NOUVELLES APPROCHES GENOTYPIQUES POUR LE MONITORING DE RESISTANCE DU VIH AUX ARV DANS LES PAYS A RESSOURCES LIMITEES : CAS DU TCHAD

Dimension: px
Commencer à balayer dès la page:

Download "NOUVELLES APPROCHES GENOTYPIQUES POUR LE MONITORING DE RESISTANCE DU VIH AUX ARV DANS LES PAYS A RESSOURCES LIMITEES : CAS DU TCHAD"

Transcription

1 Université de Liège Faculté de Médecine Laboratoire de Référence Sida NOUVELLES APPROCHES GENOTYPIQUES POUR LE MONITORING DE RESISTANCE DU VIH AUX ARV DANS LES PAYS A RESSOURCES LIMITEES : CAS DU TCHAD Chatté Idékhim ADAWAYE Matricule : s Thèse présentée en vue de l obtention du grade de Docteur en Sciences Biomédicales et Pharmaceutiques Soutenue publiquement le 1 er décembre 2014 Jury : Danièle SONDAG-THULL Michel MOUTSCHEN Souad RAHMOUNI Carole DEVAUX Jacques PIETTE Jean RUELLE Nathalie JACOBS Patrick DE MOL Université de Liège (Présidente) Université de Liège (Promoteur) Université de Liège (Secrétaire) CRP-Santé de Luxembourg Université de Liège Université Catholique de Louvain Université de Liège Université de Liège Année Académique i

2 Entre, ce que je pense, ce que je veux dire, ce que je crois dire, ce que je dis, ce que vous avez envie d entendre, ce que vous croyez entendre, ce que vous entendez, ce que vous avez envie de comprendre, ce que vous croyez comprendre, ce que vous comprenez, il y a dix possibilités qu on ait des difficultés à communiquer. Mais essayons quand même Bernard Werber: Encyclopédie du savoir relatif et absolu. i

3 Table des matières Table des matières Dédicaces... v Remerciements... vi Liste des sigles et abréviations... ix Liste des tableaux... xi Liste des figures... xii Résumé... xiii CHAPITRE I - Introduction Générale... 1 I. Contexte et justification du sujet... 1 II. Généralités sur le VIH et le Sida Le Virus de l Immunodéficience Humaine (VIH) La diversité génétique des groupes et sous-types du VIH La situation du VIH/SIDA au Tchad Le monitoring biologique pour la prise en charge de l infection à VIH Evaluation des signes cliniques Mesure des lymphocytes CD Mesure de la charge virale Tests de résistance: le phénotypage (antivirogramme) et le génotypage Les mécanismes d action des antirétroviraux Inhibiteurs Nucléosidiques et Nucléotidiques de la Transcriptase Inverse (INTI) Inhibiteurs Non Nucléosidiques de la Transcriptase Inverse (INNTI) Inhibiteurs de la Protéase (IP) Inhibiteurs d Intégrase Inhibiteurs d entrée La problématique et les mécanismes de résistance du VIH aux ARV Problématique de la résistance du VIH aux ARV Mécanisme de résistance du VIH aux INTI Mécanisme de résistance du VIH-1 aux INNTI Mécanisme de résistance du VIH-1 aux IP Mécanisme de résistance du VIH-1 aux anti intégrases Mécanisme de résistance du VIH-1 aux inhibiteurs d entrée (de fusion) Mécanisme de résistance du VIH-1 aux inhibiteurs de CCR III. But, hypothèses, objectifs et plan du travail Le but de l étude Les hypothèses de recherche L objectif général Les objectifs spécifiques Le plan du travail CHAPITRE II- Matériel et méthodes II.1 Le matériel ii

4 Table des matières Matériel de collecte des données Matériel de prélèvement II.2 Les méthodes Site de l étude Description du site de l étude Type d étude Durée de l étude Taille de l échantillon Méthode d échantillonnage Critères d inclusion Critères d exclusion Procédure de recueil des données Procédure de collecte des échantillons Procédure d analyse des échantillons Mesure des lymphocytes TCD Mesure de la charge virale Techniques d amplification et de détection des mutations de résistance Détections des mutations ponctuelles de résistance (Allele-Specific PCR) Traitements des données et analyses statistiques Conditions éthiques CHAPITRE III- Evaluation Immunovirologique du traitement antirétroviral Introduction Caractéristiques générales de la population d étude Méthodologie Résultats originaux Résumé des résultats du chapitre III CHAPITRE IV- Comparaison des techniques de mesures de la charge virale Introduction Méthodologie Résultats originaux Résumé des résultats du chapitre IV CHAPITRE V- Utilisation du Dried Blood Spot (DBS) pour le monitoring biologique Introduction Méthodologie Résultats originaux Résumé des résultats du chapitre V CHAPITRE VI. Prévalence des mutations de résistance acquises et diversité génétique Introduction Méthodologie Résultats originaux Résumé des résultats du chapitre VI iii

5 Table des matières CHAPITRE VII- Détection des mutations de résistance ponctuelles (ASPCR) Introduction Méthodologie Résultats originaux Résumé des résultats du chapitre VII Discussion générale Conclusion générale Perspectives d avenir Liste bibliographique Les annexes iv

6 Dédicaces Dédicaces Ce travail est dédié à : Mon cher papa Chatté Idékhim, papa, c est l occasion pour moi de te remercier pour tous les sacrifices que tu as déployés à l égard de tes fils. Toi qui as pu nous former et diriger nonobstant les moyens limités en traversant toutes les vicissitudes de la vie ; voici venu le moment de profiter du fruit de ce travail qui a été possible grâce à ton amour et tes prières. Qu ALLAH te bénisse et t accorde une longue vie. Ma chère maman Djimié Abdelkerim, maman, toi qui m as donné la vie, toi qui m as allaité, toi qui as gouverné mes premiers pas, je pense à toi. Qu Allah te bénisse maman et te prête longue vie. Pour tous les sacrifices consentis à mon égard, trouve ici l occasion de réjouissance maman. Mon grand frère Abderahmane Chaté, tu as pu m'accompagner dans chaque épreuve, comme tu l'as fait à chaque étape de ma vie. C'est un peu fou à dire, mais après toutes ces années, je réalise vraiment ce que signifie avoir un frère et je me sens moins seul de te savoir là. La valeur que tu m accordes à chaque instant m a aidé à grandir. Tu as été pour nous tes frères un père et un exemple à suivre. Nos différences ne sont pas si importantes au fond, et nous sommes toujours, à nous tous, une famille aimable. Que ce travail fasse ta fierté. Mon épouse Rabha Al-Adaouia Mahamat Doungous, merci pour ton soutien de tout genre et merci d avoir supporté mon absence auprès de toi durant ma formation. Mes frères et sœurs : Nouracham, Abdelkerim, Abdelaziz Abdelsalam, Allamine, Khadidja, Yaman, Mahamout et Abdelsamat, vous qui avez fait toujours de ma réussite votre première préoccupation, c est l occasion pour moi de vous exprimer ma profonde gratitude pour les sacrifices que vous avez toujours consentis pour ma formation. Merci encore pour vos prières, encouragements, conseils et votre soutien. Feue ma tante Adjiti et feue ma petite sœur Adjiti, vous qui nous avez quitté très tôt sans goutter le fruit de votre soutien et votre encouragement. Qu Allah vous accorde le paradis. A tous mes oncles, tantes, cousins, cousines, neveux et nièces, ce travail est aussi le fruit de votre soutien tout au long de ma formation. Ne vous laissez pas surprendre par le temps, sachez que la clé de la réussite passe par la patience, la volonté et le travail. v

7 Remerciements Remerciements En préambule de cette thèse, qu il me soit permis de présenter tout d abord mes louanges à Allah Le Tout Puisant, Le Très Miséricordieux pour Ses bienfaits pour m avoir donné la santé et la force nécessaires afin de mener à bien cette formation. Il serait ingrat de ma part d écrire ce document sans avoir une pensée à toutes les personnes qui m ont apporté de l aide et de l assistance nécessaires à l élaboration de ce travail. Je tiens à remercier sincèrement le Professeur Michel Moutschen qui, en tant que Directeur de thèse, a toujours été à l'écoute et très disponible tout au long de la réalisation de ce document. Merci pour l'inspiration, l'aide et le temps qu'il a bien voulu me consacrer et sans qui cette thèse n'aurait jamais vu le jour. Sa rigueur au travail, son dynamisme et ses conseils éclairés m inspirent une profonde reconnaissance à son égard. Je tiens à le remercier non seulement d avoir accepté de diriger ce travail mais aussi d avoir mis à ma disposition toutes les ressources nécessaires pour sa réalisation. Je voudrais remercier aussi Dolorès Vaira, responsable du Laboratoire de Référence Sida. Elle a été pour moi non seulement une formatrice mais aussi une mère durant toute ma formation. Qu elle reçoit ici tous mes remerciements pour les conseils, l encadrement et la disponibilité qu elle a consentis à mon égard. C est le moment de lui exprimer ici ma profonde reconnaissance pour le goût de l effort et le sens du travail bien fait qu elle n a cessé de m insuffler. Un grand merci au Professeur Danièle Thull Sondag, présidente du comité de thèse et à tous les autres membres du comité. Merci pour l encadrement et les orientations durant ma formation. J exprime ma gratitude à tous les membres du jury qui ont accepté de juger ce travail et d apporter leur contribution scientifique. Qu ils acceptent ici, l expression de mon plus profond respect. vi

8 Remerciements Mes remerciements vont également : Aux autorités administratives et communales du Royaume de Belgique de m avoir accepté/accueilli parmi les leurs. Aux responsables universitaires et hospitaliers, merci de m avoir permis de suivre cette formation de qualité dans cette prestigieuse institution qu est le CHU de Liège. Au Professeur Pascal Leroy, Doyen de la Faculté de Médecine vétérinaire et Consul Honoraire du Tchad à Liège, qui a été mon parrain ici à Liège et n a ménagé aucun effort avec son collègue le Professeur M. Moutschen pour que je puisse être accepté à l ULg. J aimerais tout simplement leur dire, merci pour tout. Au Professeur Mahamoud Youssouf Khayal, qui m a toujours conseillé et soutenu durant mes études supérieures ; qu il trouve ici l expression de mes sincères remerciements. A Malloum Soultan, Directeur Général de l Institut Universitaire des Sciences et Techniques d Abéché (IUSTA). Votre bon sens et votre abnégation dans le travail m ont permis d achever cette formation dans de bonnes conditions. A Issa Youssouf Adoum et Aoudalkarim Moussa Chahad, pour les précieux conseils et les encouragements. Merci aussi pour avoir lu et corrigé ce document. A Sébastien Bontems, responsable de l assurance qualité pour le laboratoire de Microbiologie. Il m a toujours aidé à imprimer mes papiers. Mes articles ont rempli sa boite mail et je suis sûr que j ai une bibliothèque de réserve auprès de lui. Merci pour les précieux conseils, la disponibilité et encadrement. A Raphaël Boreux, spécialiste de la PCR en temps réel. Merci de m avoir appris les différentes techniques de PCR en temps réel sur différentes machines. A mes collègues et amis Kamangu Erick et Fokam Joseph avec qui j ai eu l opportunité de travailler et de discuter sur des sujets très pertinents. A Fabrice Susin, Jonathan Meganck, Giuseppina Oliveri et Adjitey Caroline. Je leur ferais arracher le sourire à cette équipe dynamique du LRS si je leur parlais du marqueur de poids moléculaire PHIX174 RF ADN HaeIII ou s il fallait lire l écriture «wastle bottle». Nous avons travaillé dans une ambiance bon enfant, mais cela ne nous a pas fait perdre de vii

9 Remerciements vue la rigueur scientifique au travail bien fait. Leur contribution de tout genre à ce travail est remarquable. Ils ont été gentils avec moi en me montrant beaucoup de choses. Je leur exprime ma profonde gratitude pour l effort consenti par tous. Merci aussi pour la pizzaparty de chaque fin de séjour. A Francesca Lipari et Emilie Guissart, Secrétaires du Service d Immunologie et des Maladies Infectieuses, pour leur gentillesse, leur disponibilité et leur collaboration. Qu elles reçoivent ici ma profonde reconnaissance. Un merci sincère et véritable à Jessica Monfort pour avoir sacrifié son temps afin d apporter des corrections pertinentes à ce travail. Un grand merci aux compatriotes tchadiens de Liège pour la bonne cohabitation durant cette formation. Je pense à Acheikh Ali Annadif, Issakha Alnadjib Senoussi, Brahim Tchou, Youssouf MS Annadif, Abdelkhani Ezedine, Elhadj Adam, Haroun Hamat et Oumar Souelymane. A tous les PVVIH qui ont accepté de donner leur sang afin que cette étude ait lieu. Que ce travail vous apporte réconfort et plein courage de vivre une vie normale. Je n oublie pas le personnel du laboratoire de Microbiologie du CHU de Liège pour leur collaboration. Un grand merci aussi au personnel du laboratoire de l Hôpital Général de Référence National de N Djaména (HGRN) d avoir facilité la collecte des données. Enfin, je tiens à remercier tous ceux que je n ai pas cités dans ce travail et qui m ont apporté leur aide dans toute dimension ; qu ils reçoivent ici tous mes remerciements. viii

10 Sigles et abréviations Liste des sigles et abréviations 3TC Lamivudine ANRS Agence Nationale pour la Recherche sur le Sida ARMS Amplification Refactory Mutation System ARV Antirétroviral (aux) ASPCR Allele-Specific Polymerase Chain Reaction AZT (ZDV) Zidovudine bp paire(s) de bases CAP/CTM Cobas AmpliPrep/Cobas TaqMan CD4 Cluster of Differentiation 4 CHU Centre Hospitalier et Universitaire CNLS Centre National de Lutte Contre le Sida d4t Stavudine DBS Dried Blood Spot ddc Zalcitabine ddl Didanosine DNA/ADN Desoxyribonucleic Acid/ Acide Désoxyribonucléique DPS Dried Plasma Spot EDTA Ethylène Diamine Tétra Acétique EFZ Efavirenz ENV Enveloppe FTC Emtricitabine GAG Group Antigen Gene HAART High Active Antiretroviral Therapy HGRN Hôpital Général de Référence Nationale INNTI Inhibiteurs Non Nucléosidiques de la Transcriptase Inverse INTI Inhibiteurs Nucléosidiques et Nucléotidiques de la Transcriptase Inverse LRS Laboratoire de Référence Sida LTR Long Terminal Repeat Min Minute MMix Master Mix NVP Névirapine ix

11 Sigles et abréviations OMS ONUSIDA PCR PI POL PRL PTME PVVIH RNA Sec SIDA TAR TDF TDR ULg VIH WHO Organisation Mondiale de la Santé Organisation des Nations Unies Pour la Lutte contre le SIDA Polymerase Chain Reaction Protease Inhibitors Polymérase Pays à Ressources Limitées Prévention de la Transmission Mère-Enfant Personne Vivant avec le VIH Ribonuicleic Acid Seconde Syndrome de l Immunodéficience Acquise Traitement Antirétroviral Ténofovir Test de Dépistage Rapide Université de Liège Virus de l Immunodéficience Humaine World Health Organisation x

12 Liste des tableaux Liste des tableaux Tableau 1: Classification de la maladie à VIH/ stades cliniques OMS Tableau 2: Comparaison des différentes techniques de mesure de la charge virale Tableau 3: Préparation du MMix 1: Annealing Tableau 4: Préparation du Master Mix 2: Enzyme Mix Tableau 5: Preparation du premier Master Mix pour ASPCR Tableau 6: Préparation du second MMix pour ASPCR Tableau 7: Valeurs observées des CD4 avant et après traitement Tableau 8:Valeurs des charges virales observées avant et après traitement Tableau 9: Mutations de résistance détectées sur plasma vs DBS Tableau 10: Comparison des sous-types détectés sur plasma vs DBS Tableau 11: Nombre de patients par rapport au traitement administré Tableau 12: Valeurs charges virales sur CAP/CTM vs Abbott RealTime Tableau 13: Nombre de patients en échec par rapport au traitement administré Tableau 14: Distribution des sous-types et des mutations de résistance chez les patients en echec sous Triomune Tableau 15: Distribution des sous-types et mutations de résistance chez les patients en echec sous Duovir N Tableau 16: Distribution des patients par rapport aux sous-types Tableau 17: Quantification de la résistance du VIH au traitement (Stanford) Tableau 18: Coefficients de variation intra et inter-essais Tableau 19: Mutations de résistance détectées par ASPCR (Plasma) Tableau 20: Comparaison des mutations de résistance en fonction des sous-types détectés par ASPCR vs plasma Tableau 21: Evaluation de la sensibilité de l'aspcr par rapport au séquençage sur DBS vs plasma Tableau 22: Distribution des mutations de résistances détectées par ASPCR par rapport aux sous-types détectés sur DBS xi

13 Liste des figures Liste des figures Figure 1: Principe du séquençage selon la méthode de Sanger Figure 2: Distribution des tranches d'âge par rapport au sexe Figure 3: Nombre des patients par rapport au traitement administré Figure 4: Répartition des patients en échec par rapport au traitement Figure 5: Comparaison CAP/CTM et Abbott RealTime Figure 6: Résultats de mesures CAP/CTM et Abbott RealTime Figure 7: Comparaison CAP/CTM et ANRS Figure 8: Comparaison Abbott RealTime et ANRS Figure 9: Courbes de mesure entre CAP/CTM V2.0, ANRS et Abbott RealTime Figure 10: Fréquence des mutations de résistance associées aux INTI Figure 11: Fréquence des mutations de résistance associées aux INNTI Figure 12: Arbre phylogénétique des séquences de la protease (plasma) Figure 13: Courbes standard des différences des Ct (sauvage-muté) pour les différentes mutations Figure 14: Courbes standard avec le primer générique et muté des différentes dilutions Figure 15: Exemple de la courbe d'amplification (générique et sauvage) avec différences des Ct pour la K103N Figure 16: Quantifications des mutations de resistance détectées par ASPCR vs plasma xii

14 Résumé Résumé Introduction La lutte contre le VIH demeure jusqu à présent un problème majeur de santé publique dans les pays au sud du Sahara et ce, malgré les avancées notables enregistrées depuis quelques années. Les ressources limitées pour la prise en charge des personnes vivant avec le VIH (PVVIH) dans ces pays ont pour conséquence l émergence et la transmission des souches résistantes qui se traduit par la perte de l efficacité du traitement administré. Un traitement antirétroviral est administré dans l objectif d obtenir et de maintenir une charge virale plasmatique indétectable, tandis que la prise en charge d'une situation d'échec virologique (première ligne, lignes ultérieures ou multi-échecs) implique le plus souvent une adaptation du traitement en fonction des résultats, le contrôle régulier de la charge virale et des tests génotypiques de résistance. Or, la performance d un test de résistance est influencée par ses propriétés intrinsèques (sensibilité et spécificité), la qualité et le type de l échantillon à analyser, la connaissance de la prévalence de résistance et de la diversité génétique dans la population. En tout état de cause, les techniques de mesure de la charge virale et les tests de résistance standard nécessitent des infrastructures de laboratoire adéquats et du personnel bien formé. Toutes ces méthodes, pour utiles qu elles soient, se révèlent être inadaptées sinon très onéreuses pour les pays à ressources limitées (PRL). C est la raison pour laquelle, le développement et la mise en place au Tchad des nouvelles alternatives, fiables et moins coûteuses seraient à notre avis, la solution pour une meilleure surveillance épidémiologique de la résistance du VIH au traitement. Objectifs Etant donné que les tests de résistance ne sont pas encore disponibles au Tchad ; et afin de pouvoir aider les cliniciens sur leur prise de décision et contribuer à un meilleur suivi des personnes vivant avec le VIH (PVVIH), nous nous sommes fixés comme objectif général d évaluer et de mettre en place des méthodes alternatives pour le monitoring biologique de la résistance du VIH aux ARV au Tchad. L atteinte de cet objectif général, passe nécessairement par la réalisation d objectifs spécifiques qui sont: 1) Faire une évaluation immunovirologique avant et après traitement. 2) Quantifier la charge virale et évaluer les différentes techniques disponibles. 3) Identifier chez ces sujets les différentes mutations de la Reverse Transcriptase et de la Protéase associées à la résistance du virus et en évaluer la prévalence sur DBS et Plasma. 4) Evaluer la technique ASPCR afin de détecter les mutations ponctuelles associées à xiii

15 Résumé la résistance du VIH-1 pour les sous-types non-b. 5) Déterminer la prévalence de la résistance acquise et la diversité génétique des sous-types du VIH-1 circulants à N Djamena. Méthodologie Notre échantillon est constitué de 116 patients (78 femmes et 38 hommes représentant respectivement 67,24 % et 32,76 %). Ces patients sont recrutés sur base des critères d inclusion et d exclusion bien définis. La moyenne d âge de nos patients est de 41 6,87 ans avec 84 ans pour le plus âgé et 17 ans pour le plus jeune. Deux types d étude sont utilisés: l une traversable (prospective et rétrospective) et l autre expérimentale. L échantillonnage est de type consécutif non exhaustif (tout venant). L échantillon utilisé est le sang veineux prélevé sur EDTA au pli du coude. Le plasma est aliquoté dans des cryotubes et conservé à - 80 C; 75 µl du sang total sont déposés sur papier buvard de type Whatman 903 (Whatman, Maidstone, UK). La charge virale est évaluée à l aide des trois techniques: Abbott RealTime, Cobas AmpliPrep/Cobas TaqMan (CAP/CTM) v2.0 et la technique de l ANRS. La conservation du DBS est faite à -20 C jusqu au transport en Belgique pour les analyses. L extraction de l ARN viral est faite avec le kit QiAamp Viral RNA mini kit. Nous avons recouru à la technique de l ANRS (ANRS AC11 Resistance Study Group, 2008) pour réaliser le séquençage sur la Réverse Transcriptase et la Protéase sur un total de 30 DBS. En vue d évaluer la réponse immunvirologique des PVVIH sous ARV et suivre l évolution de l infection vers le stade SIDA à travers les deux marqueurs principaux qui sont les lymphocytes TCD4 et la charge virale, nous avons effectué le suivi des 116 patients pendant huit mois. Ces deux marqueurs sont mesurés avant le traitement (Jour 0) et après huit mois de traitement. Les moyennes des CD4 et de la charge virale au J0 sont comparées aux valeurs obtenues après 8 mois de traitement. Ensuite, concernant les patients sous Triomune, ceux-ci ont fait l objet d une évaluation particulière pour déterminer le taux d échec à la Triomune. Les méthodes d amplification et de détection employées sont celles décrites dans la procédure du groupe de résistance de l ANRS AC11 (ANRS AC11 Resistance Study Group, 2008). L amplification des régions concernées de la polymérase (Protéase et Reverse Transcriptase) a été réalisée avec le Titan One tube RT-PCR Kit, Version 13 (Boehringer Mannheim, Manneheim, Germany). La technique ASPCR (Allele-Specific PCR) est utilisée pour la détection des mutations de résistances ponctuelles sur DBS et le plasma. Les séquences de la Protéase et de la Reverse Transcriptase sont alignées avec le logiciel Bioedit xiv

16 Résumé (version 7.2.5) et sur CLUSTAL W version 1.7 (Thompson, Higgins, & Gibson, 1994). Les séquences obtenues de la Protéase et de la Reverse Transcriptase sont comparées à la banque des sous-types non-b disponibles dans Los Alamos (http://www.hiv.lanl.gov/). Les soustypes, les formes recombinantes et les mutations de résistance sont obtenus après analyse des séquences sur le site de Stanford University/HIV Drug Résistance Database (http://hivdb.stanford.edu/). Les résistances sont interprétées conformément à l algorithme de l ANRS AC11, révisé en septembre 2013 (http://www.hivfrenchresistance.org/). Afin d autoriser des taux de mutations différents le long des branches, nous avons eu recours à la «Neighbor Joining», méthode du plus proche voisin en vue de construire l arbre phylogénétique sur MEGA Résultats En évaluant les paramètres immunovirologiques, nous avons remarqué que la médiane des charges virales observée avant le traitement est loin d être la même après huit mois de traitement (5000 vs 51; U de Mann-Whitney significatif à p < 0,001 pour les deux médianes). Par contre la moyenne au J0 n a pas significativement changée au M8 (44739 vs ; p > 0,05). La moyenne des CD4 n a pas considérablement fluctué chez les 116 patients avant et après 8 mois de traitement (309 vs 344 ; p = 0,62). La médiane des CD4 au J0 est de 248 alors que celle de M8 est de 298,5 (p = 0,75). Le taux d échec à la Triomune est de 43,75 % (21/48). L étude ne relève également, aucune différence significative entre le taux d échec et le sexe (p > 0,05). La corrélation entre la mesure de la charge virale sur CAP/CTM et Abbott RealTime est excellente avec R 2 = 0, Si la mesure avec la technique de l ANRS semble être discordante des deux premiers tests, il n empêche que la corrélation soit bonne avec R 2 = 0,72603 pour CAP/CTM-ANRS et R 2 = 0,81064 pour Abbott-ANRS. Un «blip» est observé sur deux échantillons (2,23 et 2,68 Log10 copies/ml) avec la version 2.0 du Cobas. La dégélation du plasma lors de la mesure avec la technique ANRS pourrait être à l origine des valeurs sous estimées obtenues comparativement à Abbott RealTime et le Cobas. L analyse nucléotidique des 44 échantillons indique la présence des sous-types suivants : A = 4 (9,30 %), D = 4 (9,30 %), F = 2 (4,65 %), G = 7 (16,28 %) et J =13 (30,23 %). La seule forme recombinante que nous avons trouvée dans l étude est CRF02_AG chez 13 patients, soit 30,23 %. Un échantillon était indéterminé après analyse des séquences. Il ressort de cette étude qu il y a présence d un nouveau sous-type J qui circule à xv

17 Résumé N Djaména avec un taux de 30,23 % (13/43); il est apparenté au sous-type F après analyse phylogénétique. Sur DBS, nous avons obtenu un taux d amplification de 80 % (24/30). La limite de détection est de 3,33 log10, ce qui équivaut à 2150 copies/ml. Le CRF02_AG est également le plus représenté sur DBS (29,17 %; 7/24) comme sur le plasma (30,23 %; 13/43). Le sous-type K est présent (3/24; 12,5 %) sur DBS sur la Reverse Transcriptase alors qu il est absent dans le plasma. Concernant les Inhibiteurs Nucléosidiques et Nucléotidiques de la Transcriptase Inverse (INTI), les principales mutations enregistrées sont la M184V/I/L qui est largement rencontrée chez 30 patients sur les 43, soit 69,77 %; la T215Y/F/I/S enregistrée chez 13 autres patients (soit 30,23 %). D autres mutations communes (A62V, V75I/L, M184V/I) ont aussi été constatées chez deux patients, à hauteur de 4,65 %. Les analogues à la thymidine (TAMs) sont représentées par la T215Y/F, la K70P/R/W et la K219E/N/Q respectivement à concurrence de 30,23 % (13/43), de 9,30% (4/43) et de 9,30 % (4/43). Les résistances que nous avons remarquées pour les INNTI sont représentées par la K103N/S/E chez 13/43 (30,23 %) et la Y181C/V/F/L chez 11/43 (25,58 %). Comme nous pouvions nous attendre dans le cas des INNTI, nous avons noté l association Y181C/F et K103N chez 3/43 (6,98 %). Certaines mutations telles que L100I, F227L et P225H ne sont constatées que chez un seul patient à hauteur de 2,33 %. S agissant de la quantification des résistances, nous avons observé qu il existe une résistance élevée aux INNTI chez plus de la moitié des patients, avec 74 % (32/43) pour la NVP et 55,8 % (24/43) pour l EFZ. Pour les INTI, nous avons noté une forte résistance à la 3TC à hauteur de 67,5 % (29/43). Pour la détection des mutations ponctuelles, une spécificité de 10 % est obtenue avec l ASPCR comparativement au plasma. Pour les sous-types D, il s agit de la Y181C; pour le sous-type J, de lay181c et de la M184V et pour le CRF02_AG, de la Y181C et de la M184V. L ASPCR est une méthode fiable de détection de mutation de résistance ponctuelle mineure à hauteur de 0,01 %. Elle est la méthode de choix pour la détection des mutations de résistance mineures dans un échantillon; les coefficients de variation en intra et inter-essais sont tous inférieures à 0,50. Cela montre que l estimation de la technique est plus précise. Le taux de suppression virale (CV < 1000 copies/ml) est de 56,9 % (66/116). La prévalence de la résistance parmi les individus ayant une CV 1000 copies/ml est de 74 % xvi

18 Résumé (37/50) alors que celle de la résistance acquise chez tous les patients est donc de 31,9 % (37/116). Conclusion Promouvoir la collecte des échantillons sur DBS, c est une manière de résoudre en partie la problématique liée à la conservation de l échantillon. Ainsi, le suivi de l efficacité d un traitement bien régulié, bien toléré et bien observé passe nécessairement par un contrôle immunovirologique constant et des tests de résistances. Plusieurs mutations associées à la résistance aux ARV à différents niveaux sont présentes chez les PVVIH à N Djamena occasionnant dès lors l échec au traitement et l apparition des souches résistantes dans la population. La présence de ces mutations serait liée à la mauvaise observance notifiée dans l étude (80 %; p < 0,05). Pour la mesure de la charge virale, la technique de l ANRS semble être la plus simple et la moins onéreuse ; mais pour les pays à ressources limitées, l application de cette technique nécessite un personnel qualifié et des infrastructures de laboratoire suffisants. La Triomune ne doit pas être utilisée comme traitement de première intention à cause de l échec immunovirologique relatif à son utilisation. Nous osons croire enfin, que l approvisionnement régulier en molécules antirétrovirales, l adéquation des infrastructures de laboratoire et la formation continue du personnel technique dans les PRL, paraissent l une des options fiables pour réduire au maximum le risque d émergence de résistance du VIH. xvii

19 Chapitre I : Introduction Générale Chapitre I Introduction Générale ii

20 Chapitre I : Introduction Générale CHAPITRE I - Introduction Générale I. Contexte et justification du sujet Plusieurs années après sa découverte, le Virus de l Immunodéficience Humaine (VIH) reste encore une des causes majeures des décès dans le monde et c est l Afrique Subsaharienne qui en paye le lourd tribut. Parmi les 35,3 millions [32,2-38,8] de personnes qui vivent avec le VIH dans le monde en fin 2012, près de 69 % résident en Afrique Subsaharienne, une région qui ne représente que 12 % de la population mondiale (Onusida, 2013). Malgré les avancées thérapeutiques pour la lutte contre le Sida, l émergence de la résistance aux antirétroviraux dans les pays à ressources limitées se révèle être l un des problèmes majeurs de la thérapeutique antirétrovirale. C est ainsi que divers sous-types de virus circulent en Afrique Centrale et sont responsables d'environ 85 % des nouvelles infections, dont les plus fréquents sont A (A1, A2, A3, A4, A5), C, CRF02_AG et D. Récemment, un nouveau groupe putatif désigné P a été retrouvé chez deux patients camerounais (Lihana et al., 2012; Plantier et al., 2009). A l instar des autres pays, au Tchad, la pandémie du Sida fait de nombreux décès chaque année. La prévalence chez la population tchadienne de 15 à 45 ans, estimée à 7 millions d habitants en 2005 est de 3,3 % (Ouagadjio et al., 2005). Le type de VIH qui circule au Tchad depuis l avènement du SIDA est le VIH-1. A notre connaissance, jusqu à présent, une seule étude, publiée en 2003 renseigne sur les différents groupes du VIH-1 qui circulent au pays. Parmi ces groupes, seul le M avec les 4 sous-types (A, D, F et G) et trois recombinants (CRF01-AE, CRF02-AG et CRF11-cpx) est majoritairement retrouvé. Le groupe O est minoritaire et le N n a pas été rencontré. De même, des cas de VIH-2 n ont pour l heure pas été observés au Tchad (Vidal et al., 2003). Cette situation a conduit le gouvernement tchadien à réévaluer les priorités nationales en matière de santé, et plus particulièrement à se concentrer sur les difficultés qu affrontent les personnes vivant avec le VIH (PVVIH) et d origine tchadienne, personnes qui ont souffert depuis longtemps d un manque d accès à l éducation et à des soins de santé appropriés. Afin de relever ces défis, le Gouvernement du Tchad, avec le concours de bailleurs de fonds extérieurs, a élaboré en 1998, une stratégie nationale de la santé ainsi qu un plan national stratégique de lutte contre le SIDA. C est pourquoi, depuis 2007, le Gouvernement tchadien a instauré la gratuité des antirétroviraux (ARV) et tous les examens complémentaires afférents à 1

