La synthèse des protéines transcription code génétique traduction

Dimension: px
Commencer à balayer dès la page:

Download "La synthèse des protéines transcription code génétique traduction"


1 CEC André-Chavanne BIO 3 OS La synthèse des protéines transcription code génétique traduction I. La «Transcription» : de l ADN à l ARNm. L'adresse suivante permet d accéder à une ANIMATION sur la TRANSCRIPTION. A.Ouvrir le lien : Double cliquer sur biologie / cliquer sur biologie cellulaire / aller à la page 2 / ouvrir le lien sur La transcription de l'adn en ARN messager / cliquer sur légendes Regarder l'animation une 1 ère fois, puis complétez les phrases en la regardant une 2 nd fois ( n'hésitez pas à utiliser la fonction «pause» et «retour en arrière» ) a) La transcription de l'adn en ARNm se réalise dans b) Un promoteur c'est c) Un signal de terminaison c'est d) l'arnpolymérase, se lie à l'adn au niveau de e) Les 3 fonctions de l'arnpolymérase sont : 1) ) ) page 1/6 -

2 f) L'ARNm ( = ARN messager) c'est g) Le sens de lecture du brin transcrit d'adn est de.. vers.... h) L'ARNm est synthétisé dans le sens..... vers.... I. Ouvrir le lien Cliquez sur «ANIMATION COMPLETE» complétez les phrases et répondez aux questions a) On sait que le b) L'information doit c) Il faut pour cela d) Le génotype c'est e) Le phénotype c'est f) A l aide de l animation représentez le fragment de gène proposé (écrivez la séquence à l aide des lettres ATCG). g) Pourquoi la transcription est-elle nécessaire? page 2/6 -

3 CEC André-Chavanne BIO 3 OS h) À l aide de l animation, représentez le brin transcrit et la séquence d ARNm, résultat de la transcription. i) Les nucléotides de l ADN et de l ARNm présentent deux différences importantes. A l aide de l animation dessinez le sucre ( et donnez son nom ) de l'adn et celui de L'ARN, puis les lettres représentant les bases identiques et différentes. ADN ARN - Sucres - Bases identiques : - Bases différentes : j) Quel est l intérêt du brin transcrit? k) Pour résumer, et en utilisant l animation, quelle est l intérêt de la transcription et que deviendra l ARNm? - page 3/6 -

4 II. Le Code génétique : Une correspondance entre un codon et un acide animé A.Lisez le texte ci dessous, puis soulignez le plus important L'information génétique est conservée par la cellule au niveau de son ADN. Cette information est transcrite en ARNm, puis traduite en protéines. Ce sont ces protéines fonctionnelles qui sont l'expression de l'information génétique. Une étape clé dans l'expression de l'information génétique est donc la traduction de l'information sous forme nucléotidique en une forme protéique. Cette traduction est réalisée par groupe de 3 nucléotides appelé «codon» : 3 nucléotides codent pour un des 20 acides aminés naturels. Cette correspondance «codon - acide aminé» est le «code génétique». B.Ouvrir le lien Cette adresse permet d accéder à un DOCUMENT sur le CODE GENETIQUE Complétez les phrases et répondez aux questions a) Les trois propriétés du code génétique sont : 1) ) ) b) Quel est l intérêt des trois codons «non sens»? c) A l aide du lien permettant d accéder à l animation vous pouvez vérifiez deux de ces propriétés : lesquelles? - page 4/6 -

5 CEC André-Chavanne BIO 3 OS III. La «Traduction» : de l ARNm à la protéine. A.Ouvrir le lien : Double cliquer sur biologie / cliquer sur biologie cellulaire / aller à la page 2 / ouvrir le lien sur La traduction de l'arn messager en protéines. / cliquer sur légendes Regarder l'animation une 1 ère fois, puis complétez les phrases en la regardant une 2 nd fois ( n'hésitez pas à utiliser la fonction «pause» et «retour en arrière» ) La traduction de l'arnm en protéine se réalise dans ) Phase d'initiation : Faites un schéma légendé de cette étape en appuyant sur pause. ARNm CAAGCCAUGUGCUACUACAUCCACCAAGUACCCCCUUGGUAGUUUUUA 2) Phase d'élongation : Expliquez clairement étape par étape ce qui se passe au cours de cette phase. - page 5/6 -

6 Phase de terminaison Faites un schéma légendé de cette étape en appuyant sur pause. ARNm CAAGCCAUGUGCUACUACAUCCACCAAGUACCCCCUUGGUAGUUUUUA B.Ouvrir le lien : a) Démarrez la synthèse des protéines (traduction). Recopiez la séquence de l ARNm proposée, prévoyez la séquence d acides aminés et vérifiez à l aide de l animation. b) Recopiez la séquence d ARNm, puis schématisez et légendez les trois phases de la seconde étape? - page 6/6 -

Chapitre 2. La synthèse protéique : la relation entre le génotype et le phénotype.

