Informatique UAG. Classification de documents/textes

Master 2 Informatique UAG. Classification de documents/textes Data Mining Master 2 Informatique UAG Classification de documents/textes Utilisée en text mining, information retrieval : amélioration du recall et de la précision Moyen de trouver les voisins les plus

Plus en détail

Prototypes et k plus proches voisins (kppv (knn))

Prototypes et k plus proches voisins (kppv (knn)) Prototypes et k plus proches voisins (kppv (knn)) Université Grenoble 1 - Lab. Informatique Grenbole / MRIM Learning Vector Quantization (1) Algorithme en ligne (on-line) dans lequel des prototypes sont

Plus en détail

La régression logistique. Par Sonia NEJI et Anne-Hélène JIGOREL

La régression logistique. Par Sonia NEJI et Anne-Hélène JIGOREL La régression logistique Par Sonia NEJI et Anne-Hélène JIGOREL Introduction La régression logistique s applique au cas où: Y est qualitative à 2 modalités Xk qualitatives ou quantitatives Le plus souvent

Plus en détail

GOUTTE. Analyse Statistique des Données Cours 6. Master 2 EID. LUISS, Libera Università Internazionale degli Studi Sociali

GOUTTE. Analyse Statistique des Données Cours 6. Master 2 EID. LUISS, Libera Università Internazionale degli Studi Sociali LUISS, Libera Università Internazionale degli Studi Sociali Université Paris 13 Laboratoire Analyse, Géométrie et Applications UMR 7539 GOUTTE Analyse Statistique des Données Cours 6 Master 2 EID goutte@math.univ-paris13.fr

Plus en détail

Conditions d application des méthodes statistiques paramétriques :

Conditions d application des méthodes statistiques paramétriques : Conditions d application des méthodes statistiques paramétriques : applications sur ordinateur GLELE KAKAÏ R., SODJINOU E., FONTON N. Cotonou, Décembre 006 Conditions d application des méthodes statistiques

Plus en détail

Analyse factorielle des correspondances de Benzécri

Analyse factorielle des correspondances de Benzécri Analyse factorielle des correspondances de Benzécri One Pager Décembre 2013 Vol. 8 Num. 011 Copyright Laréq 2013 http://www.lareq.com Analyse Factorielle des Correspondances de Benzécri Une illustration

Plus en détail

La nouvelle planification de l échantillonnage

La nouvelle planification de l échantillonnage La nouvelle planification de l échantillonnage Pierre-Arnaud Pendoli Division Sondages Plan de la présentation Rappel sur le Recensement de la population (RP) en continu Description de la base de sondage

Plus en détail

L analyse des données statistiques

L analyse des données statistiques L analyse des données statistiques Public : Les cadres devant analyser des données quantitatives et qualitatives Objectif : Apprendre, en utilisant principalement Excel : - à traiter des données provenant

Plus en détail

Cours de Statistiques

Cours de Statistiques Cours de Statistiques Romain Raveaux 1 1 Laboratoire L3I Université de La Rochelle romain.raveaux01 at univ-lr.fr Octobre 24-11, 2008 1 / 35 Sommaire 1 Quelques Rappels 2 numériques Relations entre deux

Plus en détail

Programme des épreuves des concours externes de recrutement des personnels techniques et administratifs de recherche et de formation

Programme des épreuves des concours externes de recrutement des personnels techniques et administratifs de recherche et de formation Programme des épreuves des concours externes de recrutement des personnels E1 RECRUTEMENT DES ASSISTANTS INGENIEURS DE RECHERCHE ET DE FORMATION...2 E1.1 Gestionnaire de base de données...2 E1.2 Développeur

Plus en détail

L3 Géographie UE Méthodologie. Statistiques COURS 1. Salle 125. Intervenants : Nadège. UMR Centre de Recherches de Climatologie (CRC)

L3 Géographie UE Méthodologie. Statistiques COURS 1. Salle 125. Intervenants : Nadège. UMR Centre de Recherches de Climatologie (CRC) L3 Géographie UE Méthodologie Statistiques COURS 1 Salle 125 Intervenants : Nadège Martiny & Julien Crétat UFR Sciences Humaines (Département de Géographie) UMR Centre de Recherches de Climatologie (CRC)