21 Chapitre I : Introduction Générale l infection à VIH. Depuis lors, un protocole de traitement basé sur une trithérapie a vu le jour. Cette trithérapie était fondée sur la Triomune (Cipla-Inde) jusqu à fin 2012, année au cours de laquelle, elle fut abandonnée non seulement à cause de ses effets secondaires, mais aussi à cause de l échec immunovirologique associé à son utilisation (Adawaye et al., 2014). Les molécules d actualité sont aujourd hui au Tchad le Duovir N (AZT, 3TC et NVP) et le Viraday ou Atripla (FTC, TDF et EFZ). Depuis lors, ces molécules n ont fait l objet d aucune évaluation dans le pays; c est pourquoi, pour vérifier leur efficacité, un monitoring biologique régulier s impose. Problématique Un traitement antirétroviral quelle que soit la situation thérapeutique du patient est administré dans l objectif d obtenir et de maintenir une charge virale plasmatique indétectable (Palella et al.,1998) sinon inférieure à 50 copies/ml (Hocini & Andreoletti, 2009). La charge virale permet d apprécier l évolutivité de la maladie en complément de la mesure des CD4 et de l appréciation des signes cliniques. Ces résultats doivent en tout état de cause être confrontés au taux de CD4 et aux signes cliniques, le dialogue clinicien-biologiste reste primordial pour l interprétation des résultats (Hocini & Andreoletti, 2009). Ces indicateurs biologiques, pour utiles qu ils soient, s avèrent être très rares dans les pays à ressources limitées (PRL), en raison des coûts élevés des différentes techniques et des exigences strictes pour le stockage et le transport du plasma. Pourtant ces indicateurs présentent des sérieuses limites dès lors qu il s agit de mettre en place des moyens de suivi permettant de faire évoluer les traitements pour les patients en situation d échec et de résistance aux traitements (Johannessen et al., 2009; Palella et al., 1998). Ainsi donc, l OMS recommande que l échec virologique soit évalué par les signes cliniques ou par la mesure des taux des CD4 pour les PRL (Hirsch et al., 2008), bien que ces derniers aient une faible sensibilité et spécificité dans l évaluation de l échec virologique (D. E. Bennett et al., 2009). De manière générale, les méthodes standards de l évaluation du traitement et de l évolution de la maladie nécessitent le cas échéant des techniques et des exigences strictes pour le stockage et le transport du plasma, du personnel qualifié et les infrastructures d un laboratoire de biologie moléculaire (Johannessen et al., 2009). Le coût élevé et la complexité de toutes ces méthodes les rendent inadaptées pour les PRL et notamment pour le Tchad. Cette situation nous a amené à poser la question de savoir «Quelles pourraient être les 2

22 Chapitre I : Introduction Générale approches alternatives pour le monitoring de résistance du VIH aux antirétroviraux au Tchad»? Tenant compte des conditions dérisoires de nos laboratoires et du manque d une main d œuvre qualifiée, la meilleure stratégie pour une surveillance épidémiologique fiable serait de développer de nouvelles alternatives permettant la mesure de la charge virale et la détection des mutations de résistance ponctuelles sur papier buvard et sur plasma, avec des techniques efficaces et moins onéreuses, d où l intérêt de notre étude. C est la raison pour laquelle, la technique du papier buvard, dénommée DBS (Dried Blood Spot) ou DPS (Dried Plasma Spot) parait la mieux indiquée pour élargir la surveillance virologique au traitement anti-vih au Tchad. La technique consiste à collecter du sang total (DBS) ou du plasma (DPS) sur un papier filtre appelé buvard. Cette technique se révèle être très pratique ne nécessitant pas forcément un personnel qualifié. Elle a démontré ses preuves dans les enquêtes séroépidémiologiques car elle a pour avantage d être facile à réaliser. Le DBS est acheminé vers les laboratoires pour les analyses moléculaires sous forme de courrier. La conservation ne nécessite pas une chaine de froid continue car il se conserve à température ambiante (Bertagnolio et al., 2010; Fiscus et al., 1998; Leelawiwat et al., 2009; Mee et al., 2008). Il faut noter cependant que récemment, plusieurs études réalisées en Amérique du Nord, en Europe et même en Afrique (Cameroun, Malawi, Tanzanie etc.) ont montré la faisabilité et la fiabilité de l utilisation du DBS pour le contrôle de la charge virale et les mutations de résistance aux antirétroviraux (Adawaye et al., 2013; Bertagnolio et al., 2010; Johannessen et al., 2009). L amplification pour la mesure de la charge virale à 1000 copies/ml et l identification des mutations associées à la résistance sur DBS étaient similaires à celles déterminées sur le plasma (Arredondo et al., 2012). Une revue à la fin de ce chapitre nous renseigne plus sur les avantages du DBS dans le monitoring biologique dans les PRL. Nonobstant, les tests génotypiques de résistance sur buvard ou sur plasma se révèlent eux aussi être très onéreux et nécessitent des laboratoires équipés de type «Référence» et du personnel qualifié. Les tests génotypiques standard quant à eux ne détectent une mutation de résistance dans un échantillon que quand sa proportion dans l échantillon atteint 20 % (Brun- Vézinet et al., 2004; Halvas et al., 2006; Kuritzkes et al., 2003). C est pourquoi, l évaluation et la mise en place au Tchad d une technique basée sur la détection des mutations de résistances ciblées (ASPCR pour Allele-Specific PCR) ainsi que la détection des mutations de 3

23 Chapitre I : Introduction Générale résistance sur DBS seraient une panacée pour répondre aux besoins croissants des cliniciens dans leur prise de décision. L ASPCR permet la détection des mutations mineures mêmes si elles sont présentes à faibles proportions ou celle de plusieurs mutations dans un même échantillon. Il est question pour nous ici, de rechercher les mutations de résistance sélectionnées essentiellement pour les médicaments utilisés au Tchad et qui en elles mêmes, confèrent une résistance majeure à l exemple de la K103N ou la Y181C pour les INNTI et la M184V ou la T215F/Y pour les INTI. La barrière génétique étant faible pour ce groupe de médicaments (NVP et EFZ), une seule mutation pourrait entrainer une résistance irréversible (loi de tout ou rien). Dans ce document, nous allons tout d abord, donner un aperçu général sur les techniques utilisées pour la prise en charge des personnes vivant avec le VIH, en évaluant la faisabilité de chaque technique de prélèvement et de conservation de l échantillon, de mesure de la charge virale et du génotypage. La technique ASPCR sera utilisée pour la détection des mutations ponctuelles. Nous allons enfin dégager les avantages et les limites de chaque technique qui sera par la suite transposable au Tchad. Intérêt de l étude Etant donné que les tests de résistance n étaient jusqu à présent pas disponibles au Tchad, ce travail apporte une connaissance approfondie sur la diversité génétique et l enjeu de la résistance dans la surveillance épidémiologique. Les recommandations tirées de cette étude, permettrons l implantation à court ou à moyen terme au Tchad des techniques de biologie moléculaire testées et validées au laboratoire de Référence Sida de Liège durant notre formation. La biologie moléculaire au Tchad est à l état embryonnaire et ne se limite qu à la charge virale sur Abbott RealTime. La création d un Centre de Référence Sida au Tchad serait à notre avis un cadre idéal pour promouvoir cette discipline à l échelle nationale et permettre aussi aux cliniciens le choix des méthodes alternatives de prise en charge. Ceci leur permettra de prendre des décisions rapides et efficaces pour donner de grandes chances aux malades de vivre une vie longue, saine et quasi normale. 4

24 Chapitre I : Introduction Générale II. Généralités sur le VIH et le Sida 2.1 Le Virus de l Immunodéficience Humaine (VIH) Le VIH appartient à l ordre des Rétroïdes, à la grande famille des Rétroviridae, lesquels se caractérisent par leur génome d ARN, qui est rétrotranscrit en ADN proviral à l aide de la Transcriptase Inverse (TI) appelée encore Reverse Transcriptase (RT). Cette enzyme qui n est pas pourvue d activité correctrice comme l ADN polymérase cellulaire laissera sur son passage, au cours de la rétrotranscription, de nombreuses erreurs à l origine du fort taux de mutations présentes dans l ADN rétroviral. Ce dernier, nanti désormais de la possibilité de pouvoir échapper à tout contrôle du système de défense de l hôte et aux thérapies, s intégrera dans le génome de la cellule hôte, restera en forme latente ou se reproduira pendant toute la durée de vie des cellules infectées. Il appartient au genre des lentivirus. Suivant la structure de leur génome et le type d infection dont ils sont la cause (lytique ou oncogène), les Rétrovirus se subdivisent en trois sous-familles: les lentivirus (parmi lesquels le VIH-1 et VIH-2), les oncovirinae et les spumavirinae. Les lentivirus sont exogènes, non oncogènes et infectent principalement les cellules du système immunitaire (macrophages et lymphocytes T CD4 + ) ce qui explique le fait que les infections lentiformes résistent aux assauts du système immunitaire et causent généralement des immunodéficiences. 2.2 La diversité génétique des groupes et sous-types du VIH A ce jour, ont été identifiés deux types de VIH, le VIH-1 (en 1983) et le VIH-2 (1986) qui se différencient sur la base de leur origine géographique, de l organisation de leur génome et de leur lien de parenté avec le SIV (Simian Immunodefisciency Virus). L origine de la diversité génétique s explique par l action de l enzyme Reverse transcriptase qui est dépourvue d activité 3-5 exanucléasique et qui est dépourvue d activité correctrice comme l ADN polymérase cellulaire. Elle laissera sur son passage, au cours de la retro transcription, un taux d erreur très élevé de l ordre de 10-3 à 10-4 ; ce qui correspond à une à deux mutation(s) par cycle de réplication. Le VIH-1 est classé depuis 1998 selon les critères phylogénétiques en quatre groupes, dont chacun correspondrait à des transmissions indépendantes de SIV à l Homme (Gao et al., 5

25 Chapitre I : Introduction Générale 1999). Le plus répandu à travers le monde est le groupe M qui se subdivise en 9 sous-types ou clades (A, B, C, D, F, G, H, J et K), obtenus sur l analyse génomique des gènes env et gag. La majorité des sous-types du VIH-1, responsable de la pandémie du VIH/SIDA, appartiennent à la lignée du VIH-1 du groupe M (Doualla-bell et al., 2010). Le groupe O (pour outlier group), présent en Afrique Centrale; le groupe N (pour non-m, non-o group) présent au Cameroun et un nouveau groupe putatif désigné P a été retrouvé chez deux patients camerounais (Lihana et al., 2012). Ce même groupe P a déjà été identifié chez une patiente camerounaise vivant en France (Plantier et al., 2009). Les sous-types B correspondent au VIH que l on soupçonne d être à l origine de l épidémie dans les pays industrialisés (Amérique, en Europe et en Australie). Les sous-types non-b (qui regroupent tous les autres sous-types) seraient proportionnellement en augmentation. Parmi les sous-types non-b, les sous-types A, C, D et E se retrouvent largement en Afrique. Les sous-groupes N et O principalement présents au Cameroun demeurent plus rares (Bodelle et al., 2004). La diversité génétique du VIH-1 augmente dans le monde. La majorité des cas est du aux virus VIH-1 de sous-types non-b, le sous-type B étant majoritaire uniquement sur le continent américain, en Europe de l Ouest et en Australie. Ainsi, ce sont les VIH-1 de soustype C qui sont responsables de plus de 50 % des infections dans le monde. Ceux-ci prédominent en Afrique du Sud, alors que les sous-types A et D sont présents en Afrique de l Est (Peeters, Chaix, & Delaporte, 2008). Les sous-types de virus circulants en Afrique Centrale et responsables d'environ 85 % des nouvelles infections sont A (A1, A2, A3, A4, A5), C, CRF02_AG et D (Lihana et al., 2012). Certains sous-types se recombinent entre eux pour donner des virus recombinants, les CRF, composant de véritables mosaïques des différents sous-types. La prévalence des sous-types non-b est croissante, y compris en Europe, passant de 17 % en à 28 % en (S. Matheron et al., 2010). En Europe et notamment en France, hormis le sous-type B, de nombreux autres soustypes ou CRF non-b comme les virus A, C, D, F, G, H, CRF01_AE et aussi CRF02_AG y circulent. La moitié des virus non-b isolés en France sont des virus CRF02_AG, ce qui témoigne des liens existants entre la France et l Afrique de l Ouest (Peeters et al., 2008). Il faut noter cependant que l évolution de la maladie ne semble pas différente chez les patients infectés par le CRF02_AG et ceux infectés par d autres sous-types non-b (Atlas et al., 2005). 6

26 Chapitre I : Introduction Générale Le type de VIH circulant au Tchad depuis l avènement du SIDA est le VIH-1. Parmi les groupes circulants, seul le M avec les 4 sous-types (A, D, F et G) et trois recombinants (CRF01-AE, CRF02-AG et CRF11-cpx) sont majoritairement retrouvés. Le groupe O est minoritaire et le N n est pas encore rencontré. Le VIH-2 lui aussi n a pas encore été rencontré au Tchad (Vidal et al., 2003). Le VIH-2 isolé en 1986 trouve son origine chez le singe Cercocebus torquatus et il est principalement retrouvé en Afrique de l Ouest. Il faut y ajouter la prolifération et la circulation de nombreuses formes recombinantes qui sont sources de résistance croisée aux antirétroviraux. Pour le VIH-2, au moins huit transmissions inter-espèces de SIVsmm (Simian immunodeficiency virus from sooty mangabey monkeys) ont eu lieu entre l homme et le mangabey enfumé, ce qui a conduit à définir 8 groupes de VIH-2 (A, B, C, D, E, F, G, H). Les groupes A et B sont les plus représentés (Yeni, 2010). 2.3 La situation du VIH/SIDA au Tchad Pays enclavé de l Afrique Centrale d une superficie de km 2, le Tchad est limité au Nord par la Libye, au Sud par la République Centrafricaine, à l Est par le Soudan et le Soudan du Sud et à l Ouest par le Niger, le Nigeria et le Cameroun. Cet enclavement extérieur est aggravé par une insuffisance des réseaux routiers qui rendent difficile l évacuation des malades durant la saison des pluies car plusieurs formations sanitaires sont inaccessibles. La population du Tchad est estimée en 2009 à habitants avec un taux d accroissement annuel de 3,6 %; ce qui permet d estimer la population du pays à habitants en 2011(CNLS, 2012; INSEED, 2009). La population féminine représente 50,7 % de la population totale contre 49,3 % pour les hommes. Les jeunes de moins de 18 ans représentent 57% du total. Près de la moitié (47 %) de la population total du pays est concentrée sur seulement 10 % de la superficie nationale, dans le Sud du pays. Près de 78,3 % de cette population vit en milieu rural, le reste vit dans la capitale N Djaména et dans quelques grandes villes (Abéché, Moundou, Sarh, Bongor, Doba). La population nomade est estimée à 3,5 %. Le Tchad est une mosaïque ethnolinguistique constituée de plus de 250 groupes différents. Les deux langues officielles sont le Français et l Arabe. Depuis 2003, le Tchad est devenu un pays exportateur de pétrole. Le Gouvernement a identifié un certain nombre de 7

27 Chapitre I : Introduction Générale secteurs définis comme prioritaires dont ceux de la santé et de l éducation, pour bénéficier d une partie de ces ressources additionnelles, particulièrement en termes d infrastructures à construire. Selon l OMS, sur le plan économique, le Tchad reste encore un pays très pauvre malgré l exploitation de son bassin pétrolier de Doba au sud du pays. En 2006, le pays occupait le 171 ième rang sur 177 pays du classement mondial et 55 % de sa population vit en dessous du seuil de la pauvreté (OMS, 2009). Son système de santé est peu performant dû essentiellement à l insuffisance des ressources humaines qualifiées, des infrastructures sanitaires et des équipements médicaux. L épidémie du VIH au Tchad est de type évolutif et généralisé qui pourrait être en légère baisse ces dernières années, selon les dernières estimations de l ONUSIDA (Onusida, 2013). Il est à noter que des pics de séroprévalence sont observés à Ndjamena, la capitale du Tchad (8,3 %) et au Logone Oriental (9,8 %). Il existe en plus, une disparité entre le milieu urbain (7 %) et le milieu rural (2,3 %). En fonction des tranches d âges, la plus touchée pour le sexe masculin (3,5 %) est la tranche d âge de 25 à 29 ans ; pour le sexe féminin (5,6 %) celles les plus concernées sont celles de 25 à 29 ans et celles de 30 à 34 ans. La tendance évolutive de cette pandémie s explique par la persistance des conflits armés et des comportements sexuels à risque favorisés par les pesanteurs socio culturelles, l analphabétisme et la pauvreté. Malgré l absence des résultats d une enquête récente sur le sujet, la première datant de 2005 donne une prévalence de 3,3 % chez les adultes de 15 à 49 ans dont 4 % chez les femmes et 2,6 % chez les hommes, avec des grandes disparités sous régionales (Onusida, 2013; Ouagadjio et al., 2005). Ce même rapport stipule que les estimations de l ONUSIDA pour 2012 notifient que ( ) personnes de tous âges vivent avec le VIH au Tchad ; il semblerait aussi que ( ) nouvelles infections à VIH se produisent au Tchad (CNLS, 2012). La Sérosurveillance sentinelle auprès des femmes enceintes lors de la consultation prénatale organisée en 2010 dans 13 sites a montré une séroprévalence de 3,4 % (CNLS, 2012). Cette prévalence est plus élevée dans certains sites, comme ceux des régions du Lac et de Logone occidental qui se chiffrent respectivement à 4,8 % vs 6,1 %. En termes de couverture de centre de PTME, le Tchad est passé de 107 sites en 2010 à 140 sites en Le nombre des femmes enceintes ayant bénéficié de la prophylaxie contre le VIH est passé de 834 en 2010 à 1611 en En 2012, 1680 femmes enceintes vivant avec le VIH ont reçu des ARV pour la PTME (CNLS, 2012). Malgré tous ces efforts fournis, la PTME demeure un maillon faible. 8

28 Chapitre I : Introduction Générale S agissant de la couverture pour les ARV, l ONUSIDA estime qu en 2012, adultes recevaient des ARV, soit environ 43% (38-51%) des patients qui en auraient besoin, puisque selon les recommandations de l OMS de 2010, environ personnes ( ) devraient en bénéficier (Onusida, 2013). Les décès dus au sida en 2012 ont été estimés à cas ( ). Entre 2011 et 2015, le nombre moyen annuel de personnes vivant avec le VIH dont l état de santé nécessitera un traitement par les ARV est estimé à personnes ; les besoins actuellement couverts sont d environ 4 % (CNLS, 2012). Par ailleurs, une enquête socio comportementale et de séroprévalence sous régionale menée en 2011 par le Projet d Initiative du Bassin du Lac Tchad (PAIBLT) dans 4 régions du Sud du pays appartenant au basin conventionnel du lac Tchad, a révélé une prévalence de 5,5 % dans la population générale. Ces régions sont caractérisées par une grande mobilité des populations pour des raisons économiques. Cette prévalence relativement élevée tiendrait au fait que l échantillonnage utilisé est constitué en grande partie des groupes à risque d infection à VIH et n a concerné que 4 régions sur les 22 que compte le pays. Les données sur la situation au Tchad étant obsolètes, une Enquête Démographique de Sérosurveillance (EDS) est prévue en 2014 mais n a pas encore vu le jour. 2.4 Le monitoring biologique pour la prise en charge de l infection à VIH Evaluation des signes cliniques La classification en stades cliniques est prévue pour les patients dont l infection par le VIH est confirmée par un test anticorps. Elle doit faire partie de l évaluation initiale réalisée au cours de la première visite à l entrée d un programme de prise en charge et de traitement. Dans les pays à ressources limitées, l OMS recommande que le suivi biologique soit réalisé par la mesure des lymphocytes TCD4 et par l évaluation des signes cliniques. Si la numération des TCD4 n est pas disponible, l évaluation des signes cliniques doit être utilisée pour guider les décisions quant à la mise sous prophylaxie par le Cotrimoxazole, à la mise sous TAR ou au changement de TAR. Le traitement antirétroviral améliore l état clinique et contribue à un retour en arrière du stade clinique chez les patients ayant une maladie symptomatique. Toutefois, pour suivre l efficacité du TAR, pour définir un échec thérapeutique ou pour pointer la nécessité d un changement de traitement, la validité de l utilisation du stade clinique est moins bien connue. Il est urgent que des études déterminent la pertinence des 9

29 Chapitre I : Introduction Générale critères cliniques (stade clinique sous traitement) afin de décider du moment opportun et de changer le traitement en l absence des tests de numération des CD4 et de la charge virale (OMS, 2006). Ces différentes phases de la maladie sont classées selon l OMS en quatre stades (1, 2, 3 et 4) et selon la CDC en trois catégories (A, B et C). Tableau 1 Classification de la maladie à VIH/ stades cliniques OMS Classification de la maladie Stades Cliniques OMS Asymptomatique 1 Modérée 2 Avancée 3 Sévère Mesure des lymphocytes CD4 Le nombre de CD4 demeure le meilleur facteur pour prédire la survenue de complications liées au VIH même après avoir commencé le traitement (Gadelha et al., 2002). Le seul paramètre immunologique pertinent pour surveiller et prendre en charge les patients infectés par le VIH est le nombre absolu de lymphocytes TCD4 circulants dans le sang. Cependant, pour les distinguer des autres lymphocytes, on pratique un immuno-marquage avec des anticorps anti-cd4 fluorescents et on compte les cellules marquées par cytométrie de flux (une technique de numération automatique). Valeurs normales des TCD4 : entre 600 et 1200/mm 3 Il existe normalement en règle générale 1500 à 4000 lymphocytes/mm 3 dont 70 % de lymphocytes T parmi lesquels 60 % de TCD4 et 40 % de TCD8. Ainsi, le taux de TCD4 est normalement supérieur à 600/mm 3. Le taux de lymphocytes TCD4. Ce taux peut varier d'une mesure à l'autre en raison de la variabilité du nombre de lymphocytes circulants. Définition de l échec virologique Les définitions à la fois acceptables et fonctionnelles de l échec immunologique sont les suivantes: si le nombre de CD4 est inférieur à 100 cellules/mm 3 après six mois de 10

30 Chapitre I : Introduction Générale traitement; ou encore s il y a un retour au niveau des CD4 précédant le début du traitement (ou chute en dessous de ce niveau) après six mois de traitement; ou si s il y a chute du nombre de CD4 à moins de 50 % de la valeur du pic obtenue sous traitement (lorsque cette valeur est connue). Le nombre de CD4 peut également permettre de déterminer quand il ne faut pas changer de traitement (exemple: le cas d un patient qui présente une nouvelle pathologie définissant un stade 3 en raison de laquelle on envisage de changer de traitement, ou le cas d un patient asymptomatique dans le cadre de son suivi de routine habituel). Selon les recommandations de l OMS datant de 2006, il ne devrait pas être recommandé de changer de traitement si le nombre de CD4 est supérieur à 200 cellules/mm 3 (OMS, 2006). Les nouvelles recommandations de l OMS de 2013 encouragent par contre tous les pays à mettre en route le TAR chez les adultes vivant avec le VIH quand leur système immunitaire est encore fort; c est à dire dès que le nombre des LTCD4 devient inférieur à 500cellules/mm 3 ou moins. Les précédentes recommandations de l OMS, formulées en 2010, incitaient à proposer le traitement au stade de 350 cellules CD4/mm 3 ou moins. Plusieurs pays (90%) avaient adopté les recommandations de Certains pays comme l Algérie, l Argentine et le Brésil, proposaient déjà le TAR au seuil de 500 cellules CD4/mm 3 (OMS, 2013) Mesure de la charge virale La mesure de la concentration plasmatique de l'arn du VIH (ou charge virale) évalue l'intensité de la réplication du virus dans l'organisme qui se situe en fait non dans le sang mais bien dans les organes lymphoïdes. Le niveau de réplication du virus, estimé par la charge virale, est le paramètre le plus précis et le plus précoce pour prédire l'évolution clinique ultérieure. L'ARN viral est évalué par une technique d'amplification génique, la technique de polymérisation en chaîne PCR. Compte tenu des variations de sensibilité des tests utilisés, il est important qu'un patient soit suivi dans un même laboratoire avec la même technique. Les résultats sont présentés à la fois sous la forme de la charge virale proprement dite (nombre de molécules d'arn viral ou copies par ml de plasma) et sous sa transformation logarithmique (log10 du nombre de copies/ml). Toutefois, l'incertitude sur la mesure de la charge virale est élevée. On considère que seule une variation de 0,5 log10 copies/ml est significative. Ce qui équivaut à 11

31 Chapitre I : Introduction Générale un nombre de copies multiplié ou divisé par 3. Ainsi, une charge virale qui passe de à copies/ml correspond à une réelle augmentation, alors que le passage de à copies/ml n'est pas significatif. La variabilité de la mesure est liée à deux phénomènes intriqués. Le premier phénomène est technique: Il fait référence à la variabilité des conditions de mesure au laboratoire. Le deuxième porte sur la fluctuation de la quantité de virus présents dans le plasma qui cause souvent des résultats faux positifs appelés «blips». Les principales méthodes de mesure de la charge virale sont résumés dans le tableau ci dessous (Hocini & Andreoletti, 2009; Serge et al., 2009). Tableau 2 Comparaison des différentes techniques de mesure de la charge virale Tests de résistance: le phénotypage (antivirogramme) et le génotypage De nos jours, deux méthodes sont employées pour évaluer la résistance du VIH aux différents médicaments: les tests phénotypiques et génotypiques. Les premiers reposent sur la détermination de la concentration de produit actif nécessaire pour inhiber la réplication virale de 50 % ou 90 %. S agissant de la résistance phénotypique, elle est mesurée en comparant la valeur de la concentration inhibitrice (CI) des isolats viraux testés à celle d isolats de souche sauvage. Une valeur élevée de la CI reflète cependant une perte de sensibilité du virus vis-àvis de tel ou tel agent antirétroviral (Larder B.A., 2000). 12

32 Chapitre I : Introduction Générale Les tests génotypiques sont fondés sur l analyse des séquences du gène de la Protéase et de la Reverse transcriptase. La résistance génotypique reflète la présence de mutations à l origine de résistances phénotypiques ou cliniques (Sheldon & Condra, 1999). Il existe généralement une corrélation entre le nombre de mutations associées à la résistance aux différents médicaments et l augmentation de la CI 50. La résistance à un médicament antirétroviral dépend de la présence de mutations majeures ou mineures. Une mutation majeure est celle dont l unique présence induit un niveau de résistance élevé à un ARV donné. Dans le cas des mutations mineures, l accumulation de plusieurs substitutions secondaires est nécessaire pour observer un phénotype de résistance élevé (Larder B.A., 2000). Le Séquençage Le séquençage de l ADN a été inventé dans la deuxième moitié des années Deux méthodes ont été développées indépendamment: l une par l équipe de Walter Gilbert, (Maxam and Gilbert 1977) aux États-Unis, et l autre par celle de Frederick Sanger (Sanger, Nicklen et al. 1977) en Grande-Bretagne. Ces deux méthodes sont fondées sur des principes diamétralement opposés: l approche de Sanger est une méthode par synthèse enzymatique sélective, tandis que celle de Maxam et Gilbert est une méthode par dégradation chimique sélective. Pour cette découverte, Gilbert et Sanger ont été récompensés par le prix Nobel de chimie en 1980 (Kolata 1980). Par ailleurs, la première méthode non Sanger ayant fait ses preuves dans le domaine du séquençage a été introduite en 1988 (Hyman, 1988; Ronaghi, 2001). Il s agit du pyroséquençage, une technique principalement basée sur l addition d un seul nucléotide qui est révélé en temps réel par détection de la luminescence. Principe de la méthode de Sanger et Nicklen Cette méthode se base sur l interruption de la synthèse enzymatique d un brin d ADN complémentaire (arrêt d élongation). L ADN à séquencer est cloné et de nombreuses molécules d ADN simple brin sont produites. Une courte amorce d oligonucléotides (généralement synthétisée chimiquement et éventuellement marquée) est ajoutée à l ADN. Le point de fixation de l amorce sert de point de départ pour la synthèse du brin complémentaire (Lamoril et al., 2008). 13

33 Chapitre I : Introduction Générale Comme pour la méthode précédente, les bandes sont révélées par autoradiographie et la séquence est lue directement sur le gel. Une adaptation de cette technique consiste à marquer les didéoxynucléotides plutôt que les amorces, ce qui permet de n utiliser qu un seul mélange au lieu des quatre nécessaires dans le cas d un marquage des amorces. Chaque didésoxyribonucléotides est marqué par un fluorochrome spécifique. Les fragments d ADN synthétisés portent ce fluorochrome terminal. On les appelle des terminateurs d élongation ou des «BigDye Terminators» ou des «Dye-labeled terminator». Dans ce cas on parle d un séquençage par arrêt de synthèse à l aide d un terminateur marqué «dye terminator sequencing» tel que proposé par Smith et al. (Smith, Sanders et al. 1986). C est la technique actuellement utilisée dans certains séquenceurs automatisés. Figure 1 Principe du séquençage selon la méthode de Sanger Après dénaturation du produit amplifié par séquençage, l un des deux brins s hybride à une amorce spécifique. Le mélange réactionnel contient, outre les tampons et l ADN polymérase, des déoxynucléotides triphosphates (dntp, da-, dc-, dg-, dt-tp), mais aussi des didéoxynucléotides triphosphates (ddntp, dda-, ddc-, ddg-, ddt-tp). L incorporation aléatoire d un ddntp à la place d un dntp ne permet plus la polymérisation par l ADN polymérase entrainant l arrêt de l extension. À la fin de la réaction de séquence effectuée selon des cycles thermiques identiques à ceux de la PCR (on parle de PCR asymétrique, une seule amorce étant utilisée au lieu de deux), nous avons des fragments de taille différente. Ces fragments sont soumis à migration dans un champ électrique. Il s agit le plus souvent d une électrophorèse capillaire. Chaque ddntp étant marqué par un fluorochrome différent, un signal lumineux sera généré, spécifique de la base didéoxy incorporée. Les fragments étant de taille différente et la résolution allant jusqu à une base de différence, il sera simple de recueillir ce signal et en 14

34 Chapitre I : Introduction Générale déduire la séquence. Les signaux lumineux sont analysés par un logiciel spécifique, et le résultat de l analyse peut être lu, par exemple, sous forme d un électrophorégramme de lecture facile. Des logiciels d interprétation des séquences sont également disponibles. Pour confirmer un résultat, toute réaction de séquence d un fragment d ADN est systématiquement faite sur le brin sens et le brin antisens. Principe de la Méthode de Maxam & Gilbert (Maxam & Gilbert, 1977) Cette technique est pratiquement abandonnée de nos jours. Nous la décrirons brièvement pour des raisons historiques. Cette méthode utilise des échantillons d ADN double brin et ne nécessite donc pas le clonage de l ADN dans un vecteur pour produire de l ADN simple brin comme c est le cas pour la méthode de Sanger. Cette méthode est basée sur une dégradation chimique de l ADN et emploie les réactivités différentes issues des quatre bases A, T, G et C, pour réaliser des coupures sélectives. En reconstituant l ordre des coupures, on peut remonter à la séquence des nucléotides de l ADN correspondant. La méthode de Maxam et Gilbert nécessite des réactifs chimiques toxiques et reste limitée quant à la taille des fragments d ADN qu elle permet d analyser (< 250 nucléotides). Moins facile à robotiser, son usage est devenu aujourd hui confidentiel. 2.5 Les mécanismes d action des antirétroviraux Inhibiteurs Nucléosidiques et Nucléotidiques de la Transcriptase Inverse (INTI) Ces molécules sont des pro-médicaments qui doivent être triphosphorylés dans la cellule pour être actifs. Ils entrent alors en compétition avec les nucléosides naturels. Ils sont dépourvus de groupement hydroxyles en 3 de sorte que leur incorporation empêche l enzyme de procéder à l incorporation d un nouveau nucléotide, entraînant l arrêt simple de l élongation. La principale toxicité imputée à cette classe de molécules concerne la toxicité mitochondriale due à l inhibition non spécifique de l ADN polymérase mitochondriale. Plusieurs organes et tissus sont concernés comme le pancréas et les muscles. En particulier, les analogues de la thymidine sélectionnés essentiellement pour l AZT et la d4t sont impliqués dans la survenue de lipoatrophies plus ou moins sévères. 15

