Chapitre C. (ancien programme) (Nouveau programme) POLY-PREPAS AMIENS M.LAIGNIER

Dimension: px
Commencer à balayer dès la page:

Download "Chapitre C. (ancien programme) (Nouveau programme) POLY-PREPAS AMIENS M.LAIGNIER ll.polyprepas@orange.fr"

Transcription

1 1 Chapitre C LA SYNTHÈSE PROTÉIQUE (ancien programme) L expression du matériel génétique (Nouveau programme)

2 Le phénotype macroscopique des individus est sous la dépendance des protéines. Le phénotype des individus est sous la dépendance d une information génétique ayant pour support moléculaire la macromolécule d ADN (Acide DesoxyriboNucléique). 1. Les Chromosomes, l ADN et l Information Génétique. La vie cellulaire comporte deux phases : une interphase et une phase de division, la mitose. C est en fonction de ces deux phases que l information génétique prend différentes formes. a) Le Noyau Interphasique (Document 1) On y trouve la chromatine. Celle-ci est constituée de l association de la molécule d ADN avec des protéines histones et non histones (les cellules procaryotes n ont pas de protéines histones donc le terme de chromatine est réservée aux cellules eucaryotes). Les histones sont des protéines basiques se fixant sur l ADN. On peut citer l histone H1 qui a pour rôle de compacter l ADN. Elles forment le nucléosome (Document 2). L enchaînement de ces nucléosomes et des segments d ADN forme une fibre nucléosomique ou nucléofilament «en collier de perles» d environ 10 nm de diamètre. On distingue 2 types de chromatine : - l euchromatine peu condensée. L euchromatine est la seule à pouvoir s exprimer c'està-dire être transcrite (elle ne représente que 5% de l ADN total dans les cellules différenciées). - l hétérochromatine très condensée, celle-ci n est pas transcrite. La chromatine peut se condenser et former les chromosomes. b) Le noyau mitotique, les chromosomes. Au début de la division cellulaire, les nucléofilaments vont se sur-enrouler considérablement : l ADN est alors très condensé, ce qui se traduit par un raccourcissement et un épaississement de la structure. On obtient un chromosome constitué de 2 chromatides reliées au centromère. Une chromatide correspond à une molécule d ADN et une molécule d ADN est constitué de deux brins. c) Les chromosomes, porteurs de l information génétique (Document 3) Après un prélévement sur l individu, ses cellules (souvent des lymphocytes obtenus par prélévement sanguin) sont mises en culture in vitro. La culture est alors mise en présence de colchicine (un alcaloïde très toxique extrait de plantes appelées colchiques) qui bloque les cellules en métaphase de la mitose (phase de condensation maximale des chromosomes). Les cellules en mitose sont récoltées, on les fait gonfler par une incubation en milieu hypotonique (l eau a tendance à rentrer dans la cellule). On les met en présence d un fixateur et on étale la suspension cellulaire fixée sur une lame de verre, en vue de l observation au microscope. Cette préparation est ensuite colorée. La coloration la plus classique est la coloration au Giemsa. Puis on réalise une microphotographie. On la découpe afin de classer les chromosomes en fonction de leurs tailles décroissantes et en fonction de la position de leur centromère. On obtient ainsi un caryotype. Ce dernier est une représentation photographique ou dessinée des chromosomes métaphasiques d un individu, regroupées par paires d homologues (même taille, même forme, même répartition des bandes chromosomiques). 2

3 3 Chaque espèce Eucaryote possède un nombre caractéristique de chromosomes. La cellule humaine possède 46 chromosomes ou 23 paires de chromosomes. Un homme possède 22 paires de chromosomes homologues appelées AUTOSOMES et une paire de chromosomes sexuels notés X et Y (appelés aussi GONOSOMES ou HÉTÉROCHROMOSOMES). Une femme possède 22 paires de chromosomes homologues et une paire de chromosomes sexuels XX. La formule chromosomique pour l homme est 44 + XY et celle de la femme est 44 + XX. Sur les chromosomes sont positionnés les gènes (Document 4). Sur ce mode de représentation, la localisation des gènes (appelée locus au sigulier, loci au pluriel) est indiqué sur un chromosome formé d une seule chromatide. La place de chaque locus peut être précisée par sa distance au centromère. Les chromosomes portent de nombreux gènes. Un gène est une portion d ADN codant une protéine donnée et qui occupe un emplacement précis sur le chromosome, c est le locus. Chaque gène occupe un locus précis. Celui-ci est toujours le même chez les individus d une même espèce. Les chromosomes homologues portent les mêmes gènes mais ils ne portent pas forcément la même information allélique. Un allèle est une version d un gène, une variante donnée d une séquence d ADN au sein d une espèce. Tous les allèles d une même séquence d ADN occupent le même locus sur un même chromosome. d) Structure chimique de l ADN La structure primaire détermine la conformation d une protéine. Cette structure primaire (enchaînement linéaire d AA) est programmée par l information génétique. Les gènes se composent d ADN, une macromolécule appartenant à la classe de composés appelés acides nucléiques. Les Nucléotides Les acides nucléiques sont des polymères de nucléotides. Chaque nucléotide se compose de 3 parties (Document 5) : une base azotée liée à un pentose lui-même uni à un groupement phosphate. L association du sucre et d une base azotée est appelée nucléoside. Il existe 2 familles de bases azotées : les purines et les pyrimidines (Document 5). Les pyrimidines sont composées d un cycle formé de 4 atomes de Carbone (C) et de 2 atomes d Azote (N). L appelation baze azotée vient du fait, qu en solution, l azote du cycle a tendance à se lier aux protons de la solution. Les membres de la famille des pyrimidines sont la cytosine (C), la thymine (T) et l Uracile (U). Les purines sont composées d un double cycle contenant 5 atomes de Carbone et 4 atomes d Azote. Les purines sont l Adénine (A) et la Guanine (G).

4 La thymine ne se retrouve que dans l ADN et l uracile dans l ARN. A ces bases azotées est fixé un ose à 5 atomes de carbone. Il s agit d un pentose : - pour l ADN, le désoxyribose C 5 H 10 O 4 ; - pour l ARN, le ribose C 5 H 10 O 5. Un nucléotide contient également un groupement phosphate attaché au 5 ème atome de carbone du pentose. Il existe de nombreux nucléotides ayant des fonctions différentes : transport de protons (NAD : Nicotinamide Adénine Dinucléotide), stockage d énergie (ATP) (Document 6). Un enchaînement de plusieurs nucléotides est appelé polynucléotide. Les polynucléotides (Document 5) Dans un polynucléotide, les monomères (étant ici des nucléotides) se lient par des liaisons covalentes appelés liaisons phosphodiester. Ces liaisons unissent le phosphate d un nucléotide avec le pentose d un nucléotide suivant. On voit apparaître la répétition de la séquence suivante : PENTOSE PHOSPHATE PENTOSE PHOSPHATE - Tout le long de ce squelette viennent s ajouter les bases azotées. La séquence des bases azotées le long d un polynucléotide est unique à chaque gène. Comme les gènes comprennent des centaines de nucléotides, le nombre de séquences possibles est illimité. Le polynucléotide universel du monde vivant est l ADN. La double hélice (Document 7) L acide désoxyribonucléique (ADN) est une macromolécule que l on retrouve dans toutes les cellules vivantes à l exception des cellules anucléées commes les hématies. L ADN est le support de l information génétique car il constitue le génome (correspondant à l ensemble des gènes d un organisme) des êtres vivants. L ADN détermine également la synthèse des protéines (voir plus loin). L ADN est un polynucléotide. C est à Cambridge qu a été établie la structure en double hélice de l ADN grâce à la technique de la diffraction des rayons X. Cette structure fut établie en 1953 par Watson et Crick (Prix Nobel en 1962). Ils s appuyèrent sur un fait établi : pour une espèce donnée les quantités de A et de T sont sensiblement égales ainsi que pour les quantités C et G. On parle de règle de Chargaff ou règle de complémentarité des bases azotées. L ADN est composé de deux brins desoxyribonucléotidiques formant une double hélice. On constate que l adénine est complémentaire de la thymine et la guanine est complémentaire de la cytosine. Il y a 2 liaisons hydrogène entre A et T et 3 entre C et G. Pour un brin d ADN possèdant 20 nucléotides, nous pouvons retrouver la séquence du brin complémentaire et retrouver la double séquence de la double hélice : 5 ATTGCCTATGCCAATTGCCG 3 3 TAACGGATACGGTTAACGGC 5 On constate que la molécule d ADN est orientée et les chaînes sont antiparallèles. Comme une molécule d ADN est double brin, on dit qu elle est bicaténaire. 4