Plus en détail

Hélène Desmier ab, Pascale Kuntz a & Ivan Kojadinovic a. Pauc, 44306 Nantes. {prenom.nom}@polytech.univ-nantes.fr

Hélène Desmier ab, Pascale Kuntz a & Ivan Kojadinovic a. Pauc, 44306 Nantes. {prenom.nom}@polytech.univ-nantes.fr Une classification hiérarchique de variables discrètes basée sur l information mutuelle en pré-traitement d un algorithme de sélection de variables pertinentes. Hélène Desmier ab, Pascale Kuntz a & Ivan

Plus en détail

Table des cas d entreprise et enquêtes. Avant-propos Nos choix d adaptation Visite guidée La 4 e édition Remerciements

Table des cas d entreprise et enquêtes. Avant-propos Nos choix d adaptation Visite guidée La 4 e édition Remerciements Table des matières Table des cas d entreprise et enquêtes Avant-propos Nos choix d adaptation Visite guidée La 4 e édition Remerciements xiii xiii xiv xv xv Première partie Les fondements de la comptabilité

Plus en détail

Motivation : pourquoi exploration de données? Nous nous noyons dans les données, mais manquons cruellement de connaissances

Motivation : pourquoi exploration de données? Nous nous noyons dans les données, mais manquons cruellement de connaissances 1 Introduction Définition et motivations Tâches de data mining (fouille de données, exploration de données) Techniques et algorithmes Exemples et applications 1 Motivation : pourquoi exploration de données?

Plus en détail

23. Interprétation clinique des mesures de l effet traitement

23. Interprétation clinique des mesures de l effet traitement 23. Interprétation clinique des mesures de l effet traitement 23.1. Critères de jugement binaires Plusieurs mesures (indices) sont utilisables pour quantifier l effet traitement lors de l utilisation d

Plus en détail

Données biologiques haut-débit :

Données biologiques haut-débit : Données biologiques haut-débit : problèmes méthodologiques liés à la dimension et utilisation des algorithmes génétiques Christelle REYNES EA 2415 Epidémiologie, Biostatistique et Santé Publique Université

Plus en détail

Baccalauréat ES/L Amérique du Sud 21 novembre 2013

Baccalauréat ES/L Amérique du Sud 21 novembre 2013 Baccalauréat ES/L Amérique du Sud 21 novembre 2013 A. P. M. E. P. EXERCICE 1 Commun à tous les candidats 5 points Une entreprise informatique produit et vend des clés USB. La vente de ces clés est réalisée

Plus en détail

Outils méthodologiques et astuces pour la thèse de médecine Les statistiques, comment faire?

Outils méthodologiques et astuces pour la thèse de médecine Les statistiques, comment faire? Outils méthodologiques et astuces pour la thèse de médecine Les statistiques, comment faire? Cyril Ferdynus, USM, CHU RECUEIL DE DONNEES Recueil hors ligne Epidata (http://www.epiconcept.fr/html/epidata.html)

Plus en détail

Analyse d images numériques en microscopie

Analyse d images numériques en microscopie Analyse d images numériques en microscopie Yves Usson Reconnaissance et Microscopie Quantitative, Laboratoire TIMC UMR5525 CNRS Institut d Ingénierie et d Information de Santé (IN3S), La Tronche Traitement

Plus en détail

Le Data Mining au service du Scoring ou notation statistique des emprunteurs!

Le Data Mining au service du Scoring ou notation statistique des emprunteurs! France Le Data Mining au service du Scoring ou notation statistique des emprunteurs! Comme le rappelle la CNIL dans sa délibération n 88-083 du 5 Juillet 1988 portant adoption d une recommandation relative

Plus en détail

Annexe 4 Programmes des classes préparatoires aux Grandes Ecoles

Annexe 4 Programmes des classes préparatoires aux Grandes Ecoles Annexe 4 Programmes des classes préparatoires aux Grandes Ecoles Filière : scientifique Voie : Technologie et biologie (TB) Discipline : Informatique Première et seconde années Programme d informatique

Plus en détail

Analyse en composantes principales (ACP)

Analyse en composantes principales (ACP) Analyse en composantes principales (ACP) François Husson Laboratoire de mathématiques appliquées - Agrocampus Rennes husson@agrocampus-ouest.fr 1 / 31 Quel type de données? L ACP s intéresse à des tableaux

Plus en détail

Analyse d images, vision par ordinateur. Partie 6: Segmentation d images. Segmentation? Segmentation?