35 Chapitre I : Introduction Générale Inhibiteurs Non Nucléosidiques de la Transcriptase Inverse (INNTI) Les médicaments de cette classe ne sont pas des analogues compétitifs de nucléosides. Ils ne rentrent pas non plus en compétition avec l'arn génomique viral au site actif de l'enzyme. Ces molécules se fixent sur des résidus aminoacides de l'enzyme, à proximité du site catalytique dont ils modifient la structure, ce qui rend l'enzyme inactive. Ces médicaments agissent sans interférer directement avec les substrats de l'enzyme, ce sont donc des inhibiteurs non compétitifs. Ils sont spécifiques de la Reverse Transcriptase du VIH1 et donc inactifs sur le VIH 2. L'action sur le cours de l'infection est la même que celle des INTI. Il s'agit de NVP (Viramune ), de Delavirdine (Rescriptor ) et d EFZ (Sustiva ) Inhibiteurs de la Protéase (IP) Les inhibiteurs de la Protéase appelés aussi antiprotéases comme le Saquinavir (Invirase ) sont des molécules de nature encore différente qui ciblent une autre étape du cycle viral. Développés par génie biochimique à partir de la structure tridimensionnelle de la Protéase, le saquinavir est un pseudopeptide (nature chimique proche du peptide avec structure similaire) analogue d un point de vue structural de la séquence peptidique du site de clivage reconnue par la Protéase. Il s'insère au site catalytique, à l'interface entre les deux sous unités du dimère qui constitue l'enzyme, et bloque son activité protéolytique de façon sélective et réversible. Son activité sur les Protéases humaines analogues est approximativement fois plus faible. Ces molécules sont métabolisées par le cytochrome P450, ce qui est à l origine de nombreuses interactions médicamenteuses. De ce fait, les associations de deux IP ou d IP et INNTI peuvent nécessiter des ajustements posologiques. L utilisation des IP est associée à des degrés divers, à une redistribution des graisses, à des troubles de la glycorégulation et à des hyperlipidémies. En présence d'antiprotéases, la maturation des précurseurs des protéines constitutives de la particule virale est donc rendue impossible ce qui bloque la formation des particules virales ou engendre des particules incomplètes et non infectieuses. Leur action se situe en aval de celle des inhibiteurs de la Reverse Transcriptase. 16

36 Chapitre I : Introduction Générale Inhibiteurs d Intégrase En 2013, la molécule de cette classe ayant une AMM est le Raltégravir (Isentress ) qui est disponible depuis L intégrase du VIH-1 catalyse à la fois les réactions de 3 processing et de transfert de brin. Les anti-intégrases quant à eux bloquent spécifiquement cette réaction de transfert du brin, empêchant ainsi l incorporation de l ADN viral dans la cellule hôte. Ce mécanisme interrompt le cycle de multiplication du virus. Ces inhibiteurs de l Intégrase sont appelés des INSTI «Integrase Strand Transfer Inhibitor». Cette dernière a eu un impact majeur sur les stratégies de traitement contre le VIH. D autres molécules sont en cours de développement: il s agit de l Elvitégravir (GS 9137) et du Dolutégravir (S/GSK 572) (Javaugue, 2014) Inhibiteurs d entrée Des nouvelles classes de molécules sont maintenant utilisables pour améliorer la prise en charge thérapeutique des patients VIH et pour permettre de diminuer la multiplication du virus. Ces molécules agissent sur les différentes étapes d entrée du virus dans la cellule cible : fixation sur la molécule CD4 (anti-ccr5), fusion entre l enveloppe et la membrane cellulaire (inhibiteurs de fusion) et intégration du génome viral (anti-intégrase). a. Inhibiteurs des récepteurs aux chimiokines Appelées encore antagonistes du CCR5 (Maraviroc), ces molécules se fixent sur la région transmembranaire du récepteur gênant ainsi la fixation de la GP120. Elles sont utilisables en primo-infection sur un virus à tropisme CCR5. Elles ont des effets non spécifiques sur les récepteurs aux chimiokines des cellules non infectées. b. Inhibiteurs de fusion Ce groupe de médicament est représenté par l Enfuvirtide (ou T20) qui est un analogue d une région de la protéine d ancrage GP 41 du virus empêchant dès lors la fusion de la GP120 avec la membrane cellulaire et donc la pénétration cellulaire. Ces médicaments sont utilisables en association avec les autres molécules sur les souches virales résistantes. Leurs effets secondaires indésirables sont essentiellement locaux (nodules). c. Inhibiteurs de l intégration du génome viral Le Raltégravir, inhibiteur d intégrase qui a son AMM depuis janvier 2007, agit par 17

37 Chapitre I : Introduction Générale inhibition du transfert de brin de l ADN proviral sur le génome cellulaire(j.-m.m., 2008). 2.6 La problématique et les mécanismes de résistance du VIH aux ARV La résistance se définit comme étant la capacité du VIH à se répliquer en présence d antirétroviraux qui empêchent habituellement sa réplication. La résistance du VIH aux antirétroviraux est provoquée par des changements au niveau génétique (mutations). Ces mutations sont très fréquentes dans le cas du VIH car ce dernier se réplique très rapidement et n est pas doté d une machinerie de correction des erreurs au cours de ces processus. Mutation majeure: c est une mutation dont l unique présence induit un niveau de résistance élevé à un médicament donné. Mutations mineures: ce sont des mutations dont l accumulation de plusieurs substitutions secondaires est nécessaire pour observer un phénotype de résistance élevé. Résistance primaire: c est la transmission d une souche virale résistante; elle s observe chez un patient naïf de tout traitement antirétroviral. Elle peut être naturelle ou transmise lors de l infection. Résistance secondaire: c est une mutation qui est due à la sélection d un virus résistant sous traitement non-optimal. Elle apparait chez un patient VIH en échec thérapeutique. Résistance croisée: Elle apparait lorsqu une ou plusieurs mutations sélectionnées par un antirétroviral causent aussi des résistances à d autres molécules antirétrovirales de la même classe. A titre illustratif, la M41L qui crée une résistance à l AZT, à la d4t, à la ddi, à l ABC et à la TDF Problématique de la résistance du VIH aux ARV Les mécanismes et la cinétique d acquisition des mutations de résistance diffèrent selon les classes des antirétroviraux. La prévention des mutants résistants nécessite de maintenir une charge virale sous traitement inférieur à la limite de détection. L adhérence du patient au traitement est le facteur le plus important pour prévenir l émergence de la résistance du VIH. Cependant, le choix des ARV dans un traitement de relais requiert une concertation multidisciplinaire associant cliniciens, virologues et pharmacologues. La résistance du VIH-1 aux antirétroviraux est liée à la présence des espèces virales présentant des mutations sur le génome viral, lesquelles réduisent la sensibilité du virus par 18

38 Chapitre I : Introduction Générale rapport à celle d un virus sauvage. Cette résistance peut être naturelle, comme celle du VIH2 pour les INNTI ou de l enfuvirtide, transmise ou primaire (en l absence de traitement préalable). La fréquence de la résistance à au moins un antirétroviral est plus grande chez les patients diagnostiqués au moment de leur primo-infection que chez les patients plus anciennement infectés. La souche sauvage possède une capacité réplicative meilleure que les souches mutées qui ne seront plus détectées par les tests de routine au fur et à mesure de l évolution de l infection. La résistance peut être également secondaire, acquise, liée à l émergence de souches comportant des mutations dans les gènes qui codent les cibles des antirétroviraux sous l effet de la pression de sélection d un traitement non optimal. Les différentes mutations sont archivées dans les cellules à durée de vie longue et préexistent déjà dans les cellules de l hôte avant la mise en place du traitement. Le développement de ces résistances est un facteur indépendant d échec virologique (Bigaillon, Mérens, & Rapp, 2010). Plusieurs facteurs favorisants peuvent être responsables de l installation des résistances. Ces facteurs peuvent être entre autres, la préexistence chez les sujets des mutations de résistances. Cela est favorisé le plus souvent par l inefficacité du traitement administré, sinon par la mauvaise observance, ou encore par les interactions médicamenteuses ou la malabsorption. Certains facteurs cellulaires, tels que des défauts de métabolisation ou des mécanismes d efflux, pourraient également être un facteur favorisant le développement de la résistance. Cependant, leur implication est encore mal connue. Ces souches résistantes ont le plus souvent une capacité réplicative inférieure à la population sauvage (Delaugerre et al., 2007). Leurs mutations sont responsables de modifications structurales ou fonctionnelles des cibles des antirétroviraux. Néanmoins, le nombre et le type de mutations entraînant un phénomène de résistance est variable selon la molécule antivirale concernée. Par exemple, la résistance aux INNTI est un phénomène de «tout ou rien» liée à une seule mutation qui entraînera une résistance croisée à tous les INNTI de première génération (NVP et EFZ). Ces molécules ont une faible barrière génétique à l inverse des inhibiteurs de Protéase pour lesquels plusieurs mutations sont nécessaires pour induire une résistance (Kempf et al., 2001). Pour les pays à faibles revenus, avec l extension des traitements ARV qui s est opérée entre 2003 et 2010, la prévalence de la résistance transmise a augmentée culminant à 6,6 % en 19

39 Chapitre I : Introduction Générale 2009 [IC] à 95 % : 5,1 8,3 %. Elle s est notamment accrue pour les INNTI en Afrique où elle a atteint un taux de 3,4 % [IC] à 95 % : 1,8 5,2 %. Cette prévalence est qualifiée de modérée (5-15 %) dans 20 des 72 enquêtes OMS (soit 28 %) relatives à la résistance transmise menée entre 2004 et Concernant les résistances acquises, les personnes en échec virologique, si elles sont mises sous schéma thérapeutique de deuxième intention peu de temps après l échec, ont des chances de ne pas développer de résistance aux médicaments. L OMS affirme qu entre 2006 et 2010, la prévalence à un ARV quelconque est passée de 4,8 % en 2007 à 6,8 % en 2010 chez des patients débutant un TARV (OMS, 2012). L échec thérapeutique n est pas seulement dû à l apparition d une mutation de résistance au niveau du virus, mais peut également s expliquer aussi par une faible observance ou une interruption prolongée du traitement. Nous nous intéresserons dans un premier temps, tout au long de ce travail, à étudier la résistance acquise puisque sa connaissance permettrait l évaluation de la performance du programme de surveillance mis en place au niveau national, en termes de suppression de la réplication virale. Nous décrivons dans un deuxième temps, les profils des résistances aux ARV chez les PVVIH sous traitements. Ceci permettrait aux cliniciens, une optimisation du choix des combinaisons des antirétroviraux à prescrire Mécanisme de résistance du VIH aux INTI Ce sont des analogues des nucléosides ou des nucléotides naturels avec lesquels ils entrent en compétition. Ne disposant pas de groupements OH en 3, ils agissent en bloquant l élongation de la chaine. Le virus développe cependant deux mécanismes de résistance à ce groupe des médicaments (Hirsch et al., 2008): le premier mécanisme concerne l excision de l analogue Nucléosidiques incorporé permettant ainsi la reprise de l élongation de la chaine. L excision de l analogue Nucléosidiques déjà incorporé est conférée par les mutations appelées TAMs pour «thymidine analogue mutations». Elles sont sélectionnées séquentiellement par les analogues de la thymidine et comprennent les mutations M41L, D67N, K70R, L210W, T215Y/F et K219Q/E. Elles confèrent une forte résistance à l AZT et à la d4t. La plus fréquente de ce groupe de 6 mutations TAMs est la T215Y/F, alors que K70R et K219Q/E ont moins d impact que les quatre autres dans cette résistance croisée. Ces TAMs peuvent entraîner un niveau de résistance variable aux autres INTI dont l ABC, la ddi, le TDF, et la ddc. Elles peuvent favoriser l apparition d autres mutations telles que la 44D/A et 118I. 20

40 Chapitre I : Introduction Générale Notons que dans tous les cas, l impact de la résistance dépend du profil et du nombre de TAMs observés (Calvez et al., 2002; Johnson et al., 2010; Kellam, Boucher, & Larder, 1992; Kuritzkes et al., 2004; Larder & Kemp, 1989; Whitcomb, Parkin, Chappey, Hellmann, & Petropoulos, 2003). La mutation M184V en présence de TAMs augmente la résistance in vivo à l ABC et n a pas d impact sur le TDF et la ddl (Doualla-bell et al., 2010). Cette mutation peut être responsable d une faible résistance à l ABC et à la ddl (Whitcomb et al., 2003). Le second mécanisme consiste en la diminution de l incorporation des nucléosides/nucléotides artificiels au profit des nucléosides naturels induite par des mutations au site actif de l enzyme ou à distance. Il convient de mentionner que la barrière génétique pour ce groupe des ARV est variable selon les molécules (Bigaillon et al., 2010) Mécanisme de résistance du VIH-1 aux INNTI Ils inhibent l action de l enzyme (la Reverse Transcriptase) de façon non compétitive en se fixant directement sur une poche hydrophobe de l enzyme située près du site actif et en empêchant la mobilité de certains domaines de l enzyme. Un seul changement d acide aminé entraine une diminution de l affinité de l inhibiteur (Bigaillon et al., 2010). La barrière génétique est très faible pour ce groupe de médicament si bien qu une seule mutation telle que la K103N ou la Y181C pour ce groupe peut engendrer une résistance totale et irréversible (Villar et al., 2009). Cependant, la mutation K103N n a aucun impact délétère sur la réponse virologique à l Etravirine. En outre, la Y181C n est associée à une diminution de la réponse virologique qu en présence d autres mutations dans cette classe des INNTI (Vingerhoets et al., 2007) Mécanisme de résistance du VIH-1 aux IP Les Inhibiteurs de la Protéase agissent selon le modèle de la «clé et la serrure» c est à dire qu il y a perte d affinité. Les mutations majeures ou mineures sont souvent sélectionnées et sont plus ou moins spécifiques de l inhibiteur et ont un effet important sur la diminution de la sensibilité du virus à l antirétroviral concerné. Les inhibiteurs de la Protéase ont une action tardive dans le cycle en bloquant l action de la Protéase qui clive les polypeptides précurseurs. Ils empêchent la maturation des néo virions qui ne pourront pas infecter d autres cellules. La résistance intervient lorsqu il y a accumulation des mutations dont toutes n ont pas les mêmes impacts. Les mutations 21

41 Chapitre I : Introduction Générale secondaires ou mineures ont peu d effet sur le niveau de résistance déjà atteint La barrière génétique des IP est élevée, il faut cependant l accumulation de plusieurs mutations pour voir apparaître la résistance (Bigaillon et al., 2010) Mécanisme de résistance du VIH-1 aux antiintégrases L intégrase du VIH agit en se fixant sur l extrémité de l ADN viral après retro transcription pour digérer l extrémité 3, puis elle insère l ADN-VIH proviral dans l ADN génomique. Les Inhibiteurs d Intégrase se fixent sur le complexe ADN viral-enzyme au niveau du site catalytique de l intégrase en bloquant la fixation cellulaire. Les mutations de résistance apparaissent cependant autour du site catalytique de l enzyme. Elles entrainent ainsi donc des changements conformationnels qui diminuent l affinité du médicament qui ne peut plus exercer son pouvoir de chélateur des cations nécessaires au fonctionnement de l enzyme. La barrière génétique pour ce groupe de médicaments est faible, une seule mutation suffit pour induire une résistance (Bigaillon et al., 2010) Mécanisme de résistance du VIH-1 aux inhibiteurs d entrée (de fusion) Le médicament se lie à la région HR1 de la gp41 et bloque son changement conformationnel qui permet l insertion du peptide de fusion dans la membrane cellulaire. La résistance du VIH-1 à l Enfuvirtide ou T20 est liée à l acquisition par le virus des mutations dans le région HR-1 du gène de la gp41 dans une région allant des acides aminés 36 à 45 (A. Marcelin & Calvez, 2007; Yeni, 2008) Mécanisme de résistance du VIH-1 aux inhibiteurs de CCR5 C est par l intermédiaire de la boucle V3 que les corécepteurs CCR5 et CXCR4 interagissent en réponse à la formation de la liaison gp120-cd4 entrainant le changement de la conformité de l enveloppe. Les molécules antirétrovirales bloquent donc l interaction de la gp120 avec le CCR5 en modifiant sa conformation. Ces ARV sont efficaces sur les virus à tropisme R5 mais pas sur ceux à tropisme X4 ou mixte (R5+X4) ou encore sur les doubles populations R5/X4. Néanmoins, deux mécanismes de résistance à ces médicaments : le premier correspond au changement de tropisme du virus par l émergence de souches X4 préexistantes sous forme d une population minoritaire non initialement détectée (Bigaillon et al., 2010). Le second mécanisme consiste en l apparition des mutations dans la boucle V3 ou 22

42 Chapitre I : Introduction Générale dans d autres régions de la gp120. Même si les mutations des acides aminés 13 et 26 semblent importantes, il n y a aucune signature spécifique de résistance identifiée à ce jour (Hirsch et al., 2008; Morand-joubert, 2009). Aucune résistance croisée n existe entre les inhibiteurs de CCR5 et les autres classes thérapeutiques des antirétroviraux (A. Marcelin & Calvez, 2007; Yeni, 2008). III. But, hypothèses, objectifs et plan du travail 3.1. Le but de l étude Le but de cette étude est de contribuer au bien être des PVVIH en proposant des méthodes alternatives pour une meilleure prise en charge Les hypothèses de recherche L utilisation du DBS pour les tests de résistance, permettra de limiter les exigences strictes liées à l échantillon (stockage, transport et conservation). Un monitoring biologique basé sur les méthodes de l ANRS pour la détection des mutations de résistance permettra un suivi biologique efficace et à moindre coût des patients VIH-1 positifs. La connaissance du profil génotypique du VIH chez des patients sous traitement ARV permettra de proposer des protocoles thérapeutiques plus efficaces L objectif général Etant donné qu au Tchad les tests de résistance ne sont pas encore disponibles, notre objectif dans le cadre de cette thèse, est d évaluer et de mettre en place des méthodes alternatives pour le monitoring biologique de la résistance du VIH aux ARV chez les PVVIH au Tchad Les objectifs spécifiques Chez les patients vivants avec le VIH au Tchad, sous traitement pendant au moins 6 mois, nous entendons: faire une évaluation immunovirologique avant et après traitement; quantifier la charge virale et évaluer les différentes techniques disponibles; 23

43 Chapitre I : Introduction Générale identifier chez ces sujets les différentes mutations de la Reverse Transcriptase et de la Protéase associées à la résistance du virus et en évaluer la prévalence sur DBS et plasma; évaluer la technique ASPCR afin de détecter les mutations ponctuelles associées à la résistance du VIH-1 pour les sous-types non-b; déterminer la prévalence de la résistance acquise et la diversité génétique des sous-types du VIH-1 circulants à N Djamena. Chaque objectif spécifique énuméré ci-dessus fait l objet d un chapitre dans ce document Le plan du travail Ce travail est structuré en sept chapitres et chacun d eux répond à une problématique bien définie. Les deux premiers chapitres retracent la situation globale du VIH, les médicaments antirétroviraux ainsi que leurs mécanismes d action et de résistance Le matériel et la méthodologie sont aussi décrits dans ces deux premiers chapitres. Les résultats répondants aux objectifs spécifiques sont résumés dans les cinq derniers chapitres. Le premier chapitre est une introduction générale qui donne une brève définition du VIH/SIDA. Il décrit les différentes classes de médicaments antirétroviraux avec leurs mécanismes d action ainsi que leurs mécanismes de résistance. La problématique de la résistance est aussi décrite dans ce chapitre. A la fin de ce chapitre, une revue nous renseigne d avantage sur l importance de l utilisation du DBS pour le monitoring biologique dans les pays à ressources limitées. Le deuxième chapitre décrit le matériel utilisé et la méthodologie adoptée pour répondre à la question de recherche à travers nos objectifs généraux et spécifiques. Les cinq autres chapitres font partie des résultats et répondent aux objectifs spécifiques et seront structurés de la façon suivante: Le troisième chapitre renseigne sur la possibilité d une prise en charge des PVVIH par l évaluation immunovirologique (mesure des lymphocytes TCD4 et la Charge Virale). Une première partie est consacrée à l évaluation immunovirologique. La dernière partie traite l évaluation immunovirologique uniquement chez les patients qui étaient sous Triomune. Un article publié à ce sujet est mis à la fin du chapitre. Le quatrième chapitre compare trois différentes techniques de meures de la charge virale (Abbott RealTime, CAP/CTM V2.0 et la technique de l ANRS) disponibles au 24

44 Chapitre I : Introduction Générale Laboratoire de Référence Sida du CHU de Liège. Ce chapitre donne le nombre des patients en échec virologique et la prévalence de la suppression virale chez les patients. Le cinquième chapitre traite l importance de l utilisation du DBS pour le monitoring biologique dans les pays à ressources limitées. Le sixième chapitre relate de long en large la diversité génétique du VIH et la prévalence de la résistance acquise à N Djaména au Tchad. Le Septième chapitre reprend la prise en charge par le monitoring biologique mais en utilisant la technique de détection des mutations ponctuelles (ASPCR) sur du plasma et sur DBS. Nous introduisons chaque chapitre par une brève présentation, suivie de la méthodologie utilisée. Nous présenterons ensuite les résultats originaux et nous résumerons les résultats à la fin du chapitre. A la fin de ce document, sera présentée une discussion générale qui reprend les différents chapitres pour une discussion beaucoup plus approfondie. Enfin, une conclusion générale et les perspectives d avenir viendront mettre un terme à ce travail. 25

45 Article: Utilisation du Dried Blood Spots (DBS) pour améliorer le diagnostic et la prise en charge du VIH en milieux à ressources limitées. Cet article comme nous l avions dit dans la problématique en début du chapitre I, nous renseigne d avantage sur l utilisation du DBS dans les milieux à ressources limitées. Il décrit largement les avantages et les limites liés à l utilisation du DBS dans le diagnostic de l infection à VIH ainsi que dans le monitoring biologique. 26

46 27

47 28

48 29

49 30

50 31

51 32

52 Chapitre II : Matériel et Méthodes Chapitre II Matériel et Méthodes 33

53 Chapitre II : Matériel et Méthodes CHAPITRE II- Matériel et méthodes II.1 Le matériel Matériel de collecte des données Ce matériel est constitué essentiellement d une fiche de consentement éclairé (Annexe 4) et d une fiche contenant un questionnaire standardisé pour la collecte des informations socio-épidémiologiques et professionnelles (Annexe 3) Matériel de prélèvement Le prélèvement du sang veineux a lieu à l aide de matériel adéquat stérile. Il est constitué de : garrot, tubes à EDTA de 4ml, cryotubes de 2ml, aiguille vacutainer, douille pour prélèvement, compresse stérile, alcool à 70 pour désinfection de la zone à ponctionner ; papier buvard Wathman 903, desséchants, sparadrap. II.2 Les méthodes Site de l étude Notre étude s est déroulée à l Hôpital Général de Référence National de N Djaména (HGRN). Le choix du site n est pas fortuit, car pendant la période de la collecte de nos échantillons, cet hôpital est le seul où l on pratique le suivi immunovirologique (charge virale et CD4). Il se trouve à N Djaména, la capitale de la République du Tchad. Les analyses de biologies moléculaires sont réalisées au Laboratoire de Référence Sida du CHU de Liège Description du site de l étude L'Hôpital Général de Référence Nationale (HGRN) est un établissement public à caractère administratif doté de la personnalité morale et de l autonomie financière. Il est placé sous la tutelle du Ministère de la Santé Publique et d'un Conseil d'administration. Il dispose essentiellement des services et d'unités de soins qui couvrent la quasi-totalité des besoins de santé. L éventail très large des activités s adresse à toute la population tchadienne. Sur le plan organisationnel, l hôpital se divise en quatre grands départements regroupant des différents services techniques et médicaux. La population de N'Djaména s élève à habitants pour une population générale de habitants en Jusqu au moment où nous 34

54 Chapitre II : Matériel et Méthodes avons collecté les échantillons, le HGRN demeurait le seul endroit où se réalisait la charge virale sur Abbott RealTime pour le suivi biologique de l infection à VIH. Les tests génotypiques ne sont actuellement pas encore disponibles au Tchad Type d étude Pour atteindre notre objectif, nous avons eu recours à deux types d études: l une étant transversale prospective et rétrospective et l autre étant expérimentale Durée de l étude La collecte des échantillons a duré 10 mois (1 er avril 2011 au 31 janvier 2012). La durée totale de l étude est de quatre années. La première année était consacrée à la revue bibliographique sur le sujet et à l apprentissage de techniques de biologie moléculaire au LRS de Liège. La deuxième année était dédiée à la collecte des données et des échantillons au Tchad et leur transport à Liège. Au cours de cette deuxième année, les premières analyses et notamment les charges virales, ont été réalisées et les résultats ont été transmis aux médecins traitants au Tchad. Au cours de la troisième et quatrième année, s en est suivi la suite des analyses, la rédaction des articles et de la thèse Taille de l échantillon Puisqu il s agit d une étude transversale, nous avons utilisé la formule de Lorentz (n= Z 2 1-α [p (1-p)/α 2 ]) pour calculer la taille de notre échantillon : n: taille de l échantillon recherchée; La prévalence de la résistance rapportée par Koyalta et al. (2009) est de 64% (p = 0,64); α: marge d erreur à 5 %= 0.05; Z1-α: intervalle de confiance 95% = n = 92,16; or nous avons enrôlé 116 patients dans l étude Méthode d échantillonnage Notre échantillonnage se compose des sujets sous traitement ARV en échec virologique ou en suspicion d échec des deux sexes et suivis à l Hôpital Général de Référence 35

55 Chapitre II : Matériel et Méthodes Nationale au Tchad depuis plus de six mois. Au moins 116 patients (soit 78 femmes et 38 hommes respectivement 67,24 % et 32,76 %) ont été enrôlés dans notre étude. Notre échantillonnage utilisé est de type consécutif non exhaustif. Tout patient qui vient à l hôpital pendant la période de l étude et qui répond aux critères de sélection est inclus dans l étude Critères d inclusion Patient sous traitement ARV, des deux sexes et suivis à l Hôpital Général de Référence Nationale pendant au moins 6 mois. Sujet en situation d échec thérapeutique ou suspicion d échec notifiée par le médecin Critères d exclusion Sujet refusant volontairement de faire partie de l étude. Tout sujet en transit dans à l Hôpital Général de Référence Nationale et dont le dossier ne contient pas ou contient peu d informations Procédure de recueil des données Les objectifs de l étude, son importance et sa bienfaisance sont expliqués à tous les patients afin d obtenir leur consentement éclairé. Les informations socioprofessionnelles du patient sont récoltées dans un questionnaire bien standardisé après qu il ait accepté de faire partie de l étude. Une fiche de consentement éclairé est signée par chaque patient avant le prélèvement Procédure de collecte des échantillons L échantillon que nous avons utilisé est le sang veineux qui est d abord recueilli dans deux tubes EDTA de 4 ml chacun. Les deux tubes sont remués doucement pour mélanger le sang avec l anticoagulant. Pour le DBS, un papier buvard de type Wathman 903 est employé avec ce sang total. Sur le DBS dûment préparé, il est inscrit les informations suivantes: les initiales du patient, sa date de naissance, la date du prélèvement et le numéro d identification de la fiche. A partir du sang total prélevé sur tube EDTA, 75 µl sont prélevés à l aide d une micropipette et sont 36

56 Chapitre II : Matériel et Méthodes déposés sur le buvard. Cinq spots sont utilisés pour chaque patient. Le séchage a lieu pendant une nuit à température ambiante et à l abri de la lumière conformément à plusieurs études. Le lendemain, ces buvards sont mis dans un emballage en plastique contenant deux desséchants. La conservation est faite à -20 C jusqu au transport en Belgique pour les analyses. Pour le plasma, le sang est centrifugé pendant 10 mn à g. Le plasma est aliquoté dans trois cryotubes de 2 ml (2 à 3 cryotubes sont utilisés selon le volume du plasma). Ils sont ensuite mis dans une boite et conservés à -80 C jusqu au transport en Belgique Procédure d analyse des échantillons Les échantillons de sang collectés sur papier buvard (DBS) ou sur tube (plasma) et sont analysés conformément à la procédure définie. Pour les papiers buvard, il a été d abord question d extraction du matériel génétique du virus (ARN) avant toute analyse. Le buffy coat est également sollicité pour l extraction de l ADN proviral des lymphocytes. Le plasma aliquoté est employé pour la charge virale et le séquençage Mesure des lymphocytes TCD4 Cette mesure est réalisée sur sang total par le FACS Count (Becton Dickinson Immunocytometry Systems, USA.). La première a lieu avant le traitement au J0 et la seconde après huit mois de traitement Mesure de la charge virale Pour la charge virale, l échantillon utilisé est le plasma. Les mesures sont réalisées au Laboratoire de Référence Sida du CHU de Liège à l aide des trois techniques: le CAP/CTM et Abbott RealTime Cobas AmpliPrep/Cobas TaqMan HIV-Test, v2.0 La technique CAP/CTM permet l'automatisation de la préparation des échantillons pour le dosage quantitatif ou qualitatif des acides nucléiques. La préparation des échantillons est suivie de la transcription inverse, de l amplification par PCR et de la détection automatisée de l ARN cible du HIV-1 et de l Armored RNA du Standard de Quantification (QS) du HIV- 37

57 Chapitre II : Matériel et Méthodes 1. Le mélange réactionnel contient des amorces et des sondes spécifiques à la fois de l ARN du HIV-1 et de l ARN du QS du HIV-1. Le mélange réactionnel a été conçu de façon à permettre une détermination quantitative équivalente des sous-types du HIV-1 du groupe M et du groupe O. La détection de l ADN amplifié est réalisée par l utilisation de sondes doublement marquées spécifiques de la cible et du QS, permettant l identification indépendante des amplicons du HIV-1 et du QS du HIV-1. Cette technique est destinée à être utilisée en complément du tableau clinique et d autres marqueurs biologiques indiquant l évolution de la maladie, en vue du traitement clinique des patients infectés par le HIV-1 de groupe M et le HIV-1 de groupe O. Le CAP/CTM v2.0 utilise des amorces de transcription inverse et d amplification par PCR qui définissent des séquences dans les régions hautement conservées du gène gag du HIV-1 et de la région LTR du HIV-1 (Troppan et al., 2009). Le test permet d évaluer le pronostic du patient en déterminant le niveau de base d ARN du HIV-1 ou d examiner les effets du traitement antirétroviral en fonction de la charge virale dans le plasma prélevé sur tube EDTA tout au long du traitement. Ce test a été validé exclusivement pour l analyse de plasma humain prélevé sur tube contenant l anticoagulant EDTA. L analyse de types d échantillons différents de ceux du type indiqué peut aboutir à des résultats inexacts. La performance de la technique n a été évaluée ni avec des échantillons contenant le HIV-1 du groupe N, ni avec des échantillons contenant le HIV Abbott RealTime Abbott RealTime HIV-1 in vitro test, est un dosage in vitro par RT-PCR pour la détermination quantitative du VIH-1 dans le plasma d'individus infectés. Le système Abbott m2000 est une plate-forme. Il permet la détection qualitative in vitro de l ADN et de l ARN du virus sur le système m2000. C est un test réalisable sur plasma et sur du sang total récolté sur papier buvards sur des échantillons adultes et pédiatriques. Il permet la détection des soustypes HIV-1: groupe M sous-types A, B, C, D, CRF01_AE, F, CRF02_AG, G et H, groupe N et O PCR en temps réel de l ANRS Cette technique a pour intérêt la détection et la quantification de l ARN du VIH-1 38

58 Chapitre II : Matériel et Méthodes ciblant le gène du LTR. Elle permet la détection de la plupart des sous-types du VIH-1 du groupe M, et constituent désormais une alternative intéressante. Elle nécessite cependant du personnel entraîné et une supervision importante au début de la mise en place. La technique en elle-même est moins chère, mais la maintenance des appareils n est souvent pas assurée. L utilisation de ces appareils pour un passage à l échelle est en cours d évaluation (Francois Rouet et al., 2005). En ce qui concerne l extraction de l ARN par le kit d extraction QIAamp DNA mini kit, 140 µl du plasma conservé à -80 C sont utilisés pour l extraction afin d obtenir un éluat final de 60 µl. S agissant du contrôle, 10 µl sont mis dans tous les échantillons avant extraction. Pour la RT-PCR, un volume total de 25 µl contenant 20 µl de Mix et 5 µl d extrait ARN est employé. Les amorces (forward et Reverse; une concentration finale de 500 nm chacune), la sonde (une concentration de 200 nm) et Taqman One-Step RT-PCR Master Mix; (Applied Biosystems). La Sonde et les amorces utilisés sont: La séquence de l amorce sens est: (HIV1MGF) 5 -GCCTCAATAAAGCTTGCCTTGA-3. La séquence de l amorce anti-sens est: (HIV1MGR) 5 -GGCGCCACTGCTAGAGATTTT-3.La séquence de la sonde LTR : HIV1MGP FAM5 AAGTAGTGTGTGCCCGTCTGTTRTKTGACT- 3. Le reporter pour la sonde se trouve en 5 : 6-carboxyfluorescéine et en 3 le quencher: le 6- carboxytétraméthylrhodamine (Applied Biosystems, Foster City, CA). La sonde est marquée en 5 avec le 6-FAM (Fluorochrome) et en 3 avec le TAMRA (Quencher) et purifiée par le HPLC. La courbe de contrôle est faite par un facteur de dilutions de 10 sur un contrôle, le Cy5 RNA Detection Probe. Définition de l échec au traitement Les comparaisons des moyennes des lymphocytes CD4 et la CV plasmatique ( 1000 copies) ont été utilisés pour définir l échec au traitement. Tous les échantillons ayant une CV ( 1000 copies; n = 50) sont soumis au séquençage pour la détection des mutations de résistance et la distribution des sous-types circulantes Techniques d amplification et de détection des mutations de résistance Puisqu il s agit des patients sous première ligne, le séquençage ne concernera que deux enzymes du gène POL: la Reverse Transcriptase et la Protéase. 39

