DU GÈNE À LA PROTÉINE

Dimension: px
Commencer à balayer dès la page:

Download "DU GÈNE À LA PROTÉINE"

Transcription

1 1 DU GÈNE À LA PROTÉINE 1. Le génome et la notion de gène: Génome: ensemble du matériel génétique d'un individu. = patrimoine héréditaire Gène: région d'un brin d'adn dont la séquence code l'information nécessaire à la synthèse d'une protéine. Les gènes sont les sous-unités fonctionnelles de l'hérédité. La revue Nature dans son numéro du 21 octobre 2004 annonce que "le séquençage du génome humain est presque terminé". Le génome humain, selon l International Human Genome Sequencing Consoritum (IHGSC), compterait non pas 30'000 gènes (annonce de 2001) mais entre 20'000 et 25'000. Le génome des cellules eucaryotes semble contenir un large excès d'adn. Chez les mammifères, moins de 10% du génome serait utile à l'expression en protéine ou à la régulation de cette expression. Le génome est constitué par 3 types d'adn différents: 1. ADN "à copie localisée": environ 75% du génome, est formé de gènes présents en un seul exemplaire ou en un nombre limité de copies. 2. ADN répétitif et dispersé: environ 15% du génome, est caractérisé par de courtes séquences nucléotidiques (6 à 10 paires) répétées un très grand nombre de fois ( x) en de nombreuses régions du génome. 3. ADN satellite: environ 10% of génome, est constitué de séquences hautement répétitives, essentiellement localisées dans les régions des centromères et des télomères. La taille des gènes peut varier de quelques centaines à plusieurs dizaines de milliers de nucléotides. Cependant même les plus longs gènes n'utilisent qu'une faible portion de leur séquence pour coder l'information nécessaire à l'expression en protéine. régions codantes: exons régions non-codantes: introns Plus l'organisme est complexe, plus la quantité et la taille des introns est importante. Ainsi la présence d'introns sur l'adn d'organismes prokaryotes est extrêmement rare.

2 2 Certaines régions de l'adn sont impliquées dans la régulation de l'expression des gènes. Ces séquences de régulation sont généralement localisées en début (coté 5') ou en fin de gène (coté 3') et plus rarement à l'intérieur d'introns ou d'exons. Le gène: région de l'adn contenant l'information nécessaire à la synthèse d'une protéine. Le gène est souvent composé de parties codantes (= exons) et de parties non codantes (=introns)

3 3 2. Les acides ribonucléiques: L'information génétique est véhiculée et exprimée par l'intermédiaire de molécules polymères nommées Acides RiboNucléiques = ARN. 3 classes d'arn qui diffèrent suivant leur taille, localisation et fonction. 1. ARN messager = ARNm 2. ARN ribosomique = ARNr 3. ARN de transfert = ARNt ARNm: copie de la séquence codante d'un gène, servant de matrice pour l'expression en protéine. ARNr et ARNt: fournissent les structures et les outils nécessaires à l'expression de l'arn messager en protéine. Structure de l'arn: - chaînes polynucléotides - 4 bases AUGC, mais diffère de l'adn par la présence de bases Uracile (U) remplaçant les Thymines (T) - sucres de type ribose, en lieu et place de déoxyribose - un seul brin (monocaténaire) - ARNm possède une structure linéaire - ARNr et ARNt sont faits d'un brin fréquemment replié sur lui-même (conformation épingles à cheveux) et sont souvent associés à des protéines spécifiques. 3. La transcription: Dans un premier temps, un brin de l'adn est copié en une molécule voisine appelée ARN messager (ARNm). On dit que l'adn est transcrit. Ce processus appelé transcription est proche, dans son mécanisme, de la réplication de l'adn. La transcription s'effectue en 3 étapes successives: 1. Initiation 2. Elongation 3. Terminaison. L'initiation: débute lorsque l'arn polymérase s'associe à une région spécifique d'un brin d'adn appelée promoteur. L'élongation de la chaîne d'arn s'effectue par polymérisation successive de nucléotides dans le sens 5' - 3'. La terminaison intervient lorsqu'un signal indiquant la fin du gène est lu (séquence palindromique riche en Guanine et Cytosine suivie d'une région essentiellement composé d'adénine). A l'issue de la transcription, le brin d'arn synthétisé est appelé transcrit primaire car il est le négatif de la séquence complète du gène.

4 4 Du gène à la protéine: 4. La traduction: = processus permettant la synthèse d'une protéine à partir d'un brin d'arn messager. Au cours de ce processus qui se déroule dans le cytoplasme, les molécules d'arnm vont être traduites en protéines. On dit que l'arn a été traduit. Dans un premier temps, dans les cellules eucaryotes, les molécules ARNm nouvellement transcrites vont subir dans le cytoplasme un épissage (ou splicing en anglais) qui consiste à séparer dans l'arnm les portions qui seront traduites (exons) de celles qui ne le seront pas (introns). Puis au niveau des ribosomes va commencer la traduction proprement dite. Il y aura simultanément une "lecture" de l'arn accompagnée d'une synthèse de chaîne polypeptidique. L'ARNm sert de matrice à la synthèse du polypeptide. L'ARNm va glisser dans un sillon du ribosome où il va être décrypté par unité de trois bases consécutives (= codon). Chaque codon dirige l'addition d'un acide aminé particulier sur la protéine en formation. A chaque codon va être associé un acide aminé qui est amené au niveau du ribosome par un ARN de transfert (ARNt). L'ARNt fait donc le lien entre les nucléotides et acides aminés.

5 5 Shéma de la traduction: L'acide aminé va être ensuite lié par une liaison peptidique à l'acide aminé qui le précède dans la chaîne peptidique en cours de synthèse. La liaison est effectuée par des enzymes. (Polymérases - ARN dépendante) Un codon spécifique détermine le début de la traduction = codon d'initiation, qui est le plus souvent AUG, qui code pour une méthionine. Un autre codon spécifique (codon stop) détermine la fin de la traduction. C'est donc l'information génétique contenue dans la séquence linéaire de bases de l'adn qui dirige via un intermédiaire (ARN) la production d'une séquence linéaire d'acides aminés d'une protéine. Une modification génétique des bases de l'adn peut se traduire par une modification de la protéine produite. Cette chaîne de synthèse allant de l'adn aux protéines, en passant par l'arn a été appelée le "dogme central de la biologie moléculaire".