Chapitre 2. La synthèse protéique : la relation entre le génotype et le phénotype. Chapitre 2. La synthèse protéique : la relation entre le génotype et le phénotype. Les maladies génétiques comme la drépanocytose ou l'albinisme sont liées à des modifications du génotype des individus

Plus en détail


TRANSCRIPTION TRADUCTION 4 TRANSCRIPTION TRADUCTION Objectifs : définir transcription et traduction et donner leur localisation cellulaire sur un schéma, identifier les acteurs de la transcription (ARNpol, brin transcrit, ARNm)

Plus en détail


LA SYNTHÈSE DES PROTÉINES LA SYNTHÈSE DES PROTÉINES La transcription Information : dans le noyau (sous forme d'adn) Synthèse des protéines : dans le cytoplasme (au niveau des ribosomes du reticulum endoplasmique) L'ADN ne sort

Plus en détail


CHAPITRE 3 LA SYNTHESE DES PROTEINES CHAITRE 3 LA SYNTHESE DES ROTEINES On sait qu un gène détient dans sa séquence nucléotidique, l information permettant la synthèse d un polypeptide. Ce dernier caractérisé par sa séquence d acides aminés

Plus en détail

Tutoriel pour les enseignants de lycée. Rappel du contenu des programmes au lycée en classe de seconde

Tutoriel pour les enseignants de lycée. Rappel du contenu des programmes au lycée en classe de seconde Tutoriel pour les enseignants de lycée Ce document sert à l enseignant pour préparer différentes séquences pédagogiques afin d aborder : les questions de la génétique, des maladies génétiques, et les métiers

Plus en détail

L'ordre et la nature des acides aminés (ou séquence) d un polypeptide dépend de la séquence des nucléotides de l ADN du gène qui le code.

L'ordre et la nature des acides aminés (ou séquence) d un polypeptide dépend de la séquence des nucléotides de l ADN du gène qui le code. L'ordre et la nature des acides aminés (ou séquence) d un polypeptide dépend de la séquence des nucléotides de l ADN du gène qui le code. Une mutation, peut entraîner une modification de la séquence des

Plus en détail

Baccalauréat général Sciences de la vie et de la Terre

Baccalauréat général Sciences de la vie et de la Terre Baccalauréat général Sciences de la vie et de la Terre Épreuve obligatoire série S Partie 1 (5 points) Thème 1-: Expression, stabilité, variation du patrimoine génétique. Sujet : On cherche à montrer,

Plus en détail

Eléments primordiaux de biologie moléculaire

Eléments primordiaux de biologie moléculaire Eléments primordiaux de biologie moléculaire Pourquoi s intéresser au matériel génétique? Base de l information génétique Tissu Cellule Noyau Organisme entier Lieu où est localisé l ADN Mol d ADN qui est

Plus en détail

Le gène, de l'adn aux protéines

Le gène, de l'adn aux protéines 13/10/2011 - Par Claude Sauter Le gène, de l'adn aux protéines La vie d'un gène, de sa duplication à la fabrication d'une protéine pour laquelle il code, est une succession d'étapes cruciales. Ce dossier

Plus en détail

Biologie Moléculaire et Organismes Modèles

Biologie Moléculaire et Organismes Modèles Biologie Moléculaire et Organismes Modèles Sami Khuri Department of Computer Science San José State University Usine de Protéines Les protéines sont responsables de la plupart des fonctions

Plus en détail

Cahier de texte de la classe 1 ère 3 - SVT

Cahier de texte de la classe 1 ère 3 - SVT Cahier de texte de la classe 1 ère 3 - SVT DATE SEQUENCE jeudi 8 : revoir la fiche méthodologique «utiliser le microscope optique» (disponible sur le site du lycée) Jeudi 8 1 er contact avec les élèves.

Plus en détail

Cahier de texte de la classe 1 ère 4 - SVT

Cahier de texte de la classe 1 ère 4 - SVT Cahier de texte de la classe 1 ère 4 - SVT DATE SEQUENCE lundi 12 : revoir la fiche méthodologique «utiliser le microscope optique» (disponible sur le site du lycée) Lundi 12 1 er contact avec les élèves.

Plus en détail

Acides Nucléiques. ADN et ARN Unités de base : les nucléotides donc les nucléotides = monomères ADN et ARN = polynucléotides = polymères

Acides Nucléiques. ADN et ARN Unités de base : les nucléotides donc les nucléotides = monomères ADN et ARN = polynucléotides = polymères Acides Nucléiques ADN et ARN Unités de base : les nucléotides donc les nucléotides = monomères ADN et ARN = polynucléotides = polymères Structure d un nucléotide Tous composés d une base azotée, d un sucre

Plus en détail

De la biologie molécualire à la génomique

De la biologie molécualire à la génomique De la biologie molécualire à la génomique Pierre Neuvial École Nationale de la Statistique et de l Administration Économique Méthodes statistiques pour la biologie Plan du cours 1 Introduction à la biologie

Plus en détail

LA TRANSCRIPTION. Introduction. I. Modalité générale de la transcription. II. Transcription chez les Procaryotes

LA TRANSCRIPTION. Introduction. I. Modalité générale de la transcription. II. Transcription chez les Procaryotes LA TRANSCRIPTION Introduction I. Modalité générale de la transcription II. Transcription chez les Procaryotes 1. L'ARN polymérase 2. Etapes de la transcription a. Initiation b. Elongation c. Terminaison

Plus en détail

Université du Québec à Montréal

Université du Québec à Montréal RECUEIL D EXERCICES DE BICHIMIE 6. Les acides nucléiques 6.2. Réplication, transcription et traduction P P P CH 2 H N H N N NH NH 2 Université du Québec à Montréal 6.2. Réplication, transcription et traduction

Plus en détail

Quelques termes-clef de biologie moléculaire et leur définition

Quelques termes-clef de biologie moléculaire et leur définition Acide aminé (AA) Quelques termes-clef de biologie moléculaire et leur définition Isabelle Quinkal INRIA Rhône-Alpes Septembre 2003 Petite molécule dont l enchaînement compose les protéines - on dit qu