5 Les 4 bases azotées entrant dans la composition des nucléotides (A,T,C,G) sont les «lettres» de l alphabet génétique et c est l ordre de ces bases de l ADN qui donne les informations génétiques nécessaires à la synthèse des protéines. Chaque séquence de 3 bases azotées sur un brin d ADN appelée triplet peut être considérée comme un «mot» désignant un acide aminé spécifique. Comment l information contenue sur un brin d ADN sous forme d une chaîne de désoxyribonucléotides peut-elle être transposée en une chaîne d AA aboutissant à la formation des protéines? 2. Le Passage ADN-ARN messager : la Transcription. a) La transcription ou lecture du gène dans le noyau. L ADN est présent dans le noyau des cellules eucaryotes. Nous avons vu que les polypeptides sont fabriqués par les ribosomes du cytoplasme. L ADN a donc besoin d un messager. C est l ARN (Acide Ribonucléique) qui remplit cette fonction et en particulier l ARNm (ARN messager). Ce dernier permet le passage de l information génétique d un compartiment vers l autre. Molécule Nature de la molécule Structure Sucre Bases Azotées Durée de Vie Localisation ADN Acide Nucléique = Acide Desoxyribonucléique Double chaîne de nucléotides = bicaténaire Désoxyribose A, T, C, G Longue noyau, mitochondrie, chloroplaste (eucaryote) ARN Acide Nucléique = Acide Ribonucléique Simple chaîne de nucléotides = monocaténaire Ribose A, U, C, G (U = Uracile) Temporaire (labile) noyau (nucléole), mitochondrie, chloroplaste, cytoplasme (eucaryote) Tableau de Comparaison ADN / ARN Le Document 9 montre que l ADN et l ARN sont complémentaires. On constate que l ARN est complémentaire d un seul des 2 brins d ADN. Il est complémentaire du brin transcrit qui sert de matrice. L autre brin est le brin codant. ADN 5-3 => brin codant, brin non transcrit. 3-5 => brin non codant, brin transcrit, brin matrice, brin modèle, brin informatif. La lecture de l ADN se fait dans le sens 3-5 et la synthèse dans le sens 5-3. C est une réaction catalysée par une enzyme appelée ARN polymérase (Document 8). Sur l ADN, des séquences de nucléotides spécifiques marquent les sites d initiation et de terminaison là où commence et finit la transcription. Ces bornes et les centaines ou milliers de nucléotides entre ces bornes constituent l unité de transcription (Document 10). 5

6 6 Chez les Eucaryotes, cette unité de transcription forme un seul gène et l ARNm qui en découle code pour une seule protéine. Chez les Procaryotes, une unité de transcription peut comporter plusieurs gènes dont les protéines en résultant ont des fonctions reliées. Les Bactéries possèdent un seul type d ARN polymérase qui permet la synthèse de l ARNm. Par contre, les Eucaryotes possèdent 3 types d ARN polymérase : -l ARN polymérase de type I permet la synthèse de l ARN ribosomal (ARNr); -l ARN polymérase de type II permet la synthèse de l ARN messager (ARNm); -l ARN polymérase de type III permet la synthèse de l ARN de transfert (ARNt) ou certains ARNr. La transcription comprend 3 étapes : (document 8) - La liaison de l ARN polymérase et l initiation : une enzyme, l ARN polymérase ou transcriptase ouvre la double hélice d ADN et se fixe en amont du gène. Un seul des brins de l ADN est informatif, toujours le même pour un gène donné. - l élongation de l ARN : l ARN polymérase se déplace de 3 vers 5. Des ribonucléotides complémentaires viennent se placer en face du brin transcrit. La croissance de l ARN se fait donc de 5 vers 3 (30 nucléotides par seconde). - la terminaison de la transcription : à l extrémité du gène, la transcription est terminée. Les deux brins de l ADN se réassocient. L ARN est, du point de vue de la succession des bases azotées, la copie conforme du brin non transcrit, à une différence près, l uracile remplace la thymine. Après la transcription a lieu, chez les Eucaryotes, la maturation post-transcriptionnelle de l ARN messager. Le schéma théorique : 1 gène de structure donne un ARN messager qui lui donne un polypeptide ne se trouve que chez les Procaryotes. On parle de gènes linéaires. Chez les Eucaryotes, les gènes sont morcelés, discontinus, en mosaïque : ils sont constitués de séquences nucléotidiques codantes (exons) et non codantes (introns). Toutes seront transcrites et on obtiendra un ARN pré messager (ARN immature, ARN non fonctionnel) ou transcript primaire) mais seuls les exons seront traduits, les introns seront dégradés dans le noyau (excision).

7 7 Ce processus qui aboutit à la formation de l ARN messager mature est appelée ÉPISSAGE. On parle d épissage alternatif car certains exons peuvent ou non être retenus dans l ARN messager définitif. Une séquence de 3 bases sur l ADN est appelée TRIPLET mais la séquence de 3 bases correspondantes sur l ARNm est appelée CODON. Ce nom indique que ce sont les séquences de bases de l ARNm qui déterminent quels AA sont utilisés pour la synthèse des protéines. Nous utiliserons le code génétique pour passer d une séquence de ribonucléotides à une séquence d AA. b) Le Code Génétique (Document 11) La traduction d une séquence nucléotidique d un gène en séquence d AA d une protéine s effectue selon un ensemble de règles qui furent déchiffrées au début des années 1960 et qui constituent le code génétique. En 1966, le code génétique est totalement décrypté par les expériences de Nirenberg et Khorama. La lecture du message s effectue par groupe de 3 bases azotées successives (codons). Chacun de ces codons désignent un AA. Les 4 bases azotées (A, U, C, G) groupées par 3 permettent 4 3 = 64 possibilités différentes pour désigner l un des 20 AA utilisé. Plusieurs triplets peuvent correspondre au même AA, on dit que le code génétique est redondant ou dénégéré. Certains triplets n ont pas de traduction en termes d AA. Ils sont nommés codons non-sens ou codons Stop (UAA, UAG, UGA). D autre part le code génétique est quasi-universel : le langage est quasi-identique chez tous les êtres vivants. Il existe des exceptions : par exemple chez la Paramécie (Eucaryote unicellulaire), le code génétique est différent. Il existe également des différences au niveau de l ADN des mitochondries et des chloroplastes. Cette universalité permet l expression de gènes d une espèce à l autre (c est la transgenèse). Par exemple, les Bactéries peuvent fabriquer de grandes quantités de protéines humaines (ex : l insuline). De plus, le code génétique est non chevauchant et sans blanc : un codon n appartient jamais à 2 codons successifs et il n y a jamais de nucléotides isolés intercalés entre 2 codons. Le code génétique n est pas ambigu, il est univoque : à un codon correspond un acide aminé. L ARNm construit, quitte le noyau cellulaire par un pore de la membrane nucléaire et pénètre dans le cytoplasme où il porte le message nécessaire pour synthétiser la protéine spécifique. Il est à noter que 2 autres types d ARN sont synthétisés dans le noyau à partir de l ADN : il s agit de l ARN de transfert (ARNt) et l ARN ribosomal (ARNr). Ces 2 types d ARN sont essentiels lors de la traduction du message.