6 6 5. Le code génétique: code génétique: ensemble des règles de correspondance (code) permettant au message génétique d'être traduit par une cellule (passage d'un alphabet à 4 lettres (A, T/U, G, C)) et un produit écrit dans un alphabet de 20 lettres). Les 20 lettres correspondent aux 20 acides aminés. Alanine acide Aspartique inine Asparagine Cystéine Glutamine Acide Glutamique Glycine Histidine Isoleucine Ala Asp Asn Cys Gln Glu Gly His Ileu cine Lysine Methionine Phénylalanine Proline Serine Threonine Tryptophane Tyrosine Valine Phe Lys Met Pro Ser Thr Trp Tyr Val Les acides aminés et leur abréviation: Au sein du code génétique, chaque acide aminé est désigné par codon. Il existe 64 codons possibles (4 bases A,T,G,C 4x4x4 = 64 possibilités!). 61 codent les vingt acides aminés existant 3 sont des codons de terminaison (codons STOP: UAA, UGA et UAG) qui arrêtent la traduction. 64 possibilités mais seulement 20 acides aminés! plusieurs codons codent le même acide aminé le code est dit dégénéré (ou redondant). Le code génétique est identique pour la très grande majorité des espèces qu'elles soient animales, végétales ou appartenant au monde microbien. On dit que le code génétique est universel.

7 7 Le code génétique peut être représenté sous la forme du tableau suivant: 1 ère base U C A G UUU UUC UUA UUG CUU CUC CUA CUG AUU AUC AUA AUG AUG GUU GUC GUA GUG 2 ème base U C A G 3 ème base Phe UCU Ser UAU Tyr UGU Cys U Phe UCC Ser UAC Tyr UGC Cys C Ile Ile Ile Met fmet Val Val Val Val UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Ser Pro Pro Pro Pro Thr Thr Thr Thr Ala Ala Ala Ala UAA UAG CAU CAC CAA CAG AAU AAC AAA AAG GAU GAC GAA GAG STOP STOP His His Gln Gln Asn Asn Lys Lys Asp Asp Glu Glu UGA UGG CGU CGC CGA CGG AGU AGC AGA AGG GGU GGC GGA GGG STOP Trp Ser Ser Gly Gly Gly Gly A G U C A G U C A G U C A G Exemple: G T G G T A C C C G A G G T A G C C G C G T C G T T C G C A C C A U G G G C U C C A U C G G C G C A G C A A G C codon 1 codon 2 codon 3 codon 4 codon 5 codon 6 codon 7 codon 8 Méthionine Glycine Sérine Isoleucine Glycine Alanine Alanine Sérine

8 8 Schéma récapitulatif de la synthèse des protéines:

9 9 Résumé: Pour passer du gène à la protéine, deux étapes sont nécessaires: 1. LA TRANSCRIPTION: Cette étape fait une copie d un des deux brins d ADN en ARN. Cet ARN est appelé un ARN messager (ARNm). Il transporte l information génétique hors du noyau pour permettre la deuxième étape qui a lieu dans le cytoplasme. 2. LA TRADUCTION: Cette étape transforme le code de 4 lettres en code de 20 lettres. Elle nécessite différentes structures, comme les ribosomes et l ARN de transfert (ARNt) qui transporte les acides aminés. la séquence de bases d un gène détermine la séquence des acides aminés d une protéine. des parties de la séquence d ADN sont copiées en ARN (ARNm) pour la synthèse des protéines. la séquence des bases de l ARNm est lue par groupe de trois (codon) et traduite en acides aminés.

10 10 Exercice: A partir de la séquence suivante d un brin d ADN, donnez la séquence des acides aminés qui composent la protéine codée par ce gène. ATGTCCGAACTCGATTCGATACGTGTTTAGTACAACGATGCGGAGCGATT CATGGGATTAAAGATGATCATCGATACTTGCCAGATCATGCATGCATGCA TGCATGCATTCAGGAAAAAACGATCGATCCAGTCAGATCAGACTGCTGAT GGCATGCGATTGACGTCAG

Cours IFSI Rockefeller 2013 Dr Julie Marzais

Cours IFSI Rockefeller 2013 Dr Julie Marzais Cours IFSI Rockefeller 2013 Dr Julie Marzais Synthèse s Protéines Du co génétique g aux molécules du Vivant Fonction principale l information l génétique g L information est codée e dans l ADN l succession

Plus en détail

Sujets de mini-projets

Sujets de mini-projets Sujets de mini-projets Sujet I: Décodage neuronal Assistant responsable: Samuel.Gmehlin@epfl.ch et Lukas.Rytz@epfl.ch Motivation Certains neurones du cerveau sont corrélés avec des stimuli complexes, par

Plus en détail

LA SYNTHÈSE DES PROTÉINES

LA SYNTHÈSE DES PROTÉINES LA SYNTHÈSE DES PROTÉINES La transcription Information : dans le noyau (sous forme d'adn) Synthèse des protéines : dans le cytoplasme (au niveau des ribosomes du reticulum endoplasmique) L'ADN ne sort

Plus en détail

JE M ENTRAINE POUR ETRE AU TOP LE JOUR J

JE M ENTRAINE POUR ETRE AU TOP LE JOUR J JE M ENTRAINE POUR ETRE AU TOP LE JOUR J Exercice n 1 : du gène (brin non transcrit) à la protéine L'ocytocine et l'adh sont deux hormones peptidiques libérées par la post-hypophyse. Les séquences peptidiques

Plus en détail

CORRECTION DES EXERCICES DE GENETIQUE SYNTHESE PROTEIQUE : P 136-137

CORRECTION DES EXERCICES DE GENETIQUE SYNTHESE PROTEIQUE : P 136-137 CORRECTION DES EXERCICES DE GENETIQUE SYNTHESE PROTEIQUE : P 136-137 Exercice 1 p 171 : définir en une phrase les mots suivants Polypeptide : chaine de plusieurs acides aminés. Séquence protéinique : séquence

Plus en détail

Prédiction de gènes. Présentation du problème. Open Reading Frame. HMM (Modèles de Markov cachés) Fonctionnement Exemples Limites

Prédiction de gènes. Présentation du problème. Open Reading Frame. HMM (Modèles de Markov cachés) Fonctionnement Exemples Limites Présentation du problème Open Reading Frame Fonctionnement Exemples Limites Procaryotes versus eucaryotes Validation des résultats: 1) comparaison de séquences 2) utilisation de données statistiques HMM

Plus en détail

Chapitre 2. La synthèse protéique : la relation entre le génotype et le phénotype.