Plus en détail

III - Régulation du métabolisme A) X B) Transcription

III - Régulation du métabolisme A) X B) Transcription BPV : Physiologie Bactérienne UE: 5 Semaine : n 9 (du 02/11/2015 au 06/11/2015 Date : 03/11/2015 Heure : de 9h-10h Professeur : Pr. Romond Binôme : n 54 Correcteur : 53 Aucune remarque particulière du

Plus en détail

Du génotype au phénotype, relation avec l environnement

Du génotype au phénotype, relation avec l environnement Du génotype au phénotype, relation avec l environnement Pré-requis (troisième et seconde) : Chaque individu présente les caractères de l'espèce avec des variations qui lui sont propres. C'est le résultat

Plus en détail

Chapitre 3 : L expression de l information génétique. Activité 1 : Les deux étapes de l expression de l information génétique

Chapitre 3 : L expression de l information génétique. Activité 1 : Les deux étapes de l expression de l information génétique Connaissances L'ADN contient des unités d'information appelées gènes. Le génome est l ensemble du matériel génétique d un organisme. Chez les eucaryotes, la transcription a lieu dans le noyau, la traduction

Plus en détail



Plus en détail


DU GÈNE À LA PROTÉINE 1 DU GÈNE À LA PROTÉINE 1. Le génome et la notion de gène: Génome: ensemble du matériel génétique d'un individu. = patrimoine héréditaire Gène: région d'un brin d'adn dont la séquence code l'information

Plus en détail

Expression des gènes Comparatif entre procaryotes et eucaryotes

Expression des gènes Comparatif entre procaryotes et eucaryotes Comparaison procaryotes/ 2TSbc Expression des gènes Comparatif entre procaryotes et eucaryotes La majeure partie des connaissances de biologie moléculaire a d'abord débuté par l'étude des phénomènes chez

Plus en détail

BIO6: Bioinformatique appliquée Correction du TD3

BIO6: Bioinformatique appliquée Correction du TD3 BIO6: Bioinformatique appliquée Correction du TD3 Exercice 1 : programmation dynamique voir le site web indiqué dans le TD pour corriger l'exercice Exercice 2 : similarité de séquence et distance évolutive

Plus en détail

La division cellulaire Chapitre 5 Anatomie

La division cellulaire Chapitre 5 Anatomie La division cellulaire Chapitre 5 Anatomie La division cellulaire est le mode de multiplication de toute cellule. Elle lui permet de se diviser en plusieurs cellules-filles (deux le plus souvent). C'est

Plus en détail

Procaryotes RÉGULATION DE L EXPRESSION GÉNÉTIQUE. 1. L opéron lactose

Procaryotes RÉGULATION DE L EXPRESSION GÉNÉTIQUE. 1. L opéron lactose Procaryotes RÉGULATION DE L EXPRESSION GÉNÉTIQUE 1. L opéron lactose STRUCTURE DU LACTOSE liaison β-galactosidique β-galactosidase galactose lactose glucose CROISSANCE BACTÉRIENNE EN PRÉSENCE DE GLUCOSE

Plus en détail

Comment la Souris fait de la souris avec des graines?

Comment la Souris fait de la souris avec des graines? Comment la Souris fait de la souris avec des graines? d après «10 clés pour la Biologie» de J. Tavlitzki «[ ] La Souris, l Ecureuil, le Lapin mangent des graines. La Souris fait de la souris, l Ecureuil

Plus en détail

La synthèse des protéines

La synthèse des protéines La synthèse des protéines exemple vers théorie Rappel : le phénotype correspond à l'ensemble des caractéristiques d'un individu. Ces caractéristiques peuvent s'observer à différentes échelles. Un caractère

Plus en détail

GM- Support de l'information génétique ; structure et fonction du génome. Support de l'information génétique ; structure et fonction du génome

GM- Support de l'information génétique ; structure et fonction du génome. Support de l'information génétique ; structure et fonction du génome Mercredi 9 octobre ABECASSIS Anna L2 GM Pr Beroud 16 pages Support de l'information génétique ; structure et fonction du génome Plan A. Des gènes aux protéines I. Structure de l'adn II. Structure des gènes

Plus en détail

Chapitre 14: La génétique

Chapitre 14: La génétique Chapitre 14: La génétique A) Les gènes et les protéines, ça te gêne? 1) a) Quel est l élément de base des vivants? Les cellules b) Qu a-t-elle en son centre? Un noyau c) Qu y retrouve-t-on sous forme de

Plus en détail

Collège Notre Dame de Jamhour. THEME 1A : Expression, stabilité et variation du patrimoine génétique

Collège Notre Dame de Jamhour. THEME 1A : Expression, stabilité et variation du patrimoine génétique Collège Notre Dame de Jamhour Classe : 1 ère S THEME 1A : Expression, stabilité et variation du patrimoine génétique Chapitre 3 : L expression du patrimoine génétique TD- 5 : La protéosynthèse, un processus

Plus en détail

Chapitre 2 : Organisation de la cellule

Chapitre 2 : Organisation de la cellule Partie 1 : notions de biologie cellulaire DAEU- Cours Sciences de la Nature & de la Vie- Marc Cantaloube Chapitre 2 : Organisation de la cellule La cellule est l unité de base des êtres vivants. Il existe