8 8 3. La traduction. La traduction correspond à la transformation du message contenu dans l ARNm en une chaîne polypeptidique. Les acteurs de la protéosynthèse sont les suivants : ARNm, ARNt, ARNr, acides aminés, enzymes et énergie. a) Les Ribosomes (ARNr) (ribosome=grain de Palade car les ribosomes ont été découverts par Palade) Les ARN ribosomaux (ou ribosomiaux) sont transcrits à partir de certains gènes de fonction présents dans le nucléole. Ils se combinent à des protéines pour former 2 types de sousunités, une petite et une grosse qui s assemblent au moment de la traduction. Ces risobomes présentent 2 sites de liaison pour les ARNt : les sites A (aminoacyl-arnt) et P (peptidyl- ARNt). Ces ribosomes contiennent l enzyme majeure de la synthèse protéique à savoir la peptidyl-transférase qui réalise la liaison peptidique entre deux acides aminés. b) Les ARN de transfert (ARNt) (Document 12) L anticodon est une séquence spécifique de 3 bases azotées qui constitue le complément du codon d ARNm déterminant l AA porté par cette molécule d ARNt. Les molécules d ARNt résultent de la transcription de l ADN et donc comme l ARNm, l ARNt doit sortir du noyau pour rejoindre le cytoplasme.

9 9 Chaque molécule d ARNt peut servir plusieurs fois. Il se lie à l AA, dépose cet AA au niveau du ribosome, quitte le ribosome et fixe un nouvel AA dans le cytoplasme. Une molécule d ARNt est composée d un seul brin d ARN de 80 nucléotides environ. Ce brin se replie sur lui-même pour former une molécule pourvue d une structure secondaire (on lui attribue l aspect d une feuille de trèfle). Certaines parties du brin d ARNt forment des liaisons hydrogène avec des bases complémentaires situées dans d autres régions. L ARNt présente des portions bicaténaires mais c est une molécule monocaténaire. La molécule d ARNt possède une structure trilobée, tordue et pliée en forme de L. L extrémité 3 de l ARNt possède le site de liaison de l AA. Comment se fait la liaison codon-anticodon? c) Les aminoacyl-arnt-synthétases. Les ARNt s associent à un des 20 AA par l intermédiaire d une des 20 enzymes aminoacyl- ARNt-synthétases spécifiques d un AA. Cette fixation des AA sont des phénomènes nécessitant de l énergie, ici l ATP. Il existe autant d enzymes différentes que d AA différents. La traduction peut être divisée en 3 parties (Document 13). d) Initiation de la synthèse. Elle commence toujours au niveau d un codon AUG (méthionine) de l ARNm. Ce codon d initiation ou codon «initiateur» détermine la mise en place : - d un ribosome qui s assemble à partir de ses 2 sous-unités jusque là indépendantes, - de l ARNt méthionine se liant par son anticodon au codon AUG. Le ribosome possède alors deux sites fonctionnels : le site P où est installé l ARNt méthionine lié au codon AUG et le site A au niveau duquel est situé le codon suivant de l ARNm. e) Elongation de la chaîne. La mise en place sur le codon présent au site A, d un nouvel ARNt-AA est suivie : - de la libération de l ARNt fixé au site P qui se décroche de son AA ; - de la création d une liaison peptidique entre les 2 AA présents dans le ribosome. Du GTP (Guanosine Tri Phosphate) est nécessaire pour créer la liaison peptidique ; - du déplacement relatif du ribosome par rapport à l ARNm qui permet la libération du site A. Ce déplacement nécessite un facteur G (translocase) et de l énergie sous forme de GTP.

10 10 A mesure qu il est lu, l ARNm avance sur le ribosome. Ainsi le début de l ARNm finit par dépasser du 1 er ribosome et il peut s attacher successivement à plusieurs autres ribosomes qui liront son message simultanément. Un tel complexe formé de multiples ribosomes et d un ARNm est appelé polysome ou polyribosome (Document 14). La dernière étape de la traduction est : f) Terminaison de la synthèse. C est l arrivée au niveau du site A d un codon STOP (UAA ou UAG ou UGA) qui interrompt la synthèse en déclenchant la dissociation du complexe ARNm-ribosome-ARNt-polypeptide : - les sous-unités du ribosome se séparent ; - la chaîne polypeptidique est libérée et la méthionine, permier AA incorporé, est détachée de cette chaîne (cette étape n est pas obligatoire car la méthionine peut, dans certains cas, rester sur la chaîne polypeptidique). Remarques : - Si le ribosome est libre dans le cytoplasme, le peptide assemblé reste dans le cytoplasme (protéine cytosolique). Ce peptide peut entrer dans le noyau par des pores nucléaires (ex : histones). - Si le peptide a été assemblé par des ribosomes de la membrane extérieure du RER, il pénétre dans sa lumière et subit des modifications (protéines sécrétoires). - Chaque molécule d ARN messager gouverne la synthèse simultanée de 10 à 20 molécules polypeptidiques identiques. 4. Transport et Emballage des Protéines (Document 15) La synthèse protéique s effectue au niveau des ribosomes présents sur le REG, grâce à l information parvenue du noyau via les ARNm. Les polypeptides sont ensuite déversés dans les cavités du réticulum endoplasmique. Certains subissent la glycosylation à savoir la formation de glycoprotéines et de glycolipides présents à la surface des cellules. Ils sont ensuite englobés dans des vésicules de transition qui se rendent jusqu à l appareil de Golgi. Les vésicules de transition fusionnent avec les membranes de l appareil de Golgi. Les polypeptides sont ensuite modifiés à l intérieur du Golgi. Certains groupes sucres sont retirés, d autres sont ajoutés et, dans quelques cas, des groupes phosphates sont ajoutés. On appelle ces événements la maturation des polypeptides aboutissant à des protéines. Les protéines sont ensuite triées, puis accumulées dans des vésicules de sécrétion qui se détachent du Golgi et migrent vers la membrane plasmique. Ces vésicules libèrent leur contenu à l extérieur de la cellule par exocytose. Les protéines destinées à l exportation hors de la cellule sont par exemple des hormones (insuline, glucagon), des immunoglobulines, des enzymes extracellulaires. D autres sont expédiés vers les lysosomes.

11 11 Conclusion : Les protéines, ainsi synthétisées, participent à la réalisation des phénotypes cellulaire et moléculaire. En dirigeant la synthèse des protéines, les gènes jouent un rôle fondamental dans la réalisation du phénotype. Cependant, un caractère phénotypique dépend en partie de facteurs externes (voir chapitre D). On peut achever ce chapitre par un schéma-bilan.

CHAPITRE 3 LA SYNTHESE DES PROTEINES

CHAPITRE 3 LA SYNTHESE DES PROTEINES CHAITRE 3 LA SYNTHESE DES ROTEINES On sait qu un gène détient dans sa séquence nucléotidique, l information permettant la synthèse d un polypeptide. Ce dernier caractérisé par sa séquence d acides aminés

Plus en détail

Chapitre 2. La synthèse protéique : la relation entre le génotype et le phénotype.