Analyse d images, vision par ordinateur. Partie 6: Segmentation d images. Segmentation? Segmentation? Analyse d images, vision par ordinateur Traitement d images Segmentation : partitionner l image en ses différentes parties. Reconnaissance : étiqueter les différentes parties Partie 6: Segmentation d images

Plus en détail

MÉTHODES ET STATISTIQUES POUR LIRE UN ARTICLE

MÉTHODES ET STATISTIQUES POUR LIRE UN ARTICLE MÉTHODES ET STATISTIQUES POUR LIRE UN ARTICLE Forum HH 05.02.2013 Ghislaine Gagnon Unité HPCI Qualitatif ou quantitatif? Les 2 méthodes peuvent être utilisées séparément ou en conjonction - le qualitatif

Plus en détail

Comparaison et alignement de séquences 2

Comparaison et alignement de séquences 2 Comparaison et alignement de séquences 2 LV348 -BI Sophie Pasek sophie.pasek@upmc.fr Comment comparer une séquence contre une banque? Comparaison séquence/banque Pourquoi? : Réunir un échantillon taxonomique

Plus en détail

GOUTTE. Analyse Statistique des Données Cours 4. Master 2 EID. LUISS, Libera Università Internazionale degli Studi Sociali

GOUTTE. Analyse Statistique des Données Cours 4. Master 2 EID. LUISS, Libera Università Internazionale degli Studi Sociali LUISS, Libera Università Internazionale degli Studi Sociali Université Paris 13 Laboratoire Analyse, Géométrie et Applications UMR 7539 GOUTTE Analyse Statistique des Données Cours 4 Master 2 EID goutte@math.univ-paris13.fr

Plus en détail

Evolution d un scénario dans l expérience e-colab. EMF, Dakar avril 2009 Gilles Aldon, Eductice, INRP Dominique Raymond-Baroux, IREM Paris 7

Evolution d un scénario dans l expérience e-colab. EMF, Dakar avril 2009 Gilles Aldon, Eductice, INRP Dominique Raymond-Baroux, IREM Paris 7 Evolution d un scénario dans l expérience e-colab EMF, Dakar avril 2009 Gilles Aldon, Eductice, INRP Dominique Raymond-Baroux, IREM Paris 7 Cadre général Groupe e-colab au sein de l INRP Collaboration

Plus en détail

Atelier 5/11/2013. Structure de la chromatine et marques épigénétiques

Atelier 5/11/2013. Structure de la chromatine et marques épigénétiques Atelier 5/11/2013 Structure de la chromatine et marques épigénétiques La chromatine ADN ADN + Histones = Nucleosome ADN + Protéines + ARNs = Chromatine Niveau extrême de condensation = Chromosome métaphasique

Plus en détail

Correction de l épreuve de Statistiques et Informatique appliquées à la Psychologie

Correction de l épreuve de Statistiques et Informatique appliquées à la Psychologie Université de Bretagne Occidentale Année Universitaire 2013-2014 U.F.R. de Lettres et Sciences Humaines CS 93837-29238 BREST CEDEX 3 Section : Psychologie - Licence 3è année Enseignant responsable : F.-G.

Plus en détail

Session B2: Assurance

Session B2: Assurance 33 èmes Journées des Économistes de la Santé Français 1 er et 2 décembre 2011 Session B2: Assurance Auteurs: Sophie Guthmuller et Jérôme Wittwer, Université Paris-Dauphine Référé: Aurore Pélissier, CERDI,

Plus en détail

PROPOSITION D UNE APPROCHE DE SEGMENTATION D IMAGES HYPERSPECTRALES

PROPOSITION D UNE APPROCHE DE SEGMENTATION D IMAGES HYPERSPECTRALES PROPOSITION D UNE APPROCHE DE SEGMENTATION D IMAGES HYPERSPECTRALES Nathalie GORRETTA MONTEIRO 1 1 UMR Information et Technologies pour les Agro-Procédés, Cemagref Montpellier, France Présentée le 25 Février