Plus en détail

III/De la structure à la fonction.. Le B.A.-ba Principes généraux la réplication/la transcription/la traduction

III/De la structure à la fonction.. Le B.A.-ba Principes généraux la réplication/la transcription/la traduction III/De la structure à la fonction.. Le B.A.-ba Principes généraux la réplication/la transcription/la traduction Attention! Seuls les concepts généraux seront explicités en cours Mais vous pouvez approfondir

Plus en détail


CHAPITRE 3 : L'EXPRESSION DU PATRIMOINE GÉNÉTIQUE CHAPITRE 3 : L'EXPRESSION DU PATRIMOINE GÉNÉTIQUE LES PROTÉINES SONT LE RÉSULTAT DE L'EXPRESSION DES GÈNES On observe de nombreuses différences entre ces deux gènes; 1061 nucléotides pour l'allèle du groupe

Plus en détail

Chapitre 1 La révolution des sciences de la vie par la génétique

Chapitre 1 La révolution des sciences de la vie par la génétique Chapitre 1 La révolution des sciences de la vie par la génétique Variation génétique de la couleur des grains de maïs. Chaque grain représente un individu de constitution génétique distincte. La sélection

Plus en détail


CORRECTION DES EXERCICES DE GENETIQUE SYNTHESE PROTEIQUE : P 136-137 CORRECTION DES EXERCICES DE GENETIQUE SYNTHESE PROTEIQUE : P 136-137 Exercice 1 p 171 : définir en une phrase les mots suivants Polypeptide : chaine de plusieurs acides aminés. Séquence protéinique : séquence

Plus en détail

LES BASES MOLÉCULAIRES DE L HÉRÉDITÉ Archibald Garrod Reginald Punnett and William Bateson 1907

LES BASES MOLÉCULAIRES DE L HÉRÉDITÉ Archibald Garrod Reginald Punnett and William Bateson 1907 ADN : matériel génétique LES BASES MOLÉCULAIRES DE L HÉRÉDITÉ 1909 Archibald Garrod Reginald Punnett and William Bateson 1907 Du gène à la protéine Les protéines représentent le lien entre le génotype

Plus en détail

TP6 : La synthèse de protéine

TP6 : La synthèse de protéine TP6 : La synthèse de protéine On cherche à comprendre comment sont synthétisées les protéines. COMPARAISON DES CAUSES DE LA MALADIE XERODERMA PIGMENTOSUM CHEZ 3 INDIVIDUS ATTEINTS Différence dans la séquence

Plus en détail

TD Révision BIO57. Connaissance et Technique du gène

TD Révision BIO57. Connaissance et Technique du gène TD Révision BIO57 Connaissance et Technique du gène Novembre 2007 Cécile BAUDOT INSERM 910 «Génétique Médicale et Génomique Fonctionnelle» Maladies Neuromusculaires Le

Plus en détail

Tp6 Du gène à la protéine (partie 2) 1 TP 6 Du gène à la protéine (partie 2). I - Niveau : première S La synthèse des protéines

Tp6 Du gène à la protéine (partie 2) 1 TP 6 Du gène à la protéine (partie 2). I - Niveau : première S La synthèse des protéines Tp6 Du gène à la protéine (partie 2) I - Niveau : première S La synthèse des protéines II- Extrait de programme : La traduction permet la synthèse cytoplasmique de chaînes polypeptidiques. La séquence

Plus en détail

Série : STL Spécialité biotechnologies SESSION 2014 BACCALAURÉAT TECHNOLOGIQUE

Série : STL Spécialité biotechnologies SESSION 2014 BACCALAURÉAT TECHNOLOGIQUE BACCALAURÉAT TECHNLGIQUE Série : STL Spécialité biotechnologies SESSIN 2014 CBSV : sous épreuve coefficient 4 Biotechnologies : sous épreuve coefficient 4 Durée totale de l épreuve: 4 heures Les sujets

Plus en détail

! recenser, extraire, saisir l informa3on u3le d un document !!! Que code un gène? Comment? Activité 1 :

! recenser, extraire, saisir l informa3on u3le d un document !!! Que code un gène? Comment? Activité 1 : Que code un gène? Comment? C2 recenser, extraire, saisir l informa3on u3le d un document C12 C26 C27 savoir exploiter un logiciel déduire interpréter Activité 1 : Le phénotype de la maladie héréditaire

Plus en détail

Corrigé série N 2. Exercice 1 QCS (V/F)

Corrigé série N 2. Exercice 1 QCS (V/F) Exercice 1 Corrigé série N 2 QCS (V/F) V1-Les acides nucléiques sont des polymères de nucléotides F2-Un nucléotide est un enchaînement base glucide F3-Les bases azotées sont toutes complémentaires F4-Les

Plus en détail


CHAPITRE III: Le Clonage BIOLOGIE MOLECULAIRE CHAPITRE III: Le Clonage I) Définition: Cloner un fragment d'adn consiste à: isoler physiquement ce fragment. en augmenter le nombre de copie (cf: amplification) II) Principe: Le clonage

Plus en détail

La Bioinformatique fonctionnelle Retrouver les Gènes

La Bioinformatique fonctionnelle Retrouver les Gènes Biologie moléculaire-2016 1 La Bioinformatique fonctionnelle Retrouver les Gènes Le séquençage est devenu chose tellement courante, que dans les dernières années nous avons obtenu les séquences complètes

Plus en détail

Fiche technique : utilisation d Anagène (logiciel d étude des données moléculaires).