Chapitre 2. La synthèse protéique : la relation entre le génotype et le phénotype. Chapitre 2. La synthèse protéique : la relation entre le génotype et le phénotype. Les maladies génétiques comme la drépanocytose ou l'albinisme sont liées à des modifications du génotype des individus

Plus en détail

BACCALAUREAT TECHNOLOGIQUE SCIENCES ET TECHNOLOGIES DE LA SANTE ET DU SOCIAL BIOLOGIE ET PHYSIOPATHOLOGIE HUMAINES SESSION 2012

BACCALAUREAT TECHNOLOGIQUE SCIENCES ET TECHNOLOGIES DE LA SANTE ET DU SOCIAL BIOLOGIE ET PHYSIOPATHOLOGIE HUMAINES SESSION 2012 BACCALAUREAT TECHNOLOGIQUE SCIENCES ET TECHNOLOGIES DE LA SANTE ET DU SOCIAL BIOLOGIE ET PHYSIOPATHOLOGIE HUMAINES SESSION 2012 Durée : 3 h 30 Coefficient : 7 Avant de composer, le candidat s assurera

Plus en détail

BACCALAURÉAT GÉNÉRAL

BACCALAURÉAT GÉNÉRAL BACCALAURÉAT GÉNÉRAL SESSION 2016 ÉCOLOGIE AGRONOMIE et TERRITOIRES Épreuve n 6 Série S ÉPREUVE DU MERCREDI 22 JUIN 2016 Durée de l épreuve : 3 heures 30 Coefficient : 5 Aucun appareil électronique n est

Plus en détail

CHAPITRE 3 LA SYNTHESE DES PROTEINES

CHAPITRE 3 LA SYNTHESE DES PROTEINES CHAITRE 3 LA SYNTHESE DES ROTEINES On sait qu un gène détient dans sa séquence nucléotidique, l information permettant la synthèse d un polypeptide. Ce dernier caractérisé par sa séquence d acides aminés

Plus en détail

THEME 1 A EXPRESSION, STABILITE ET VARIATION DU PATRIMOINE GENETIQUE

THEME 1 A EXPRESSION, STABILITE ET VARIATION DU PATRIMOINE GENETIQUE THEME 1 A EXPRESSION, STABILITE ET VARIATION DU PATRIMOINE GENETIQUE CHAPITRE 3 L EXPRESSION DU PATRIMOINE GENETIQUE I. LA RELATION GENES-PROTEINES Les protéines interviennent dans le fonctionnement d

Plus en détail

CHAPITRE 3 : L'EXPRESSION DU PATRIMOINE GÉNÉTIQUE

CHAPITRE 3 : L'EXPRESSION DU PATRIMOINE GÉNÉTIQUE CHAPITRE 3 : L'EXPRESSION DU PATRIMOINE GÉNÉTIQUE LES PROTÉINES SONT LE RÉSULTAT DE L'EXPRESSION DES GÈNES On observe de nombreuses différences entre ces deux gènes; 1061 nucléotides pour l'allèle du groupe

Plus en détail

MÉCANISMES MOLÉCULAIRES DE L EXPRESSION DES GÉNES : LA TRADUCTION OU BIOSYNTHÈSE DES PROTÉINES

MÉCANISMES MOLÉCULAIRES DE L EXPRESSION DES GÉNES : LA TRADUCTION OU BIOSYNTHÈSE DES PROTÉINES MÉCANISMES MOLÉCULAIRES DE L EXPRESSION DES GÉNES : LA TRADUCTION OU BIOSYNTHÈSE DES PROTÉINES Le sens de lecture L ARN polymérase lit le brin matrice dans la direction 3 vers 5 de façon à synthétiser

Plus en détail

TRANSCRIPTION TRADUCTION

TRANSCRIPTION TRADUCTION 4 TRANSCRIPTION TRADUCTION Objectifs : définir transcription et traduction et donner leur localisation cellulaire sur un schéma, identifier les acteurs de la transcription (ARNpol, brin transcrit, ARNm)

Plus en détail

Alanine (Ala) Codons: GCT, GCC, GCA, GCG

Alanine (Ala) Codons: GCT, GCC, GCA, GCG A Alanine (Ala) Codons: GCT, GCC, GCA, GCG R Arginine (Arg) Le nourrisson ne peut pas la fabriquer L'arginine est fréquemment retrouvée dans les energy drinks. Depuis 2008, elle a été remplacée par la

Plus en détail

Solutions aux exercices

Solutions aux exercices Solutions aux exercices Chapitre 18 La génétique moléculaire Page 627 du manuel 1. Un échantillon d ADN contient des nucléotides A et C dans les proportions suivantes : A = 34 % et C = 16 %. Quelles sont

Plus en détail

BACCALAUREAT TECHNOLOGIQUE CHIMIE, BIOCHIMIE, SCIENCES DU VIVANT ET ENSEIGNEMENT SPECIFIQUE A LA SPECIALITE SCIENCES ET TECHNOLOGIES DE LABORATOIRE

BACCALAUREAT TECHNOLOGIQUE CHIMIE, BIOCHIMIE, SCIENCES DU VIVANT ET ENSEIGNEMENT SPECIFIQUE A LA SPECIALITE SCIENCES ET TECHNOLOGIES DE LABORATOIRE BAALAUREAT TEHNLGIQUE ANNALE ZER 2013 Epreuve : HIMIE, BIHIMIE, SIENES DU VIVANT ET ENSEIGNEMENT SPEIFIQUE A LA SPEIALITE Série SIENES ET TEHNLGIES DE LABRATIRE Sous-épreuve de himie, Biochimie, Sciences

Plus en détail

L'ordre et la nature des acides aminés (ou séquence) d un polypeptide dépend de la séquence des nucléotides de l ADN du gène qui le code.

L'ordre et la nature des acides aminés (ou séquence) d un polypeptide dépend de la séquence des nucléotides de l ADN du gène qui le code. L'ordre et la nature des acides aminés (ou séquence) d un polypeptide dépend de la séquence des nucléotides de l ADN du gène qui le code. Une mutation, peut entraîner une modification de la séquence des

Plus en détail

Acides Nucléiques. ADN et ARN Unités de base : les nucléotides donc les nucléotides = monomères ADN et ARN = polynucléotides = polymères

Acides Nucléiques. ADN et ARN Unités de base : les nucléotides donc les nucléotides = monomères ADN et ARN = polynucléotides = polymères Acides Nucléiques ADN et ARN Unités de base : les nucléotides donc les nucléotides = monomères ADN et ARN = polynucléotides = polymères Structure d un nucléotide Tous composés d une base azotée, d un sucre

Plus en détail

Figure 1. Schéma général d une cellule d un organisme vivant terrien. En rouge : l ADN, compacté dans la cellule. La structure simplifiée d un

Figure 1. Schéma général d une cellule d un organisme vivant terrien. En rouge : l ADN, compacté dans la cellule. La structure simplifiée d un Iconographie Figure 1. Schéma général d une cellule d un organisme vivant terrien. En rouge : l ADN, compacté dans la cellule. La structure simplifiée d un fragment d ADN a été obtenue avec le logiciel