59 Chapitre II : Matériel et Méthodes La technique utilise des amorces et des sondes qui peuvent interagir avec des acides nucléiques, par exemple les acides nucléiques qui codent pour la Reverse Transcriptase ou la Protéase du VIH. Cette technique concerne également un oligonucléotide comprenant une quelconque séquence nucléotidique parmi la liste des différentes séquences identifiées. Chacun desdits oligonucléotides est une sonde ou une amorce (ANRS AC11 Resistance Study Group, 2008). Cette méthode se rapporte également à des mélanges d'amorces et de sondes, destinés à être employés dans des réactions RT-PCR et des réactions PCR primaires. Elle concerne en outre des procédés pour détecter de manière spécifique plusieurs mutations du VIH. Les mutations au sein de la Reverse Transcriptase et de la Protéase du VIH peuvent être détectées au moyen desdits procédés. Le principe de la technique consiste à comparer les amplifications différentielles d'une PCR spécifique de mutation et une PCR totale, qui détecte toutes les séquences présentes. Le dosage peut utiliser le modèle généré à partir de la RT-PCR de l'arn viral ou de PCR de l'adn proviral de cellules infectées. Pour l Amplification, des mélanges d'amplification sont prévus, qui comprennent une sonde pour un usage dans une réaction de PCR en temps réel. Les mélanges peuvent ainsi comprendre une amorce sens, une amorce antisens et une sonde. Par exemple, un mélange d'amplification est prévu, comprenant une amorce sens ou un mélange d'amorces sens qui amplifie le 103N, 65R, 69T et 70R mutations, dans lequel le mélange comprend en outre un oligonucléotide ayant les nucléotides bien définis. La détection d une mutation ponctuelle sur la Reverse Transcriptase du VIH consiste en la transcription inverse de l ARN extrait à l aide d un primer défini pour obtenir de l ADNc. Ce dernier est mis en contact avec une amorce anti sens et un jeu d amorces spécifiques pour amplifier le ADN virale contenant la mutation à rechercher. Amplification Tout comme la Protéase et la Reverse transcriptase, la reverse transcription et la première PCR ont été réalisées avec le Titan One tube RT-PCR Kit, Version 13. Le kit est commercialisé par Roche et contient : Titan Enzyme Mix, RNAse Inhibitor (5 U/ l), dntp Mix à 10mM (2,5mM pour chacun), Human Control RNA (2 pg/ l), Control Primer Mix (20 M), H2O free, RT-PR Buffer (contenant du MgCl2 à 7,5 mm et du Dimethylesulfoxyde (DMSO)), DTT ou dithiothréitol à 100 mm, du MgCl2 (25 mm) en stock. 40

60 Chapitre II : Matériel et Méthodes Le Master Mix pour une réaction est préparé avec: Eau (24,5 l), RT buffer (10 l), dntp (4 l), DTT (2,5 l), RNAse Inhibitor (1 l), Enzyme Mix (1 l) et les oligos: MJ3 (5 -AGTAGGACCTACACCTGTCA-3 ( )) et MJ4 (5 - CTGTTAGTGCTTTGGTTCCTCT-3 ( )) pour la Reverse transcriptase (1 l de chaque), 5 Prot1 (5 -TAATTTTTTAGGGAAGATCTGGCCTTCC-3 ( )) et 3 Prot1 (5 -GCAAATACTGGAGTATTGTATGGATTTTCAGG-3 ( )) pour la Protéase (1 l de chaque). Les primers alternatifs pour la Reverse transcriptase sont RT18 (5 - GGAAACCAAAAATGATAGGGGGAATTGGAGG -3) et RT21 (5 -CTG TATTTCTGCTATTAAGTCTTTTGATGGG-3). Ceux de la Protéase sont 5 eprb (5 - AGAGCTTCAGGTTTGGGG-3) et 3 eprb (5 -GCCATCCATTCCTGGCTT-3 ). Le Mix est toujours prévu pour n+1 échantillons. Sous la hotte free ADN/ARN, la plaque 96 puits étant sur Eppendorf Cooler, le Mix est reparti dans les puits de la plaque à raison de 45 l, on y ajoute 10 l d extrait d ARN dans la chambre d assemblage. Le volume total pour une réaction est de 55 l. La reverse transcription et l amplification ont été réalisées sur le thermocycleur 9700 (les temps sont adaptés au thermocycleur et à l enzyme utilisée conformément au Kit TITAN). Il est allumé quelques minutes avant le lancement du run. Conditions de la RT-PCR pour la Reverse Transcriptase et la Protéase: 1 cycle à 30 min à 50 C, 1 autre cycle à 94 C pendant 2 min. Puis: (30 sec à 94 C; 30 sec à 55 C; 1 min à 68 C) x 40 cycles et enfin 1 cycle à 68 C pendant 7mn et 4 C pour toujours. PCR Nichée ou Nested PCR Au total 10 l du produit de la première PCR sont utilisés dans 45 l du MMix2. Le kit employé pour la Nested PCR est AmpliTaq ADN polymérase with GeneAmp 10X PCR BufferII MgCl2 solution. Le Mix pour la Nested pour une réaction contient: dntp à 1,25 mm (8,8 l), Tampon 10X (5,5 l), Eau free RNA (18,8 l), MgCl2 (25 mm), Taq Polymérase (0,3 l) et les oligos à 20 mm: A35 (5 - TTGGTTGCACTTTAAATTTTCCCATTAGTCCTATT-3 (2530 to 2558)) et NE1 (35) (5 - CCTACTAACTTCTGTATGTCATTGACAGTCCAGCT-3 (3300 to 3334)) pour la Reverse transcriptase et 5 prot2 (5 -TCAGAGCAGACCAGAGCCAACAGCCCCA-3 (2136 to 2163)) et 3 Prot2 (5 -AATGCTTTTATTTTTTCTTCTGTCAATGGC-3 (2621 to 2650)) pour la Protéase (2,5 l de chaque oligo). Le Primers alternatifs pour la Nested de la Reverse transcriptase sont RT1 (5 - CCAAAAGTTAAACAATGGCCATTGACAGA -3) et RT4 (5-41

61 Chapitre II : Matériel et Méthodes AGTTCATAACCCATCCAAAG-3). Pour la Protéase, c est 5 prb (5 - GAAGCAGGAGCCGATAGACA-3 ) et 3 prb (5 -ACTGGTACAGTTTCAATAGG-3 ). Le volume total pour la réaction est de 55 l. Conditions de la Nested pour la Reverse Transcriptase et la Protéase : 1 cycle à 94 C pendant 3 min, puis (30 sec à 94 C, 30 sec à 55 C, 1,30 min à 72 C) x 40 cycles et enfin 1 cycle à 72 C pendant 7 min; puis 4 C à l infini. Dépôt sur gel : l électrophorèse sur gel d agarose est utilisée pour déterminer les bandes spécifiques. Les produits de la Nested sont déposés sur gel d agarose contenant du bromure d éthidium à 4 %. Une bande est considérée comme spécifique si sa taille correspond à celle du contrôle aux alentours de 731 paires de base pour la Reverse Transcriptase et 507 pour la Protéase. Le contrôle de poids moléculaire utilisés est le Tacklt TM X174 RF ADN/Hae III fragment qui a un intervalle de 72 à paires de bases. Purification des produits de la réaction de séquençage La résine de Sephadex G-50 est utilisée pour la purification du produit de séquençage. Elle permet de dé-saler les échantillons, d éliminer les nucléotides non incorporés et les amorces en excès. La limite d exclusion est d environ 20 bases. La plaque 96 Nucleo Fast 96 de Machery Nagel est utilisée comme support inerte à la résine de Sephadex G. Le principe est celui d une chromatographie par gel filtration qui consiste en la séparation des composés en fonction de leur poids moléculaires. En fonction de la dimension des pores du gel, les composés qui sont en trop dans le mélange (excès d amorces, de didésoxyribonucléotides, les sels) sortiront en premier. Le produit issu de la réaction de séquence sera incorporé dans la colonne puis extraits à l aide d un tampon d élution. Détection des mutations de résistances Le protocole de l ANRS (ANRS AC 11 Resistance Study Group/PCR and Sequencing Procédures: HIV-1/Version de février 2008: est utilisé pour le séquençage. L analyse des séquences et la détection des mutations des résistances sont faites en utilisant le site de Stanford University/HIV Drug Resistance Database (http://hivdb.stanford.edu/). L interprétation des résultats est effectuée conformément à l algorithme de l ANRS AC11 révisé en septembre 2013 (N 23). 42

62 Chapitre II : Matériel et Méthodes Détections des mutations ponctuelles de résistance (Allele-Specific PCR) La technique ASPCR ou encore ARMS-PCR est utilisée pour détecter le polymorphisme bi-allélique. Son principe est issu de certaines propriétés observées dans l étude des duplex amorce/adn cible lors d une réaction de PCR réalisée avec une ADN polymérase dépourvue d activité 3-5 exonucléasique, ou activité Proof reading free. Parmi ces propriétés, deux sont importantes: Premièrement, la présence d un mésappariement au niveau du duplex amorce/adn cible surtout en 3 de l amorce ralenti considérablement l extension de ce dernier par rapport à un duplex sans mésappariement et deuxièmement la présence d un mésappariement en 3 de l amorce déstabilise considérablement le duplex. En pratique, quand une mutation est connue, il est possible de dessiner une amorce qui sera spécifique à la mutation. La technique elle-même repose sur l utilisation des trois amorces: deux amorces A1 et A2 complémentaires chacune d un des deux allèles étudiés (l allèle normal et l allèle muté) et une troisième antisens (reverse) A3 commune aux deux allèles. La réaction de PCR est réalisée dans deux types différents: dans le premier tube, PCR avec l amorce A1 spécifique à l allèle normal et l amorce A3 commune aux deux allèles (normal et muté) ; dans le deuxième tube, PCR avec l amorce A2 spécifique à l allèle muté et l allèle A3 commune aux deux allèles (normal et muté). Après amplification, la détection de la mutation, par exemple A/C, peut se faire sur gel d agarose ou électrophorèse capillaire. Si le sujet est hétérozygote pour la mutation étudiée (génotype A/C), la réaction PCR sera positive dans les deux tubes (tube A1-A3 puis tube A2- A3. Si le sujet est homozygote sauvage (génotype A/A), la réaction de PCR ne sera positive que dans le tube 1 contenant l amorce A1 non mutée et l amorce A3. Chez un sujet homozygote muté (génotype (C/C), la réaction de PCR sera positive uniquement dans le tube 2 contenant A2 et A3 (Ameziane, Bogard, & Lamoril, 2005). Procédure de la Reverse transcription, de l Outer RT-PCR et de la PCR Spécifique L ARN est extrait avec le kit QiAamp Viral RNA mini kit à partir de 140 l de plasma centrifugé à rpm, à 4 C pendant 90 min. L éluât final est de 60 l. Des aliquotes de10 l sont réalisés et conservés à -70 C. 43

63 Chapitre II : Matériel et Méthodes Les produits utilisés Hexanucléotide Mix, (10X concentré) /Random hexamers: Roche: Réf dntp: Roche diagnostic : SuperScript II Transcriptase 10,000U: Invitrogen: Rnasin Ribonuclease Inhibitor U: Promega: N2515. LightCycler FastStart DNA Master Plus SYBR Green I: (Roche, Mannheim, Germany): Ultra Pure. 1M Tris-HCL: Life Technologie: Tableau 3 Préparation du MMix 1: Annealing Produits Pour 1 réaction Pour 10 réactions Eau 8 l 80 l Random Hexamer 10X 2 l 20 l 10 l d extrait RNA sont ajoutés à 10 l de MMix pour un volume final de 20 l Thermocycler 9 700: Annealing primer à 70 C pendant 10 min; 25 C pendant 10 min et conservé à 4 C à l infini. Tableau 4 Préparation du Master Mix 2: Enzyme Mix Produits Pour 1 réaction Pour 10 réactions 5X first Straind Buffer 8 l 80 l DTT 4 l 40 l dntps (10 mm) 2 l 20 l RNAse inh (40 U) 1 l 10 l SuperScript II 1 l 10 l Eau 4 l 40 l Dans le Cycler 9700 déjà programmé, 20 l de Master Mix2 sont ajoutés à chaque tube de la 1 ère réaction puis le run est lancé. Le volume final est de 40 l. Les conditions de cycling sont: 25 C pendant 10 min, 37 C pendant 45 min, 42 C pendant 45 min, 70 C pendant 15 min puis 4 C à l infini. Le dntps, le 5Xfirst Straind Buffer utilisés sont les produits du Kit SuperScript II. A la fin du run, on obtient un ADNc sur lequel on a pu faire toute la suite de l analyse pour la détection des mutations de résistance. Puisqu il n est pas dilué, il est conseillé de ne prendre que 2 l pour la réalisation de la PCR (Outer PCR). 44

64 Chapitre II : Matériel et Méthodes Première PCR ou Outer PCR Elle est réalisée avec le Kit LightCycler FastStart DNA Master Plus SYBR Green I. En général, ce kit est utilisé pour amplifier des régions ne dépassant pas 900 bp. Il donne des résultats concluants pour amplifier une région de moins de 700 bp. Dans notre cas, nous avons amplifié une région de Pol contenant 644 bp (FOR = et REV = HXB2). Préparation du MMix Dégeler le tube 1b avec capuchon vert de la «Reaction Mix» ; Centrifuger brièvement le tube 1a capuchon blanc contenant l enzyme ; Garder les deux tubes dans un portoir réfrigéré ; Prendre 14 l de l enzyme (1a) et le mettre dans le tube 1b de la «Reaction Mix» ; Chaque tube d enzyme contient un volume suffisant pour 3 réactions Mix avec les tubes 1b ; Mélanger par refoulement mais sans trop agiter ; Ré-étiqueter le tube 1b réaction mix avec les étiquettes disponibles dans le kit «Master Mix 5x conc». Une fois le Master Mix préparé, il se conserve entre -15 et - 25 C pour maximum 3 mois ou entre + 2 et + 8 C pour une semaine ; Le Mix est composé d un milieu réactionnel qui contient l enzyme. Pas besoin d ajouter encore du MgCl2 ou autres réactifs ; Le volume final de 20 l doit contenir 2 l du ADNc puisqu il est non purifié et 0,75 M de chaque primer (Outer Forward et Outer Reverse) ; La réaction est faite sur le thermocycleur d Applied Biosystems. Les conditions de cycling: le mélange est d abord incubé 10 min à 95 C, puis 10 min à 94 C (dénaturation) puis 50 cycles d amplification (15 sec à 94 C ; 20 sec à 62 C et 1 min à 72 C) et 72 C pendant 7 minutes puis 4 C à plus infini ; Une analyse des points de fusion des produits de PCR de 60 C à 95 C a été effectuée afin de s'assurer de la spécificité des produits amplifiés, et seulement ceux des échantillons ayant une température prévue de 78 C ont été analysés par ASPCR. Le produit de l Outer PCR est dilué: 1/200 dans du 5 mm de Tris HCl Buffer à PH = 8. La solution mère du Tris HCl est à 1 M. Pour obtenir une solution à 5 mm, on prend 50 l du Tris HCl à 1 M que l on met dans l d eau. Pour obtenir un produit PCR dilué à 1/200, on prend 5 l du produit PCR que l on met dans 995 l d eau. 45

65 Chapitre II : Matériel et Méthodes Tableau 5 Preparation du premier Master Mix pour ASPCR Produits Pour 1 réaction Pour 10 réactions Water, PCR Grade (Vial 2, colorless Cap) 12,5 l 125 l Primer 1 Fwd (20 M) 0,75 l 7,5 l Primer 2 Rev (20 M) 0,75 l 7,5 l Master Mix, 5x conc 4 l 40 l Total 18 l 180 l Dans le local Post PCR, sur Eppendorf cooler, 2 l de l ADNc sont ajoutés au 18 l de MMix contenus dans la plaque. Le volume final pour la réaction est de 20 l. Deux réactions par mutation sont réalisées séparément : une pour l allèle normal et l autre pour l allèle muté: 2 l du produit de l Outer PCR (dilué au 1/200) et chaque primer à 0,5 l sont utilisés avec le LightCycler FastStart DNA Master Plus SYBR Green I pour un volume final de 20 l. La détection des mutations ponctuelles se fait dans deux tubes différents pour chaque mutation. L un pour le virus sauvage (allèle normal et allèle commun) et l autre pour l allèle muté (allèle commun et allèle muté). Les conditions de température diffèrent d une mutation à une autre (Hauser et al., 2009, 2012). Pour K103N (AAC/AAT): Dénaturation = 5 min à 95 C, puis 45 cycles (95 C pendant 10 sec, 62 C pendant 10 sec et 72 C pendant 10 sec). Pour Y181C: Dénaturation = 5 min à 95 C, puis 45 cycles (95 C pendant 10 sec, 60 C pendant 10 sec et 72 C pendant 10 sec). Pour M184V: Dénaturation = 5 min à 95 C, puis 45 cycles (95 C pendant 10 sec, 56 C pendant 10 sec et 72 C pendant 10 sec). Pour K70R: Dénaturation= 5 min à 95 C, puis 45 cycles (95 C pendant 10 sec, 48 C pendant 10 sec et 72 C pendant 10 sec). Pour T215Y et T215F: Dénaturation = 5 min à 95 C, puis 45 cycles (95 C pendant 10 sec, 56 C pendant 10 secondes et 72 C pendant 10 sec). NB : Chaque run est réalisé en double et la moyenne arithmétique est utilisée pour l interprétation. Chaque essai a été effectué avec un ensemble complet de contrôles d'adn mutant et de type sauvage. 46

66 Chapitre II : Matériel et Méthodes Tableau 6 Préparation du second MMix pour ASPCR Produits Pour 1 réaction Pour 10 réactions Water, PCR Grade (Vial 2, colorless Cap) 13 l 130 l Primer 1 Fwd (20 M) 0,5 l 5 l Primer 2 Rev (20 M) 0,5 l 5 l MMix, 5xconc 4 l 40 l Total 18 l 180 l Sur Eppendorf cooler, 18 l de MMix sont distribués dans une plaque 96 puits puis on a ajouté 2 l du produit de Outer PCR dilué dans le Tris HCl à 5mM, PH = 8. Le volume final pour la réaction est de 20 l. Sur LightCycler 480 (Roche), le run est lancé et dure environ 1h20mn. L interprétation du résultat est détaillée dans la partie résultats de la détection des mutations ponctuelles Traitements des données et analyses statistiques Le Logiciel Microsoft World et Excel 2011 pour Mac et EPI INFO (version 3.3.2) sont utilisés pour le traitement des données. Le test Chi 2 et celui de Student sont quant à eux utilisés pour mesurer les relations entre les variables; une différence de p < 0,05 entre les variables est considérée comme significative. Le test non paramétrique U de Mann-Whitney nous a permis de comparer les différentes moyennes. Ensuite, grâce au logiciel BioEdit (version 7.2.5) et Clustral W, nous avons aligné et comparé les séquences avec des sous-types non-b disponibles dans Los Alamos (http://www.hiv.lanl.gov). Nous avons utilisé la base de données de Stanford University (http://www.hivdb.stanford.edu) pour l analyse des séquences et la détermination des sous-types et des mutations de résistance. Le Logiciel MEGA nous a servi pour construire l arbre phylogénétique. Enfin, nous nous sommes recouru à Mendeley Desktop (version 1.11) pour les références bibliographiques Conditions éthiques Cette étude est réalisée tout en obéissant à certains principes généraux et fondamentaux de l éthique en recherche biomédicale et dans le respect de certains mécanismes qui sont: 47

67 Chapitre II : Matériel et Méthodes l obtention de l accord du promoteur de thèse; l obtention d une autorisation de collecte des données du promoteur ULg et du responsable site d étude (Hôpital Général de Référence National de N Djaména); l obtention de l accord des patients inclus dans l étude (principe du consentement éclairé); les mesures garantissant la protection de la vie privée, l anonymat et la confidentialité des données : les données des patients sont anonymes, seuls les investigateurs (chercheur, médecins traitant et promoteurs) de cette étude sont habilités à les consulter; la déclaration de tous les conflits d intérêts (principe de justice); la garantie d une large diffusion des conclusions (principe de bienfaisance). A chaque étape de l analyse, les résultats sont transmis aux médecins traitant au Tchad. 48

68 Chapitre III : Evaluation Immunovirologique du traitement antirétroviral Chapitre III Evaluation immunovirologique du traitement antirétroviral 49

69 Chapitre III : Evaluation Immunovirologique du traitement antirétroviral CHAPITRE III- Evaluation Immunovirologique du traitement antirétroviral 3.1. Introduction Certaines personnes qui vivent avec le VIH présentent souvent des symptômes évidents même s ils ne sont pas mis sous traitement antirétroviral. D autres par contre, maintiennent un taux des CD4 normal et ne présentent pas de symptômes pendant longtemps même sans traitement ; on emploie le terme de «non progression» pour décrire ces cas (Fener, 2011). Dans l objectif d évaluer la capacité de la reconstitution immunitaire afin de juger de l efficacité du traitement administré, nous avons fait une évaluation immunovirologique chez tous les 116 patients inclus dans l étude. Dans ce chapitre, nous décrivons d abord les caractéristiques générales de la population. Nous illustrons ensuite dans les résultats originaux les taux des lymphocytes CD4 et les valeurs des charges virales obtenues avant le traitement (J0) et après huit mois de traitement (M8). Et enfin, nous présenterons les résultats de l évaluation immunovirologique faite uniquement chez les patients qui étaient sous Triomune ; un article sur le sujet termine ce chapitre Caractéristiques générales de la population d étude Notre échantillon se constitue de 116 patients (soit 78 femmes et 38 hommes représentant respectivement 67,24 % et 32,76 %); la moyenne d âge de nos patients est de 41 6,87 ans avec 84 ans pour le plus âgé et 17 pour le plus jeune. La charge virale est mesurée chez tous les 116 patients sous traitement parmi lesquels 50 (43,10 %) ont une charge virale supérieure ou égale à copies/ml. Figure 2 Distribution des tranches d'âge par rapport au sexe 50

70 Chapitre III : Evaluation Immunovirologique du traitement antirétroviral La tranche d âge la plus dominante dans cette étude est celle de l intervalle ans ; les femmes sont les plus représentées avec un pourcentage équivalent à 83,33 % (25/30). La tranche d âge où les hommes sont les plus nombreux est celle de l intervalle ans Méthodologie En vue d évaluer la réponse immunvirologique des PVVIH sous ARV et suivre l évolution de l infection vers le stade SIDA à travers les deux marqueurs principaux qui sont les lymphocytes TCD4 et la charge virale, nous avons suivi les patients pendant 8 mois. Le taux des lymphocytes TCD4 et la charge virale sont mesurés avant le traitement (Jour 0) et après huit mois de traitement. L automate utilisé pour la mesure est le FACS Count (Becton Dickinson Immunocytometry Systems, USA.). Les moyennes des CD4 et de la charge virale au J0 sont comparées aux valeurs obtenues après 8 mois de traitement. Ensuite, pour les patients sous Triomune, ils ont fait l objet d une évaluation particulière pour déterminer le taux d échec à la Triomune. L article que vous trouverez à la fin du chapitre renseigne d avantage sur ces patients sous Triomune Résultats originaux Figure 3 Nombre des patients par rapport au traitement administré La plus part des patients sélectionnés pour l étude étaient sous Duovir N (45,69 %; 53/116) alors que ceux qui étaient placés sous Triomune représentaient 41,38 % (48/116) de l échantillon total. Durant l étude, la Triomune était progressivement abandonnée au profit du Duovir N. 51

71 Chapitre III : Evaluation Immunovirologique du traitement antirétroviral Tableau 7 Valeurs observées des CD4 avant et après traitement CD4 J0 CD4 au 8 Mois Maximale Minimale Médiane ,5 Moyenne (34,48 %) 27 (23,26 %) 200 X (39,66 %) 70 (60,34 %) (25,86 %) 19 (16,38 %) Nous remarquons dans ce tableau que le nombre de patients qui étaient à plus de 500 CD4/mm3 avant le traitement est passé de 30 à 19. La médiane des CD4 au J0 est de 248 alors que celle au M8 est de 298,5. L étude n a mis en relief aucune différence entre les deux valeurs. Ces dernières sont quasi les mêmes (test de Mann-Whitney, p = 0,75). La moyenne des CD4 avant le traitement et après le 8 ième mois de traitement n a pratiquement pas évoluée: 309 vs 344 (p = 0,62). Avant le début du traitement, la charge virale n a été mesurée que chez 49 patients (42,24 %; 49/116) avec Abbott RealTime. Après huit mois de traitement, tous les 116 échantillons ont été testés pour la mesure de la charge virale avec le CAP/CTM et Abbott RealTime. Pour la commodité de nos résultats, nous comparerons seulement les valeurs obtenues sur Abbott RealTime après le traitement pour les 49 patients. Le tableau ci-dessous nous renseigne sur les différentes valeurs de la charge virale. Tableau 8 Valeurs des charges virales observées avant et après traitement CV J0 CV au M8 CV Max CV Min CV Médiane CV Moyenne (30,61 %) 63 (54,31 %) 200 X (0,0 %) 04 (3,45 %) (69,39 %) 49 (42,24 %) 52

72 Chapitre III : Evaluation Immunovirologique du traitement antirétroviral Le chiffre zéro (00) indique que la charge virale est indéterminée. La médiane observée avant le traitement est loin d être la même après huit mois de traitement (5 000 vs 51; p < 0,001); Par contre la moyenne au J0 n a pas significativement changée au M8 ( vs ; p > 0,05) pour les 49 patients comparables par les deux techniques. Parmi les 116 patients, 50 avaient une charge virale supérieure ou égale à copies/ml, soit un taux d échec virologique de 43,10 %. La figure ci-dessous nous donne une idée sur le traitement des patients en échec virologique. Figure 4 Répartition des patients en échec par rapport au traitement Nous constatons que 23/50 des sujets soit 46 % étaient sous Triomune (d4t, 3TC et NVP) qui est la trithérapie d actualité au moment de notre étude. Cette molécule était progressivement abandonnée au profit du Duovir N représentée ici avec 38% (19/50). Cette situation nous a amené à faire une évaluation immunovirologique spécifiquement chez tous les patients sous Triomune avant le traitement et après huit mois de traitement. Les résultats sont détaillés dans l article en fin de chapitre. Résumé de l article : Au total, 48 patients, soit 28 femmes (58,33 %) et 20 hommes (41,66 %) sous Triomune sont enrôlés dans cette étude d évaluation, puis suivis pendant 8 mois. Chez tous ces patients, nous avons ensuite mesuré au Tchad, le nombre de lymphocytes CD4 avant le traitement et après 8 ième mois de traitement. A ce moment, nous avons évalué la charge virale plasmatique au Laboratoire de Référence Sida du CHU de Liège avec deux automates 53

73 Chapitre III : Evaluation Immunovirologique du traitement antirétroviral Cobas AmpliPrep/Cobas TaqMan HIV-1 Test Version 2.0 et Abbott RealTime HIV-1 in vitro test Ref 2G3190. Chez les patients sous Triomune, la moyenne des CD4 était passée de ,22 [56-981] cellules/mm 3 au J0 à 327,23 153,77 [ ] cellules/mm 3 au 8 ième mois. La moyenne de la charge virale plasmatique pour les patients en échec était de ,62 copies/mm 3. Le taux d échec à la Triomune est de 43,75 % (21/48). Nous n avons pas constaté une différence significative entre le taux d échec et le sexe (p > 0,05). En conclusion, nous pouvons dire que le taux d échec à la Triomune trouvé dans cette étude est de 43,75 %. Ce taux nous parait très élevé pour un pays où tous les médicaments antirétroviraux et les tests afférents à la maladie sont gratuits. Le protocole de régime thérapeutique sous Triomune à administrer en première intention doit cependant être révisé Résumé des résultats du chapitre III En l absence des tests génotypiques de résistance, le taux des lymphocytes TCD4 et la charge virale peuvent être utilisés pour évaluer le traitement antirétroviral et déterminer l échec virologique. Pour estimer la mesure de la charge virale, la médiane observée avant le traitement est loin d être la même après huit mois de traitement (5 000 vs 51; Mann-Whitney significatif à p < 0,001 pour les deux médianes). Par contre la moyenne pour la charge virale au J0 n a pas significativement changée au M8 ( vs ; p > 0,05). La moyenne des CD4 n a pas significativement changée chez les 116 patients avant et après 8 mois de traitement (309 vs 344; p = 0,62). La médiane au J0 est de 248 alors que celle de M8 est de 298,5 (p = 0,75). Le taux de suppression virale (CV < 1000 copies/ml) chez les patients est de 56,9 % (66/116). Le taux d échec à la Triomune chez 48 patients suivis à l Hôpital Général de Référence National de Ndjamena est de 43,75 % (21/48). La Triomune ne doit pas être utilisée comme traitement de première intention. 54

74 Chapitre III : Evaluation Immunovirologique du traitement antirétroviral Article : Evaluation immunovirologique de la thérapie antirétrovirale par la Triomune (Lamivudine, Stavudine et Névirapine). Cet article résume les résultats obtenus lors de l évaluation immunovirologique réalisée chez 48 patients qui étaient traités à la Triomune (3TC, d4t et NEV). Il a été mesuré chez ces patients, le taux des lymphocytes TCD4 et la charge virale avant le traitement (J0) et après huit mois de traitement (M8). 55

75 Chapitre III : Evaluation Immunovirologique du traitement antirétroviral 56

76 Chapitre III : Evaluation Immunovirologique du traitement antirétroviral 57

77 Chapitre III : Evaluation Immunovirologique du traitement antirétroviral 58

78 Chapitre III : Evaluation Immunovirologique du traitement antirétroviral 59

79 Chapitre III : Evaluation Immunovirologique du traitement antirétroviral 60

80 Chapitre IV Comparaison des techniques de mesure de la charge virale Chapitre IV Comparaison des techniques de mesure de la charge virale 61

81 Chapitre IV Comparaison des techniques de mesure de la charge virale CHAPITRE IV- Comparaison des techniques de mesures de la charge virale 4.1. Introduction L application de la biologie moléculaire dans le domaine du VIH est née des premières mesures de l ADN proviral dans les cellules mononuclées du sang périphérique (Ou et al., 1988). Elle a été ensuite appliquée dans le cadre de l infection pédiatrique (De Rossi et al., 1988; Laure et al., 1988) qui a succédé aux méthodes de mesure de l antigénémie p24 et aux cultures quantitatives du VIH-1. Bon nombre de techniques commercialisées de nos jours reposent sur la RT-PCR en temps réel permettant une amplification et une détection simultanée des fragments amplifiés (Wittek et al., 2007). La charge virale et l évaluation génotypique de la résistance sont considérées comme étant des marqueurs de l efficacité du traitement. Mais pour utiles soient elles, ces méthodes exigent du matériel adéquat et du personnel qualifié. La complexité de ces techniques et leurs coûts élevés font qu elles ne sont pas utilisées ou du moins rarement dans les pays à ressources limitées. C est la raison pour laquelle, l OMS recommande pour ces pays que le suivi des patients vivant avec le VIH soit fait avec les signes cliniques et la mesure des lymphocytes CD4 (OMS, 2012). Bien qu il existe des structures de prise en charge telles que les hôpitaux et les laboratoires, elles sont pour la plupart, limitées et sous équipées pour pallier à ce problème du suivi de l infection à VIH. A cela s ajoutent aussi les difficultés logistiques telles que le transport des échantillons sanguins et le respect de la chaîne de froid qui rendent difficile le monitoring des patients vivant dans des zones reculées, loin des centres spécialisés (Adawaye et al., 2013). La mesure de la charge virale est utilisée pour évaluer l efficacité du traitement et pour observer l évolution de la maladie. Cependant, afin que la mesure soit significative, la différence entre deux résultats doit être d au moins 0,5 log10, soit une différence du simple au triple. Ainsi une charge virale de copies/ml (5 log10) et une charge virale de copies/ml (5,4 log10) ne sont pas considérées comme étant significativement différentes (Belan et al., 2008; Viard, 2009). La diversité des différents sous-types dans les pays à ressources limitées est généralement favorisée par l émergence de résistances du VIH au traitement. Ce qui impose le choix d une technique pouvant détecter plusieurs sous-types du VIH-1 du groupe M, N et du groupe O. Dans ce même ordre d idée que l «International AIDS Society» a rappelé en 2008 l importance de disposer des techniques de mesure de la charge 62