Fiche technique : utilisation d Anagène (logiciel d étude des données moléculaires). Fiche technique : utilisation d Anagène (logiciel d étude des données moléculaires). Objectifs de la fiche : 1. Ouvrir des séquences (ADN ou protéine). 2. Changer de règle de numérotation & faire apparaître

Plus en détail

L'ADN peut être copié au travers des générations cellulaires successives de manière fidèle, c'est la réplication de l'adn.

L'ADN peut être copié au travers des générations cellulaires successives de manière fidèle, c'est la réplication de l'adn. 24/09/2014 REBOUL Nicolas L2 CR : Hamza BERGUIGUA Génétique Médicale Dr Martin KRAHN 8 pages Introduction à la Génétique Médicale : Les champs de la Génétique Médicale, La place de la Génétique Médicale

Plus en détail

THÈME 3 : DU GÉNOTYPE AU PHÉNOTYPE. CHAPITRE 1 : la relation entre ADN et protéines

THÈME 3 : DU GÉNOTYPE AU PHÉNOTYPE. CHAPITRE 1 : la relation entre ADN et protéines THÈME 3 : DU GÉNOTYPE AU PHÉNOTYPE CHAPITRE 1 : la relation entre ADN et protéines Les caractères d un individu dépendent de plusieurs facteurs : certains dépendent des caractères présents dans la famille

Plus en détail

Chapitre 3 : La cellule bactérienne, génétique et synthèse protéique

Chapitre 3 : La cellule bactérienne, génétique et synthèse protéique Chapitre 3 : La cellule bactérienne, génétique et synthèse protéique Attention, ce cours suppose la connaissance de notions de base en génétique, notamment les notions de transcription, traduction ainsi

Plus en détail

Technologie de l ADN recombinant. Complément de cours sur: «Les Méthodes d Etude de la Cellule»

Technologie de l ADN recombinant. Complément de cours sur: «Les Méthodes d Etude de la Cellule» Technologie de l ADN recombinant Complément de cours sur: «Les Méthodes d Etude de la Cellule» 1 Les techniques de l ADN Recombinant But: isoler des fragments d ADN de génomes complexes et les recombiner

Plus en détail

Brin transcrit : chaine de l ADN qui, par complémentarité des nucléotides, sert de modèle pour la synthèse de l ARN messager

Brin transcrit : chaine de l ADN qui, par complémentarité des nucléotides, sert de modèle pour la synthèse de l ARN messager Fin du cours chap 5 La transcription : de l ADN à l ARN : Par définition, le brin transcrit est le brin d ADN complémentaire de l ARN : c est le brin qui sert à la synthèse de l ARN, donc ici le brin2.

Plus en détail

L3-BH01 Cours n 10 Modifications post-transcriptionnelles

L3-BH01 Cours n 10 Modifications post-transcriptionnelles L3-BH01 Cours n 10 Modifications post-transcriptionnelles Ce cours est présent sur le web à l adresse suivante : Plan (cours n 10 & 11) Introduction

Plus en détail

Séance 5. Les Acides Nucléiques. 3. Conservation de l information génétique: Réplication semi-conservative de l ADN

Séance 5. Les Acides Nucléiques. 3. Conservation de l information génétique: Réplication semi-conservative de l ADN UNIVERSITE MOHAMMED V-AGDAL FACULTE DES SCIENCES Les Acides Nucléiques DEPARTEMENT DE BIOLOGIE Filière Sciences de la Vie (SVI) Module de Biochimie (M 11) Élément : Biochimie structurale - Semestre 3-2005-2006

Plus en détail

PHENOTYPE - GENOTYPE Le phénotype d un individu : - peut être observé uniquement à l échelle moléculaire et à l échelle cellulaire PROTEINES ENZYMES

PHENOTYPE - GENOTYPE Le phénotype d un individu : - peut être observé uniquement à l échelle moléculaire et à l échelle cellulaire PROTEINES ENZYMES REVISIONS DE 1 S. Vous devez indiquer pour chaque proposition si celle-ci est vraie (V) ou fausse (F) en cochant la case correspondante ; une abstention ou une réponse trop peu lisible seront considérées

Plus en détail

Stage de Pré-Rentrée de Biochimie. Chapitre 3 : Biologie Moléculaire. Correction des exercices

Stage de Pré-Rentrée de Biochimie. Chapitre 3 : Biologie Moléculaire. Correction des exercices Stage de Pré-Rentrée de Biochimie Chapitre 3 : Biologie Moléculaire Correction des exercices 3 septembre 2013 1 Question 1 Parmi les séquences suivantes, laquelle s hybride parfaitement avec ce fragment?

Plus en détail

Thème 1 : La Terre dans l Univers, la Vie et l évolution du vivant. Partie 1 : Expression, stabilité et variation du patrimoine génétique

Thème 1 : La Terre dans l Univers, la Vie et l évolution du vivant. Partie 1 : Expression, stabilité et variation du patrimoine génétique TP 6 : Du gène à la protéine (2) Thème 1 : La Terre dans l Univers, la Vie et l évolution du vivant Partie 1 : Expression, stabilité et variation du patrimoine génétique Chapitre 3 : L expression du patrimoine

Plus en détail

Cours 3 : Bases de la génétique, transcription, synthèse des protéines, structures des protéines, enzymes

Cours 3 : Bases de la génétique, transcription, synthèse des protéines, structures des protéines, enzymes Cours 3 : Bases de la génétique, transcription, synthèse des protéines, structures des protéines, enzymes Partie 1 : Bases de la génétique, transcription, synthèse des protéines I) Les gènes contrôlent

Plus en détail

Pipetez, chargez et observez!