Plus en détail

BACCALAURÉAT PROFESSIONNEL SUJET

BACCALAURÉAT PROFESSIONNEL SUJET SESSION 2011 France métropolitaine BACCALAURÉAT PROFESSIONNEL ÉPREUVE N 5 SCIENCES APPLIQUÉES ET TECHNOLOIE Option : Conduite et gestion de l élevage canin et félin Durée : 2 heures Matériel(s) et document(s)

Plus en détail

DE L ADN AUX PROTÉINES LES ÉTAPES

DE L ADN AUX PROTÉINES LES ÉTAPES DE L ADN AUX PROTÉINES LES ÉTAPES L ADN (acide désoxyribonucléique) Situé dans le noyau, l ADN constitue le matériel génétique noyau Double hélice d ADN cytoplasme LES NUCLEOTIDES (ADN et ARNs) Une classe

Plus en détail

Quelques termes-clef de biologie moléculaire et leur définition

Quelques termes-clef de biologie moléculaire et leur définition Acide aminé (AA) Quelques termes-clef de biologie moléculaire et leur définition Isabelle Quinkal INRIA Rhône-Alpes Septembre 2003 Petite molécule dont l enchaînement compose les protéines - on dit qu

Plus en détail

La synthèse des protéines transcription code génétique traduction

La synthèse des protéines transcription code génétique traduction CEC André-Chavanne BIO 3 OS La synthèse des protéines transcription code génétique traduction I. La «Transcription» : de l ADN à l ARNm. L'adresse suivante permet d accéder à une ANIMATION sur la TRANSCRIPTION.

Plus en détail

NUMEROTATION NATURELLE DES ACIDES AMINES

NUMEROTATION NATURELLE DES ACIDES AMINES Jean-Nicolas Maisonnier Le 22 novembre 2008 jean.nicolas@maisonnier.com NUMEROTATION NATURELLE DES ACIDES AMINES LE POINT SUR LES INVESTIGATIONS DU GROUPE BENA Le code génétique atteste d une numérotation

Plus en détail

dans la cellule, où se trouve la substance responsable de l hérédité? Génétique quelle est la substance responsable de l hérédité?

dans la cellule, où se trouve la substance responsable de l hérédité? Génétique quelle est la substance responsable de l hérédité? dans la cellule, où se trouve la substance responsable de l hérédité? Génétique acetabularia sp. Pr. R. Raynal Questions Si l'information était contenue dans le cytoplasme de l'ovule, de quelle couleur

Plus en détail

III. GENE, CODE GENETIQUE ET SYNTHESE DES PROTEINES

III. GENE, CODE GENETIQUE ET SYNTHESE DES PROTEINES le caryotype. De nouvelles techniques de marquage des chromosomes directement sur coupes tissulaires (FISH) ou in vitro ( C G H ) (Fig. 14) ont été développées ces dernières années et permettent d étudier

Plus en détail

La synthèse des protéines

La synthèse des protéines La synthèse des protéines exemple vers théorie Rappel : le phénotype correspond à l'ensemble des caractéristiques d'un individu. Ces caractéristiques peuvent s'observer à différentes échelles. Un caractère

Plus en détail

Eléments primordiaux de biologie moléculaire

Eléments primordiaux de biologie moléculaire Eléments primordiaux de biologie moléculaire Pourquoi s intéresser au matériel génétique? Base de l information génétique Tissu Cellule Noyau Organisme entier Lieu où est localisé l ADN Mol d ADN qui est

Plus en détail

BIOLOGIE. 1re année. Santé. VISA pour la 1 re année Santé. 2 e édition. Marie-Claude Descamps. Préparer et réussir son entrée en PACES/L1 Santé 100%

BIOLOGIE. 1re année. Santé. VISA pour la 1 re année Santé. 2 e édition. Marie-Claude Descamps. Préparer et réussir son entrée en PACES/L1 Santé 100% 100% 1re année Santé Médecine Pharmacie Dentaire Sage-Femme Marie-Claude Descamps BILGIE VISA pour la 1 re année Santé Préparer et réussir son entrée en PACES/L1 Santé Toutes les notions du Lycée requises

Plus en détail

INSTITUT NATIONAL DE PODOLOGIE, PARIS, SAINTE-ANNE, 2013

INSTITUT NATIONAL DE PODOLOGIE, PARIS, SAINTE-ANNE, 2013 3_Pedicure_podologue_2e ed._concours 170x240 mardi24/06/14 11:57 Page211 4 INSTITUT NATIONAL DE PODOLOGIE, PARIS, SAINTE-ANNE, 2013 Durée de l épreuve : 2 heures. Cette épreuve est notée sur 40 points.

Plus en détail

Spécialité Sciences Physiques et Chimiques en Laboratoire

Spécialité Sciences Physiques et Chimiques en Laboratoire BACCALAURÉAT TECHNOLOGIQUE Série : STL Spécialité Sciences Physiques et Chimiques en Laboratoire SESSION 2014 CBSV : sous épreuve coefficient 4 Sciences physiques et chimiques en laboratoire : sous épreuve

Plus en détail

Séquence 4. Génétique et évolution : le brassage génétique et sa contribution à la diversité génétique, et processus de diversification du vivant

Séquence 4. Génétique et évolution : le brassage génétique et sa contribution à la diversité génétique, et processus de diversification du vivant Séquence 4 Génétique et évolution : le brassage génétique et sa contribution à la diversité génétique, et processus de diversification du vivant Sommaire Chapitre 1. Prérequis Chapitre 2. La reproduction

Plus en détail

III - Régulation du métabolisme A) X B) Transcription

III - Régulation du métabolisme A) X B) Transcription BPV : Physiologie Bactérienne UE: 5 Semaine : n 9 (du 02/11/2015 au 06/11/2015 Date : 03/11/2015 Heure : de 9h-10h Professeur : Pr. Romond Binôme : n 54 Correcteur : 53 Aucune remarque particulière du

Plus en détail

Biologie Moléculaire et Organismes Modèles

Biologie Moléculaire et Organismes Modèles Biologie Moléculaire et Organismes Modèles Sami Khuri Department of Computer Science San José State University khuri@cs.sjsu.edu Usine de Protéines Les protéines sont responsables de la plupart des fonctions

Plus en détail

MÉCANISMES MOLÉCULAIRES DE L EXPRESSION DES GÉNES : LA TRADUCTION OU BIOSYNTHÈSE DES PROTÉINES

MÉCANISMES MOLÉCULAIRES DE L EXPRESSION DES GÉNES : LA TRADUCTION OU BIOSYNTHÈSE DES PROTÉINES MÉCANISMES MOLÉCULAIRES DE L EXPRESSION DES GÉNES : LA TRADUCTION OU BIOSYNTHÈSE DES PROTÉINES I-Introduction - définition gène 5 A B C 3 transcription Traduction mrna AA1-AA2-AA3 AAn Protéines fonctionnelles