Chapitre 2. La synthèse protéique : la relation entre le génotype et le phénotype. Chapitre 2. La synthèse protéique : la relation entre le génotype et le phénotype. Les maladies génétiques comme la drépanocytose ou l'albinisme sont liées à des modifications du génotype des individus

Plus en détail

Acides Nucléiques. ADN et ARN Unités de base : les nucléotides donc les nucléotides = monomères ADN et ARN = polynucléotides = polymères

Acides Nucléiques. ADN et ARN Unités de base : les nucléotides donc les nucléotides = monomères ADN et ARN = polynucléotides = polymères Acides Nucléiques ADN et ARN Unités de base : les nucléotides donc les nucléotides = monomères ADN et ARN = polynucléotides = polymères Structure d un nucléotide Tous composés d une base azotée, d un sucre

Plus en détail

Macromolécules et la Cellule

Macromolécules et la Cellule Macromolécules et la Cellule Macromolécules Campbell chapitre 5 Macromolécules Définition: Molécule géante formée par l assemblage de plusieurs petites molécules organiques Macromolécules Définition:

Plus en détail

Quelques termes-clef de biologie moléculaire et leur définition

Quelques termes-clef de biologie moléculaire et leur définition Acide aminé (AA) Quelques termes-clef de biologie moléculaire et leur définition Isabelle Quinkal INRIA Rhône-Alpes Septembre 2003 Petite molécule dont l enchaînement compose les protéines - on dit qu

Plus en détail

THEME 1 A EXPRESSION, STABILITE ET VARIATION DU PATRIMOINE GENETIQUE

THEME 1 A EXPRESSION, STABILITE ET VARIATION DU PATRIMOINE GENETIQUE THEME 1 A EXPRESSION, STABILITE ET VARIATION DU PATRIMOINE GENETIQUE CHAPITRE 3 L EXPRESSION DU PATRIMOINE GENETIQUE I. LA RELATION GENES-PROTEINES Les protéines interviennent dans le fonctionnement d

Plus en détail

Eléments primordiaux de biologie moléculaire

Eléments primordiaux de biologie moléculaire Eléments primordiaux de biologie moléculaire Pourquoi s intéresser au matériel génétique? Base de l information génétique Tissu Cellule Noyau Organisme entier Lieu où est localisé l ADN Mol d ADN qui est

Plus en détail

TRANSCRIPTION TRADUCTION

TRANSCRIPTION TRADUCTION 4 TRANSCRIPTION TRADUCTION Objectifs : définir transcription et traduction et donner leur localisation cellulaire sur un schéma, identifier les acteurs de la transcription (ARNpol, brin transcrit, ARNm)

Plus en détail

L'ordre et la nature des acides aminés (ou séquence) d un polypeptide dépend de la séquence des nucléotides de l ADN du gène qui le code.

L'ordre et la nature des acides aminés (ou séquence) d un polypeptide dépend de la séquence des nucléotides de l ADN du gène qui le code. L'ordre et la nature des acides aminés (ou séquence) d un polypeptide dépend de la séquence des nucléotides de l ADN du gène qui le code. Une mutation, peut entraîner une modification de la séquence des

Plus en détail

LA SYNTHÈSE DES PROTÉINES

LA SYNTHÈSE DES PROTÉINES LA SYNTHÈSE DES PROTÉINES La transcription Information : dans le noyau (sous forme d'adn) Synthèse des protéines : dans le cytoplasme (au niveau des ribosomes du reticulum endoplasmique) L'ADN ne sort

Plus en détail

Biologie cellulaire. Cours 8 : Synthèse des protéines

Biologie cellulaire. Cours 8 : Synthèse des protéines Département des Troncs Communs Sciences de la Nature Faculté des Sciences de la Nature et de la Vie Université Abderrahmane Mira de Bejaia Biologie cellulaire Cours 8 : Synthèse des protéines Année universitaire

Plus en détail

Le noyau interphasique

Le noyau interphasique Chapitre 1 Le noyau interphasique COURS 1.1 Généralités Certaines cellules ne possèdent pas de noyau : ce sont les procaryotes. Les autres, les eucaryotes, possèdent un noyau. Le reste de la cellule (à

Plus en détail

Cahier de texte de la classe 1 ère 4 - SVT

Cahier de texte de la classe 1 ère 4 - SVT Cahier de texte de la classe 1 ère 4 - SVT DATE SEQUENCE lundi 12 : revoir la fiche méthodologique «utiliser le microscope optique» (disponible sur le site du lycée) Lundi 12 1 er contact avec les élèves.

Plus en détail

CHAPITRE III : LE NOYAU INTERPHASIQUE ET LE CYCLE CELLULAIRE

CHAPITRE III : LE NOYAU INTERPHASIQUE ET LE CYCLE CELLULAIRE CHAPITRE III : LE NOYAU INTERPHASIQUE ET LE CYCLE CELLULAIRE III.1 LE NOYAU INTERPHASIQUE III.1. 1 STRUCTURE L organite le plus proéminent de la cellule est le noyau. Il est le centre vital de la cellule.

Plus en détail

UE1 Atomes, Biomolécules, Génome PACES 2011-2012

UE1 Atomes, Biomolécules, Génome PACES 2011-2012 UE1 Atomes, Biomolécules, Génome Traduction et régulation (1) PACES 2011-2012 Sandrine Dabernat Code génétique et traduction 1- Les ARN de transfert 2- Les ARN ribosomaux et ribosomes 3- Le code génétique

Plus en détail

Biologie Moléculaire et Organismes Modèles

Biologie Moléculaire et Organismes Modèles Biologie Moléculaire et Organismes Modèles Sami Khuri Department of Computer Science San José State University khuri@cs.sjsu.edu Usine de Protéines Les protéines sont responsables de la plupart des fonctions

Plus en détail

Université du Québec à Montréal

Université du Québec à Montréal RECUEIL D EXERCICES DE BICHIMIE 6. Les acides nucléiques 6.2. Réplication, transcription et traduction P P P CH 2 H N H N N NH NH 2 Université du Québec à Montréal 6.2. Réplication, transcription et traduction

Plus en détail

STRUCTURE ET FONCTION DES GÈNES ET DES CHROMOSOMES

STRUCTURE ET FONCTION DES GÈNES ET DES CHROMOSOMES Faculté de Médecine de Sousse Tunisie Année Universitaire 209-2010 Deuxième Année Médecine Support pédagogique illustré relatif au cours: STRUCTURE ET FONCTION DES GÈNES ET DES CHROMOSOMES Pr. Ag. ELGHEZAL

Plus en détail

THÈME 3 : DU GÉNOTYPE AU PHÉNOTYPE. CHAPITRE 1 : la relation entre ADN et protéines

THÈME 3 : DU GÉNOTYPE AU PHÉNOTYPE. CHAPITRE 1 : la relation entre ADN et protéines THÈME 3 : DU GÉNOTYPE AU PHÉNOTYPE CHAPITRE 1 : la relation entre ADN et protéines Les caractères d un individu dépendent de plusieurs facteurs : certains dépendent des caractères présents dans la famille

Plus en détail

Cahier de texte de la classe 1 ère 3 - SVT

Cahier de texte de la classe 1 ère 3 - SVT Cahier de texte de la classe 1 ère 3 - SVT DATE SEQUENCE jeudi 8 : revoir la fiche méthodologique «utiliser le microscope optique» (disponible sur le site du lycée) Jeudi 8 1 er contact avec les élèves.

Plus en détail

Chapitre 2 : Organisation de la cellule

Chapitre 2 : Organisation de la cellule Partie 1 : notions de biologie cellulaire DAEU- Cours Sciences de la Nature & de la Vie- Marc Cantaloube Chapitre 2 : Organisation de la cellule La cellule est l unité de base des êtres vivants. Il existe

Plus en détail

Consultations Martinique / Guyane. Activité LABORATOIRE. Dr Odile Béra, CHU de Fort-de-France. Unité Oncogénétique

Consultations Martinique / Guyane. Activité LABORATOIRE. Dr Odile Béra, CHU de Fort-de-France. Unité Oncogénétique Dr Odile Béra, CHU de Fort-de-France Unité Oncogénétique Unité Génétique moléculaire des cancers Consultations Martinique / Guyane Prédisposition génétique cancers SEIN/OVAIRES COLON (Sd de Lynch & PAF)

Plus en détail

5-1. Introduction 5-2. L appareil de traduction et son fonctionnement - Les ribosomes - Les ARNt - Les ARNt Synthétases

5-1. Introduction 5-2. L appareil de traduction et son fonctionnement - Les ribosomes - Les ARNt - Les ARNt Synthétases 5 - la traduction 5-1. Introduction 5-2. L appareil de traduction et son fonctionnement - Les ribosomes - Les ARNt - Les ARNt Synthétases 5-3. Les étapes de la synthèse protéiques -Initiation - Élongation