Pipetez, chargez et observez! Ce document propose une activité préparatoire et une activité de prolongement à l activité Pipetez, chargez et observez! proposée aux élèves du 3 e, 4 e et 5 e secondaire en complément de la visite de

Plus en détail

Biologie Moléculaire et Organismes Modèles

Biologie Moléculaire et Organismes Modèles Biologie Moléculaire et Organismes Modèles Sami Khuri Department of Computer Science San José State University Plan du Cours Biologie Moléculaire et Organismes Modèles Qu est-ce que la

Plus en détail

L épissage alternatif : un gène, combien de protéines?

L épissage alternatif : un gène, combien de protéines? L épissage alternatif : un gène, combien de protéines? Avant la publication de la séquence complète de l ADN du génome humain, au début des années 2000, on estimait le nombre de gènes à environ 300.000.

Plus en détail



Plus en détail

TP 4: de l ADN à l ARNm les étapes de la transcription

TP 4: de l ADN à l ARNm les étapes de la transcription TP 4: de l ADN à l ARNm les étapes de la transcription Lycée E. Delacroix 1 ère S Programme 2011 Activité 1: la localisation de la synthèse des protéines Objectif de l autoradiographie Marquer l emplacement

Plus en détail

Cours de Biologie moléculaire de Licence professionnelle 2011

Cours de Biologie moléculaire de Licence professionnelle 2011 Cours de Biologie moléculaire de Licence professionnelle 2011 Sommaire 1. Introduction 2.1. La structure de l ADN 2.2. La structure de l ARN 2.3. Du gène à la protéine 2.3.1. La réplication 2.3.2. La transcription

Plus en détail

Recherche de parenté entre les vertébrés

Recherche de parenté entre les vertébrés 1 CHAPITRE A Recherche de parenté entre les vertébrés 2 Chapitre A : Recherche de parentés entre les êtres vivants Tous les êtres vivants présentent des structures cellulaires et un fonctionnement commun

Plus en détail

Partie 2: Expression génétique. Traduction

Partie 2: Expression génétique. Traduction Faculté des Sciences - Rabat Laboratoire de Microbiologie et Biologie Moléculaire -------------------------------------- Université Mohamed V - Agdal Faculté des Sciences B.P. 1014 - Rabat - MAROC Filière

Plus en détail

TD 3 : LA GÉNÉTIQUE. L Homme possède 46 chromosomes, soit 23 paires de chromosomes.

TD 3 : LA GÉNÉTIQUE. L Homme possède 46 chromosomes, soit 23 paires de chromosomes. TD 3 : LA GÉNÉTIQUE ADN : acide désoxyribonucléique. ARN : acide ribonucléique.! L ADN possède deux brins, l ARN un seul. Ils sont composés de nucléotides eux-même composés d une base azoté, d un sucre,

Plus en détail


BIOLOGIE MOLECULAIRE ET EXERCICES SCEANCE 4 BIOLOGIE MOLECULAIRE ET EXERCICES LA REPLICATION Nous avons vu lors de la séance précédente de biomol les caractéristiques de l ADN et des différents ARN. Nous allons aujourd hui voir la réplication.

Plus en détail

Méthodes et techniques de la biologie du développement

Méthodes et techniques de la biologie du développement Méthodes et techniques de la biologie du développement 1. Etude de l expression des gènes : Détecter les transcrits et les protéines au cours de l ontogenèse l outil anticorps 1.1. La RT-PCR La réaction

Plus en détail

5-1. Introduction 5-2. L appareil de traduction et son fonctionnement - Les ribosomes - Les ARNt - Les ARNt Synthétases

5-1. Introduction 5-2. L appareil de traduction et son fonctionnement - Les ribosomes - Les ARNt - Les ARNt Synthétases 5 - la traduction 5-1. Introduction 5-2. L appareil de traduction et son fonctionnement - Les ribosomes - Les ARNt - Les ARNt Synthétases 5-3. Les étapes de la synthèse protéiques -Initiation - Élongation

Plus en détail

Information Génétique et hérédité 1- Réplication, mitose, méiose

Information Génétique et hérédité 1- Réplication, mitose, méiose Information Génétique et hérédité 1- Réplication, mitose, méiose REPLICATION DE L ADN et CYCLE CELLULAIRE quantité d'adn 4C 2C G 1 S G 2 M G 1 5 12 15 16 duplication de l'adn mitose temps heures CYCLE

Plus en détail

- la transcription permet de copier l'adn en ARNm au niveau du noyau. Elle est réalisée grâce à l ARN polymérase.