82 Chapitre IV Comparaison des techniques de mesure de la charge virale virale performantes, sensibles, reproductibles, coût-efficaces et accessibles à la majorité des équipes médicales (Hammer et al., 2008). Dans ce chapitre, nous décrivons beaucoup plus en détail chaque technique dans la partie méthodologie. La partie résultats originaux sera consacrée à la présentation des résultats obtenus et aux comparaisons des trois techniques utilisées. L évaluation de la technique de l ANRS pour la mesure de la charge virale sur des patients infectés par les sous-types non-b à Kinshasa (RDC) est décrite dans l article mis en annexe (Annexe 1). Un article sur la comparaison des techniques utilisées dans ce chapitre est en cours de rédaction Méthodologie La taille totale de notre échantillon est de 116 patients, soit 78 femmes et 38 hommes représentant respectivement 67,24 % et 32,76 %. Les patients enrôlés dans notre étude sont sous traitement ARV et recrutés sur la base des critères d inclusion et d exclusion. La collecte des échantillons a duré 10 mois (du 1 er avril 2011 au 31 janvier 2012). Un échantillon de sang veineux est prélevé à l Hôpital Général de Référence Nationale de N Djamena (Tchad). Deux tubes EDTA de 4 ml chacun sont utilisés pour recueillir le sang prélevé au pli du coude. Les deux tubes sont remués doucement pour mélanger le sang avec l anticoagulant. Le sang est centrifugé pendant 10 mn à g. Le plasma est distribué dans trois cryotubes de 2 ml (2 à 3 cryotubes sont utilisés selon le volume du plasma). Ils sont ensuite mis dans une boite et conservés à - 80 C. Le choix du site n est pas fortuit car il est le seul endroit où il était possible de faire une charge virale au moment de notre étude. Nous avons utilisé un échantillonnage tout venant, consécutif et non exhaustif. Trois techniques sont utilisées pour mesurer la charge virale sur les échantillons collectés des patients infectés par des sous-types non-b du VIH-1. Nous avons également comparé ces trois techniques sur un échantillon de plasma qui a subi l effet de congélation/dégélation au moins deux fois. Cobas AmpliPrep/Cobas TaqMan (CAP/CTM) V2.0 C est un test basé sur l amplification in vitro de l ARN du VIH à partir du plasma recueilli sur tube EDTA. Il peut quantifier de 20 à copies /ml d ARN du HIV-1 du groupe M et O. C est un test qui comprend trois opérations principales : d abord la préparation de l échantillon dans le but d isoler l ARN du VIH-1; ensuite la transcription inverse de l ARN cible pour produire l ADN complémentaire (ADNc); et enfin 63

83 Chapitre IV Comparaison des techniques de mesure de la charge virale l amplification par PCR de l ADNc cible en même temps que la détection de la sonde de détection d oligonucléotides clivés, doublement marqués, spécifiques à la cible. Le mélange réactionnel, conçu pour permettre une détermination quantitative équivalente des sous-types du groupe M et O du VIH-1 contient des amorces et des sondes spécifiques à la fois de l ARN viral et de l ARN Standard de Quantification (QS). La détection de l ADN amplifié est réalisée grâce à l utilisation des sondes oligonucléotidiques doublement marquées spécifiques de la cible et du QS, permettant l identification indépendante des amplicons du VIH-1 et du QS. La quantité d ARN viral est évaluée à l aide du QS du VIH-1. La quantité de l ARN viral est mesurée à l aide du QS du VIH-1. Elle compense les effets d inhibition et contrôle la préparation et le processus d amplification en permettant une quantification plus précise de l ARN. Le QS est ajouté à chaque échantillon en un nombre connu de copies et il a subi toutes les étapes de préparation de l échantillon, transcription inverse, amplification par PCR et détection simultanée des sondes. Ce test utilise des amorces de transcription inverse et d amplification par PCR qui définissent des séquences dans les régions hautement conservées du gène GAG et de la région LTR. Extraction Bien que la machine utilise 850 µl de plasma, il est recommandé de distribuer plus de µl afin de minimiser le risque de non extraction. Ainsi donc, nous avons utilisé µl qui sont distribués dans les tubes contenus dans le rack. Le CAP/CTM recourt à une préparation et à une extraction automatisée des échantillons sur l instrument Cobas AmpliPrep à l aide d une technique générique de capture basée sur silice. La procédure traite 850 µl de plasma. Transcription inverse et amplification par PCR La transcription inverse et l amplification sont faites avec l ADN polymérase de l enzyme recombinante thermostable Thermus species (Z05). En présence de magnésium (Mn2+) et sous conditions tampon appropriées, Z05 exerce à la fois les activités de la Reverse Transcriptase de l ADN polymérase. Ceci permet donc à la transcription inverse et à la PCR de se produire en même temps que la détection en temps réel de l amplicon. Le mélange réactionnel est chauffé pour permettre aux amorces anti sens de s hybrider spécifiquement à l ARN cible du VIH-1 et à l ARN du QS du VIH-1. En présence de Mn2+ et d un excès de déoxynucléotides triphosphates (dntps) comprenant les triphosphates de desoxyadénosine, desoxyguanosine, desoxycytidine, desoxyuridine et désoxythymidine, la polymérase Z05 64

84 Chapitre IV Comparaison des techniques de mesure de la charge virale allonge les amorces hybridées, produisant ainsi des brins d ADN complémentaire de l ARN cible. Abbott RealTime Le dosage Abbott RealTime HIV-1 est une RT-Real Time (Reverse Transcription en temps réel). Une RT PCR est une PCR classique après transcription inverse de l'arn en ADNc. Autrement dit, une PCR réalisée sur un ADNc qui lui est obtenu d'un ARN par l'action d'une Reverse Transcriptase. Le test est réalisable sur plasma et sur du sang total récolté sur papier buvard sur des échantillons adultes et pédiatriques. Ce test permet la détection des sous-types HIV-1 : groupe M sous-types M (A- H) groupe N et O. La PCR en temps réel est basée sur l'amplification et la détection d'un reporteur fluorescent. Soulignons que l'activité 5' exonucléase est spécifique à l'adn double brin. Une séquence d'arn non liée à la séquence cible VIH-1 est introduite dans chaque échantillon au début de la préparation des échantillons. Cette séquence d'arn non liée est simultanément amplifiée par RT-PCR et sert de contrôle interne (IC) afin de démontrer le traitement correct de chaque échantillon. La quantité de séquences cibles de VIH-1 présente à chaque cycle d'amplification est mesurée à l'aide de sondes oligonucléotidiques marquées par fluorescence sur l'appareil Abbott m2000rt. Les sondes ne génèrent aucun signal à moins d être spécifiquement liées au produit amplifié. Le cycle d'amplification au cours duquel le signal fluorescent est détecté par le m2000rt est proportionnel au log10 de la concentration d'arn VIH-1 présente dans l'échantillon d'origine. PCR en temps réel de l ANRS Elle a pour intérêt la détection et la quantification de l ARN du VIH-1 ciblant le gène du LTR qui est décrit comme la région la moins changeante du génome du VIH-1 (Drosten et al., 2006; F Rouet & Rouzioux, 2007a, 2007b; Francois Rouet et al., 2005). Le kit pour la mesure de la charge virale est commercialisé par Biocentric. Cette technique de l ANRS permet la détection de la plupart des sous-types du VIH-1 du groupe M, et constituent désormais une alternative intéressante dans les pays à forte diversité génétique et à ressources limitées. Elle nécessite cependant du personnel entraîné et une supervision importante au début de la mise en place. La technique en elle-même est moins chère, mais la maintenance des appareils n est souvent pas assurée (absence de réseau commercial). L utilisation de ces appareils pour un passage à l échelle est en cours d évaluation. 65

85 Chapitre IV Comparaison des techniques de mesure de la charge virale Cette technique, contrairement aux autres utilise l ARN extrait pour la PCR. Le kit d extraction employé est le kit Qiagen. Un volume de 140 µl du plasma conservé à - 80 C est utilisé pour l extraction pour un éluât final de 60 µl. Un volume de 10 µl de contrôle (RNA virus) est mis dans tous les échantillons avant extraction. Pour la RT-PCR, un volume total de 25 µl contenant 20 µl de MMix et 5µl d extrait ARN est utilisé. Les amorces (forward et reverse ; une concentration finale de 500 nm chacune), la sonde (une concentration de 200 nm) et Taqman One-Step RT-PCR MMix; (Applied Biosystems). La sonde et les amorces utilisées sont: l amorce sens HIV1MGF 5 - GCCTCAATAAAGCTTGCCTTGA-3. La séquence de l amorce anti-sens est HIV1MGR 5 -GGCGCCACTGCTAGAGATTTT-3. La sonde utilisée est HIV1MGProbe 5 AAGTAGTGTGTGCCCGTCTGTTRTKTGACT-3. Le reporter pour la sonde se trouve en 5 : 6-carboxyfluorescéine et le quencher en 3 : le 6-carboxytétraméthylrhodamine (Applied Biosystems, Foster City,CA). La sonde est marquée en 5 avec le 6-FAM (Fluorochrome) et en 3 avec le TAMRA (Quencher). L enzyme utilisée est le TaqMan one step. La courbe de contrôle est construite à l aide d un contrôle, le Cy5 RNA Detection Probe kit (DIA-EIC/RNA (Cy5)-050 Diagenode) dilué au dixième Résultats originaux Au total 110 échantillons étaient comparables avec le test Abbott RealTime et CAP/CTM. L objectif de la réalisation de ces différentes techniques de charge virale, est justement d obtenir une grande possibilité de détection des sous-types par une technique fiable, moins onéreuse et qui ne demande pas trop d expertise du personnel technique. Chaque technique utilisée a une sensibilité spécifique aux différents groupes et soustypes du VIH-1. Le CAP/CTM est sensible aux sous-types A-H du groupe M; Abbott RealTime détecte les groupes N, O et les sous-types A-G du groupe M, enfin la RT-PCR ANRS G2-LTR détecte les sous-types A-H du groupe M (Hocini & Andreoletti, 2009). 66

86 Chapitre IV Comparaison des techniques de mesure de la charge virale Fig.5a: Courbes de mesures CAP/CTM vs Abbott real time Fig.5b: Corrélation CAP/CTM vs Abbott Fig.5c: Différence des Log10 CAP/CTM vs Abbott Figure 5 Comparaison CAP/CTM et Abbott RealTime Les deux courbes de mesures sont presque superposables sur la figure 5a. Nous remarquons aussi qu il y a une excellente corrélation entre ces deux techniques avec un coefficient de corrélation R 2 = 0,96016 (fig 5b). Un blip est détecté avec la version 2.0 du Cobas sur deux échantillons qui sont bien visible sur la figure 5b et figure 5c. La première mesure est faite d abord sur CAP/CTM puis sur Abbott RealTime. A l issue de la comparaison des deux techniques, les résultats sont transposés dans la figure cidessous: Figure 6 Résultats de mesures CAP/CTM et Abbott RealTime 67

87 Chapitre IV Comparaison des techniques de mesure de la charge virale Le nombre d échantillon ayant une charge virale supérieure ou égale à copies/ml (48) est le même avec Abbott et Cobas, tandis que les non détectés avec Abbott sont supérieurs de ceux non détectés avec Cobas. Ceci s explique par le fait que les limites de détection inferieures ne sont pas les mêmes pour les deux techniques : 20 copies/ml pour le CAP/CTM contre 40 copies/ml pour Abbott RealTime. Parmi les échantillons ayant une CV supérieure ou égales à 1000 copies/ml, 42 ont été testés avec la technique ANRS et comparés avec la mesure au CAP/CTM et Abbott RealTime. Les résultats sont représentés sur les graphiques ci dessous. Fig.7a : Courbes de mesure CAP/CTM vs ANRS Fig.7b : Corrélation CAP/CTM vs ANRS Fig.7c : Différences des Log CAP/CTM vs ANRS Figure 7 Comparaison CAP/CTM et ANRS Une bonne corrélation est observée entre ces deux techniques avec R 2 = 0,72603 (fig 7b). Les deux courbent de mesures montrent qu une légère différence existe entre ces deux mesures (fig 7a) ainsi qu au niveau des différences des Log (fig7c). Il pourrait bien s agir du fait que la mesure avec CAP/CTM a été faite en première position quand le plasma était dans son état «normal», alors que pour la mesure avec la technique ANRS, le plasma a subit le phénomène de congélation/dégélation. 68

88 Chapitre IV Comparaison des techniques de mesure de la charge virale Fig. 8a : Courbes de mesures Abbott et ANRS fig.8b : Corrélation Abbott vs ANRS Figure 8 Comparaison Abbott RealTime et ANRS Fig.8a : courbes de mesures Abbott vs ANRS Pour ces deux techniques, la corrélation est aussi bonne avec R 2 = 0,81064 (fig.8a) et ce, malgré quelques dispersions au niveau des différences des Log (fig. 8c). Les deux courbent montrent une dispersion (fig.8a). Ce constat serait dû comme nous l avions déjà signalé aux différentes périodes de mesure et au phénomène de congélation/dégélation. Après comparaison des deux premières techniques, pour les échantillons ayant une CV supérieure ou égale à copies/ml et dont il y a encore du plasma disponible, 42 ont été testés ensuite avec la technique de l ANRS. Nous souhaiterions signaler qu avec la méthode de l ANRS, le sang a subit le phénomène de congélation/dégélation au moins deux fois de suite. Ceci pourrait interférer sur le résultat final. Les résultats pour n = 42 sont donnés dans la figure ci-dessous. fig.8c : Différences des Log Abbott-ANRS Figure 9 Courbes de mesure entre CAP/CTM V2.0, ANRS et Abbott RealTime 69

89 Chapitre IV Comparaison des techniques de mesure de la charge virale L ensemble des 42 échantillons testés ont une CV 1000 copies/ml. La superposition des courbes traduit la fidélité des différentes techniques utilisées. Nous remarquons que la courbe pour CAP/CTM est au-dessus par rapport aux deux autres. La corrélation entre la mesure de la charge virale sur CAP/CTM et Abbott RealTime est parfaite avec R 2 = 0,89793 ; les deux courbes semblent se coïncider alors que la mesure avec la technique de l ANRS semble être discordante des deux premières. La courbe est légèrement en dessous des deux premières. Cette discordance pourrait s expliquer par le fait que pour la mesure avec la méthode ANRS, le plasma a été congelé et dégelé au moins deux fois. Un blip est observé sur deux échantillons mesurés à l aide du Cobas avec respectivement 2,23 et 2,68 log10 copies/ml. La technique de l ANRS G2-LTR commercialisée par Biocentric est connue pour sa bonne performance quel que soit le sous-type viral VIH-1 groupe M (Gueudin et al., 2007; François Rouet et al., 2007). Elle est utilisée en routine en Côte d ivoire, au Cambodge, au Vietnam, au Gabon, au Cameroun (François Rouet et al., 2007). Bien que la fiabilité générale, l'exactitude de la technique CAP/CTM v2.0 et le dosage avec Abbott RealTime, ciblant la région de l'intégrase, étaient jugés similaires par certaines études (Foulongne, Montes, Didelot-Rousseau, & Segondy, 2006; Sloma et al., 2009; Taylor et al., 2009), les rapports initiaux décrivent quand même une variabilité importante entre ces deux techniques autour de la limite de quantification (Naeth et al., 2013). La diversité des virus, en particulier des formes recombinantes complexes, rend difficile la mise au point d une technique «universelle» permettant l amplification de tous les variants quel que soit leur niveau de complexité. Il est donc préférable de suivre un patient avec le même test et de changer de test pour toute discordance immunologique et/ou clinique Résumé des résultats du chapitre IV La corrélation entre la mesure de la charge virale sur CAP/CTM et Abbott RealTime est parfaite avec R 2 = 0,96016; tandis que la mesure avec la technique de l ANRS semble être discordante des deux premiers tests. La corrélation est toute fois, bonne: R 2 = 0,72603 pour CAP/CTM-ANRS et R 2 = 0,81064 pour Abbott-ANRS. Un blip est observé sur deux échantillons (2,23 et 2,68 Log10 copies/ml) avec la version 2.0 du CAP/CTM. 70

90 Chapitre IV Comparaison des techniques de mesure de la charge virale Abbott RealTime et CAP/CTM ont la même capacité de détection pour les échantillons avec une CV 1000 copies/ml (48 vs 48). La dégélation répétée du plasma interfère sur le résultat final avec une diminution de la charge virale d au moins 1 log10 copies/ml. 71

91 Chapitre V : Utilisation du DBS (Dried Blood Spot) pour le monitoring biologique Chapitre V Utilisation du DBS (Dried Blood Spot) pour le monitoring biologique 72

92 Chapitre V : Utilisation du DBS (Dried Blood Spot) pour le monitoring biologique CHAPITRE V- Utilisation du Dried Blood Spot (DBS) pour le monitoring biologique 5.1. Introduction Facilement applicables, les prélèvements sur papier buvard permettent de recueillir du sang prélevé sur tube EDTA ou par piqûre au talon ou au doigt, tant en ville que dans des régions décentralisées. Ils permettent de conserver les échantillons de sang séché à température ambiante (ou congelés), dans des sacs étanches en prévenant l humidité. L ARN viral contenu sur le buvard imbibé de sang total ou de plasma peut se conserver à température ambiante ou à 70 C et est stable durant au moins un an (Fiscus et al., 1998). Le DBS a également l avantage de s acheminer facilement vers les laboratoires, ce qui favorise dès lors la décentralisation. Par ailleurs, la technique du recueil de sang sur papier buvard évite le déplacement d équipes spécialisées puisque le prélèvement peut être réalisé par toute personne correctement formée. Les données indiquent que la détermination de la charge virale et l évaluation de la résistance génotypique du VIH-1 par le DBS et le DPS sont possibles ; plusieurs études ont obtenu des résultats comparables même après stockage à long terme (Hamers et al., 2009). C est pour cette raison que nous avons décidé d étudier cette sensibilité du DBS sur des échantillons des patients tchadiens infectés par des sous-types non-b. Dans ce chapitre, nous décrivons la méthodologie utilisée pour la collecte du sang sur DBS, sa conservation, l extraction du matériel génétique ainsi que la technique utilisée pour le séquençage. Dans la partie résultats originaux, nous allons présenter les résultats obtenus (sous-types et mutations de résistance) sur DBS par la technique de l ANRS que nous comparerons avec les résultats obtenus sur le plasma Méthodologie Le sang est prélevé sur EDTA au pli du coude et 75 µl sont déposés sur papier buvard de type Whatman 903. Il est noté les informations suivantes : les initiales du patient, sa date de naissance, la date du prélèvement et le numéro d identification de la fiche. Cinq spots (375 µl de sang au total) sont utilisés pour chaque patient. Le séchage est fait pendant une nuit à température ambiante et à l abri de la lumière conformément à plusieurs études. Le lendemain, ces buvards sont mis dans un emballage en plastique contenant deux dessiccants. La conservation est faite à -20 C jusqu au transport en Belgique pour les analyses. 73

93 Chapitre V : Utilisation du DBS (Dried Blood Spot) pour le monitoring biologique L extraction de l ARN viral est effectuée avec le kit QiAamp Viral RNA mini kit. Nous avons fait recours à la technique de l ANRS pour réaliser le séquençage (ANRS AC11 Resistance Study Group, 2008) sur un total de 30 DBS Résultats originaux Les mutations de résistances sont recherchées sur 30 échantillons de patients VIH-1 positif sur DBS et sur plasma. Un taux d amplification de 80 % (24/30) est obtenu sur le DBS. La limite de détection du buvard est de 3,33 log10 ce qui équivaut à copies/ml. Cette différence par rapport au plasma pourrait s expliquer par les techniques d extraction utilisées et aussi par la limite de détection du DBS pour les charges virales faibles. Il faut noter cependant que certains sous-types sont moins sensibles sur papier buvard que sur plasma. Les virus archivés dans les lymphocytes peuvent être différents de ceux présents dans le plasma (CNS & ANRS, 2013). C est pour cette raison que nous avons remarqué la présence du sous-type K sur DBS alors qu il n a pas été trouvé dans le plasma. Tableau 9 Mutations de résistance détectées sur plasma vs DBS ID CV DBS/Plasma PI PI INTI INNTI Log10/ml Major Minor 2 4,67 K/A NA NA M184V K103N, Y188F 5 5,46 CRF02_AG/ CRF02_AG M46I, I54V, V82S L10V, K20I A62V, L74V, V75T, M184I V90I, K103N, V108I, Y181C, H221Y 9 4,81 F/D NA NA M184V, T215F K101E, V108I, Y181C 12 4,58 D/D None L10I NA NA 15 4,47 D/D NA NA M41L, T69D, K103E, V108I K70R 23 5,56 J/J None L10I K65E, M184V K103N 30 5,98 G/G None K20I M41L, D67E, T69Si, L74V, M184V, L210W, T215Y 31 5,14 D/NA None L10V T69N, K70R, M184V 32 5,41 J/J NA NA M41L, D67N, L74V, M184V, T215Y, K219E 35 4,77 G/G NA NA D67N, T69d, V75I, F116Y, Q151M, M184V 48 3,33 K/G NA NA None None 49 5,19 K/NA None L10I, K20I M184V A98G, K103N, V108I, P225H V106I, V179D, Y181C V106M, V108I, Y181V, H221Y K101E, G190A, K238T V106I 74

94 Chapitre V : Utilisation du DBS (Dried Blood Spot) pour le monitoring biologique 54 5,26 CRF02_AG/ None K20I K219N K103N, Y181C CRF02_AG 59 5,18 CRF02_AG/ None K20I None None CRF02_AG 62 5,09 F/J NA NA None L34A, V35N, E36R, I135V, S162C, K173T, Q174K, I180V, T200A, Q207D, R211K, P226H, F227i, M230V, E233L, P236A, K238R, W239R, T240A, Q242P, P243T, I244L, V245L, P247X, K249E, S251X, N255D, D256X, I257V, K259Q 65 4,41 J/J NA NA M184V K103N, Y181C 67 4,63 J/J None L10I D67N, K70R, Y188L M184V 71 3,88 CRF02_AG/J None K20I NA NA 79 5,30 J/NA None None NA NA 92 4,68 CRF02_AG/ None L10I, NA NA CRF02_AG K20I 93 5,72 D/D None None K70R, M184V, K103N, V108I, H221Y K219Q 107 4,87 CRF02_AG/ None K20I M184V V90I, K101E, V106I, G190A CRF02_AG 108 4,39 CRF02_AG/ None K20I None V90I CRF02_AG 110 5,09 CRF02_AG/ CRF02_AG None K20I M41L, D67N, M184V, T215F A98G, Y181C Pour les analyses des séquences, nous avons remarqué que pour un même patient, nous pouvions avoir un sous-type différent sur la Reverse Transcriptase et (un autre différent) sur la Protéase. Cette distribution est représentée dans le tableau ci-dessous : Tableau 10 Comparison des sous-types détectés sur plasma vs DBS DBS/Plasma Nombre Pourcentage (%) CRF02_AG/CRF02_AG 7 29,17 CRFF02_AG/J 1 4,17 D/D 3 12,50 D/Ind 1 4,17 F/D 1 4,17 F/J 1 4,17 G/G 2 8,33 J/J 4 16,67 J/Ind 1 4,17 75

95 Chapitre V : Utilisation du DBS (Dried Blood Spot) pour le monitoring biologique K/G 1 4,17 K/A 1 4,17 K/Ind 1 4, Ind: indéterminé Pour le résultat final, nous avons retenu les sous-types obtenus sur les séquences de la Protéase qui est la région la moins changeante du virus. Le CRF02_AG est le plus représenté tant sur DBS (29,17 %; 7/24) que sur le plasma (30,23 %; 13/43). Il existe des concordances entre le DBS et le plasma comme le montre le tableau ci-dessus. Le sous-type K est présent (3/24; 12,5 %) sur DBS alors qu il est absent dans le plasma. Ceci serait l une des conséquences de l utilisation du BDS qui favorisera l apparition des souches virales archivées dans les cellules comme nous l avions dit ci haut. Le sous-type K est décrit dans la littérature comme minoritaire et retrouvé en Afrique Centrale (Hemelaar et al., 2011). Selon Javaugue, il était initialement apparenté au sous-type F pour former un sous-type F3 (Javaugue, 2014) Résumé des résultats du chapitre V Mise à part l utilisation du buvard pour le diagnostic précoce chez l enfant comme le recommande l OMS (GIP Esther., 2008) et pour la surveillance de la résistance au traitement (Bennett et al., 2008), le DBS est utilisé pour le dépistage des troubles métaboliques chez les nouveaux nés (McCabe etal., 1987), pour la détection des anticorps VIH-1 (Hoff et al., 1988) mais aussi pour le diagnostic infantile du VIH-1 par PCR ADN (Stevens et al., 2008). Le DBS peut cependant très bien servir pour l évaluation du traitement antirétroviral pour les sous-types non-b. Le kit QiAamp Viral RNA mini kit pourrait être utilisé pour l extraction de l ARN viral en vue de la détection des mutations de résistance par séquençage ou par ASPCR. Sur DBS, un taux de réussite d amplification de 80 % (24/30) par rapport au plasma est observé. Pour un même patient, des variations des sous-types sont parfois observées au niveau de la Protéase et de la Reverse Transcriptase. Le séquençage sur DBS a montré la présence du sous-type K (3/24 ; 12,5 %) au niveau de la Reverse Transcriptase alors qu il est absent dans le plasma après séquençage. 76

96 Chapitre V : Utilisation du DBS (Dried Blood Spot) pour le monitoring biologique La limite de détection du papier buvard pour le test de résistance par la méthode de l ANRS est de 3,33 log10 ce qui équivaut à 2150 copies/ml. 77

97 Chapitre VI : Prévalence des mutations de résistance acquises et diversité génétique Chapitre VI Prévalence des mutations de résistance acquise et diversité génétique 78

98 Chapitre VI : Prévalence des mutations de résistance acquises et diversité génétique CHAPITRE VI. Prévalence des mutations de résistance acquises et diversité génétique 6.1. Introduction A défaut d éliminer le virus dans le sang, le traitement antirétroviral inhibe la réplication virale et permet le maintien d une charge virale indétectable (Damond & Descamps, 1998; Grant et al., 2002). L évaluation de l efficacité d un médicament nécessite le cas échéant, un suivi régulier par la mesure de la charge virale et des tests génotypiques. L apparition des mutations de résistance favorise l émergence des souches résistantes conduisant à l échec thérapeutique; ce qui constitue l un des problèmes majeurs de la trithérapie antirétrovirale (Roquebert et al., 2009). L émergence des mutations de résistance est fonction de la réplication résiduelle (puissance du traitement) et de la barrière génétique (pression de sélection). La prévalence de résistance aux médicaments de 1 ère ligne à l Hôpital Général de Référence nationale rapportée en 2009 est de 64 % (Koyalta et al., 2009). Dans les premières années de la prise en charge des PVVIH au Tchad, le protocole de traitement mis en place est basé sur une trithérapie (Triomune Cipla-Inde) qui est une combinaison de deux inhibiteurs nucléosidiques (la d4t et la 3TC) et un inhibiteur non nucléosidique (la NVP). Mais cette combinaison n est plus utilisée depuis début 2012 non seulement à cause de ses effets secondaires mais aussi à cause de l échec immunovirologique lié à son usage (Adawaye et al., 2014). Les trithérapies prescrites actuellement au Tchad sont le Viraday (TDF, FTC et EFZ) et le Duovir-N (3TC, AZT et NVP). Cependant, l absence d un suivi biologique régulier ou la non observance aux médicaments favorise l émergence des résistances aux antirétroviraux. Ces résistances favorisent quant à elles la prolifération des certains sous-types qui se recombinent entre eux pour donner des virus recombinants appelés CRF. Ceux-ci donnent de véritables mosaïques des différents sous-types. Dans ce chapitre, nous présenterons les résultats du séquençage qui vont nous permettre de présenter les sous-types et les mutations de résistances chez les patients. Ensuite nous donnerons la prévalence des mutations de résistance acquise et enfin, nous présenterons la diversité génétique des souches du VIH qui circulent à N Djamena au Tchad. Les techniques utilisées pour l extraction, l amplification et la détection seront aussi décrites dans la partie méthodologie. Un article sur ce chapitre est rédigé et est soumis pour publication. 79

99 Chapitre VI : Prévalence des mutations de résistance acquises et diversité génétique 6.2. Méthodologie Nous rappelons que tous nos patients sont sous traitement de première ligne. Les charges virales sont réalisées sur 116 échantillons au Laboratoire de Référence Sida du CHU de Liège avec deux techniques différentes : la première technique utilisée est le Cobas AmpliPrep/CobasTaqman HIV-1 version 2.0 (v2.0). C est un test basé sur l amplification in vitro de l ARN du VIH à partir du plasma recueilli sur tube EDTA. Il peut quantifier de 20 à copies /ml d ARN du HIV-1 du groupe M et O. L autre technique utilisée est l Abbott RealTime HIV-1 in vitro test Réf 2G3190, qui est basée sur un dosage in vitro par RT-PCR pour la détermination quantitative du virus de l'immunodéficience humaine de type 1 (VIH-1) dans le plasma d'individus infectés par ce virus. Les comparaisons des moyennes des lymphocytes CD4 et la CV plasmatique ( 1000 copies/ml) ont été utilisées pour définir l échec au traitement. Tous les échantillons ayant une CV supérieure ou égale à copies (n = 50) sont soumis au séquençage pour la détection des mutations de résistance et la distribution des sous-types circulantes. Extraction de l ARN, RT-PCR, Outer PCR et séquençage L ARN est extrait du plasma en utilisant le kit QIAamp ADN mini kit. A partir du plasma conservé à -80 C, 140µl sont utilisés pour l extraction pour un éluât final de 60 µl. Les méthodes d amplification et de détection utilisées auxquelles nous avions eu recours, sont celles décrites dans la procédure du groupe de résistance de l ANRS AC11(ANRS AC11 Resistance Study Group, 2008). L amplification des régions concernées de la polymérase (Protéase et Reverse Transcriptase) a été effectuée avec le Titan One tube RT-PCR Kit, Version 13 (Boehringer Mannheim, Manneheim, Germany). La première PCR (outer) est réalisée en utilisant le couple d amorce MJ3/MJ4 pour amplifier 941 bp du gène de la Reverse transcriptase (RT) et 5 Prot1/3 Prot1 pour amplifier 653bp du gène de la Protéase. La deuxième PCR (nested) est accomplie avec les amorces A35/NE (1) 35 afin d amplifier 731 bp de la Reverse Transcriptase et 5 prot2/3 prot2 afin d amplifier 507 bp de la Protéase. Les primers (outers) alternatifs utilisés pour la Reverse Transcriptase sont RT18/RT21 et 5 eprb/3 eprb pour la Protéase. Les alternatives pour la nested sont RT1/RT4 pour la Reverse transcriptase et 5 prb/3 prb pour la Protéase. Tous les «primers» utilisés ont fait l objet d un alignement sur Los Alamos (http://www.hiv.lanl.gov/). Le séquençage est exécuté sur le 3730 DNA Analyser 48 capillaires avec l amorce A20 80