Plus en détail

IV Expression des gènes : transcription et traduction

IV Expression des gènes : transcription et traduction IV Expression des gènes : transcription et traduction La transcription et la traduction ont lieu dans des compartiments séparés chez les eucaryotes Procaryote 1/ Définition d un gène Gène : segment d ADN

Plus en détail

Cours 3 : Bases de la génétique, transcription, synthèse des protéines, structures des protéines, enzymes

Cours 3 : Bases de la génétique, transcription, synthèse des protéines, structures des protéines, enzymes Cours 3 : Bases de la génétique, transcription, synthèse des protéines, structures des protéines, enzymes Partie 1 : Bases de la génétique, transcription, synthèse des protéines I) Les gènes contrôlent

Plus en détail

L3-BH01 Cours n 12 Traduction (1)

L3-BH01 Cours n 12 Traduction (1) L3-BH01 Cours n 12 Traduction (1) Ce cours est présent sur le web à l adresse suivante : http://www.univ-orleans.fr/sciences/biochimie/l/ressources.htm 1 Plan Introduction I- Code génétique : comment l

Plus en détail

Université du Québec à Montréal

Université du Québec à Montréal RECUEIL D EXERCICES DE BICHIMIE 6. Les acides nucléiques 6.2. Réplication, transcription et traduction P P P CH 2 H N H N N NH NH 2 Université du Québec à Montréal 6.2. Réplication, transcription et traduction

Plus en détail

Le gène, de l'adn aux protéines

Le gène, de l'adn aux protéines 13/10/2011 - Par Claude Sauter Le gène, de l'adn aux protéines La vie d'un gène, de sa duplication à la fabrication d'une protéine pour laquelle il code, est une succession d'étapes cruciales. Ce dossier

Plus en détail

FONCTIONS DES GENES, TRANSCRIPTION ET TRADUCTION

FONCTIONS DES GENES, TRANSCRIPTION ET TRADUCTION FONCTIONS DES GENES, TRANSCRIPTION ET TRADUCTION I. Transcription et propriétés de l ARN La transcription est la synthèse d un ARN à partir d un ADN double brin. La transcription est catalysée par une

Plus en détail

Baccalauréat général Sciences de la vie et de la Terre

Baccalauréat général Sciences de la vie et de la Terre Baccalauréat général Sciences de la vie et de la Terre Épreuve obligatoire série S Partie 1 (5 points) Thème 1-: Expression, stabilité, variation du patrimoine génétique. Sujet : On cherche à montrer,

Plus en détail

Comment la Souris fait de la souris avec des graines?

Comment la Souris fait de la souris avec des graines? Comment la Souris fait de la souris avec des graines? d après «10 clés pour la Biologie» de J. Tavlitzki «[ ] La Souris, l Ecureuil, le Lapin mangent des graines. La Souris fait de la souris, l Ecureuil

Plus en détail

Expression des gènes Comparatif entre procaryotes et eucaryotes

Expression des gènes Comparatif entre procaryotes et eucaryotes Comparaison procaryotes/ 2TSbc Expression des gènes Comparatif entre procaryotes et eucaryotes La majeure partie des connaissances de biologie moléculaire a d'abord débuté par l'étude des phénomènes chez

Plus en détail

BACCALAURÉAT TECHNOLOGIQUE

BACCALAURÉAT TECHNOLOGIQUE BACCALAURÉAT TECHNOLOGIQUE Série : STL Spécialité biotechnologies SESSION 2014 CBSV : sous épreuve coefficient 4 Biotechnologies : sous épreuve coefficient 4 Durée totale de l épreuve: 4 heures Les sujets

Plus en détail

Biologie cellulaire. Cours 8 : Synthèse des protéines

Biologie cellulaire. Cours 8 : Synthèse des protéines Département des Troncs Communs Sciences de la Nature Faculté des Sciences de la Nature et de la Vie Université Abderrahmane Mira de Bejaia Biologie cellulaire Cours 8 : Synthèse des protéines Année universitaire

Plus en détail

Un peu de Génétique Médicale. Hélène Cavé UF de Biochimie et Biologie Moléculaire

Un peu de Génétique Médicale. Hélène Cavé UF de Biochimie et Biologie Moléculaire Un peu de Génétique Médicale Hélène Cavé UF de Biochimie et Biologie Moléculaire Les mutations mutations géniques mutations chromosomiques conséquences des mutations Maladies génétiques et transmission

Plus en détail

Chapitre 3 : L expression de l information génétique. Activité 1 : Les deux étapes de l expression de l information génétique

Chapitre 3 : L expression de l information génétique. Activité 1 : Les deux étapes de l expression de l information génétique Connaissances L'ADN contient des unités d'information appelées gènes. Le génome est l ensemble du matériel génétique d un organisme. Chez les eucaryotes, la transcription a lieu dans le noyau, la traduction

Plus en détail

Brin transcrit : chaine de l ADN qui, par complémentarité des nucléotides, sert de modèle pour la synthèse de l ARN messager

Brin transcrit : chaine de l ADN qui, par complémentarité des nucléotides, sert de modèle pour la synthèse de l ARN messager Fin du cours chap 5 La transcription : de l ADN à l ARN : Par définition, le brin transcrit est le brin d ADN complémentaire de l ARN : c est le brin qui sert à la synthèse de l ARN, donc ici le brin2.

Plus en détail

Traduction des ARNm : synthèse protéique

Traduction des ARNm : synthèse protéique Traduction des ARNm : synthèse protéique Traduction Notions générales. Traduction : synthèse d une protéine donnée à partir d un ARNm spécifique. Synthèse protéique localisée dans le cytoplasme (et la

Plus en détail

Chapitre 3 : La cellule bactérienne, génétique et synthèse protéique

Chapitre 3 : La cellule bactérienne, génétique et synthèse protéique Chapitre 3 : La cellule bactérienne, génétique et synthèse protéique Attention, ce cours suppose la connaissance de notions de base en génétique, notamment les notions de transcription, traduction ainsi

Plus en détail

5. Les interactions intermoléculaires. Questions fondamentales du chapitre 5:

5. Les interactions intermoléculaires. Questions fondamentales du chapitre 5: 5. Les interactions intermoléculaires Questions fondamentales du chapitre 5: Qu est qui détermine l état d un composé (i.e., gaz, liquide ou solide) aux conditions normales? Quels sont les types de forces

Plus en détail

C'est la conversion d'arnm en protéine, selon le code génétique. Seule la séquence ORF ( Open Reading Frame ) de l'arn est traduite.