- la transcription permet de copier l'adn en ARNm au niveau du noyau. Elle est réalisée grâce à l ARN polymérase. La synthèse des protéines comprend deux étapes: - la transcription permet de copier l'adn en ARNm au niveau du noyau. Elle est réalisée grâce à l ARN polymérase. -la traduction correspond au décodage de

Plus en détail



Plus en détail


LES ACIDES NUCLEIQUES LES ACIDES NUCLEIQUES INTRODUCTION Les acides nucléiques sont des macromolécules présentes dans toutes les cellules vivantes et également chez les virus. Ils constituent le support de l'information génétique

Plus en détail

AVL Liban 2011 Biologie Moléculaire et Organismes Modèles

AVL Liban 2011 Biologie Moléculaire et Organismes Modèles AVL Liban 2011 Biologie Moléculaire et Organismes Modèles Sami Khuri Department of omputer Science San José State University San José, alifornia, USA Plan

Plus en détail

Toutes les caractéristiques d'un organisme vivant sont déterminées par le type de protéines que fabrique cet être vivant. Ce qui différencie un être

Toutes les caractéristiques d'un organisme vivant sont déterminées par le type de protéines que fabrique cet être vivant. Ce qui différencie un être 2 L ADN ET LES PROTÉINES : GÉNÉRALITÉS Toutes les caractéristiques d'un organisme vivant sont déterminées par le type de protéines que fabrique cet être vivant. Ce qui différencie un être vivant d'un autre,

Plus en détail

Filière SVI - S6 Module de Génétique et Biologie Moléculaire M21 Elément 2: Biologie Moléculaire l -Pr. Abdelkarim FILALI-MALTOUF

Filière SVI - S6 Module de Génétique et Biologie Moléculaire M21 Elément 2: Biologie Moléculaire l -Pr. Abdelkarim FILALI-MALTOUF Laboratoire de Microbiologie et Biologie Moléculaire Faculté des Sciences - Rabat Filière SVI - S6 Module de Génétique et Biologie Moléculaire M21 Elément 2: Biologie Moléculaire l -Pr. Abdelkarim FILALI-MALTOUF

Plus en détail

Les propriétés physicochimiques de l ADN Structure des génomes La chromatine

Les propriétés physicochimiques de l ADN Structure des génomes La chromatine Cours de Biologie Moléculaire L2S3 Structure de l ADN Organisation des génomes 2ème cours (1h30) Les propriétés physicochimiques de l ADN Structure des génomes La chromatine L ADN est chargé négativement

Plus en détail


STRUCTURE ET FONCTION DES GÈNES ET DES CHROMOSOMES Faculté de Médecine de Sousse Tunisie Année Universitaire 209-2010 Deuxième Année Médecine Support pédagogique illustré relatif au cours: STRUCTURE ET FONCTION DES GÈNES ET DES CHROMOSOMES Pr. Ag. ELGHEZAL

Plus en détail


EXAMEN DE BIOLOGIE. 35m 12 EXAMEN DE BIOLOGIE La concision, la qualité de l'expression et de l'orthographe des réponses seront particulièrement appréciées. L'attention portée aux schémas et dessins ainsi que le respect des conventions

Plus en détail

Fiche pédagogique : De l ADN aux protéines. Les secrets de l expression de l information génétique.

Fiche pédagogique : De l ADN aux protéines. Les secrets de l expression de l information génétique. Fiche pédagogique : De l ADN aux protéines. Les secrets de l expression de l information génétique. Pourquoi êtes-vous blonds? bruns? chauves? Pourquoi avez-vous les yeux bleus? Pourquoi ressemblez-vous

Plus en détail

TUTORAT UE Séance n 10 Semaine du 24/11/2014 Transcription, traduction Pr Maudelonde et Cornillot

TUTORAT UE Séance n 10 Semaine du 24/11/2014 Transcription, traduction Pr Maudelonde et Cornillot TUTORAT UE1 2014-2015 Séance n 10 Semaine du 24/11/2014 Transcription, traduction Pr Maudelonde et Cornillot Séance préparée par Maxime MAUREY, Benjamin HAYOUN (TSN) QCM n 1 : A propos de la transcription,

Plus en détail


Nom : Groupe : Date : 1 LES RESPONSABLES DES CARACTÈRES CHEZ LES ÊTRES VIVANTS (p. 350-358) CHAPITRE 811 STE Questions 1 à 17, A, B. Verdict 1 LES RESPONSABLES DES CARACTÈRES CHEZ LES ÊTRES VIVANTS (p. 350-358) 1. Observez les deux cellules ci-contre. a) Sous quelle forme apparaît l ADN dans

Plus en détail



Plus en détail

ECUE 2 (L 1 -S 2 ) : Microbiologie générale Microbiologie générale

ECUE 2 (L 1 -S 2 ) : Microbiologie générale Microbiologie générale Unité d enseignement UE 8 : Biologie Moléculaire - Microbiologie ECUE 2 (L 1 -S 2 ) : Microbiologie générale Microbiologie générale 1h30 de cours et 1h15 de Travaux pratiques Un examen écrit ; un examen

Plus en détail


DEVOIR DE SCIENCES DE LA VIE et de LA TERRE. Septembre 2014. DEVOIR DE SCIENCES DE LA VIE et de LA TERRE. Septembre 2014. Vous devez choisir pour chaque question proposée, zéro, une ou plusieurs réponses exactes parmi celles proposées ou bien répondez à la question.