Plus en détail

La division cellulaire Chapitre 5 Anatomie

La division cellulaire Chapitre 5 Anatomie La division cellulaire Chapitre 5 Anatomie La division cellulaire est le mode de multiplication de toute cellule. Elle lui permet de se diviser en plusieurs cellules-filles (deux le plus souvent). C'est

Plus en détail

Chapitre 1 La révolution des sciences de la vie par la génétique

Chapitre 1 La révolution des sciences de la vie par la génétique Chapitre 1 La révolution des sciences de la vie par la génétique Variation génétique de la couleur des grains de maïs. Chaque grain représente un individu de constitution génétique distincte. La sélection

Plus en détail

Bases Structurales de l hérédité

Bases Structurales de l hérédité Bases Structurales de l hérédité I- La Génétique Partie de la biologie relative à l hérédité et à la variation. Unités héréditaires transmises d une génération à la suivante sont les gènes. Localisés le

Plus en détail

De la biologie molécualire à la génomique

De la biologie molécualire à la génomique De la biologie molécualire à la génomique Pierre Neuvial École Nationale de la Statistique et de l Administration Économique Méthodes statistiques pour la biologie Plan du cours 1 Introduction à la biologie

Plus en détail

Cours Biologie cellulaire

Cours Biologie cellulaire Cours Biologie cellulaire GLBE102_ L1-S1 Le Noyau et la Transcription Généralités Un organite interphasique (disparaît en fin de prophase) Contient l ADN de la cellule = génome (sauf ADN mito. et chloroplastique)

Plus en détail

Expression des gènes Comparatif entre procaryotes et eucaryotes

Expression des gènes Comparatif entre procaryotes et eucaryotes Comparaison procaryotes/ 2TSbc Expression des gènes Comparatif entre procaryotes et eucaryotes La majeure partie des connaissances de biologie moléculaire a d'abord débuté par l'étude des phénomènes chez

Plus en détail

Filière SVI - S6 Module de Génétique et Biologie Moléculaire M21 Elément 2: Biologie Moléculaire l -Pr. Abdelkarim FILALI-MALTOUF

Filière SVI - S6 Module de Génétique et Biologie Moléculaire M21 Elément 2: Biologie Moléculaire l -Pr. Abdelkarim FILALI-MALTOUF Laboratoire de Microbiologie et Biologie Moléculaire Faculté des Sciences - Rabat Filière SVI - S6 Module de Génétique et Biologie Moléculaire M21 Elément 2: Biologie Moléculaire l -Pr. Abdelkarim FILALI-MALTOUF

Plus en détail

Cours de Biologie moléculaire de Licence professionnelle 2011

Cours de Biologie moléculaire de Licence professionnelle 2011 Cours de Biologie moléculaire de Licence professionnelle 2011 Sommaire 1. Introduction 2.1. La structure de l ADN 2.2. La structure de l ARN 2.3. Du gène à la protéine 2.3.1. La réplication 2.3.2. La transcription

Plus en détail

Chapitre 14: La génétique

Chapitre 14: La génétique Chapitre 14: La génétique A) Les gènes et les protéines, ça te gêne? 1) a) Quel est l élément de base des vivants? Les cellules b) Qu a-t-elle en son centre? Un noyau c) Qu y retrouve-t-on sous forme de

Plus en détail

PHENOTYPE - GENOTYPE Le phénotype d un individu : - peut être observé uniquement à l échelle moléculaire et à l échelle cellulaire PROTEINES ENZYMES

PHENOTYPE - GENOTYPE Le phénotype d un individu : - peut être observé uniquement à l échelle moléculaire et à l échelle cellulaire PROTEINES ENZYMES REVISIONS DE 1 S. Vous devez indiquer pour chaque proposition si celle-ci est vraie (V) ou fausse (F) en cochant la case correspondante ; une abstention ou une réponse trop peu lisible seront considérées

Plus en détail

LES BASES MOLECULAIRES DE L ORGANISATION DU GENOME HUMAIN

LES BASES MOLECULAIRES DE L ORGANISATION DU GENOME HUMAIN LES BASES MOLECULAIRES DE L ORGANISATION DU GENOME HUMAIN I. STRUCTURE DE L ADN Le génome humain est contenu dans des NOYAUX (EUCARYOTES) Petite quantité d ADN en dehors du noyau dans la MITOCHONDRIE Sous

Plus en détail

Organisation générale du noyau

Organisation générale du noyau Organisation générale du noyau L enveloppe nucléaire Le nucléoplasme A. Ait Chaoui Références www.sciencebio.com/facbio/biocell juin 2009 Biologie cellulaire. Des molécules aux organismes. Jean-Claud Callen.

Plus en détail

Du génotype au phénotype, relation avec l environnement

Du génotype au phénotype, relation avec l environnement Du génotype au phénotype, relation avec l environnement Pré-requis (troisième et seconde) : Chaque individu présente les caractères de l'espèce avec des variations qui lui sont propres. C'est le résultat

Plus en détail

L ADN. Schématisez un nucléotide et un nucléoside en précisant sur quel carbone du sucre se font les différents assemblages :

L ADN. Schématisez un nucléotide et un nucléoside en précisant sur quel carbone du sucre se font les différents assemblages : L ADN. I. GENERALITES. A. Les caractéristiques de l ADN. Donnez les 6 caractéristiques de l ADN : B. Les nucléotides/nucléosides : Schématisez un nucléotide et un nucléoside en précisant sur quel carbone

Plus en détail

TD 3 : LA GÉNÉTIQUE. L Homme possède 46 chromosomes, soit 23 paires de chromosomes.

TD 3 : LA GÉNÉTIQUE. L Homme possède 46 chromosomes, soit 23 paires de chromosomes. TD 3 : LA GÉNÉTIQUE ADN : acide désoxyribonucléique. ARN : acide ribonucléique.! L ADN possède deux brins, l ARN un seul. Ils sont composés de nucléotides eux-même composés d une base azoté, d un sucre,

Plus en détail

L3-BH01 Cours n 10 Modifications post-transcriptionnelles

L3-BH01 Cours n 10 Modifications post-transcriptionnelles L3-BH01 Cours n 10 Modifications post-transcriptionnelles Ce cours est présent sur le web à l adresse suivante : http://www.univ-orleans.fr/sciences/biochimie/l/ressources.htm Plan (cours n 10 & 11) Introduction

Plus en détail

BIOLOGIE MOLECULAIRE ET EXERCICES

BIOLOGIE MOLECULAIRE ET EXERCICES SCEANCE 4 BIOLOGIE MOLECULAIRE ET EXERCICES LA REPLICATION Nous avons vu lors de la séance précédente de biomol les caractéristiques de l ADN et des différents ARN. Nous allons aujourd hui voir la réplication.

Plus en détail

TD3: support du cours/td

TD3: support du cours/td TD3: support du cours/td Auteur: P RAG D BRUANT Livres de complément: -Maillet (Biologie cellulaire) Masson -Alberts (la cellule) Médecine-science Flammarion -Koolman (Atlas de poche de biochimie) Médecinescience

Plus en détail

COURS N 8 DE BIOLOGIE CELLULAIRE : LA TRANSCRIPTION

COURS N 8 DE BIOLOGIE CELLULAIRE : LA TRANSCRIPTION COURS N 8 DE BIOLOGIE CELLULAIRE : LA TRANSCRIPTION

Plus en détail

Chapitre 3 : L expression de l information génétique. Activité 1 : Les deux étapes de l expression de l information génétique

Chapitre 3 : L expression de l information génétique. Activité 1 : Les deux étapes de l expression de l information génétique Connaissances L'ADN contient des unités d'information appelées gènes. Le génome est l ensemble du matériel génétique d un organisme. Chez les eucaryotes, la transcription a lieu dans le noyau, la traduction

Plus en détail

Cours Biologie cellulaire ULBI 101 _ L1-S1

Cours Biologie cellulaire ULBI 101 _ L1-S1 Cours Biologie cellulaire ULBI 101 _ L1-S1 RMI_Partie 2-2 Le Noyau et la Transcription 5- Définition des organites et des fonctions associées 5.1 Noyau : ADN et information génétique - Généralités - Structure