100 Chapitre VI : Prévalence des mutations de résistance acquises et diversité génétique (HIV55 alternative) pour la Reverse Transcriptase et avec 5 prb pour la Protéase. Un contrôle négatif est introduit dans chaque run. L amplification est faite avec le thermocycleur GeneAmp PCR System Les temps sont adaptés au thermocycleur et à l enzyme utilisée (AmpliTaq DNA polymerase) conformément au Kit Titan. L électrophorèse sur gel d agarose au bromure d éthidium à 4 % est employée pour déterminer les bandes spécifiques du produit PCR : 731 paires de base pour la Reverse Transcriptase et 507 pour la Protéase. Le contrôle de poids moléculaire utilisé est le Tacklt TM X174 RF ADN/Hae III Fragment. Les produits PCR sont purifiés sur NucleoFast 96 PCR de Macherey Nagel et les produits de séquence par le biais de la Résine Séphadex G. Le séquençage est réalisé par la méthode de Sanger avec ABI 3730 Automatic cappilar sequencer. Analyse des séquences et phylogénie Les séquences de la Protéase et de la Reverse Transcriptase sont alignés avec le logiciel Bioedit (version 7.2.5) et sur CLUSTAL W version 1.7 (Thompson et al., 1994). Les séquences obtenues de la Protéase et de la Reverse Transcriptase sont comparées à la banque des sous-types non-b disponible dans Los Alamos (http://www.hiv.lanl.gov/). La détermination des sous-types, des formes recombinantes et des mutations de résistance sont obtenues après analyse sur le site de Stanford University/HIV Drug Resistance Database (http://hivdb.stanford.edu/). L interprétation des résistances est faite conformément à l algorithme de l ANRS AC11 (septembre 2013) (http://www.hivfrenchresistance.org/). Afin d autoriser des taux de mutations différents le long des branches, la méthode du plus proche voisin «Neighbor Joining» nous a permis de construire l arbre phylogénétique sur MEGA Résultats originaux Caractéristiques de la population étudiée Au total 116 patients (soit 68 femmes et 48 hommes respectivement 58,62 % et 41,38 %) ont participé à l étude. La moyenne d âge de nos patients était de 41 6,87 ans avec 84 ans pour le plus âgé et 17 ans pour le plus jeune. La tranche d âge la plus dominante dans cette étude est celle comprise entre 36 et 40 ans dont la majorité des représentants sont de sexe féminin (83,33 % (n = 30)). Tous les patients étaient sous première ligne. La plupart des patients (48/116 ; 41,38 %) étaient sous Triomune (d4t+3tc+nvp) alors que 53 patients (45,69 %) étaient sous Duovir-N (AZT+3TC+NVP). 81

101 Chapitre VI : Prévalence des mutations de résistance acquises et diversité génétique Tableau 11 Nombre de patients par rapport au traitement administré Traitement Nombre Pourcentage ABC + 3TC + EFV 1 0,86 % AZT + 3TC + NVP 53 45,69 % d4t + 3TC + EFV 1 0,86 % d4t + 3TC + NVP 48 41,38 % FTC + TDF + EFV 13 11,21 % Total % Les patients sous Duovir N sont les plus nombreux avec 45,69 % ( soit 53/116) tandis que ceux qui sont sous Triomune représentent 41,38 % (soit 48/116). Amplification, détection et sous typage La charge virale a été mesurée auprès de l ensemble des patients sous traitement avec les deux techniques précédemment citées (Abbott et Cobas). Tableau 12 Valeurs charges virales sur CAP/CTM vs Abbott RealTime CAP/CTM V2.0 Abbott RealTime Copies/ml Log10 Copie/ml Log10 CV Minimum 0,00 0,00 0,00 0,00 CV Maximum , ,95 CV Moyenne , ,6 CV Médiane 85 1, ,7 Après mesure de la charge virale sur les 116 échantillons par les deux techniques (CAP/CTM et Abbott RealTime), 109 étaient comparables parmi lesquels 50 échantillons ont une CV copies/ml, soit un taux d échec de 43,10 %. Les moyennes ( et ) et les médianes (85 et 51) sont quasiment les mêmes (respectivement p = 0,16 et p = 0,32; test de Mann-Whitney). Tous les 50 échantillons ont fait l objet d un séquençage par la méthode de l ANRS parmi eux, 44 échantillons ont été amplifiés avec succès; soit un taux de réussite d amplification de 88 % (44/50). Le taux de la suppression virale (CV < copies/ml) s élève à 56,897 % (66/116). La prévalence de la résistance parmi les individus ayant une CV 1000 copies/ml est de 74 % (37/50). Un échantillon n a pas donné de résultat après analyse 82

102 Chapitre VI : Prévalence des mutations de résistance acquises et diversité génétique des séquences. La prévalence de la résistance acquise est donc de 31,89 % (37/116). La distribution du traitement utilisé parmi les patients en échec est présentée dans le tableau ci dessous: Tableau 13 Nombre de patients en échec par rapport au traitement administré Traitement Nombre pourcentage AZT + 3TC + NVP 19 38,00 % ABC + ddl + EFV 1 2,00 % AZT + ddl + EFV 1 2,00 % d4t + 3TC + NVP 23 46,00 % FTC + TDF + EFV 6 12,00 % Nous remarquons que parmi ces patients en échec, 23 étaient sous Triomune et 19 étaient sous Duovir N. La tendance au moment de cette étude reflète l abandon de la Triomune au profit du Duovir N. Parmi les 23 patients en echec sous Triomune, une amplification de 82,61 % (19/23). La distribution des différentes mutations et de sous-types est donnée dans le tableau suivant: Tableau 14 Distribution des sous-types et des mutations de résistance chez les patients en échec sous Triomune ID Log10 (Copie/ml) Sous-type IP Maj. IP Min. INTI INNTI 1 4,12 J None L10V, V11I NA NA 6 3,43 F NA NA M184V, T215F V90I, Y181V 15 4,47 D None None M41L, T69D, K70R 18 5,43 G None L10I D67N, T69D, K70R, M184V, T215I, K219Q K103E, V108I K103S, E138Q 20 3,46 J None V32L, G48R M184V K101E, V106I, G190S 23 5,56 J None L10I K70P, V75F, M184V K103N 24 3,62 J None K20I V75M, M184V V106A, F227L 31 5,14 NA NA NA NA NA 35 4,77 G None None D67N, T69d, V75I, F116Y, K101E, G190A, 83

103 Chapitre VI : Prévalence des mutations de résistance acquises et diversité génétique Q151M, M184V K238T 39 4,31 G None K20I, L90W M184V V108I, G190A 48 3,33 G None K20I A62V, V75L, M184V G190A, H221Y 50 3,47 J NA NA M184V A98G, K101E, Y181C, H221Y 57 3,55 F None None M184V, T215F V90I, Y181V 74 3,25 J NA NA M184V Y188L 82 3,32 A None L10I, K20I M184V V108I, Y181C, H221Y 92 4,68 CRF02_A G None L10I, K20I M184L, T215F Y181V 93 5,72 D None None K70W, M184V, K219Q A98G, K103N, V108I, H221Y 97 4,51 G None L10I, K20I V75I, M184V K103N, V106I 101 3,56 J None None None None IP Min. :Inhibiteurs de la Protéase mineures ; IP Maj. : Inhibiteurs de la Protéase majeures Parmi les 19 échantillons amplifiés des patients sous Triomune, un échantillon (N 31) était indeterminé après analyse des séquences. Il apparait donc la réprésentation suivante des sous-types parmi les 18 autres: A = 1 (5,56 %) ; D = 2 (11,11 %) ; F = 2 (11,11 %) ; G = 5 (27,78 %) ; J = 7 (38,89 %) et CRF02_AG = 1 (5,56 %). Aucune mutation majeure associée à la Protéase n a été observée chez ces patients. Par contre, quelques mutations mineures pour la Protéase sont observées chez 11 patients: K20I = 4 (22,22 %) ; L10I = 4 (22,22 %) ; L90W = 1 (5,56 %) et V32L/G48R = 1 (5,56 %). Le patient N 101 n a présenté aucune mutation tant sur la Protéase que sur la Reverse Transcriptase. Les mutations observées pour les INTI sont largement representées par la M184V = 14 (77,78 %). Deux patients ne présentent aucune mutation pour cette classe de médicaments. Les autres mutations rencontrées sont: V75F/I/L/M = 5 (27,78 %) ; T215F/Y = 4 (22,22 %) ; K70R/P/W = 3 (16,67 %.) ; T69d/D = 3 (16,67 %) ; D67N = 2 ; K219Q = 2 (11,11 %) ; A62V = 1 (5,56 %) ; F116Y = 1 (5,56 %) et Q151M = 1 (5,56 %). Quant aux INNTI, nous avons constaté une représentation à parts égales pour la V108I, la G190A/S et la H221Y rencontrées chez 4 patients chacune, soit 22,22 %. La K103N, la K101E et YA81V sont constatées chez 3 patients chacunes, soit 16,67 %. Les autres 84

104 Chapitre VI : Prévalence des mutations de résistance acquises et diversité génétique mutations sont: Y181C = 2 (11,11 %) ; K103E/S = 2; V90I = 2 (11,11 %) ; A98G = 2 (11,11 %) ; E138Q = 1 (5,56 %) ; V106A/I = 1 (5,56 %) et Y188L = 1 (5,56 %). Dix neuf patients en echec virologique étaient sous Duovir N. Tous les 19 échantillons ont été amplifiés avec succès (100%). La réprésentation des sous-types et la distribution des mutations de résistance sont données dans le tableau suivant: Tableau 15 Distribution des sous-types et mutations de résistance chez les patients en échec sous Duovir N ID Log10 Sous-types IP Maj. IP Min. INTI INNTI (Copies/ml) 5 5,46 CRF02_AG M46I, I54V, V82S L10V, K20I A62V, V75I, M184I K103N, V108I, Y181C, H221Y 10 4,29 CRF02_AG None K20I M184V Y188L 30 5,98 G None K20I M41L, D67E, T69Si, L74M, M184V, L210W, T215Y 32 5,41 J None None M41L, D67N, L74V, M184V, T215Y, K219E A98G, K103N, V108I, P225H V106M, V108I, Y181V, H221Y 56 3,84 CRF02_AG None K20I None None 59 5,18 CRF02_AG None K20I None None 62 5,09 J None None None None 65 4,41 J None None M184V K103N, Y181C 67 4,63 J None L10I M184V, T215F Y188L 68 4,73 A None L10I, K20I None V108I 73 4,26 CRF02_AG None K20M M184V G190A 75 4,67 A None L10I, K20I 90 5,69 CRF02_AG None L10V, L76S, V75A, M184I, T215F None V106I, Y188L, H221Y, K238N V90I 85

105 Chapitre VI : Prévalence des mutations de résistance acquises et diversité génétique N88D 91 5,76 CRF02_AG None None Y115F K101H, V108I, E138R 102 4,27 CRF02_AG None K20I None None 105 4,55 J None L10I M184V, T215F Y188L 107 4,87 CRF02_AG None K20I M184V K101E, G190A 108 4,39 CRF02_AG None K20I V75I, M184V L100I, K103N 110 5,09 CRF02_AG None K20I M41L, D67N, M184V, T215F A98G, Y181C IP Min. :Inhibiteurs de la Protéase mineures ; IP Maj. : Inhibiteurs de la Protéase majeures Le CRF02_AG est rencontré chez 11 patients en échec sous Duovir N soit 57,89 %. Viens ensuite le sous-type J chez 5 patients (soit 26,31 %). Le sous-type A chez 2 patients (10,53 %) et le sous-type G retrouvé chez un seul patient (5,26 %). Il a été retrouvé chez un seul patient (soit 5,26 %) des mutations majeures associées aux IP : M46I, I54V, V82S. Les mutations mineures sont observées chez 15 patients : K20I/M (11/19; 57,89 %) ; L10I/V (5/19 ; 5,26 %). La mutation L76S est présente chez un seul patient (soit 5,26 %). La N88D est aussi présente chez un seul (soit 5,26%). Pour les mutations de résistance aux INTI, elles sont présentes chez 13 patients sur les 19 (68,42 %). Elles sont representées essentiellement par la M184V/I retrouvée ches 12 patients (soit 63,16 %) suivie de la T215F/Y presente chez 6 patients (soit 31,58 %). Les autres mutations sont distribuées de la facon suivante : A62V = 1 (5,26 %) ; V75A/I = 3 (15,79 %) ; M41L = 3 (15,79 %) ; D67N/E = 3 (15,79 %) ; T69Si = 1 (5,26 %) ; L74M/V = 2 (10,53 %) et Y115F = 1 (5,26 %). Concernant les mutations de résistance observées pour les INNTI, 15 patients présentent au moins une mutation, soit 78,95 %. Les plus représentées sont la Y181C/V et la V108I qui sont rencontrées à part égales chez 5 patients, soit 26,31 % chacune. On rencontre la K103N chez 3 patients (soit 15,79 %) ainsi que la H221Y avec 15,79 %). Les autres sont : G190A = 2 (10,53 %) ; Y188L = 2 (10,53 %) ; K101H/E = 2 (10,53 %) ; A98G = 2 (10,53 %) ; V106M/I = 2 (10,53 %) ; K238N = 1 (5,26 %) ; V90I = 1 (5,26 %) ; P225H = 1 (5,26 %) E138R = 1 (5,26 %) et L100I = 1 (5,26 %). 86

106 Chapitre VI : Prévalence des mutations de résistance acquises et diversité génétique L analyse nucléotidique des 44 échantillons indique la présence des sous-types décrits dans le tableau suivant: Tableau 16 Distribution des patients par rapport aux sous-types Sous-types Nombre Pourcentage (%) A 4 9,3 D 4 9,3 F 2 4,65 G 7 16,28 J 13 30,23 CRF02_AG 13 30,23 Ces sous-types sont basés sur les séquences de la Protéase. La représentation observée est: A = 4 (9,30 %), D = 4 (9,30 %), F = 2 (4,65 %), G = 7 (16,28 %) et J = 13 (30,23 %). La seule forme recombinante rencontrée est CRF02_AG = 13 (30,23 %). Un échantillon était indéterminé après analyse des séquences dans Stanford. La littérature décrit que parmi toutes les souches du VIH-1 incriminées dans l infection dans le monde, la part globale des soustypes F, G, H, J et K réunit avoisine le 6 %; la majorité d entre elles (5 %) étant dues au soustype G (Javaugue, 2014). Des mutations des résistances sont observées au niveau du gène de la Reverse transcriptase et à celui de la Protéase. Prévalence des mutations de résistance Nous rappelons d ores et déjà que certains polymorphismes occasionnent l installation des mutations silencieuses et cela a pour conséquence l acquisition d une mutation au niveau d un codon de résistance qui peut différer selon le sous-types (Brenner et al., 2003). La présence d au moins une mutation majeure observée au niveau de la Reverse Transcriptase est de 86,04 % (37/43). Il en est de même pour la Protéase et la Reverse Transcriptase car la présence d au moins une mutation majeure sur les deux gènes est de 86,04 % (37/43). Quant à la prévalence de la résistance acquise chez tous les patients, elle est de 31,9 % (37/116). Six patients soit 13,95 % (n = 43) ne présentent aucune mutation de résistance sur la Reverse Transcriptase pour les deux groupes de médicaments. Pour les INTI, 9 patients (soit 20,93 %) ne présentent aucune mutation tandis que pour les INNTI, ceux qui ne présentent aucune mutation de résistance sont 6 (soit 13,95 %). 87

107 Chapitre VI : Prévalence des mutations de résistance acquises et diversité génétique Mutations associées à la Protéase Au niveau de la Protéase, il n y a pas eu des mutations majeures sauf chez un seul patient (1/43 ; 2,33 %) où nous avons a remarqué la présence de M46I, I54V, V82S. Ce patient est infecté par une forme recombinante CRF02_AG. Outre les mutations majeures associées à la Protéase, ce même patient porte aussi des mutations pour les INTI (A62V, V75I, M184I et H221Y) et pour les INNTI (K103N, V108I et Y181C). Les mutations mineures observées chez les autres patients sont: K20I/M (21/43 ; 48,84 %) ; L10I/V (15/43 ; 34,88 %) ; L90W (1/43 ; 2,33 %) ; L76S (1/43; 2,33 %) ; N88D (1/43; 2,33 %) ; V11I (1/43 ; 2,33 %) ; V32L (1/43 ; 2,33 %) et G48R (1/43 ; 2,33 %). Mutations associées à la Reverse Transcriptase Pour les INTI (Inhibiteurs Nucléosidiques et Nucléotidiques de la Transcriptase Inverse), les principales mutations observées sont: M184V/I/L largement rencontrée chez 30 patients sur les 43, soit 69,77 % ; T215Y/F/I/S chez 13 patients (soit 30,23 %) ; d autres mutations communes (A62V, V75I/L et M184V/I) sont aussi observées chez deux patients à hauteur de 4,65 %. Figure 10 Fréquence des mutations de résistance associées aux INTI Les analogues à la thymidine (TAMs) sont incarnés par la T215Y/F à 30,23 % (13/43), la K70P/R/W à 9,30 % (4/43) et la K219E/N/Q à 9,30 % (4/43). 88

108 Chapitre VI : Prévalence des mutations de résistance acquises et diversité génétique La figure suivante indique les mutations de résistance observées pour les INNTI. Figure 11 Fréquence des mutations de résistance associées aux INNTI Les résistances observées pour les INNTI sont symbolisées par la K103N/S/E chez 13/43 (30,23 %) et par la Y181C/V/F/L chez 11/43 (25,58 %). Comme on pouvait s y attendre dans le cas des INNTI; une association Y181C/F et K103N a été retrouvée chez 3/43 (6,98 %). Ces deux mutations confèrent une résistance croisée à l EFZ et à la NVP. Certaines mutations ne sont retrouvées que chez un seul patient à hauteur de 2,33 % sont: L100I, F227L et P225H. Ces mutations confèrent une résistance du virus au traitement administré. Les résultats des tests génotypiques sont habituellement présentés par des logiciels auxquels des règles d interprétation ont été transmises. Pour chaque antirétroviral, le résultat est exprimé avec la mention «résistance» ou «résistance possible» ou «sans évidence de résistance». La quantification de cette résistance par rapport au traitement est résumée dans le tableau suivant. 89

109 Chapitre VI : Prévalence des mutations de résistance acquises et diversité génétique Tableau 17 Quantification de la résistance du VIH au traitement (Stanford) ARV High-level score Intermediate score Susceptible score Potential score Low-level score resistance resistance low-level resistance resistance 3TC 29 (67,5 %) (00,0 %) 0 13 (30,2 %) (00,0 %) 0 00 (00,0 %) 0 AZT 06 (13,9 %) (20,9 %) ,8 %) (00,0 %) 0 00 (00,0 %) 0 d4t 06 (13,9 %) (23,3 %) (60,5 %) (00,0 %) 0 00 (00,0 %) 0 EFV 24 (55,8 %) (23,3 %) (16,3 %) 0 02 (04,7 %) (00,0 %) 0 NVP 32 (74,4 %) (04,7 %) (16,3 %) 0 00 (00,0 %) 0 00 (00,0 %) 15 FTC 30 (69,8 %) (00,0 %) 0 13 (30,2 %) (00,0 %) 0 00 (00,0 %) 0 TDF 01 (02,3 %) (06,9 %) (76,7 %) (2,3 %) (09,3 %) ABC 04 (09,3 %) (20,9 %) (20,9 %) 0 00 (00,0 %) 0 20 (46,51 %) Nous observons qu il y a une résistance élevée aux INNTI chez plus de la moitié des patients avec 74 % (32/43) pour la NVP et 55,8 % (24/43) pour l EFZ. Pour les INTI, une forte résistance à la 3TC est observée à hauteur de 67,5 % (29/43). Afin de pouvoir identifier les homologies (liens évolutifs) et les homoplasies (convergence, parallélisme et réversion) des souches du VIH-1 qui circulent à N'Djamena (Tchad), le logiciel sur MEGA est utilisé pour construire l arbre phylogénétique par la méthode du plus proche voisin «joining Neighbor». 90

110 Chapitre VI : Prévalence des mutations de résistance acquises et diversité génétique Figure 12 Arbre phylogénétique des séquences de la protease (plasma) Les bootstraps observés entre les branches sont tous supérieurs à 70 %. Nous remarquons aussi sur cet arbre que le nouveau sous-type J apparu dans cette étude est apparenté au sous-type F. Dans la littérature, il est décrit que le sous-type F occupe une position basale dans un arbre phylogénétique (Guimarães et al., 2009). Le sous-type J est lui aussi décrit comme rare et est retrouvé en Afrique Centrale chez 1,8 % des PVVIH (Javaugue, 2014) Résumé des résultats du chapitre VI A l issue des résultats observés dans notre étude, le taux d échec aux médicaments de première ligne à N Djamena au Tchad est de 43,10 % (n = 116). Aucune association significative entre le taux d échec et le sexe n a été observée (p 0,05). Il est important de noter que l échec thérapeutique n est pas seulement dû à une apparition d une mutation de 91

111 Chapitre VI : Prévalence des mutations de résistance acquises et diversité génétique résistance au niveau du virus, mais peut s expliquer aussi par une faible observance ou une interruption prolongée du traitement (OMS, 2012). Le taux de suppression virale (CV < 1000 copies/ml) est de 56,897 % (66/116) ; la prévalence de la résistance parmi les individus ayant une CV 1000 copies/ml est de 74% (37/50). La prévalence de la résistance acquise est de 31,9 % (37/116). Cette prévalence est inférieure à celle trouvée par Koyalta et al. (2009) dans la même population N Djaménoise qui est de 64 % (n = 88). Il ressort de cette étude qu un nouveau sous-type J circule à N Djaména avec un taux de 30,23 % (13/43). Après analyse phylogénétique, il s est avéré que ce nouveau sous-type J est apparenté au sous-type F. La littérature décrit que les sous-types F, H, J et K sont incriminés dans un nombre restreint d infections dans le monde (0,94 %) avec prédominance du sous-type F1 (0,45 %) (Javaugue, 2014). Ceux-ci sont généralement rencontrés en Afrique Centrale (Burda et al., 2004; Triques et al., 1999, 2000). Une résistance élevée de plus de 50 % est observée pour les INNTI chez plus de la moitié des patients avec 74 % pour la NVP et 55,8 % pour l EFZ. Pour les INTI, une forte résistance à la 3TC est observée chez 29 patients, soit 67,5 %. Ces résultats se révèlent être alarmants quant aux patients qui sont sous Viraday et Duovir N actuellement à N Djaména. 92

112 Chapitre VII : Détection des mutations ponctuelles de résistance (Allele-Specific PCR) Chapitre VII Détection des mutations ponctuelles de résistance (Allele-Specific PCR) 93

113 Chapitre VII : Détection des mutations ponctuelles de résistance (Allele-Specific PCR) CHAPITRE VII- Détection des mutations de résistance ponctuelles (ASPCR) 7.1. Introduction Utilisée pour la première fois en 1991 pour la détection des mutations de résistance du VIH-1 (Larder et al., 1991), l ASPCR est une technique qui permet de détecter une mutation de résistance à faible proportion (1 %) dans un échantillon. Les techniques génotypiques standard quant à elles ne détectent un variant (un nucléotide muté) que s il est majoritaire et représente au moins 20 % de la population virale totale (Brun-Vezinet et al., 2004; Grant et al., 2003; Halvas et al., 2006; Palmer et al., 2005). Avec les récentes technologies de la PCR en temps réel, l ASPCR a vu sa sensibilité augmenter (Metzner et al. 2003, 2005). Cette sensibilité de détection des mutations mineures à moins de 20 % a un intérêt clinque majeur dans les PRL et surtout quand il s agit du développement de la résistance à la Névirapine dans la PTME (Eshleman et al., 2001; Jackson et al., 2000). Cependant, La nature exacte de l'importance clinique de mutations mineures reste incertaine, mais les données indiquent que la circulation des souches virales résistantes au traitement contribue à l'échec virologique (Jourdain et al., 2004; Lecossier et al., 2005) et peut permettre la prédiction d'échec virologique à un stade précoce. La résistance à la classe des INNTI est conférée par une seule mutation au niveau du gène de la Reverse Transcriptase. Il s agit de la K103N ou de la Y181C occasionnant ainsi une résistance croisée à la Névirapine ou à la l Efavirenz du fait de leur faible barrière génétique. La mutation M184V au niveau de la Reverse Transcriptase est impliquée dans la résistance élevée à la Lamivudine. Il a été démontré que les virus qui développent cette mutation sont incapables de subir une mutagenèse compensatoire suite à la suppression de la boucle située en amont du site de liaison de l amorce (Wei et al., 2002, 2003). Considérant les molécules utilisées pour le traitement au Tchad, compte tenu aussi de l importance de chacune des mutations de résistance suscitées et conformément à celles rencontrées dans notre étude, celles qui sont choisies pour la technique ASPCR sont les suivantes: K103N (AAC); Y181C (TGT); M184V (GTG); T215Y/F (TAC ou TTC) et K70R (AGA). Nous décrivons dans ce chapitre les résultats de la technique ASPCR obtenus sur DBS et sur le Plasma. Dans la partie résultats originaux, la sensibilité de la technique ASPCR 94

114 Chapitre VII : Détection des mutations ponctuelles de résistance (Allele-Specific PCR) par rapport aux différentes mutations obtenues par séquençage sur plasma et sur DBS sera aussi décrite Méthodologie Au niveau du plasma, six mutations conférant des résistances majeures ont été sélectionnées pour l ASPCR tandis que pour le DBS, nous n avons étudié que deux de ces mutations. Il s agit de la K103N et de la M184V. Pour le plasma, 44 échantillons ont été utilisés contre 24 pour le DBS ; ces échantillons sont ceux ayant donnés des résultats positifs au séquençage. La procédure de cette méthode est détaillée dans la partie méthodologie de ce document. Pour chaque mutation, deux PCR sont réalisées dans deux tubes différents. Une première PCR avec l allèle normal (générique) et une seconde PCR avec l allèle muté. Les amorces utilisées sont celles générées spécifiquement pour les sous-types A, C et D. Nous avons testé tous les sous-types et formes recombinantes retrouvés par séquençage pour en évaluer la sensibilité de la technique pour les autres sous-types présents chez nos patients qui sont F, G, J et CRF02_AG. La PCR est réalisée sur LightCycler480 (Roche). La technique utilisée détermine la quantité absolue de la séquence d acide nucléique à l intérieur d un échantillon inconnu. Des séries des dilutions des échantillons connues sont utilisées pour générer la courbe standard. Des échantillons contrôles ont été employés pour chaque run. Pour chaque mutation, un échantillon connu contenant la mutation à rechercher est dilué cinq fois et testé avec le primer générique et le primer muté. Un autre échantillon connu, de sous-type non-b, servant de contrôle négatif, ne contenant pas de mutation (sauvage) est aussi dilué et inséré dans chaque run Résultats originaux Evaluation de l ASPCR Nous avons utilisé un échantillon positif à la mutation recherchée (muté) à 10 5 log copies/ml et un autre échantillon négatif à la mutation (sauvage) pour évaluer la technique. Tous deux étaient de sous-types non-b des patients africains. Des dilutions ont été effectuées pour chacun des deux contrôles utilisés. Ils sont ensuite dilués (de 0,01 % à 100 %) et testés 95

115 Chapitre VII : Détection des mutations ponctuelles de résistance (Allele-Specific PCR) avec des primers spécifiques pour chaque mutation recherchée. Au total 5 dilutions ont été exécutées pour construire la courbe standard: 100 % ; 10 % ; 1 % ; 0,1 % et 0,01 %. Pour évaluer la discrimination de la technique, nous avons utilisé la différence des threshold cycles ( Ct) ou crossing points (Cp) obtenues entre le virus muté et le mélange (sauvage-muté). Pour chaque dilution, nous avons fait deux réactions avec l allèle normal et deux avec l allèle muté ; la valeur moyenne des Ct de chaque dilution est utilisée nous a permis de mesurer la sensibilité et la précision de la technique pour les différentes mutations. Pour obtenir le mélange sauvage-muté, nous avons mis du virus sauvage dans les dilutions de l échantillon muté. Le cycle seuil est déterminé par la valeur des Ct moyenne ± 2 (écart type). Figure 13 Courbes standard des différences des Ct (sauvage-muté) pour les différentes mutations NB: La présence du virus muté dans le mélange est avérée si la valeur du Ct est inférieure à celle du seuil retenu pour chaque type de mutation. 96

116 Chapitre VII : Détection des mutations ponctuelles de résistance (Allele-Specific PCR) fig.14a : Corrélation Y181/Y181C fig.14b : Corrélation M184/M184V fig.14c : Corrélation K103/K103N Fig.14d : Corrélation T215/T215F fig.14e : Corrélation T215/T215Y fig.14f : Corrélation K70/K70R Figure 14 Courbes standard avec le primer générique et muté des différentes dilutions Pour chacune des courbes, le coefficient de corrélation de Pearson indique une bonne corrélation avec R 2 > 0,97 pour le virus muté et R 2 > 0,96 pour le virus wild-type. Ct Figure 15 Exemple de la courbe d'amplification (générique et sauvage) avec différences des Ct pour la K103N Une valeur Ct seuil est fixée (35 pour cette courbe) et toutes les courbes qui sortent après cette valeur sont considérées comme négatives. La différence de Ct entre la première 97

117 Chapitre VII : Détection des mutations ponctuelles de résistance (Allele-Specific PCR) courbe (Ct = 7) et la deuxième (Ct =20) permet de définir une différence de Ct ( Ct) qui est de 13. Spécificité de l ASPCR Pour mesurer la spécificité de la technique pour chaque mutation, nous avons calculé les différences des Ct des différentes dilutions du mélange (sauvage-muté). Une valeur seuil est fixée et est utilisée pour la comparaison avec celle de l échantillon sur lequel est recherchée la mutation. Les valeurs des différences des Ct ( Ct) de toutes les mutations sont plus de 9 sauf pour la K70R qui est de 6 ; ce qui indique que toutes les amorces spécifiques peuvent distinguer avec précision le virus muté. Les différences des Ct retenues pour la validation des résultats sont : Ct= 13 pour la K103N ; Ct = 9 pour la M184V ; Ct =12 pour la T215F ; Ct =12 pour la T215Y ; Ct =9 pour Y181C et Ct = 6 pour K70R. Tous les contrôles positifs sont en dessous du seuil de ces valeurs. Sensibilité, précision et reproductibilité de la technique Au total 5 dilutions variant de 0,01 % à 100 % ont été réalisées et amplifiées avec des amorces spécifiques. Les valeurs des Ct observées sont inférieures à la valeur seuil définie, ceci voudra dire que les mutations de résistance peuvent être détectées même avec une faible proportion de 1 %. Chaque analyse est réalisée en double. La différence des Crossing point ( ct) de chaque échantillon comparée au Ct (Cycle Threshold) ou Cp (Crossing point) des contrôles sauvage et muté est utilisée pour la validité des résultats. Si la mutation recherchée (A/C) est présente, le test est considéré comme positif. Le test peut seulement être positif pour une seule réaction. Dans ce cas, s il n est positif qu avec le primer générique, on dit que le sujet est sauvage homozygote (A/A). S il n est positif qu avec le primer muté, on dit que le sujet est homozygote muté (C/C). Le résultat est considéré comme faux positif si la valeur du Ct est supérieure à la valeur seuil retenue pour chaque mutation et que la différence des Ct apparaît en dehors du seuil de positivité défini. Classiquement, la précision est estimée à partir de la reproductibilité intra-essais et de la reproductibilité inter-essais. Ces paramètres qui sont alors quantifiés par le coefficient de variation (CV %) ou écart-type relatif: CV = (Ecart-type/moyenne) x 100. Le coefficient de variation est le rapport de l'écart-type à la moyenne. Plus la valeur du coefficient de variation 98

118 Chapitre VII : Détection des mutations ponctuelles de résistance (Allele-Specific PCR) est élevée, plus la dispersion autour de la moyenne est grande. Il est généralement exprimé en pourcentage. Sans unité, il permet la comparaison de distributions de valeurs dont les échelles de mesure ne sont pas comparables. Lorsqu'on dispose de valeurs estimées, le CV rapporte l'écart-type de l'estimation à la valeur de cette estimation. Plus la valeur du coefficient de variation est faible, plus l'estimation est précise. Pour évaluer la reproductibilité intra-essais et inter-essais de la technique, nous avons dosé trois fois dans la même série les dilutions du mélange de 1 % à 100 %. La moyenne et l écart type observés nous ont permis de calculer pour chaque série le coefficient de variation. Nous avons ensuite calculé les coefficients de variation à partir des différentes valeurs observées pour chaque type de mutation. Tableau 18 Coefficients de variation intra et inter-essais Coefficients de Variation intra-essais Proportion du mutant (%) M184V Y181C K103N T215F T215Y K70R 100 0,13 0,12 0,08 0,05 0,13 0, ,29 0,15 0,23 0,24 0,34 0,21 1 0,39 0,36 0,42 0,43 0,41 0,28 Coefficients de Variation inter-essais Proportion du mutant (%) M184V Y181C K103N T215F T215Y K70R 100 0,23 0,31 0,12 0,04 0,19 0, ,33 0,25 0,31 0,32 0,37 0,24 1 0,42 0,37 0,37 0,45 0,41 0,37 Les coefficients de variation intra-essais observées sont inférieurs à 0,13 pour la proportion 100 % du virus sauvage (wt) ; inférieurs à 0,35 pour 10 % wt et aux alentours de 0,41 pour la dernière proportion qu est de 1 % wt. Pour les CV inter-essais, ils sont inférieurs à 0,32 pour le 100 % sauvage; d environ 0,31 pour le 10 % wt et inferieurs à 0,46 pour la proportion 1 % du virus sauvage. Toutes les valeurs en inter et intra-essais sont faibles et ne dépassant pas 0,46. Ceci signifie que l estimation de la technique est beaucoup plus précise. 99