Plus en détail

Microbiologie BIOL La génétique microbienne: les mécanismes de la variation génétique

Microbiologie BIOL La génétique microbienne: les mécanismes de la variation génétique Microbiologie BIOL 3253 La génétique microbienne: les mécanismes de la variation génétique Reproduction sexuée et asexuée Contrairement aux organismes eucaryotes, les procaryotes n effectuent pas de reproduction

Plus en détail

Chapitre C. (ancien programme) (Nouveau programme) POLY-PREPAS AMIENS M.LAIGNIER

Chapitre C. (ancien programme) (Nouveau programme) POLY-PREPAS AMIENS M.LAIGNIER 1 Chapitre C LA SYNTHÈSE PROTÉIQUE (ancien programme) L expression du matériel génétique (Nouveau programme) Le phénotype macroscopique des individus est sous la dépendance des protéines. Le phénotype

Plus en détail


FICHES REVISION UE 2 FICHES REVISION UE 2 «Ce document est la propriété du TAM. Toute autorisation totale ou partielle sans son autorisation sera passible de poursuites selon les articles. L. 335-2 et 335-3 du Code de la Propriété

Plus en détail

Cours de Biologie Moléculaire SVI- S5 ( )

Cours de Biologie Moléculaire SVI- S5 ( ) Cours de Biologie Moléculaire SVI- S5 (2014-15) Le dogme centrale de la Biologie Moléculaire Représente le mécanisme d expression de l information génétique (Francis Crick (fin des années 50) et Nature

Plus en détail

QCM. Niveau Première S. Thème 1A : Reproduction conforme de l ADN

QCM. Niveau Première S. Thème 1A : Reproduction conforme de l ADN QCM Niveau Première S Thème 1A : Reproduction conforme de l ADN Pour chaque question, il vous est donné quatre propositions A, B, C et D. Une, deux ou trois propositions peuvent être exactes. Répondez

Plus en détail

3. L'ARN: Structure, Diffférents Types Et Propriétés tructure assification des ARN ARN ribosoinaux (ARNr) synthétisés dans le noyau

3. L'ARN: Structure, Diffférents Types Et Propriétés tructure assification des ARN ARN ribosoinaux (ARNr) synthétisés dans le noyau 3. L'ARN: Structure, Diffférents Types Et Propriétés Structure Les ARN sont des polymères de RiboNucléotides liés par des liaisons phosophodiester 5'-3'. Les bases azotées sont A-U, C-G. Le sucre est le

Plus en détail

1. L ADN et l information génétique. l ADN l information génétique est contenue dans l ADN. traduction. comment fait-on une protéine?

1. L ADN et l information génétique. l ADN l information génétique est contenue dans l ADN. traduction. comment fait-on une protéine? 1. L ADN et l information génétique l ADN l information génétique est contenue dans l ADN (ADN) (ARN) 1 2 A G T C U comment fait-on une protéine? traduction l information génétique est organisée par triplets

Plus en détail

PARTIE I A - QCM. 1/ Au cours de la mitose :

PARTIE I A - QCM. 1/ Au cours de la mitose : Ce sujet comporte deux parties. La Partie I est celle que vous devez effectuer lors du concours. La Partie II correspond aux sujets des autres formations qui sont donc des exercices à réaliser à la maison.

Plus en détail

ED Biologie moléculaire. E. Turpin J. Lehmann-Che 5-6 novembre 2007

ED Biologie moléculaire. E. Turpin J. Lehmann-Che 5-6 novembre 2007 ED Biologie moléculaire E. Turpin J. Lehmann-Che 5-6 novembre 2007 PCR 1983: Kary Mullis Amplification in vitro par une méthode enzymatique d'un fragmentd'adn en présence de deux oligonucléotides spécifiques

Plus en détail

groupement carboxyle (-COOH) liés ensemble par un atome de carbone (C) auquel

groupement carboxyle (-COOH) liés ensemble par un atome de carbone (C) auquel UV. /. Les gènes et les protéines Manuel, p. 390 à 39. Dites à quoi correspondent les définitions suivantes. a) Les unités de base de l ADN. Les nucléotides. b) Les «barreaux» dans la structure en double

Plus en détail

Biologie cellulaire. Cours 8 : Synthèse des protéines

Biologie cellulaire. Cours 8 : Synthèse des protéines Département des Troncs Communs Sciences de la Nature Faculté des Sciences de la Nature et de la Vie Université Abderrahmane Mira de Bejaia Biologie cellulaire Cours 8 : Synthèse des protéines Année universitaire

Plus en détail

Licence-Master Bioinformatique Contrôle continu 06/03/06. Correction

Licence-Master Bioinformatique Contrôle continu 06/03/06. Correction Licence-Master Bioinformatique Contrôle continu 06/03/06 Correction -«Vraies» questions de cours -«fausses» questions de cours: questions pour voir si pouviez imaginer une réponse crédible qui n était

Plus en détail

Chapitre 10 L isolement et la manipulation de gènes. Injection d ADN étranger dans une cellule animale

Chapitre 10 L isolement et la manipulation de gènes. Injection d ADN étranger dans une cellule animale Chapitre 10 L isolement et la manipulation de gènes Injection d ADN étranger dans une cellule animale Comment amplifier un gène d intérêt? Amplification in vivo à l aide du clonage d ADN L ensemble formé

Plus en détail

IV Expression des gènes : transcription et traduction

IV Expression des gènes : transcription et traduction IV Expression des gènes : transcription et traduction La transcription et la traduction ont lieu dans des compartiments séparés chez les eucaryotes Procaryote 1/ Définition d un gène Gène : segment d ADN

Plus en détail

Expression, stabilité et variation du patrimoine génétique Expression du patrimoine génétique

Expression, stabilité et variation du patrimoine génétique Expression du patrimoine génétique Thème I A Chapitre 3 Expression, stabilité et variation du patrimoine génétique Expression du patrimoine génétique Introduction : - gène = portion d ADN = information détermination des caractères [phénotype]

Plus en détail