Plus en détail

III - Régulation du métabolisme A) X B) Transcription

III - Régulation du métabolisme A) X B) Transcription BPV : Physiologie Bactérienne UE: 5 Semaine : n 9 (du 02/11/2015 au 06/11/2015 Date : 03/11/2015 Heure : de 9h-10h Professeur : Pr. Romond Binôme : n 54 Correcteur : 53 Aucune remarque particulière du

Plus en détail

UE2.2S1 LMD infirmier. Bases moléculaires de l organisation du génome. Dr F. Maupas-Schwalm Toulouse-Rangueil Septembre 2012

UE2.2S1 LMD infirmier. Bases moléculaires de l organisation du génome. Dr F. Maupas-Schwalm Toulouse-Rangueil Septembre 2012 UE2.2S1 LMD infirmier Bases moléculaires de l organisation du génome. Dr F. Maupas-Schwalm Toulouse-Rangueil Septembre 2012 Plan du cours I. Bases moléculaires de l organisation du génome. A. otions générales

Plus en détail

LES ACIDES NUCLEIQUES

LES ACIDES NUCLEIQUES LES ACIDES NUCLEIQUES INTRODUCTION Les acides nucléiques sont des macromolécules présentes dans toutes les cellules vivantes et également chez les virus. Ils constituent le support de l'information génétique

Plus en détail

MÉCANISMES MOLÉCULAIRES DE L EXPRESSION DES GÉNES : LA TRADUCTION OU BIOSYNTHÈSE DES PROTÉINES

MÉCANISMES MOLÉCULAIRES DE L EXPRESSION DES GÉNES : LA TRADUCTION OU BIOSYNTHÈSE DES PROTÉINES MÉCANISMES MOLÉCULAIRES DE L EXPRESSION DES GÉNES : LA TRADUCTION OU BIOSYNTHÈSE DES PROTÉINES Le sens de lecture L ARN polymérase lit le brin matrice dans la direction 3 vers 5 de façon à synthétiser

Plus en détail

Figure 3-4 Fonction du nucléole dans la synthèse des ribosomes.

Figure 3-4 Fonction du nucléole dans la synthèse des ribosomes. III.1.6 Le Nucléole Ce sont des structures fibrillaires sphériques denses du noyau interphasique et prophasique des organismes supérieurs. Les nucléoles qui sont le site de formation des ribosomes fixent

Plus en détail

Biologie Moléculaire et Organismes Modèles

Biologie Moléculaire et Organismes Modèles Biologie Moléculaire et Organismes Modèles Sami Khuri Department of Computer Science San José State University khuri@cs.sjsu.edu Plan du Cours Biologie Moléculaire et Organismes Modèles Qu est-ce que la

Plus en détail

DST DE SCIENCES DE LA VIE ET DE LA TERRE 1) RESTITUTION ORGANISÉE DES CONNAISSANCES (8 PTS)

DST DE SCIENCES DE LA VIE ET DE LA TERRE 1) RESTITUTION ORGANISÉE DES CONNAISSANCES (8 PTS) 1s_cntsvt_2011_11_16_corrigé.doc 1/6 CLASSE DE 1ère S - DURÉE 3H00 DST DE SCIENCES DE LA VIE ET DE LA TERRE CALCULATRICES INTERDITES 1) RESTITUTION ORGANISÉE DES CONNAISSANCES (8 PTS) Le cycle cellulaire

Plus en détail

LA TRADUCTION. Le code génétique correspond à l enchainement ordonné de trois bases nucléotidiques (triplets) permettant de définir un acide aminé.

LA TRADUCTION. Le code génétique correspond à l enchainement ordonné de trois bases nucléotidiques (triplets) permettant de définir un acide aminé. Faculté de médecine d Alger Module de génétique. Dr Boudiaf Benaferi R. LA TRADUCTION I /CODE GENETIQUE : a/ définition : Le code génétique correspond à l enchainement ordonné de trois bases nucléotidiques

Plus en détail

I. Histoire de la biologie moléculaire (Q1 à Q5)

I. Histoire de la biologie moléculaire (Q1 à Q5) I. Histoire de la biologie moléculaire (Q1 à Q5) Q1. Concernant les premières lois sur l hérédité : Elles ont été établies grâce à des expériences menées sur la drosophile (Drosophila melanogaster). Elles

Plus en détail

Le gène, de l'adn aux protéines

Le gène, de l'adn aux protéines 13/10/2011 - Par Claude Sauter Le gène, de l'adn aux protéines La vie d'un gène, de sa duplication à la fabrication d'une protéine pour laquelle il code, est une succession d'étapes cruciales. Ce dossier

Plus en détail

Cours 3 : Bases de la génétique, transcription, synthèse des protéines, structures des protéines, enzymes

Cours 3 : Bases de la génétique, transcription, synthèse des protéines, structures des protéines, enzymes Cours 3 : Bases de la génétique, transcription, synthèse des protéines, structures des protéines, enzymes Partie 1 : Bases de la génétique, transcription, synthèse des protéines I) Les gènes contrôlent

Plus en détail

Expression, stabilité et variation du patrimoine génétique Expression du patrimoine génétique

Expression, stabilité et variation du patrimoine génétique Expression du patrimoine génétique Thème I A Chapitre 3 Expression, stabilité et variation du patrimoine génétique Expression du patrimoine génétique Introduction : - gène = portion d ADN = information détermination des caractères [phénotype]

Plus en détail

Biologie Moléculaire

Biologie Moléculaire Biologie Moléculaire Sommaire Des liaisons chimiques à la structure des acides nucléiques La Transcription Maturation du transcrit La Traduction La Réplication Les Télomères 1 Des liaisons chimiques à

Plus en détail

CHAPITRE III : Synthèse Protéique. ADN ARN Protéines

CHAPITRE III : Synthèse Protéique. ADN ARN Protéines CHAPITRE III : Synthèse Protéique Introduction : L information contenue dans l ADN, c'est-à-dire le matériel génétique, se présente sous forme de séquences nucléotidiques précises, alignées sur les brins

Plus en détail

Toutes les caractéristiques d'un organisme vivant sont déterminées par le type de protéines que fabrique cet être vivant. Ce qui différencie un être

Toutes les caractéristiques d'un organisme vivant sont déterminées par le type de protéines que fabrique cet être vivant. Ce qui différencie un être 2 L ADN ET LES PROTÉINES : GÉNÉRALITÉS Toutes les caractéristiques d'un organisme vivant sont déterminées par le type de protéines que fabrique cet être vivant. Ce qui différencie un être vivant d'un autre,

Plus en détail

II ASPECTS BIOCHIMIQUES DE LA CHROMATINE

II ASPECTS BIOCHIMIQUES DE LA CHROMATINE II ASPECTS BIOCHIMIQUES DE LA CHROMATINE STRUCTURE ET ORGANISATION DES ACIDES NUCLEIQUES (VENDREDI 13 NOVEMBRE) Professeur Jean CAMBAR Laboratoire de Biologie cellulaire Faculté de Pharmacie de Bordeaux

Plus en détail

QCM Biologie Moléculaire

QCM Biologie Moléculaire QCM Biologie Moléculaire 1. Information génétique 1. L information génétique eucaryote est supportée par : A. De l ADN B. De l ARN C. Des molécules bicaténaires de polymères de nucléotides D. Des séquences

Plus en détail

Chapitre 5 : La transcription. Professeur Joël LUNARDI

Chapitre 5 : La transcription. Professeur Joël LUNARDI Chapitre 5 : La transcription UE1 : Biochimie Biologie moléculaire Professeur Joël LUNARDI Année universitaire 2011/2012 Université Joseph Fourier de Grenoble - Tous droits réservés. Chapitre 5. La transcription

Plus en détail

Chapitre 3 : La cellule bactérienne, génétique et synthèse protéique

Chapitre 3 : La cellule bactérienne, génétique et synthèse protéique Chapitre 3 : La cellule bactérienne, génétique et synthèse protéique Attention, ce cours suppose la connaissance de notions de base en génétique, notamment les notions de transcription, traduction ainsi