119 Chapitre VII : Détection des mutations ponctuelles de résistance (Allele-Specific PCR) Tableau 19 Mutations de résistance détectées par ASPCR (Plasma) CV Log10 Résultats ASPCR ID (Copie/ml) Subtyes K103N Y181C M184V T215F T215Y K70R 1 4,12 J wt wt wt wt wt wt 2 4,67 A + wt + wt wt wt 5 5,46 CRF02_AG + + wt wt wt wt 6 3,43 F wt wt + wt wt wt 9 4,81 D wt wt + wt wt wt 10 4,29 CRF02_AG wt wt + wt wt wt 12 4,58 D wt wt + wt + wt 15 4,47 D Faux + wt wt wt wt ,43 G wt wt wt wt wt wt 20 3,46 J wt wt + wt wt wt 23 5,56 J + wt + wt wt wt 24 3,62 J wt wt + wt wt wt 30 5,98 G wt wt wt wt wt wt 31 5,14 NA wt wt wt wt wt wt 32 5,41 J wt + + wt wt wt 35 4,77 G wt wt wt wt wt wt 39 4,31 G wt wt wt wt wt wt 48 3,33 G wt wt wt wt wt wt 50 3,47 J wt + + wt wt wt 54 5,26 CRF02_AG + wt wt wt wt wt 56 3,84 CRF02_AG wt wt wt wt wt wt 57 3,55 F wt wt + wt wt wt 59 5,18 CRF02_AG wt wt wt wt wt wt 62 5,09 J wt wt wt wt wt wt 65 4,41 J + wt wt wt wt wt 67 4,63 J wt wt wt + wt wt 68 4,73 A wt wt wt wt wt wt 69 4,79 G wt wt wt wt wt wt 71 3,88 J wt wt wt wt wt wt 100

120 Chapitre VII : Détection des mutations ponctuelles de résistance (Allele-Specific PCR) 73 4,26 CRF02_AG wt wt + wt wt wt 74 3,25 J wt wt wt wt wt wt 75 4,67 A wt wt wt wt wt wt 82 3,32 A wt + + wt wt wt 90 5,69 CRF02_AG wt wt wt wt wt wt 91 5,76 CRF02_AG wt wt wt wt wt wt 92 4,68 CRF02_AG wt wt wt + wt wt 93 5,72 D + wt + wt wt wt 97 4,51 G wt wt wt wt wt wt 101 3,56 J wt wt wt wt wt wt 102 4,27 CRF02_AG wt wt wt wt wt wt 105 4,55 J wt wt wt + wt wt 107 4,87 CRF02_AG wt wt + wt wt wt 108 4,39 CRF02_AG wt wt + wt wt wt 110 5,09 CRF02_AG wt wt wt ID = Identification patient. wt = wild type = virus sauvage (pour réaction négative) ; + = réaction positive (pour la mutation recherchée). Un faux positif (N 15) est observé pour la K103N. Les résultats obtenus par les deux méthodes (séquençage et ASPCR) nous ont permis de comparer les différentes mutations par rapport aux sous-types. Tableau 20 Comparaison des mutations de résistance en fonction des sous-types détectés par ASPCR vs plasma Mutations Résultats Séquençage Résultats ASPCR Nombre Sous-types Nombre Sous-types K103N 10 A (1) ; D (1) ; G (3) ; J (2) et CRF02_AG (3) 6 A (1) ; D (1) ; J (2) et CRF02_AG (2) Y181C 6 A (1) ; J (3) et CRF02_AG (2) 5 A (1) ; J (2) et CRF02_AG (2) M184V 27 A (2) ; D (3) ; F (2) ; G (6) ; J (9) et CRF02_AG (5) 15 A (2) ; D (3) ; F (2) J (5) et CRF02_AG (5) T215F 8 A (1) ; D (1) ; F (2) ; J (2) et 4 CRF02_AG (2) et J (2) CRF02_AG (2) T215Y 3 D (1) ; G (1) et J (1) 1 D (1) K70R 2 D (1) et G (1) 1 D (1) 101

121 Chapitre VII : Détection des mutations ponctuelles de résistance (Allele-Specific PCR) Au total 44 échantillons positifs au séquençage sont soumis à la technique ASPCR comme nous l avons mentionné plus haut. Pour les sous-types A et D pour lesquels les primers sont conçus spécialement, nous remarquons une sensibilité de 100 % de l ASPCR par rapport au séquençage pour toutes les mutations sauf à la Y181C qui n était pas présente pour le sous-type D même au séquençage. Une spécificité est observée pour le sous-type J et CRF02_AG pour la K103N, la Y181C, la M184V et la T215Y. Le sous-type F a lui aussi une spécificité de 100 % pour la M184V par l ASPCR. Figure 16 Quantifications des mutations de résistance détectées par ASPCR vs plasma Détection des mutations ponctuelles sur DBS avec la technique du séquençage de l ANRS et l ASPCR Cette technique de la détection des mutations ponctuelles (ASPCR) est très spécifique puisqu elle détecte aussi d autres sous-types tels que le sous-type J, F et CRF02_AG avec des primers conçus pour les sous-types A et D. Cela révèle l existence d un polymorphisme spécifique pour les sous-types testés positifs. Tableau 21 Evaluation de la sensibilité de l'aspcr par rapport au séquençage sur DBS vs plasma Mutations Séquencage (plasma) ASPCR (DBS) K103N 7 5 M184V

122 Chapitre VII : Détection des mutations ponctuelles de résistance (Allele-Specific PCR) Pour le DBS, nous n avons testé que 24 échantillons pour deux mutations par ASPCR, il s agit de la K103N et de la Y181C. Les primers sont générés spécifiquement pour les soustypes A, D et C. En l absence du sous-type C dans notre étude, et du sous-type A sur DBS, la proportion des sous-types D, J et du CRF02_AG détectés par séquençage et par ASPCR sont résumés dans le tableau suivant : Tableau 22 Distribution des mutations de résistances détectées par ASPCR par rapport aux sous-types détectés sur DBS Mutations Résultats Séquençage Résultats ASPCR Nombre sous-types Nombre sous-types K103N 7 CRF02_AG (2) ; J (2) ; G 5 CRF02_AG (2) ; J (2) et D (1) (1) ; K (1) et D (1) M184V 13 CRF02_AG (2) ; J (4) ; G 8 CRF02_AG (2) ; J (4) et D (2) (2) ; K (2), F (1) et D (2) Nous remarquons que la sensibilité de la technique de détection des mutations ponctuelles sur DBS est quasi égale à celle sur le plasma Résumé des résultats du chapitre VII 1. L Allele-Specific PCR (ASPCR) peut être utilisée pour une évaluation qualitative des mutations de résistance et aussi quantitative pour la mesure de la charge virale. 2. Une spécificité de 100 % est obtenue avec l ASPCR sur DBS pour les sous-types D, CRF02_AG et J pour toutes les deux mutations recherchées (K103N et M184V). Il pourrait bien s agir d un polymorphisme spécifique des sous-types non-b au niveau de la Reverse Transcriptase. 3. L ASPCR est une méthode fiable de détection de mutations de résistance ponctuelles mineures à hauteur de 0,01 %. 4. Elle est la méthode de choix pour la détection des mutations de résistance mineures dans un échantillon; les coefficients de variation en intra et inter-essais sont tous inférieurs à 0,50; ce qui montre que l estimation de la technique est plus précise. 5. L ASPCR peut être utilisée pour détecter plusieurs mutations dans un même échantillon. 6. La technique ASPCR fournit aussi des informations sur l évolution de la résistance. 103

123 Discussion générale Discussion générale Evaluation immunovirologique du traitement antirétroviral Lors d une infection par le VIH, les principales cellules cibles du VIH sont les lymphocytes TCD4 du système immunitaire, qui portent à leur surface des molécules CD4 indispensables à la pénétration cellulaire du virus. En utilisant les lymphocytes CD4 pour se répliquer, le VIH entraîne leur destruction entrainant la circulation importante du matériel viral dans la circulation sanguine et aussi l épuisement du système immunitaire ; ce qui permet l'apparition des infections opportunistes. C est pour cette raison que nous avons d abord fait une évaluation immunovirologique chez tous les 116 patients et ensuite chez les patients qui étaient sous Triomune. Cette évaluation est faite dans l objectif de mesurer l efficacité du traitement et apprécier la réponse du système immunitaire. Les lymphocytes TCD4 et la charge virale sont évalués avant le traitement (J0) et après huit mois de traitement (M8). L étude a montré que le nombre des patients qui étaient à plus de 500 CD4/mm3 avant le traitement est passé de 30 à 19. La médiane au J0 est de 248 alors que celle de M8 est de 298,5 (test de Mann-Whitney, p = 0,75). La moyenne des CD4 avant le traitement et après 8 mois de traitement n a pratiquement pas évoluée: 309 vs 344 (p = 0,62). Ces résultats témoignent la faible reconstitution du système immunitaire chez nos patients. Normalement, la charge virale devient indétectable dans le plasma (inférieure à 50 copies/ml) une dizaine de semaines après le début du traitement tandis que les CD4 amorcent leurs remontée dans les quatre à huit semaines du traitement, mais cette première remontée est attribuée au passage des CD4 des ganglions lymphatiques au flux sanguin (Routy, 2009). Le taux d échec aux médicaments de première ligne trouvé dans notre étude est de 43,10 % (50/116). La mauvaise observance est notifiée à hauteur de 80 % des patients chez tous ceux ayant fait partie de notre étude. Une corrélation positive est observée entre la mauvaise observance et le taux d échec immunovirologique (p < 0,05). La mauvaise observance peut avoir diverses raisons liées au patient, à son environnement et à la molécule utilisée ou aux acteurs de la santé. Certains patients sautent des prises, par oubli ou par négligence, ce qui peut favoriser l émergence de résistance du VIH aux traitements. D autres se fient aux marabouts et guérisseurs traditionnels qui leur font croire que la guérison du Sida est possible. Il faut noter que cette pratique n est pas sans conséquences car elle contribue à la dégradation de l état de santé des patients qui sont parfois sujets à des nombreuses infections 104

124 Discussion générale opportunistes. Parmi les 48 patients qui étaient sous Triomune, nous avons observé cependant que le taux d échec à la Triomune est de 43,75 % (21/48) et plus de 81 % de ces patients étaient en mauvaise observance. Cette mauvaise observance comme l ont notifiée les médecins pourra aussi favoriser l émergence de résistance aux médicaments dont la barrière génétique est faible à l exemple des INNTI. Une seule mutation telle que la K103N ou la Y181C pour ce groupe (NVP et EFZ) peut entrainer une résistance totale et irréversible. En somme, les CD4 et la charge virale constituent les paramètres primordiaux pour l évaluation immunovirologique quand ils sont réalisés régulièrement c est à dire à 1 mois et 3 mois de traitement, puis tous les 3 mois la première année. Nous rappelons aussi que la fréquence pour le suivi immunovirologique à l HRGN n est pas standard. Les rendez-vous ne sont pas respectés ou les examens ne sont pas réalisés pour une raison ou une autre (manque des réactifs, panne des appareils, grève du personnel, etc.). Généralement, pour les patients ayant une charge virale indétectable au-delà d un mois de traitement, un contrôle immunologique doit en principe être réalisé tous les 3 à 4 mois si les CD4 sont inférieurs à 500 cellules/mm 3 et tous les 4 à 6 mois si les CD4 sont supérieurs à 500 cellules/mm 3 (Yeni, 2008). Fener déclare aussi qu un taux de CD4 plus bas à l initiation du traitement associé à une charge virale plasmatique supérieure à copies/ml et un antécédent d événement classant sida, sont associés à une moins bonne évolution clinique sous traitement (Fener, 2011). Routy affirme quant à lui que beaucoup des patients ont réussi l augmentation de leurs CD4 jusqu à 350 à 500 celles/mm 3 et que ceci reste un objectif thérapeutique additionnel ; ceci est la conséquence d une meilleure reconstitution du système immunitaire si le traitement est entrepris avant la chute des CD4 à moins de 350 cellules/mm3 (Routy, 2009). Comparaison des techniques de mesure de la charge virale Evaluer les différentes techniques de mesure de la charge virale pour les sous-types non-b est l un des objectifs spécifiques de cette étude. S agissant de la mesure entre Cobas et Abbott RealTime, deux échantillons non détectés à l aide d Abbott sont détectés avec le test Cobas V2.0 avec respectivement 2,23 et 2,68 Log10. Cette variation pourrait être due à une erreur de manipulation ou à un blip comme décrit dans la littérature pour la version V 2.0 du Cobas (Ruelle et al., 2012; Wojewoda et al., 2013). Un blip est défini par une élévation transitoire de l ARN VIH plasmatique, en général entre 50 et copies/ml, observée sur 105

125 Discussion générale un seul prélèvement, et ne justifie pas la prescription d un test de Résistance (Wojewoda et al., 2013). Pour les méthodes de mesure de la charge virale, le choix d une méthode dépend tout d abord de la diversité des sous-types incriminés qui circulent dans le pays, de la capacité du laboratoire et de l expertise de son personnel. La technique de Roche (CAP/CTM) et celle d Abbott (Abbott RealTime) sont des techniques qui utilisent toutes deux un système fermé d extraction, d amplification et de détection. Ce procédé limite les erreurs de manipulation. Toutefois, elles sont trop chères pour les pays à ressources limitées mais nécessitent aussi un système d approvisionnent régulier en réactifs et consommables. Un entretien régulier des machines et des mises à jour des logiciels sont aussi nécessaires. Abbott RealTime a une variabilité de détection de sous-type plus large que le Cobas car elle détecte le groupe N en plus du groupe M (A à H) et O ; tandis que le Cobas lui ne détecte que le groupe M (A à G) et groupe O. Diverses évaluations de concordance pour CAP/CTM V2.0 et le Cobas Monitor V1.5 ont été faites par Rouet et al. (François Rouet et al., 2007) dans divers pays avec un coefficient de corrélation moyen de 0,79. Les différents valeurs de ce coefficient par pays sont : France (0,8701; n = 88), Maroc (0,8624; n = 50), Zimbabwe (0,8703; n = 52), Cambodge et Thaïlande (0,8446 ; n = 34), République Centrafricaine (0,8924, n = 25) et Madagascar (0,6814; n = 22). Comparant le CAP/CTM V2.0 et le CAP/CTM V1.0, Pas et al. (Pas et al., 2010) ont démontré que la V2.0 du CAP/CTM a une plus forte sensibilité que la V1.0. La version 2.0 détecte aussi le sous-type O qui n est pas détecté par la version1.0 (Gueudin et al., 2007). Dans notre étude, en comparant la technique de l ANRS avec le CAP/CTM V2.0, nous avons trouvé un coefficient de corrélation de Pearson de 0,72603 avec la version 2.0 de Cobas malgré que le plasma ait subit le phénomène de congélation et dégélation pour la mesure avec la technique de l ANRS. En ce qui concerne la méthode de l ANRS, le kit pour la mesure de la charge virale est commercialisé par Biocentric. Cette technique permet la détection de la plupart des sous-types du VIH-1 du groupe M et constitue désormais une alternative intéressante. Des résultats satisfaisants ont été obtenus avec des échantillons de plasma collectés chez des individus infectés par les sous-types non-b à Kinshasa (Annexe 1). L application de cette technique nécessite cependant du personnel entraîné et une supervision importante au début de la mise 106

126 Discussion générale en place. La technique en elle-même est moins chère, facile à réaliser, mais la maintenance des appareils n est souvent pas assurée (absence de réseau commercial). En l absence d un laboratoire de biologie moléculaire et d un réseau commercial dans un pays comme le nôtre, la technique de l ANRS n est recommandée que si toutes les conditions sont réunies. Notre étude a révélé un taux de suppression virale (CV < 1000 copies/ml) de 56,9 % (66/116) chez les individus qui sont sous traitement pendant au moins 8 mois. Ce taux est plus élevé que celui retrouvé chez la même population, dans le même hôpital en 2009 après 6 mois de traitement qui est de 47% (n = 88) (Koyalta et al., 2009). Cette augmentation de ce taux serait du bien entendu à l amélioration du système de santé au Tchad entre 2009 et 2012, permettant ainsi une couverture plus élargie en ARV. Il est important de souligner ici que toutes les techniques utilisées se reposent sur l hybridation d une amorce avec une séquence cible pour l amplification et sur l hybridation d une sonde avec l amplicon pour la détection. Par ailleurs, du fait de la variabilité génétique qui constitue un défi majeur pour la conception des amorces et de sondes, la performance d une technique reste basée sur le choix des cibles d amplification hautement conservées parmi l ensemble des variants viraux, groupes, soustypes et CRF (F Rouet & Rouzioux, 2007b). Diversité génétique et prévalence des mutations de résistance du VIH L un des problèmes majeurs de la trithérapie antirétrovirale est l émergence de la résistance aux antirétroviraux favorisant ainsi l apparition des souches résistantes (Roquebert et al., 2009). D une manière générale, la distribution des mutations de résistance est variable d un individu à un autre et d une région à une autre qu il s agisse d un patient naïf ou sous traitement et dépend aussi de type de virus en cause. Le taux d échec aux médicaments de première ligne trouvé dans notre étude est de 43,10 % (50/116). Il faut noter cependant que l échec thérapeutique n est pas seulement dû à une apparition d une mutation de résistance au niveau du virus, mais peut être expliqué aussi par une faible observance ou une interruption prolongée du traitement (OMS, 2012). Les souches isolées chez des patients traités sélectionnés dans notre étude appartiennent tous au groupe M et comprennent les sous-types A, D, F, G et J ainsi qu une forme recombinante, CRF02-AG. Par ordre d importance, il apparaît d abord le CRF02_AG suivi du sous-type J qui arrive à égalité chez 13 patients chacun (soit 30,23 %). Vient ensuite le sous-type G avec 16,28 %, A et D avec chacun 9,30 % ; le moins représenté est le soustype F qui est retrouvé chez deux patients avec 4,65 %. Ces sous-types sont décrits comme 107

127 Discussion générale étant fréquemment rencontrés en Afrique Centrale, de l Est et de l Ouest (Roquebert et al., 2009; Vergne et al., 2000; Vidal et al., 2003). Il est intéressant de signaler que le sous-type D qui circule au Tchad, forme de façon intéressante une lignée phylogénétique qui s individualise au sein des autres variants D caractérisés en Afrique de l Est ou ailleurs en Afrique Centrale (Vidal et al., 2003). Nos résultats corroborent avec ceux de Vidal et al. qui ont trouvé en 2003 dans ce même hôpital de la capitale, les sous-types A (20.5 %), D (18.7 %), F1(0.9 %) et G (3.7 %); nous avons retrouvé une forte représentation du sous-type J avec 30,23% qui n était pas présent en 2003 et la forme recombinante CRF02-AG avec 30,23 % contre 13.1 % pour ces auteurs (Vidal et al., 2003). La littérature décrit que les sous-types F, H, J et K sont incriminés dans un nombre restreint d infections dans le monde (0,94 %) avec prédominance du soustype F1 (0,45 %) (Javaugue, 2014). Deux variants du sous-type F sont décrits, le F1 et le F2; le F1 est d origine africaine et est localisé en Afrique Centrale (Bandea et al., 1995). Le F2, lui est endémique au Cameroun, pays frontalier avec le Tchad (Burda et al., 2004; Triques et al., 2000). Le sous-type J est lui aussi décrit comme rare et retrouvé en Afrique Centrale chez 1,8 % des PVVIH (Javaugue, 2014). Dans une étude réalisée en Angola, Bartolo et al. ont rapporté un taux d infection associé au sous-type H de 5,7 % et 3,1 % des 159 isolats analysés ont été rattachés au sous-type J (Bártolo et al., 2011). Aghokeng et al. (2009) ont trouvé aussi une forte prédominance des CRF02_AG jusqu à 62 % sur des échantillons de patientes enceintes collectés dans 4 pays (Congo, Tchad, Cameroun et République Centrafricaine). Le CRF02_AG domine aussi chez les patients naïfs car A Derache et al. ont découvert également une prédominance nette des CRF02_AG dans 75 % des cas chez des patients au Mali (n = 98) (Derache et al., 2007). Guillaume et al. (2012) ont affirmé que les sous-types circulant à Abidjan étaient largement représentés par la forme recombinante CRF02_AG avec 76,9 % suivi du sous-type A avec 7,7 % pour n = 39. En Mauritanie, Malick et al. (2014) ont signifié aussi la prédominance nette des CRF02_AG avec 64,6 % pour n = 65 chez des patients adultes sous traitements comme les nôtres. Contrairement à notre étude, Kamangu et al. (2013) ont affirmé qu en République Démocratique du Congo les sous-types circulants sont majoritairement ceux du groupe M et notamment A, G, C et D avec prédominance du sous-type A avec une prévalence de % [ ] mais le CRF02_AG est très peu rencontré. Les résultats trouvés dans notre étude concordent avec celle de la littérature qui décrivent les CRF02_AG comme étant majoritairement circulant en Afrique de l Est (Cote d Ivoire, Niger, Nigeria et Sénégal), ainsi 108

128 Discussion générale qu en Afrique Centrale et notamment au Tchad (Adjé et al., 2001; Aghokeng, Mpoudi-Ngole, et al., 2009; Laurent et al., 2002; Manus, 2013; Montavon et al., 2000). L assertion selon laquelle la diversité des séquences A et G constitue le CRF02_AG semble vérifiée car cette diversité aussi grande que les sous-types parentaux «purs» (Carr et al., 1998), suggérant que le CRF02_AG pourrait être aussi ancien que ses sous-types d origine. Abecasis et al. ont proposé l idée selon laquelle, le CRF02_AG pourrait être une forme parentale du sous-type G qui serait lui-même un virus recombinant (Abecasis, Vandamme, & Lemey, 2009). S agissant de la résistance aux médicaments antirétroviraux, selon le groupe de résistance de l ANRS AC11, la prévalence globale de VIH résistants à au moins un antirétroviral en 2006, estimée sur 385 patients, était de 10 %. Koyalta et al.(2009) ont affirmé que le taux d échec aux médicaments de 1 ère ligne à l Hôpital Général de Référence Nationale en 2009 était de 64 %. Dans cette même année, Aghokeng et al. (2009) publient une étude dans laquelle le taux d amplification était le même que celui trouvé dans notre étude 88 % (37/42) versus 88 % (44/50). Le taux d échec à la Triomune dans ce même hôpital avant l abandon de la Triomune début 2012 était de % (21/48) (Adawaye et al., 2014) tandis que celui lié au traitement chez tous les patients est de 43,10 % (50/116). Quant aux mutations de résistance aux médicaments, Adjé et al. (2001) ont recherché les mutations des souches chez 68 sujets en Côte d Ivoire et ont identifié des mutations majeures conférant une résistance aux inhibiteurs de la réverse transcriptase ou aux antiprotéases dans une majorité des souches (57,4 %). La répartition était la suivante : 42,6 % des souches portaient des mutations associées à la résistance à l AZT et 14,7 % au 3TC, moins de 2 % des souches présentaient une résistance aux INNTI ou aux IP. Pour les INNTI, notre étude révèle une résistance élevée à plus de 50 % pour la NVP et l EFZ avec respectivement 74 % et 55,8 %. Les tests phénotypiques pratiqués montraient que 39 % des souches étaient résistantes à au moins un INTI, tandis que dans notre étude ce taux est de 31,9 %. Au niveau de la Protéase, ces mêmes auteurs ont mis en évidence d autres mutations (K20R, L10V et L10I) à des fréquences plus faibles et concluent que chez les malades africains traités, les mêmes mutations ont été identifiées avec des fréquences analogues. En Afrique du Sud, une étude menée sur 200 souches de VIH-1 a montré que 97,5 % des virus présentaient une sensibilité diminuée d un facteur 5 à 10 aux trois molécules de la classe des INNTI (Harrigan et al., 2001). En Ouganda, l étude de 11 souches (A = 6, C = 1 et D = 4), n a pas mis en évidence de mutation de résistance dans le gène de la Reverse Transcriptase (Harrigan et al., 2001). 109

129 Discussion générale Pour les INTI, les mutations sont sélectionnées séquentiellement par les Analogues de la Thymidine (TAMs), d4t et AZT et comprennent: M41L, D67N, K70R, L210W, T215Y/F et K219Q/E (Yeni, 2008). La plus fréquente de ce groupe de 6 mutations TAMs est la T215Y/F alors que K70R et K219Q/E ont moins d impact que les quatre autres dans cette résistance croisée. Ces TAMs sont associées à la résistance à la d4t et AZT et peuvent entraîner un niveau de résistance variable aux autres INTIs dont l ABC, ddi, TDF, et ddc. Ils peuvent favoriser l apparition d autres mutations telles que la 44D/A et 118I. Mais l impact de la résistance dépend du profil et du nombre de TAMs observés (Vincent Calvez et al., 2002; Johnson et al., 2010; Kellam et al., 1992; Kuritzkes et al., 2004; Larder & Kemp, 1989; Whitcomb et al., 2003). La mutation T215F/Y/I/S est largement retrouvée dans notre étude avec 30,23 % tandis que T215Y/F est celle qui est plus responsable de la transmission des mutations de résistance pour les INTI (D. Bennett et al., 2005). Les mutations M41L, L210W et T215Y sont souvent associées à des résistances croisées d une part et d autre part ce sont les D67N, K70R, T215F et K219Q/E qui sont rencontrées ensemble dans certains cas de résistance aux INTI (Cozzi-Lepri et al., 2005; De Luca et al., 2006). Toutefois, les mutations K70R et L210W sont rarement rencontrés ensembles (Yahi et al., 2000). La mutation M184V est celle qui est la plus rencontrée pour les INTI dans notre étude. Cette mutation correspond au remplacement d une méthionine par une valine en position 184 et entraîne une résistance de haut niveau à la 3TC. Elle est aussi décrite dans la littérature comme la plus fréquente (Shafer & Schapiro, 2008). En présence des TAMs, la M184V augmente in vitro, la résistance à la 3TC et FTC, une faible résistance à la ddl et ABC et une susceptible résistance à la AZT, d4t et TDF (Whitcomb et al., 2003). La M184V passe souvent par une mutation transitoire (la M184I) après échec sous 3TC (Boucher et al., 1993). Doualla et al. (2010) affirment que la M184V augmente la résistance in vivo à l ABC et n a pas d impact sur le TDF et la ddl. Cependant, d autres études ont démontré que la M184V en association avec la K65R et la L74V donne une forte résistance à l ABC et la ddl (Rhee et al., 2004) mais en elle-même n a pas d effet sur l ABC et la ddl (Brun-Vézinet et al., 2003; Lanier et al., 2004; A.-G. Marcelin et al., 2005; Molina et al., 2005; Winters et al. 2003). D une manière générale, la présence d au moins 3 TAMs plus la M184V confèrent une résistance élevée à l ABC et à la ddl (Lanier et al., 2004; A.-G. Marcelin et al., 2005; S. Rhee et al., 2004; Whitcomb et al., 2003). 110

130 Discussion générale S agissant de la résistance aux INNTI et du fait de la faible barrière génétique pour ce groupe de médicaments (NVP et EFZ), une ou deux mutations suffisent pour leur conférer une résistance de haut niveau (Hirsch et al., 2008; Richman et al., 1994; Shafer & Schapiro, 2008; Torti, Pozniak, Nelson, Hertogs, & Gazzard, 2001). Les mutations associées aux INNTI peuvent être classées en deux catégories: la première catégorie est celle des mutations de résistance primaire qui peuvent causer une résistance de haut niveau et qui sont les premiers à se développer au cours d une thérapie aux INNTI. Chacune de ces mutations primaires (K103N/S, V106A/M, Y181C/I/V et G190A/S/E) confère une résistance de haut niveau à la NVP et à l EFZ (Bacheler et al., 2001; S.-Y. Rhee et al., 2006; Vingerhoets et al., 2005). La seconde catégorie concerne les mutations de résistance secondaire qui causent de résistance qu en association avec les premiers mais ont aussi des conséquences cliniques quant au choix d une molécule et notamment l Etravirine (Shafer & Schapiro, 2008). De façon générale, les mutations «accessoires» aux INTI comme la E44D et V118I (Mihailidis et al., 2008) et les mutations mineures de résistance aux INNTI comme la A98G, la V179D et la V106I sont présentes chez 1 à 2% des sujets naïfs (Shafer et al., 2007; Shafer, Rhee, & Bennett, 2008). Toutes ces mutations n ont pas de rôle direct dans la résistance mais peuvent faciliter l émergence de résistances et influencer les voies des mutations du virus à ce groupe de médicaments. Elles renforcent par ailleurs le niveau de résistance de mutations majeures sur le gène de la Reverse Transcriptase (Pillay et al., 2002; Spira et al., 2003; Wainberg, 2004). Malick et al. (2014) ont retrouvé en Mauritanie, des résultats semblables aux nôtres avec aussi une prédominance de la M184V/I (n = 32 ; 49,2 %) suivi de la K103N (n= 28 ; 43 %) et la Y181C (n = 13 ; 20 %). Contrairement à notre étude, ces auteurs ont trouvé des analogues à la Thymidine (TAMs) chez 26 % (n = 17) et qui sont fortement représentées par la T215Y (n = 11, 16.9 %). Dans notre étude, pour n = 43, les TAMs sont représentées par la T215Y/F à 30,23 % suivie de la K70P/R/W à 9,30 % et de la K219E/N/Q à 9,30 %. Sous NVP, la mutation Y181C apparaît le plus souvent, mais elle ne confère pas une résistance croisée de haut niveau avec l'efz. Tandis que la mutation K103N n est pas très fréquente sous NVP mais confère une résistance de haut niveau à l EFZ si elle est présente. En association avec L100I et la K101P, la K103N engendre une susceptibilité de résistance à la NVP et l EFZ (S.-Y. Rhee et al., 2006). Des études ont révélé que lors d un traitement à la NVP, l'utilisation concomitante de la AZT favorisa l émergence de la K103N en désélectionnant la Y181C (Hanna et al., 2000). 111

131 Discussion générale La prévalence des mutations de résistance acquise dans notre étude est de 31,9 % (37/116). Ce taux s avère être important dans un pays comme le Tchad où tous les ARV et les examens complémentaires sont gratuits. Selon le rapport des experts de 2013, la prévalence de la résistance du VIH aux ARV en France est de 6,4 % chez les patients infectés par des virus de sous-types non-b (CNS & ANRS, 2013). Le Dried Blood Spot (DBS) pour le monitoring biologique de la résistance du VIH aux ARV Dans les pays à ressources limitées, l'échec au traitement passe généralement inaperçu jusqu'à l apparition des symptômes graves, et souvent les mutations de résistance s accumulent et les options de médicaments de seconde ligne sont limitées. Avec les techniques standard, les prélèvements doivent être très rapidement pris en charge, ou congelés, limitant encore d avantage l accessibilité aux analyses et notamment à la PCR. La technique du papier buvard comme nous l avons décrite dans l article permet de réaliser facilement un prélèvement et l acheminer à un laboratoire de référence sous forme d un courrier évitant ainsi le déplacement d équipes spécialisées pour le prélèvement. Mise à part l utilisation du buvard dans le diagnostic précoce chez l enfant comme le recommande l OMS (GIP Esther., 2008) et pour la surveillance de la résistance au traitement (Bennett et al., 2008), le DBS est utilisé pour le dépistage des troubles métaboliques chez les nouveaux nés (McCabe et al., 1987), pour la détection des anticorps VIH-1 (Hoff et al., 1988) et aussi pour le diagnostic infantile du VIH-1 par PCR ADN (Stevens et al., 2008), le DBS peut cependant très bien servir pour l évaluation du traitement antirétroviral pour les soustypes non-b. Les données indiquent que la détermination de la charge virale et l évaluation de la résistance génotypique du VIH-1 par le DBS et le DPS est possible. Toutefois, l efficacité du buvard dépend du type et de la qualité du buvard utilisé car certains papiers s avèrent moins adaptés pour la réalisation de tests de biologie moléculaire. Beaucoup des études à l instar de la nôtre ont utilisé le papier filtre Whatman 903 (Whatman, Maidstone, UK) pour la charge virale et les tests de résistance. L efficacité de la technique dépend aussi de la charge virale en question et des techniques d extraction utilisée. Pour la quantification de la charge virale, la technique du buvard donne des très bons résultats en utilisant le DBS comparativement au plasma. Des études ont montré, que l extraction de l ARN virale avec le kit NucliSENS EasyQ HIV-1 (BioMerieux), donne une sensibilité de 91 % et une spécificité de 97 % pour la détection des 112