C'est la conversion d'arnm en protéine, selon le code génétique. Seule la séquence ORF ( Open Reading Frame ) de l'arn est traduite. I_ Le langage génétique La traduction A. Structure des ARm C'est la conversion d'arm en protéine, selon le code génétique. Seule la séquence ORF ( Open Reading Frame ) de l'ar est traduite. L'AR sera traduit

Plus en détail

STRUCTURE ET FONCTION DES GÈNES ET DES CHROMOSOMES

STRUCTURE ET FONCTION DES GÈNES ET DES CHROMOSOMES Faculté de Médecine de Sousse Tunisie Année Universitaire 209-2010 Deuxième Année Médecine Support pédagogique illustré relatif au cours: STRUCTURE ET FONCTION DES GÈNES ET DES CHROMOSOMES Pr. Ag. ELGHEZAL

Plus en détail

Génétique. Kit Traduction. Réf : Français p 1. Version : 1106

Génétique. Kit Traduction. Réf : Français p 1. Version : 1106 Français p 1 Version : 1106 1. Instructions Ce kit vous fournit des molécules et des liaisons pour construire un modèle de d ARNm comprenant 15 nucléotides, dont une coiffe de méthyl-guanosine et une queue

Plus en détail

EXERCICES : DU GENE A LA PROTEINE : pages 64 65 66 EXERCICE 1 PAGE 64 : PHENOTYPES ASSOCIES A UN ENZYME : G6PD

EXERCICES : DU GENE A LA PROTEINE : pages 64 65 66 EXERCICE 1 PAGE 64 : PHENOTYPES ASSOCIES A UN ENZYME : G6PD EXERCICES : DU GENE A LA PROTEINE : pages 64 65 66 EXERCICE 1 PAGE 64 : PHENOTYPES ASSOCIES A UN ENZYME : G6PD Question 1 : définir le phénotype à plusieurs échelles Enzyme G6PD active : eau oxygénée transformée

Plus en détail

Biologie 12 Examen de référence C Cahier d examen

Biologie 12 Examen de référence C Cahier d examen Biologie 12 Examen de référence C Cahier d examen Nombre de pages : 32 pages Durée de l examen : 2 heures 67 questions à choix multiple dans le Cahier d examen Temps supplémentaire permis : 60 minutes

Plus en détail

Cahier de texte de la classe 1 ère 4 - SVT

Cahier de texte de la classe 1 ère 4 - SVT Cahier de texte de la classe 1 ère 4 - SVT DATE SEQUENCE lundi 12 : revoir la fiche méthodologique «utiliser le microscope optique» (disponible sur le site du lycée) Lundi 12 1 er contact avec les élèves.

Plus en détail

TP 4: de l ADN à l ARNm les étapes de la transcription

TP 4: de l ADN à l ARNm les étapes de la transcription TP 4: de l ADN à l ARNm les étapes de la transcription Lycée E. Delacroix 1 ère S Programme 2011 Activité 1: la localisation de la synthèse des protéines Objectif de l autoradiographie Marquer l emplacement

Plus en détail

Problèmes préparatoires à l'intra III

Problèmes préparatoires à l'intra III Problèmes préparatoires à l'intra III 1. Les doubles liaisons dans les acides gras sont généralement de configuration. Réponse: cis 2. Les sels de sodium des acides gras sont utilisés dans la fabrication

Plus en détail

CPE Lyon ESA ESA Purpan ESCOM ESEO IGAL ISA ISAB - ISARA-Lyon ISEN Brest ISEN Lille ISEN Toulon ISEP LOUIS DE BROGLIE SELECTION FESIC

CPE Lyon ESA ESA Purpan ESCOM ESEO IGAL ISA ISAB - ISARA-Lyon ISEN Brest ISEN Lille ISEN Toulon ISEP LOUIS DE BROGLIE SELECTION FESIC CPE Lyon ESA ESA Purpan ESCOM ESEO IGAL ISA ISAB - ISARA-Lyon ISEN Brest ISEN Lille ISEN Toulon ISEP LOUIS DE BROGLIE SELECTION FESIC ADMISSION en 1ère ANNEE du 1er CYCLE 2006 EPREUVE DE SCIENCES DE LA

Plus en détail

Licence-Master Bioinformatique Contrôle continu 06/03/06. Correction

Licence-Master Bioinformatique Contrôle continu 06/03/06. Correction Licence-Master Bioinformatique Contrôle continu 06/03/06 Correction -«Vraies» questions de cours -«fausses» questions de cours: questions pour voir si pouviez imaginer une réponse crédible qui n était

Plus en détail

Partie 2: Expression génétique. Traduction

Partie 2: Expression génétique. Traduction Faculté des Sciences - Rabat Laboratoire de Microbiologie et Biologie Moléculaire -------------------------------------- Université Mohamed V - Agdal Faculté des Sciences B.P. 1014 - Rabat - MAROC Filière

Plus en détail

Cours de Biologie moléculaire de Licence professionnelle 2011

Cours de Biologie moléculaire de Licence professionnelle 2011 Cours de Biologie moléculaire de Licence professionnelle 2011 Sommaire 1. Introduction 2.1. La structure de l ADN 2.2. La structure de l ARN 2.3. Du gène à la protéine 2.3.1. La réplication 2.3.2. La transcription

Plus en détail

Chapitre 1 Les acides aminés : Structures. Professeur Michel SEVE

Chapitre 1 Les acides aminés : Structures. Professeur Michel SEVE UE1 : Biomolécules (1) : Acides aminés et protéines Chapitre 1 Les acides aminés : Structures Professeur Michel SEVE Année universitaire 2010/2011 Université Joseph Fourier de Grenoble - Tous droits réservés.