Plus en détail

Analyse multidimensionnelle de données longitudinales

Analyse multidimensionnelle de données longitudinales Analyse multidimensionnelle de données longitudinales Ndèye Niang Conservatoire National des Arts et Métiers Plan Introduction Terminologie-Notations Méthodes directes Coefficient d association vectorielle

Plus en détail

ESSEC. Cours «Management bancaire» Séance 3 Le risque de crédit Le scoring

ESSEC. Cours «Management bancaire» Séance 3 Le risque de crédit Le scoring ESSEC Cours «Management bancaire» Séance 3 Le risque de crédit Le scoring Les méthodes d évaluation du risque de crédit pour les PME et les ménages Caractéristiques Comme les montants des crédits et des

Plus en détail

Logiciel QDA Miner. Deuxième partie Gestion du livre des codes et codage manuel

Logiciel QDA Miner. Deuxième partie Gestion du livre des codes et codage manuel PLAN DE COURS «ANALYSE DE DONNEES TEXTUELLES» Trois approches pour l analyse de textes Analyse qualitative Analyse quantitative Fouille de textes Introduction au logiciel QDA Miner Introduction et gestion

Plus en détail

Scénario: Exploration, classification des encours boursiers parisiens

Scénario: Exploration, classification des encours boursiers parisiens Scénario: Exploration, classification des encours boursiers parisiens Résumé Scénario d analyse d un jeu de données : l ensemble des séries des encours boursier à Paris. Description, lissage et classification

Plus en détail

Graphes, réseaux et internet

Graphes, réseaux et internet Graphes, réseaux et internet Clémence Magnien clemence.magnien@lip6.fr LIP6 CNRS et Université Pierre et Marie Curie (UPMC Paris 6) avec Matthieu Latapy, Frédéric Ouédraogo, Guillaume Valadon, Assia Hamzaoui,...

Plus en détail

Data Mining : la classification non supervisée

Data Mining : la classification non supervisée Data Mining : la classification non supervisée Clustering : une affaire de distance. Etude préliminaire. Valeurs discrètes. Soient les deux individus suivants correspondant à des séquences ADN : X = AGGGTGGC

Plus en détail

MABioVis. Bio-informatique et la

MABioVis. Bio-informatique et la MABioVis Modèles et Algorithmes pour la Bio-informatique et la Visualisation Visite ENS Cachan 5 janvier 2011 MABioVis G GUY MELANÇON (PR UFR Maths Info / EPI GRAVITE) (là, maintenant) - MABioVis DAVID

Plus en détail

Chapitre VI Échantillonages et simulations

Chapitre VI Échantillonages et simulations Chapitre VI Commentaires : Récursivement, les commentaires ne sont pas à l attention des élèves.. Fluctuation d échantillonnage Définition : En statistiques, un échantillon de taille n est la liste des

Plus en détail

La Grille, moyen fondamental de l analyse

La Grille, moyen fondamental de l analyse Fiche méthodologie #1 La Grille, moyen fondamental de l analyse Cette rubrique présente des notes et documents publiés par Philippe Latour, enseignant au Master Géomarketing et stratégies territoriales

Plus en détail

I - Introduction à La psychologie Expérimentale

I - Introduction à La psychologie Expérimentale LA METHODE EXPERIMENTALE I - Introduction à La psychologie Expérimentale I.1. Introduction I.2. Critiques concernant l utilisation de la méthode expérimentale en psychologie I.2.A. Critiques morales I.2.A.

Plus en détail

TABLE DES MATIÈRES. Bruxelles, De Boeck, 2011, 736 p.

TABLE DES MATIÈRES. Bruxelles, De Boeck, 2011, 736 p. STATISTIQUE THÉORIQUE ET APPLIQUÉE Tome 2 Inférence statistique à une et à deux dimensions Pierre Dagnelie TABLE DES MATIÈRES Bruxelles, De Boeck, 2011, 736 p. ISBN 978-2-8041-6336-5 De Boeck Services,

Plus en détail

Choix de modèle en régression linéaire

Choix de modèle en régression linéaire Master pro Fouille de données Philippe Besse 1 Objectif Choix de modèle en régression linéaire La construction d un score d appétence sur les données bancaires correspond au choix et à l estimation d un

Plus en détail