Plus en détail

3. L'ARN: Structure, Diffférents Types Et Propriétés tructure assification des ARN ARN ribosoinaux (ARNr) synthétisés dans le noyau

3. L'ARN: Structure, Diffférents Types Et Propriétés tructure assification des ARN ARN ribosoinaux (ARNr) synthétisés dans le noyau 3. L'ARN: Structure, Diffférents Types Et Propriétés Structure Les ARN sont des polymères de RiboNucléotides liés par des liaisons phosophodiester 5'-3'. Les bases azotées sont A-U, C-G. Le sucre est le

Plus en détail

CHAPITRE I SERIE QCM N 4

CHAPITRE I SERIE QCM N 4 CHAPITRE I SERIE QCM N 4 Question n 1: Cocher la ou les affirmations exacte(s). Un kératinocyte : A. est repoussé vers la surface au fur et à mesure du temps. B. est une cellule différenciée qui fait partie

Plus en détail

GENETIQUE. La génétique est l étude de la transmission des caractères héréditaires et de ses anomalies.

GENETIQUE. La génétique est l étude de la transmission des caractères héréditaires et de ses anomalies. GENETIQUE La génétique est l étude de la transmission des caractères héréditaires et de ses anomalies. I- BASES BIOCHIMIQUES DE LA GENETIQUE L ADN est le support de l information génétique, c est à dire

Plus en détail

Chap 8 : De l ADN à la protéine

Chap 8 : De l ADN à la protéine Chap 8 : De l ADN à la protéine Transcription et Traduction animation I/ Transcription On appelle transcription le processus permettant le passage de l ADN à l ARN (copie ADN en ARN). Au sens large, ce

Plus en détail

FLUX D INFORMATION GÉNÉTIQUE

FLUX D INFORMATION GÉNÉTIQUE FLUX D INFORMATION GÉNÉTIQUE 3 TRADUCTION C est le mécanisme par lequel le flux d information va passer de la forme acide nucléique (alphabet à 4 lettres) à la forme protéine (alphabet à 20 lettres) selon

Plus en détail

Fiche pédagogique : De l ADN aux protéines. Les secrets de l expression de l information génétique.

Fiche pédagogique : De l ADN aux protéines. Les secrets de l expression de l information génétique. Fiche pédagogique : De l ADN aux protéines. Les secrets de l expression de l information génétique. Pourquoi êtes-vous blonds? bruns? chauves? Pourquoi avez-vous les yeux bleus? Pourquoi ressemblez-vous

Plus en détail

Série : STL Spécialité biotechnologies SESSION 2014 BACCALAURÉAT TECHNOLOGIQUE

Série : STL Spécialité biotechnologies SESSION 2014 BACCALAURÉAT TECHNOLOGIQUE BACCALAURÉAT TECHNLGIQUE Série : STL Spécialité biotechnologies SESSIN 2014 CBSV : sous épreuve coefficient 4 Biotechnologies : sous épreuve coefficient 4 Durée totale de l épreuve: 4 heures Les sujets

Plus en détail

GENETIQUE MOLECULAIRE. Traduction de l ADN. Chargée du module: A.Tiar Faculté de Médecine d Annaba

GENETIQUE MOLECULAIRE. Traduction de l ADN. Chargée du module: A.Tiar Faculté de Médecine d Annaba GENETIQUE MOLECULAIRE Traduction de l ADN Chargée du module: A.Tiar Faculté de Médecine d Annaba 2008-2009 Introduction La traduction est le passage de séquences de nucléotides à des séquences d acides

Plus en détail

Chapitre 5: Evolution de la biodiversité

Chapitre 5: Evolution de la biodiversité Chapitre 5: Evolution de la biodiversité Constat: Tous les êtres vivants ont la même structure (cellules, MO) et pourtant ils ont beaucoup évolué au cours des temps géologiques. Problème: Par quels mécanismes

Plus en détail

Collège Notre Dame de Jamhour. THEME 1A : Expression, stabilité et variation du patrimoine génétique

Collège Notre Dame de Jamhour. THEME 1A : Expression, stabilité et variation du patrimoine génétique Collège Notre Dame de Jamhour Classe : 1 ère S THEME 1A : Expression, stabilité et variation du patrimoine génétique Chapitre 3 : L expression du patrimoine génétique TD- 5 : La protéosynthèse, un processus

Plus en détail

Cours Biologie cellulaire ULBI 101 _ L1-S1

Cours Biologie cellulaire ULBI 101 _ L1-S1 Cours Biologie cellulaire ULBI 101 _ L1-S1 RMI_Partie 2-1 Le Noyau et la Transcription 5- Définition des organites et des fonctions associées 5.1 Noyau : ADN et information génétique - Généralités - Structure

Plus en détail

Cours de Biologie Cellulaire L1 2006/2007

Cours de Biologie Cellulaire L1 2006/2007 Cours de Biologie Cellulaire L1 2006/2007 Qu est ce que la biologie cellulaire? La biologie cellulaire étudie les cellules et leurs organites, les processus vitaux qui s'y déroulent ainsi que les mécanismes

Plus en détail

Nom : Groupe : Date : 1 LES RESPONSABLES DES CARACTÈRES CHEZ LES ÊTRES VIVANTS (p. 350-358)

Nom : Groupe : Date : 1 LES RESPONSABLES DES CARACTÈRES CHEZ LES ÊTRES VIVANTS (p. 350-358) CHAPITRE 811 STE Questions 1 à 17, A, B. Verdict 1 LES RESPONSABLES DES CARACTÈRES CHEZ LES ÊTRES VIVANTS (p. 350-358) 1. Observez les deux cellules ci-contre. a) Sous quelle forme apparaît l ADN dans

Plus en détail

La cellule, unité de vie

La cellule, unité de vie Chapitre 13 luminastock Fotolia.com La cellule, unité de vie Savoirs à à acquérir Savoirs à acquérir Organisation de base des cellules animales : savoir reconnaître sur un schéma fourni l organisation

Plus en détail

FLUX D INFORMATION GÉNÉTIQUE

FLUX D INFORMATION GÉNÉTIQUE FLUX D INFORMATION GÉNÉTIQUE 2 MÉCANISME GÉNÉRAL DE LA TRANSCRIPTION La transcription est une biosynthèse d ARN qui repose, comme celle de l ADN, sur la complémentarité des bases. Ce processus présente

Plus en détail

Cours de physiologie Cellulaire LES RIBOSOMES

Cours de physiologie Cellulaire LES RIBOSOMES 1 LES RIBOSOMES I. Introduction Seul le microscope électronique permet d observer ces organites décrits pour la première fois par Palade en 1953. Présents dans toutes les cellules, les ribosomes sont situés

Plus en détail

Du gène à la protéine Campbell, 4 ème édition, chapitre 17. Automne 2013, 101-NYA-05

Du gène à la protéine Campbell, 4 ème édition, chapitre 17. Automne 2013, 101-NYA-05 Du gène à la protéine Campbell, 4 ème édition, chapitre 17 Automne 2013, 101-NYA-05 1 Objectif général à l issue de ce cours Schématiser les principales étapes de la synthèse des protéines en identifiant

Plus en détail

Base moléculaire de l'hérédité structure de l'a.d.n et l'a.r.n

Base moléculaire de l'hérédité structure de l'a.d.n et l'a.r.n Base moléculaire de l'hérédité structure de l'a.d.n et l'a.r.n Introduction : La démonstration par Watson et Crick en 1953, que l acide désoxyribonucléique avait une structure en double hélice est considérée

Plus en détail

Cellules procaryotes (toujours unicellulaire) Cellules eucaryotes (unicellulaire ou pluricellulaire)

Cellules procaryotes (toujours unicellulaire) Cellules eucaryotes (unicellulaire ou pluricellulaire) 4- Organisation structurale et fonctionnelle des cellules Organismes unicellulaires Organismes pluricellulaires cellule Cellules procaryotes (toujours unicellulaire) Cellules eucaryotes (unicellulaire

Plus en détail

PAES 2010-2011 STAGE DE PRÉ RENTRÉE UE 2

PAES 2010-2011 STAGE DE PRÉ RENTRÉE UE 2 PAES 2010-2011 STAGE DE PRÉ RENTRÉE UE 2 Introduction Théorie cellulaire : toute cellule est issue d une cellule L information génétique est transmise aux 2 cellules filles à chaque division Le génome

Plus en détail

«Nb. Pour la correction contacter le site web :

«Nb. Pour la correction contacter le site web : L.S. Abdel Aziz Khouja Devoir de synthèse n Kélibia Sciences de la Vie et de la Terre Date : 07/0/008 Coef : Durée : h Cl: ème Sc Ex et Mr. Kordoghli M ed «Nb. Pour la correction contacter le site web

Plus en détail

1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16.