Plus en détail

Collège Notre Dame de Jamhour. THEME 1A : Expression, stabilité et variation du patrimoine génétique

Collège Notre Dame de Jamhour. THEME 1A : Expression, stabilité et variation du patrimoine génétique Collège Notre Dame de Jamhour Classe : 1 ère S THEME 1A : Expression, stabilité et variation du patrimoine génétique Chapitre 3 : L expression du patrimoine génétique TD- 5 : La protéosynthèse, un processus

Plus en détail

Les gènes, unité d information génétique :

Les gènes, unité d information génétique : Les gènes, unité d information génétique : Le gène est une portion de chromosome qui détermine un caractère héréditaire précis. Un même gène est présent sur chaque chromosome d une même paire et y occupe

Plus en détail

Toutes les caractéristiques d'un organisme vivant sont déterminées par le type de protéines que fabrique cet être vivant. Ce qui différencie un être

Toutes les caractéristiques d'un organisme vivant sont déterminées par le type de protéines que fabrique cet être vivant. Ce qui différencie un être 2 L ADN ET LES PROTÉINES : GÉNÉRALITÉS Toutes les caractéristiques d'un organisme vivant sont déterminées par le type de protéines que fabrique cet être vivant. Ce qui différencie un être vivant d'un autre,

Plus en détail

LA TRANSCRIPTION. Introduction. I. Modalité générale de la transcription. II. Transcription chez les Procaryotes

LA TRANSCRIPTION. Introduction. I. Modalité générale de la transcription. II. Transcription chez les Procaryotes LA TRANSCRIPTION Introduction I. Modalité générale de la transcription II. Transcription chez les Procaryotes 1. L'ARN polymérase 2. Etapes de la transcription a. Initiation b. Elongation c. Terminaison

Plus en détail

De la biologie molécualire à la génomique

De la biologie molécualire à la génomique De la biologie molécualire à la génomique Pierre Neuvial École Nationale de la Statistique et de l Administration Économique Méthodes statistiques pour la biologie Plan du cours 1 Introduction à la biologie

Plus en détail

Thème 1 : La Terre dans l Univers, la Vie et l évolution du vivant. Partie 1 : Expression, stabilité et variation du patrimoine génétique

Thème 1 : La Terre dans l Univers, la Vie et l évolution du vivant. Partie 1 : Expression, stabilité et variation du patrimoine génétique TP 6 : Du gène à la protéine (2) Thème 1 : La Terre dans l Univers, la Vie et l évolution du vivant Partie 1 : Expression, stabilité et variation du patrimoine génétique Chapitre 3 : L expression du patrimoine

Plus en détail

UE1 Atomes, Biomolécules, Génome PACES 2011-2012

UE1 Atomes, Biomolécules, Génome PACES 2011-2012 UE1 Atomes, Biomolécules, Génome Traduction et régulation (1) PACES 2011-2012 Sandrine Dabernat Code génétique et traduction 1- Les ARN de transfert 2- Les ARN ribosomaux et ribosomes 3- Le code génétique

Plus en détail

Filière SVI - S6 Module de Génétique et Biologie Moléculaire M21 Elément 2: Biologie Moléculaire l -Pr. Abdelkarim FILALI-MALTOUF

Filière SVI - S6 Module de Génétique et Biologie Moléculaire M21 Elément 2: Biologie Moléculaire l -Pr. Abdelkarim FILALI-MALTOUF Laboratoire de Microbiologie et Biologie Moléculaire Faculté des Sciences - Rabat Filière SVI - S6 Module de Génétique et Biologie Moléculaire M21 Elément 2: Biologie Moléculaire l -Pr. Abdelkarim FILALI-MALTOUF

Plus en détail

Parlons «protéines» La réponse à ces questions se résume en un mot : les «protéines».

Parlons «protéines» La réponse à ces questions se résume en un mot : les «protéines». Parlons «protéines» Connaissez-vous le point commun entre le collagène, qui confère la souplesse à votre peau ; la kératine qui constitue vos ongles et vos cheveux ; l insuline qui régule le taux de sucre

Plus en détail

PHYSIOLOGIE CELLULAIRE

PHYSIOLOGIE CELLULAIRE PHYSIOLOGIE CELLULAIRE Licence STAPS 1ère année Stéphane TANGUY Département STAPS Université d Avignon et des pays de Vaucluse PHYSIOLOGIE CELLULAIRE CELLULE molécules atomes CHIMIE TISSU ORGANISME ORGANE

Plus en détail

I- Unités monomériques: Nucléotides

I- Unités monomériques: Nucléotides B- Les Acide nucléiques 1 acide nucléique = polymères de nucléotides Capacité: autoduplication transport et transmission de l information > Programme des protéines produites par chaque cellule base >reproduction

Plus en détail

1) Donner la polarité de ce fragment de gène (brin transcrit) et la séquence d ADN complémentaire.

1) Donner la polarité de ce fragment de gène (brin transcrit) et la séquence d ADN complémentaire. FACULTE DE MEDECINE D'ALGER CBM DERGANA MODULE DE GENETIQUE- SERIE DE TD N 3 Exercice 1 On se propose d étudier la synthèse du facteur IX, un facteur plasmatique de la coagulation. La séquence ci dessous

Plus en détail

Biochimie-réactions cellulaires L2 Biologie-parcours BC et BCB-S3

Biochimie-réactions cellulaires L2 Biologie-parcours BC et BCB-S3 Biochimie-réactions cellulaires L2 Biologie-parcours BC et BCB-S3 Responsables de l UE: James Sturgis (AMU)-Marie-Jeanne Papandréou (P1) Organisation de l UE: 3 parties - COURS 28h 1 ère partie: Protéines

Plus en détail

Biologie Moléculaire et Organismes Modèles

Biologie Moléculaire et Organismes Modèles Biologie Moléculaire et Organismes Modèles Sami Khuri Department of Computer Science San José State University khuri@cs.sjsu.edu Plan du Cours Biologie Moléculaire et Organismes Modèles Qu est-ce que la

Plus en détail

STRUCTURE DES PROTEINES

STRUCTURE DES PROTEINES STRUCTURE DES PRTEIES STRUCTURE DES PRTEIES!Les protéines sont formées à partir d un répertoire (alphabet) de 20 acides α-aminés naturels (configuration L) Chaine Latérale Amine primaire R 2 carbone α

Plus en détail

5-1. Introduction 5-2. L appareil de traduction et son fonctionnement - Les ribosomes - Les ARNt - Les ARNt Synthétases

5-1. Introduction 5-2. L appareil de traduction et son fonctionnement - Les ribosomes - Les ARNt - Les ARNt Synthétases 5 - la traduction 5-1. Introduction 5-2. L appareil de traduction et son fonctionnement - Les ribosomes - Les ARNt - Les ARNt Synthétases 5-3. Les étapes de la synthèse protéiques -Initiation - Élongation

Plus en détail

De l ADN aux protéines

De l ADN aux protéines Biochimie - Biologie moléculaire De l DN aux protéines Julien FRÉ Institut de Formation en Soins Infirmiers 1 ère nnée nnée universitaire 2014-2015 Introduction DN réplication transcription traduction

Plus en détail

Macromolécules et la Cellule

Macromolécules et la Cellule Macromolécules et la Cellule Macromolécules Campbell chapitre 5 Macromolécules Définition: Molécule géante formée par l assemblage de plusieurs petites molécules organiques Macromolécules Définition:

Plus en détail

L3-BH01 Cours n 10 Modifications post-transcriptionnelles

L3-BH01 Cours n 10 Modifications post-transcriptionnelles L3-BH01 Cours n 10 Modifications post-transcriptionnelles Ce cours est présent sur le web à l adresse suivante : http://www.univ-orleans.fr/sciences/biochimie/l/ressources.htm Plan (cours n 10 & 11) Introduction

Plus en détail

GENETIQUE MOLECULAIRE. Traduction de l ADN. Chargée du module: A.Tiar Faculté de Médecine d Annaba

GENETIQUE MOLECULAIRE. Traduction de l ADN. Chargée du module: A.Tiar Faculté de Médecine d Annaba GENETIQUE MOLECULAIRE Traduction de l ADN Chargée du module: A.Tiar Faculté de Médecine d Annaba 2008-2009 Introduction La traduction est le passage de séquences de nucléotides à des séquences d acides

Plus en détail

Cahier de texte de la classe 1 ère 3 - SVT

Cahier de texte de la classe 1 ère 3 - SVT Cahier de texte de la classe 1 ère 3 - SVT DATE SEQUENCE jeudi 8 : revoir la fiche méthodologique «utiliser le microscope optique» (disponible sur le site du lycée) Jeudi 8 1 er contact avec les élèves.

Plus en détail

CHAPITRE III : Synthèse Protéique. ADN ARN Protéines

CHAPITRE III : Synthèse Protéique. ADN ARN Protéines CHAPITRE III : Synthèse Protéique Introduction : L information contenue dans l ADN, c'est-à-dire le matériel génétique, se présente sous forme de séquences nucléotidiques précises, alignées sur les brins

Plus en détail

1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16.

1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 1. Indiquer ce qu est un gène. 2. Décrire la structure de la molécule d ADN. 3. Indiquer ce que sont les allèles d un gène. 4. Indiquer ce qu est le génotype. 5. Indiquer ce qu est le phénotype. 6. Citer

Plus en détail

PC Brizeux AD N 2 Altmayer- Henzien 2015-2016. Approche documentaire N 2 Synthèse peptidique

PC Brizeux AD N 2 Altmayer- Henzien 2015-2016. Approche documentaire N 2 Synthèse peptidique P Brizeux AD N 2 Altmayer- Henzien 2015-2016 Approche documentaire N 2 Synthèse peptidique bjectif : Le but de cette approche documentaire est d analyser les stratégies de synthèse in vitro et in vivo

Plus en détail

La division cellulaire Chapitre 5 Anatomie

La division cellulaire Chapitre 5 Anatomie La division cellulaire Chapitre 5 Anatomie La division cellulaire est le mode de multiplication de toute cellule. Elle lui permet de se diviser en plusieurs cellules-filles (deux le plus souvent). C'est

Plus en détail

La traduction. Synthèse des protéines: La machinerie. Composition des ribosomes procaryotes Protéines ribosomales ARNs ribosomiques.

La traduction. Synthèse des protéines: La machinerie. Composition des ribosomes procaryotes Protéines ribosomales ARNs ribosomiques. La traduction 1 triplet de nucléotide sur l ARN m (codon) 1 acide aminé Synthèse des protéines: La machinerie Le mécanisme et les éléments : polypeptide ribosome acide aminé Composition des ribosomes procaryotes

Plus en détail

A T C G A T C G CORRECTION TD Ecole Manip RADIO (Montpellier) Base. Sucre 3. Base Purine Base Pyrimidine. G= Guanine C= Cytosine

A T C G A T C G CORRECTION TD Ecole Manip RADIO (Montpellier) Base. Sucre 3. Base Purine Base Pyrimidine. G= Guanine C= Cytosine CORRECTION TD 2 2011-2012 Question N1. Concernant la structure de l'adn (double brin) qu'elles sont la ou les réponses exactes? A) Dans un ADN, le rapport : nombre de A /nombre de G est égal à 1. B) Plus

Plus en détail

TD3: support du cours/td

TD3: support du cours/td TD3: support du cours/td Auteur: P RAG D BRUANT Livres de complément: -Maillet (Biologie cellulaire) Masson -Alberts (la cellule) Médecine-science Flammarion -Koolman (Atlas de poche de biochimie) Médecinescience

Plus en détail

Chapitre 14: La génétique

Chapitre 14: La génétique Chapitre 14: La génétique A) Les gènes et les protéines, ça te gêne? 1) a) Quel est l élément de base des vivants? Les cellules b) Qu a-t-elle en son centre? Un noyau c) Qu y retrouve-t-on sous forme de

Plus en détail

FACULTÉ DES ARTS ET SCIENCES DÉPARTEMENT DE CHIMIE

FACULTÉ DES ARTS ET SCIENCES DÉPARTEMENT DE CHIMIE Sigle du cours: CHM 3102 page 1 de 11 FACULTÉ DES ARTS ET SCIECES DÉPARTEMET DE CHIMIE SIGLE DU CURS: CHM 3102 TITRE DU CURS: Chimie bioanalytique avancée MS DES PRFESSEURS: Karen Waldron, Pierre Thibault

Plus en détail

Du génotype au phénotype, relation avec l environnement

Du génotype au phénotype, relation avec l environnement Du génotype au phénotype, relation avec l environnement Pré-requis (troisième et seconde) : Chaque individu présente les caractères de l'espèce avec des variations qui lui sont propres. C'est le résultat

Plus en détail

L usage de la calculatrice n est pas autorisé.

L usage de la calculatrice n est pas autorisé. DUREE : 2 heures. Dès que ce sujet vous est remis, assurez-vous qu il est complet. Ce sujet comporte 7 pages numérotées de 1/7 à 7/7. L usage de la calculatrice n est pas autorisé. Le sujet comporte 2

Plus en détail

BASES DE GENETIQUE. Y.LAMBREY- genetique-ifsi-2006 1

BASES DE GENETIQUE. Y.LAMBREY- genetique-ifsi-2006 1 BASES DE GENETIQUE Y.LAMBREY- genetique-ifsi-2006 1 ADN ET PROTEINES Y.LAMBREY- genetique-ifsi-2006 2 2 éléments fondamentaux pour la vie, les protéines et l ADN - PROTEINES, présentes partout, exercent

Plus en détail

Chapitre C. (ancien programme) (Nouveau programme) POLY-PREPAS AMIENS M.LAIGNIER ll.polyprepas@orange.fr

Chapitre C. (ancien programme) (Nouveau programme) POLY-PREPAS AMIENS M.LAIGNIER ll.polyprepas@orange.fr 1 Chapitre C LA SYNTHÈSE PROTÉIQUE (ancien programme) L expression du matériel génétique (Nouveau programme) Le phénotype macroscopique des individus est sous la dépendance des protéines. Le phénotype

Plus en détail