1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 1. Indiquer ce qu est un gène. 2. Décrire la structure de la molécule d ADN. 3. Indiquer ce que sont les allèles d un gène. 4. Indiquer ce qu est le génotype. 5. Indiquer ce qu est le phénotype. 6. Citer

Plus en détail

GENETIQUE. la division cellule. durant la division cellule. Ai Aristote Mendel. Platon. Information génétique. Chromosome

GENETIQUE. la division cellule. durant la division cellule. Ai Aristote Mendel. Platon. Information génétique. Chromosome Molécules ADN Division cellulaire Synthèse des protéines. En Lien: Campbell, Reece,2déd./Biologie./chap.13 1 En Lien: Campbell, Reece,2déd./Biologie./chap.13 2 1 Chromosome Phénotype: l'apparence : structures

Plus en détail

FONCTIONS DES GENES, TRANSCRIPTION ET TRADUCTION

FONCTIONS DES GENES, TRANSCRIPTION ET TRADUCTION FONCTIONS DES GENES, TRANSCRIPTION ET TRADUCTION I. Transcription et propriétés de l ARN La transcription est la synthèse d un ARN à partir d un ADN double brin. La transcription est catalysée par une

Plus en détail

dans la cellule, où se trouve la substance responsable de l hérédité? Génétique quelle est la substance responsable de l hérédité?

dans la cellule, où se trouve la substance responsable de l hérédité? Génétique quelle est la substance responsable de l hérédité? dans la cellule, où se trouve la substance responsable de l hérédité? Génétique acetabularia sp. Pr. R. Raynal Questions Si l'information était contenue dans le cytoplasme de l'ovule, de quelle couleur

Plus en détail

LES BASES MOLÉCULAIRES DE L HÉRÉDITÉ Archibald Garrod Reginald Punnett and William Bateson 1907

LES BASES MOLÉCULAIRES DE L HÉRÉDITÉ Archibald Garrod Reginald Punnett and William Bateson 1907 ADN : matériel génétique LES BASES MOLÉCULAIRES DE L HÉRÉDITÉ 1909 Archibald Garrod Reginald Punnett and William Bateson 1907 Du gène à la protéine Les protéines représentent le lien entre le génotype

Plus en détail

Comment la Souris fait de la souris avec des graines?

Comment la Souris fait de la souris avec des graines? Comment la Souris fait de la souris avec des graines? d après «10 clés pour la Biologie» de J. Tavlitzki «[ ] La Souris, l Ecureuil, le Lapin mangent des graines. La Souris fait de la souris, l Ecureuil

Plus en détail

La traduction. Synthèse des protéines: La machinerie. Composition des ribosomes procaryotes Protéines ribosomales ARNs ribosomiques.

La traduction. Synthèse des protéines: La machinerie. Composition des ribosomes procaryotes Protéines ribosomales ARNs ribosomiques. La traduction 1 triplet de nucléotide sur l ARN m (codon) 1 acide aminé Synthèse des protéines: La machinerie Le mécanisme et les éléments : polypeptide ribosome acide aminé Composition des ribosomes procaryotes

Plus en détail

LA TRANSCRIPTION. Introduction. I. Modalité générale de la transcription. II. Transcription chez les Procaryotes

LA TRANSCRIPTION. Introduction. I. Modalité générale de la transcription. II. Transcription chez les Procaryotes LA TRANSCRIPTION Introduction I. Modalité générale de la transcription II. Transcription chez les Procaryotes 1. L'ARN polymérase 2. Etapes de la transcription a. Initiation b. Elongation c. Terminaison

Plus en détail

La synthèse des protéines transcription code génétique traduction

La synthèse des protéines transcription code génétique traduction CEC André-Chavanne BIO 3 OS La synthèse des protéines transcription code génétique traduction I. La «Transcription» : de l ADN à l ARNm. L'adresse suivante permet d accéder à une ANIMATION sur la TRANSCRIPTION.

Plus en détail

MÉCANISMES MOLÉCULAIRES DE L EXPRESSION DES GÉNES : LA TRADUCTION OU BIOSYNTHÈSE DES PROTÉINES

MÉCANISMES MOLÉCULAIRES DE L EXPRESSION DES GÉNES : LA TRADUCTION OU BIOSYNTHÈSE DES PROTÉINES MÉCANISMES MOLÉCULAIRES DE L EXPRESSION DES GÉNES : LA TRADUCTION OU BIOSYNTHÈSE DES PROTÉINES I-Introduction - définition gène 5 A B C 3 transcription Traduction mrna AA1-AA2-AA3 AAn Protéines fonctionnelles

Plus en détail

LA TERRE DANS L UNIVERS, la vie et l évolution du vivant

LA TERRE DANS L UNIVERS, la vie et l évolution du vivant Thème 1 A Chapitre LA TERRE DANS L UNIVERS, la vie et l évolution du vivant (5 semaines) EXPRESSION, STABILITE ET VARIATION DU PATRIMOINE GENETIQUE Introduction : Les cellules de l'organisme, à l'exception

Plus en détail

Chapitre 1. La cellule : unité morphologique et fonctionnelle

Chapitre 1. La cellule : unité morphologique et fonctionnelle Chapitre 1. La cellule : unité morphologique et fonctionnelle 1. Historique de la biologie : Les premières cellules eucaryotes sont apparues il y a 3 milliards d années. Les premiers Homo Sapiens apparaissent

Plus en détail

CLASSE PREPARATOIRE QCM : TD supplémentaire... Révisions

CLASSE PREPARATOIRE QCM : TD supplémentaire... Révisions TD supplémentaire... Révisions CLASSE PREPARATOIRE QCM : 1- le phénotype moléculaire d une cellule a- est le même pour toutes les cellules de l organisme b- dépend des gènes qui se sont exprimés c- est

Plus en détail

AVL Liban 2011 Biologie Moléculaire et Organismes Modèles

AVL Liban 2011 Biologie Moléculaire et Organismes Modèles AVL Liban 2011 Biologie Moléculaire et Organismes Modèles Sami Khuri Department of omputer Science San José State University San José, alifornia, USA sami.khuri@sjsu.edu www.cs.sjsu.edu/faculty/khuri Plan

Plus en détail

Chapitre 7 : Structure de la cellule Le noyau cellulaire

Chapitre 7 : Structure de la cellule Le noyau cellulaire UE2 : Structure générale de la cellule Chapitre 7 : Structure de la cellule Le noyau cellulaire Professeur Michel SEVE Année universitaire 2010/2011 Université Joseph Fourier de Grenoble - Tous droits

Plus en détail

G.E. Wild, P. Papalia, M.J. Ropeleski, J. Faria et A.B.R. Thomson

G.E. Wild, P. Papalia, M.J. Ropeleski, J. Faria et A.B.R. Thomson 15 Applications des techniques de génie génétique à la gastro-entérologie et à l hépatologie : Paradigmes fondamentaux de la biologie moléculaire de la cellule G.E. Wild, P. Papalia, M.J. Ropeleski, J.

Plus en détail