132 Discussion générale principaux échecs virologiques et la détection d une charge virale plasmatique supérieure ou égale à copies/ml. Nous avons démontré dans notre étude que l extraction de l ARN est aussi possible avec le kit QiAmp mini kit Qiagen. Le DBS a également été évalué pour les sous-types non-b et a montré des résultats satisfaisants. Notre étude a révélé un taux d amplification de 80 % (24/30); cela témoigne que la technique utilisée pour le l extraction de l ARN et celle utilisée pour l amplification (ANRS) sont sensibles pour les sous-types non-b sur DBS. Plusieurs études ont trouvé des résultats comparables même après stockage à long terme (Hamers et al., 2009).Cependant, nous pouvons affirmer sans risque de nous tromper que le Kit Qiagen pourrait bien être utilisé pour l extraction de l ARN viral en vue des tests de résistances sur DBS. Pour la détection des mutations de résistance, des succès d amplification ont été obtenu en utilisant le Kit commercialisé ViroSeq (Abbott Molecular, USA) ou TRUGENE pour le génotypage du VIH-1 (Siemens USA) qui donnent des taux d amplification de 80 à 90 %. L expérience faite en Tanzanie dans la zone rurale avec l'utilisation de DBS appui ces conclusions ; 90 % des échantillons prélevés sur DBS provenant de patients en échec virologique ont été amplifiés avec succès et il y a eu une bonne concordance avec les mutations trouvées dans le plasma et le DBS (Johannessen et al., 2011) même lorsqu il s agit des mutations mineures (Xierong Wei et al., 2011). Il faut noter cependant que l utilisation du DBS a beaucoup des avantages mais a aussi des limites. Le sang recueilli sur DBS doit être quantitativement suffisant pour que l ARN viral puisse être détecté (utiliser 5 spots de 75 µl si possible). Pour un échantillon de 50 µl obtenu sur DBS, on peut avoir environ un Log de 3,5 copies/ml. Pour les tests de résistance avec la technique de l ANRS, la sensibilité du DBS dans notre étude est de 3,33 Log10 copies/ml (2150 copies/ml). La limite de détection du DBS décrite dans la littérature par certains auteurs semble se situer autour de 3 log10 copies/ml, soit 1000 copies (Hamers et al., 2009; Mbida et al., 2009; Pirillo et al., 2011; Viljoen et al., 2010). Chaque papier buvard doit être bien sec et protégé (pochette plastique ou film cellophane) afin d éviter tout contact entre les échantillons lors du transport. Un système d'acheminement au laboratoire doit être en place. La simplification au niveau du terrain (prélèvement) demande cependant une adaptation du laboratoire qui doit faire face à quelques manipulations supplémentaires. L inconvénient de la technique du recueil du sang sur papier buvard est souvent lié aux faibles quantités de sang collecté sur DBS (utilisation de moins de 3 spots sur les 5); ce 113

133 Discussion générale qui a pour conséquence une sensibilité réduite lors de la détection de l ARN viral si la charge virale est faible ( ) (Johannessen et al., 2009; Youngpairoj et al., 2008). Enfin, lorsqu il s agit du sang total déposé sur buvard (DBS) au lieu du plasma (DPS), l ADN proviral archivé dans les différentes cellules associées peut interférer au produit final d extraction et donnera des résultats faussement positifs de la charge virale. Les virus archivés dans les lymphocytes peuvent être différents de ceux présents dans le plasma (CNS & ANRS, 2013). C est pour cette raison qu en utilisant le sang total pour le DBS, nous avons remarqué la présence du sous-type K sur DBS alors qu il n a pas été trouvé dans le plasma. Le soustype K est décrit dans la littérature comme minoritaire et retrouvé en Afrique Centrale (Hemelaar et al., 2011). Il était initialement apparenté au sous-type F pour former un soustype F3 (Javaugue, 2014). En 2000, sur des études réalisées au Cameroun et en République Démocratique du Congo, des chercheurs ont permis de rattacher les souches caractérisées dans ces deux pays à un nouveau sous-type appelé K (Auwera et al., 200; Triques et al., 2000). Hemelaar et al. notifient que le sous-type K «pur» est impliqué dans moins de infections dans le monde avec localisation majeure en Afrique Centrale (Hemelaar et al., 2011). En somme, nous disons qu une stratégie de surveillance basée sur l utilisation du DBS est pour nous la meilleure alternative pour répondre aux besoins croissants des cliniciens pour la mesure de la charge virale et la surveillance de résistance génotypique de résistance du VIH dans les pays à ressources limitées. Une nouvelle technologie basée sur le DBS nommée Hemaspot TM est en cours d évaluation par Spotonsciences et qui serait moins invasive et plus économique que la technologie actuelle (Http://www.spotonsciences.com/contact/). Détection des mutations ponctuelles de résistance En utilisant la méthode de séquençage de l ANRS, nous avons mis en évidence des mutations de résistance acquises chez 44 des 116 patients sous traitement. Une autre technique de détection des mutations ponctuelles qu est l ASPCR est utilisée pour 44 échantillons du plasma et 24 échantillons de DBS. Les mutations recherchées sont la K103N (AAC), la Y181C (TGT), la M184V (GTG), la T215Y/F (TAC ou TTC) et la K70R (AGA) pour le plasma. Pour le DBS, nous avons recherché la M184V et la K103N. Les résultats obtenus avec le séquençage sont quasi semblables à ceux obtenus par ASPCR avec une sensibilité de 100 % pour les sous-type A, D, J et CRF02_AG. Il pourrait bien s agir d un polymorphisme spécifique pour ces différents sous-types. Javaugue définit le polymorphisme 114

134 Discussion générale génétique comme étant l existence des variations dans une séquence d acides nucléiques par rapport à un consensus de référence. Un virus de sous-type B appelé HXB2 dans le cas du VIH-1(Javaugue, 2014). C est un polymorphisme naturel présent en l absence de toute pression de sélection antivirale. Toutefois, un résultat faux positif est observé pour un échantillon (plasma) pour la K103N ; ceci pourrait être lié aux sous-types étudiés ou à la nature du contrôle utilisé (virus sauvage). L ASPCR est une technique très sensible et reproductible car les coefficients de variations retrouvées en inter et intra-essais sont toutes inferieures à 0,50. Quand les tests génotypiques standard détectent une mutation de résistance que quand elle est présente à plus de 20 %, cette technique (ASPCR) permet la détection de plusieurs mutations de résistance dans un même échantillon. Elle permet aussi de détection une seule mutation contenue dans un mélange même à faible proportion (0,01 %). Il est important de signaler ici quelques difficultés auxquelles nous nous sommes confrontés durant cette étude. Tout d abord, la collecte des données n a pas du tout été facile du fait que les patients ne viennent voir les médecins que quand ils ne vont pas bien. Les rendez-vous pour le contrôle immunovirologique ne sont pas du tout respectés par les patients. La plus part des patients viennent seulement pour le renouvellement de leur ordonnance au niveau du major de l hôpital sans pour autant aller voir leur médecin. En 10 mois, nous n avons collecté que 116 échantillons alors que pour un hôpital comme le HGRN, on aurait pu avoir plus des échantillons. Il faut noter aussi que pour bon nombre des malades au Tchad, la maladie reste encore un tabou car certains patients refusent volontairement de faire partie de l étude. Ceci est aussi favorisé par les pratiques religieuses très fréquentes au Tchad. L autre problème est celui des perdus de vue, certains patients une fois prélevés, sont difficilement joignables pour le prochain rendez-vous. Nous rappelons aussi que cette étude est la première du genre qui a permis de tester le protocole de la charge virale HIV-1 sous Abbott RealTime pour les soustypes non-b au Laboratoire de Référence Sida du CHU de Liège. Cette étude, par sa nature expérimentale et technique, ne fournit pas assez des informations sur les données sociodémographiques des patients et aussi sur la transmission de la résistance de la mère à l enfant au niveau de la PTME. Cela s explique par le fait que les femmes enceintes sont suivies dans un autre centre que le site choisi pour notre étude. Elle aurait dû être plus intéressante si la taille de notre échantillon était plus grande avec des 115

135 Discussion générale informations suffisantes sur les sujets. Cela permettra une analyse statistique approfondie afin de mesurer les relations entre les différentes variables. Tous ces manquements seront pris en compte dans des études ultérieures que nous comptons menées; cela constitue d ailleurs l un de nos perspectives d avenir. 116

136 Conclusion générale Conclusion générale Au terme de cette étude d évaluation, nous pouvons affirmer que les objectifs que nous nous sommes fixés sont atteints. Nous espérons avoir contribué à une meilleure connaissance de la problématique de la résistance du VIH aux ARV au Tchad. Cette connaissance facilite aux cliniciens de prendre une meilleure décision permettant ainsi une prise en charge efficace des PVVIH. Cette étude nous a permis aussi d apprendre et de maitriser différentes techniques de biologie moléculaire qui peuvent être utilisées à court ou moyen terme au Tchad. Nous retenons donc à la fin de l étude que la collecte du sang (DBS) ou du plasma (DPS) sur papier buvard en vue des analyses génotypiques pourrait bien être mise en place dans nos laboratoires tant au niveau central que périphérique. Il pourrait aussi être utilisé tant pour le diagnostic sérologique de l infection à VIH que pour la détection des mutations de résistance. Cela permettra de limiter les exigences liées à l échantillon et notamment la conservation. Pour les centres de prise en charge des provinces, le papier buvard pourrait être envoyé au laboratoire central sous forme de courrier simple sans une conservation particulière. Pour suivre l évolution de la maladie et l efficacité du traitement au cours de l'infection à VIH, les deux meilleurs marqueurs d'évolutivité de la maladie sont la charge virale plasmatique et le taux de lymphocytes CD4. Si la charge virale est élevée et que le taux des lymphocytes TCD4 est faible, cela témoigne l évolution rapide vers la maladie Sida et ramène à poser des questions sur l efficacité du traitement administré. En effet, nous avons remarqué dans cette étude que la moyenne et la médiane des CD4 n ont pratiquement pas évolué après huit mois de traitement. Il serait donc primordial de faire une évaluation immunovirologique au début de l'infection, lorsque l'immunité est encore peu diminuée, car c'est à ce stade qu'il reste du temps pour décider d'un traitement qui permettra de freiner la progression vers le stade Sida. Le choix d une technique de mesure de la charge virale doit être fait en fonction du problème réel et de la caractéristique de la population cible. Cependant, le choix dépend aussi de la diversité des sous-types incriminés qui circulent dans le pays, de la capacité du laboratoire et de l expertise de son personnel. Dans le cas où le laboratoire est équipé en matériel de biologie moléculaire et le personnel est bien formé, le rapport coût/efficacité doit être le critère primordial de choix d une technique. 117

137 Conclusion générale Il est important de noter que la technique de l ANRS pour la détection des mutations de résistance est bien sensible pour les sous-types non-b tant sur DBS que sur le plasma. Les sous-types du VIH-1 qui circulent au Tchad selon la littérature sont A, D, F, G et 3 formes recombinantes (CRF01-AE, CRF02-AG et CRF11-cpx) (Vidal et al., 2003). La prévalence de la résistance acquise au traitement de première ligne observée est de 31,9 % (37/116). Un autre sous-type est trouvé dans notre étude, il s agit du sous-type J avec 30,23 %. Ce nouveau sous-type est apparenté avec le sous-type F précédemment circulant au Tchad (voir arbre phylogénétique). Cela prouve que des nouveaux sous-types circulent encore au pays et ceci serait certainement favorisé par l émergence de la résistance. Un sous-type K est retrouvé sur DBS (3/24 ; 12,5 %) alors qu il est absent sur le plasma. Le CRF01_AE et CRF11-cpx ne sont pas trouvés dans notre étude. Le sous-type C décrit comme étant responsable de la plus part des infections en Afrique n est pas aussi rencontré dans notre étude. Malgré le fait que cette technique de l ANRS est facile à réaliser avec des appareils ouverts et adaptables aux pays à ressources limitées, elle est aussi moins onéreuse. Pour toutes ces raisons, nous la recommandons pour les pays du Sud et plus précisément pour le Tchad. La recommandation que nous aimerions faire aux cliniciens, c est de plaider auprès des autorités compétentes pour la mise en place au Tchad des tests de résistance afin de mieux juger l efficacité du traitement. Ils pourront ensuite prescrire un test génotypique de résistance en cas d échec virologique. Les techniques standard de détection de mutations de résistance pour le monitoring biologique des personnes vivant avec le VIH sont très chères et nécessitent des laboratoires bien équipés et un personnel aguerri en technique de biologie moléculaire. Cependant, la technique de détection des mutations ponctuelle (ASPCR) semble être la mieux indiquée pour les PRL car elle se révèle être moins chers en terme des réactifs et très spécifique tant pour les sous-types A, D, C, J et les CRF02_AG. Elle a pour avantage de détecter plusieurs mutations de résistance dans un même échantillon et aussi une seule mutation parmi tant d autres même lorsqu elles sont présentes en des faibles proportions. Il est déjà temps de mettre en place un véritable système efficace de surveillance épidémiologique des résistances au Tchad. Ceci passe nécessairement par la création d un Centre de Référence Sida pour une meilleure prise en charge des personnes vivant avec le VIH. Le système de surveillance qui existe au Tchad actuellement, n existe que de nom et est limité seulement au dépistage systématique des femmes enceintes au niveau des PTME. Tenant compte de la diversité génétique du virus, et en particulier la prolifération des formes recombinantes complexes qui rendent difficile le choix et/ou la mise au point d une 118

138 Conclusion générale technique «universelle» permettant l amplification de toutes les variantes quel que soit leur niveau de complexité, il serait donc préférable de suivre un patient avec le même test et de ne le changer qu en cas de discordance immunologique, virologique et/ou clinique. Cependant, il faut garder à l esprit que la persistance d une réplication virale sous traitement favorise la sélection des mutations de résistance et ceci quel que soit le facteur incriminé dans l échec virologique; la conséquence qui en découle est la diminution des chances d efficacité du traitement qui pourra avoir un impact négatif sur la survie du malade. Dans un pays comme le Tchad où plus de la moitié de la population est illettrée, un pays où les personnes vivant avec le VIH meurent à cause de la rupture de stock des médicaments dans certaines localités, ou à cause d un suivi immunovirologique moribond, ou encore à cause de l absence des tests génotypiques de résistance, nous osons croire enfin qu à travers cette étude, nous apporterons notre pierre à l édifice en fournissant des données de bases qui serviront à d autres scientifiques et chercheurs à l échelle nationale et internationale de poursuivre la même bataille. Cette bataille «interminable» est celle d une vie saine et normale pour les personnes vivant avec le VIH d une part et l éradication de la maladie de toute la surface de la terre d autre part. En somme, le thème développé dans cette étude apporte une connaissance approfondie de la résistance au traitement et facilite le choix des méthodes alternatives quant à la prise en charge des PVVIH au Tchad. 119

139 Perspectives d avenir Perspectives d avenir Notre souci, est que dans un proche avenir, les techniques apprises et évaluées à Liège pour le monitoring biologique, soient mises en place au Tchad ; ceci passe nécessairement par la création d un Centre de Référence Sida avec du personnel qualifié et du matériel adéquat. Afin de pouvoir étudier la diversité génétique dans tous ses états, nous allons étendre l étude de la résistance chez des patients naïfs et femmes enceintes (résistances transmises) et des patients sous traitement (résistances acquises) dans les différentes villes du pays avec un échantillonnage beaucoup plus représentatif. Pour la détection des mutations ponctuelles, nous entendons faire une étude plus diversifiée permettant la détection des mutations ponctuelles par ASPCR en même temps la quantification de la charge virale sur plasma et sur DBS. Pour cela, nous allons utiliser un plasmide que nous allons cloner avec les différentes mutations, qui servira de contrôle. 120

140 Liste bibliographique Liste bibliographique Abecasis, A. B., Vandamme, A.-M., & Lemey, P. (2009). Quantifying differences in the tempo of human immunodeficiency virus type 1 subtype evolution. Journal of Virology, 83, doi: /jvi Adawaye, C., Kamangu, E., Ali Mahamat, M., Tchoumbou HZ, B., Vaira, D., & Moutschen, M. (2013). Use of Dried Blood Spot to Improve the Diagnosis and Management of HIV in Resource-Limited Settings. World Journal of AIDS, 3(September), doi:http://dx.doi.org/ /wja Adawaye, C., Kamangu, E., Djibrine, S. I., Chahad, A. M., Ali Mahamat, M., Tchombou HZ, B., Moutschen, M. (2014). Immunovirologic Evaluation of Triomune ( Lamivudine, Stavudine and Nevirapine) Antiretroviral Therapy in first line HIV-1 adult patients in N Djamena, Chad. World Journal of AIDS, 4(3). doi: /wja Adjé, C., Cheingsong, R., Roels, T. H., Maurice, C., Djomand, G., Verbiest, W., N Nkengasong, J. (2001). High prevalence of genotypic and phenotypic HIV-1 drugresistant strains among patients receiving antiretroviral therapy in Abidjan, Côte d Ivoire. Journal of Acquired Immune Deficiency Syndromes, 26(5), Aghokeng, A. F., Mpoudi-Ngole, E., Dimodi, H., Atem-Tambe, A., Tongo, M., Butel, C., Peeters, M. (2009). Inaccurate diagnosis of HIV-1 group M and O is a key challenge for ongoing universal access to antiretroviral treatment and HIV prevention in Cameroon. PLoS ONE, 4(11), e7702. doi: /journal.pone Aghokeng, A. F., Vergne, L., Mpoudi-Ngole, E., Mbangue, M., Deoudje, N., Makondji, E., Peeters, M. (2009). Evaluation of transmitted HIV drug resistance among recentlyinfected antenatal clinic attendees in four Central African countries. Antiviral Therapy, 14(3), Ameziane, N., Bogard, M., & Lamoril, J. (2005). Principes de biologie moléculaire en biologie clinique. (Elsevier, Ed.) (p. 705). ANRS AC11 Resistance Study Group. (2008). PCR and Sequencing Procedures : HIV-1 Version February ANRS, (February), 3 7. Retrieved from Arredondo, M., Garrido, C., Parkin, N., Zahonero, N., Bertagnolio, S., Soriano, V., & de Mendoza, C. (2012). Comparison of HIV-1 RNA measurements obtained by using plasma and dried blood spots in the automated abbott real-time viral load assay. Journal of Clinical Microbiology, 50(3), doi: /jcm Atlas, A., Granath, F., Lindström, A., Lidman, K., Lindbäck, S., & Alaeus, A. (2005). Impact of HIV type 1 genetic subtype on the outcome of antiretroviral therapy. AIDS Research and Human Retroviruses, 21, doi: /aid

141 Liste bibliographique Auwera, G. V. A. N. D. E. R., Janssens, W., Heyndrickx, L. E. O., & Groen, G. V. A. N. D. E. R. (2001). Reanalysis of Full-Length HIV Type 1 Group M Subtype K and Sub- Subtype F2 with an MS-DOS. AIDS Research and Human Retroviruses, 17(2), Bacheler, L., Jeffrey, S., Hanna, G., D Aquila, R., Wallace, L., Logue, K., Rizzo, C. (2001). Genotypic correlates of phenotypic resistance to efavirenz in virus isolates from patients failing nonnucleoside reverse transcriptase inhibitor therapy. Journal of Virology, 75(11), doi: /jvi Bandea, C. I., Ramos, A., Pieniazek, D., Pascu, R., Tanuri, A., Schochetman, G., & Rayfield, M. A. (1995). Epidemiologic and evolutionary relationships between Romanian and Brazilian HIV-subtype F strains. Emerging Infectious Diseases, 1(3), doi: /eid Bártolo, I., Abecasis, A. B., Borrego, P., Barroso, H., McCutchan, F., Gomes, P., Taveira, N. (2011). Origin and epidemiological history of HIV-1 CRF14_BG. PLoS ONE, 6. doi: /journal.pone Bennett, D. E., Camacho, R. J., Otelea, D., Kuritzkes, D. R., Fleury, H. H., Kiuchi, M., Shafer, R. W. (2009). Drug resistance mutations for surveillance of transmitted HIV-1 drug-resistance: 2009 update. PLoS ONE, 4(3), e4724. doi: /journal.pone Bennett, D. E., Myatt, M., Bertagnolio, S., Sutherland, D., & Gilks, C. F. (2008). Recommendations for surveillance of transmitted HIV drug resistance in countries scaling up antiretroviral treatment. Antiviral Therapy, 13 Suppl 2(13), Bennett, D., McCormick, L., Kline, R., Wheeler, W., Hemmen, M., Smith, A., Donolero, T. (2005). US surveillance of HIV drug resistance at diagnosis using HIV diagnostic sera. In 12th Conference on Retroviruses and Opportunistic Infections (pp ). Bertagnolio, S., Parkin, N. T., Jordan, M., Brooks, J., & García-Lerma, J. G. (2010). Dried blood spots for HIV-1 drug resistance and viral load testing: A review of current knowledge and WHO efforts for global HIV drug resistance surveillance. AIDS Reviews, 12(4), Bigaillon, C., Mérens, A., & Rapp, C. (2010). Intérêt des tests génotypiques de résistance du VIH aux antirétroviraux en pratique clinique quotidienne. Revue Francophone Des Laboratoires, 2010(422), doi: /s x(10) Bodelle, P., Vallari, A., Coffey, R., McArthur, C. P., Beyeme, M., Devare, S. G., Brennan, C. a. (2004). Identification and genomic sequence of an HIV type 1 group N isolate from Cameroon. AIDS Research and Human Retroviruses, 20(8), doi: / Boucher, C. A., Cammack, N., Schipper, P., Schuurman, R., Rouse, P., Wainberg, M. A., & Cameron, J. M. (1993). High-level resistance to (-) enantiomeric 2 -deoxy-3'-thiacytidine in vitro is due to one amino acid substitution in the catalytic site of human 122

142 Liste bibliographique immunodeficiency virus type 1 reverse transcriptase. Antimicrobial Agents and Chemotherapy, 37(10), Brenner, B., Turner, D., Oliveira, M., Moisi, D., Detorio, M., Carobene, M., Wainberg, M. A. (2003). A V106M mutation in HIV-1 clade C viruses exposed to efavirenz confers cross-resistance to non-nucleoside reverse transcriptase inhibitors. AIDS (London, England), 17, F1 F5. doi: / Brun-Vézinet, F., Costagliola, D., Ait Khaled, M., Calvez, V., Clavel, F., Clotet, B., DeGruttola, V. (2004). Clinically validated genotype analysis: Guiding principles and statistical concerns. Antiviral Therapy. Brun-Vézinet, F., Descamps, D., Ruffault, A., Masquelier, B., Calvez, V., Peytavin, G., Costagliola, D. (2003). Clinically relevant interpretation of genotype for resistance to abacavir. AIDS (London, England), 17, doi: / Burda, S. T., Konings, F. A. J., Williams, C. A. U., Anyangwe, C., & Nyambi, P. N. (2004). HIV-1 CRF09_cpx circulates in the North West Province of Cameroon where CRF02_AG infections predominate and recombinant strains are common. AIDS Research and Human Retroviruses, 20, doi: /aid Calvez, V., Costagliola, D., Descamps, D., Yvon, A., Collin, G., Cécile, A., Brun-Vézinet, F. (2002). Impact of stavudine phenotype and thymidine analogues mutations on viral response to stavudine plus lamivudine in ALTIS 2 ANRS trial. Antiviral Therapy, 7(3), Calvez, V., Costagliola, D., Descamps, D., Yvon, A., Collin, G., Cécile, A., Brun-Vézinet, F. (2002). Impact of stavudine phenotype and thymidine analogues mutations on viral response to stavudine plus lamivudine in ALTIS 2 ANRS trial. Antiviral Therapy, 7(3), Carr, J. K., Salminen, M. O., Albert, J., Sanders-Buell, E., Gotte, D., Birx, D. L., & McCutchan, F. E. (1998). Full genome sequences of human immunodeficiency virus type 1 subtypes G and A/G intersubtype recombinants. Virology, 247(1), doi: /viro CNLS. (2012). RAPPORT D ACTIVITE S SUR LA RIPOSTE AU SIDA AU TCHAD. Conseil National de Lutte Contre Le Sida (CNLS), CNS, & ANRS. (2013). Prise en charge médicale des personnes vivant avec le VIH: Résistance du VIH VIH-1 aux antirétroviraux. Recommendations du groupe d experts (p. 478), France. Cozzi-Lepri, A., Ruiz, L., Loveday, C., Phillips, A. N., Clotet, B., Reiss, P., Lundgren, J. D. (2005). Thymidine analogue mutation profiles: factors associated with acquiring specific profiles and their impact on the virological response to therapy. Antiviral Therapy, 10,

143 Liste bibliographique Damond, F., & Descamps, D. (1998). Résistance du VIH aux antirétroviraux : évaluations virologiques des thérapeutiques. Revue Française Des Laboratoires, 1998(305), doi: /s (98)80139-x. De Luca, A., Di Giambenedetto, S., Romano, L., Gonnelli, A., Corsi, P., Baldari, M., Zazzi, M. (2006). Frequency and treatment-related predictors of thymidine-analogue mutation patterns in HIV-1 isolates after unsuccessful antiretroviral therapy. The Journal of Infectious Diseases, 193, doi: / De Rossi, A., Amadori, A., Chieco-Bianchi, L., Giacquinto, C., Zacchello, F., Buchbinder, A., Peckham, C. S. (1988). Polymerase chain reaction and in-vitro antibody production for early diagnosis of paediatric HIV infection. Lancet, 2(8605), 278. Retrieved from Delaugerre, C., Chaix, M.-L. M.-L., Warszawski, J., Rouzioux, C., & Blanche, S. (2007). La résistance du VIH-1 aux antirétroviraux chez les enfants infectés : du nouveau-né à l adolescent HIV-1 drug resistance in French infected-children : from newborn to adolescent. Archives de Pédiatrie, 14(3), doi: /s x(06) Derache, A., Traore, O., Koita, V., Sylla, A., Tubiana, R., Simon, A., Cisse, M. (2007). Short communication Genetic diversity and drug resistance mutations in HIV type 1 from untreated patients in Bamako, Mali. Antiviral Therapy, 12, Doualla-bell, F., Turner, D., Loemba, H., Petrella, M., Brenner, B., Wainberg, M. A., & Wainberg, A. (2010). Résistance du VIH aux antirétroviraux: Conséquences pour les pays à faibles revenus, 20(December), Retrieved from Drosten, C., Panning, M., Drexler, J. F., Hänsel, F., Pedroso, C., Yeats, J., Preiser, W. (2006). Ultrasensitive monitoring of HIV-1 viral load by a low-cost real-time reverse transcription-pcr assay with internal control for the 5 long terminal repeat domain. Clinical Chemistry, 52, doi: /clinchem Erick, K. N., Zakayi, K., Georges, M. L., Lunganza, K., & Gauthier, M. K. (2013). Genetic Diversity of Human Immunodeficiency Virus Type 1 in the Democratic Republic of Congo : a review of available data. International Journal of Collaborative Ressearch on Internal Medecine and Public Health, 5(5), Eshleman, S. H., Mracna, M., Guay, L. a, Deseyve, M., Cunningham, S., Mirochnick, M., Jackson, J. B. (2001). Selection and fading of resistance mutations in women and infants receiving nevirapine to prevent HIV-1 vertical transmission (HIVNET 012). AIDS (London, England), 15(15), Fener, P. (2011). Traitement de l infection à VIH : la restauration immunitaire comme objectif. SidaSciences. Retrieved October 26, 2014, from de l'infection à VIH-l. 124

144 Liste bibliographique Fiscus, S. A., Brambilla, D., Grosso, L., Schock, J., & Cronin, M. (1998). Quantitation of human immunodeficiency virus type 1 RNA in plasma by using blood dried on filter paper. Journal of Clinical Microbiology, 36(1), Foulongne, V., Montes, B., Didelot-Rousseau, M.-N., & Segondy, M. (2006). Comparison of the LCx human immunodeficiency virus (HIV) RNA quantitative, RealTime HIV, and COBAS AmpliPrep-COBAS TaqMan assays for quantitation of HIV type 1 RNA in plasma. Journal of Clinical Microbiology, 44, doi: /jcm Gadelha, Â. J., Accacio, N., Costa, R. L. B., Galhardo, M. C., Cotrim, M. R., De Souza, R. V, Rolla, V. C. (2002). Morbidity and survival in advanced aids in Rio de Janeiro, Brazil. Revista Do Instituto de Medicina Tropical de Sao Paulo, 44(4), Gao, F., Bailes, E., Robertson, D. L., Chen, Y., Rodenburg, C. M., Michael, S. F., Balles, E. (1999). Origin of HIV-1 in the chimpanzee Pan troglodytes troglodytes. Nature, 397(6718), doi: / GIP Esther. (2008). Monitoring biologique de l infection à VIH pour les pays à ressources limitées. Grant, R. M., Hecht, F. M., Warmerdam, M., Liu, L., Liegler, T., Petropoulos, C. J., Kahn, J. O. (2002). Time trends in primary HIV-1 drug resistance among recently infected persons. JAMA : The Journal of the American Medical Association, 288, doi: / Greder Belan, A., Chaplain, C., & Boussairi, A. (2008). Suivi biologique de l infection à VIH chez l adulte. Immuno-Analyse & Biologie Spécialisée, 23(2), doi: /j.immbio Gueudin, M., Plantier, J. C., Lemée, V., Schmitt, M. P., Chartier, L., Bourlet, T., Simon, F. (2007). Evaluation of the Roche Cobas TaqMan and Abbott RealTime extractionquantification systems for HIV-1 subtypes. Journal of Acquired Immune Deficiency Syndromes (1999), 44(5), doi: /qai.0b013e df. Guillaume, L. Y., Yessé, Z. N., Hortense, K., Laurent, D., Arsher, C. M., Joseph, L. S., & Marie-chantal, A. K. (2012). Genetic Diversity and Antiretroviral Drug Resistance among Drug-Naïve HIV-1 Infected Pregnant Women Attending Antenatal Clinics in Abidjan, Côte d Ivoire. World Journal of AIDS, 2012(June), Guimarães, M. L., Vicente, A. C. P., Otsuki, K., da Silva, R. F. F. C., Francisco, M., da Silva, F. G., Bello, G. (2009). Close phylogenetic relationship between Angolan and Romanian HIV-1 subtype F1 isolates. Retrovirology, 6(1), 39. doi: / Halvas, E. K., Aldrovandi, G. M., Balfe, P., Beck, I. A., Boltz, V. F., Coffin, J. M., Mellors, J. W. (2006). Blinded, multicenter comparison of methods to detect a drugresistant mutant of human immunodeficiency virus type 1 at low frequency. Journal of Clinical Microbiology, 44, doi: /jcm

145 Liste bibliographique Hamers, R. L., Smit, P. W., Stevens, W., Schuurman, R., & Rinke de Wit, T. F. (2009). Original article Dried fluid spots for HIV type-1 viral load and resistance genotyping : a systematic review. Antiviral Therapy, 14, Hammer, S. M., Eron, J. J., Reiss, P., Schooley, R. T., Thompson, M. A., Walmsley, S., Volberding, P. A. (2008). Antiretroviral treatment of adult HIV infection: 2008 recommendations of the International AIDS Society-USA panel. In JAMA : the journal of the American Medical Association (Vol. 300, pp ). doi: /jama Hanna, G. J., Johnson, V. A., Kuritzkes, D. R., Richman, D. D., Brown, A. J., Savara, A. V, D Aquila, R. T. (2000). Patterns of resistance mutations selected by treatment of human immunodeficiency virus type 1 infection with zidovudine, didanosine, and nevirapine. The Journal of Infectious Diseases, 181(3), doi: / Harrigan, P. R., Montaner, J. S., Wegner, S., Verbiest, W., Miller, V., Wood, R., & Larder, B. A. (2001). World-wide variation in HIV-1 phenotypic susceptibility in untreated individuals: biologically relevant values for resistance testing. AIDS (London, England), 15(13), Hauser, A., Mugenyi, K., Kabasinguzi, R., Bluethgen, K., Kuecherer, C., Harms, G., & Kunz, A. (2009). Detection and quantification of minor human immunodeficiency virus type 1 variants harboring K103N and Y181C resistance mutations in subtype A and D isolates by allele-specific real-time PCR. Antimicrobial Agents and Chemotherapy, 53(7), doi: /aac Hauser, A., Sewangi, J., Mbezi, P., Dugange, F., Lau, I., Ziske, J., Kunz, A. (2012). Emergence of minor drug-resistant HIV-1 variants after triple antiretroviral prophylaxis for prevention of vertical HIV-1 transmission. PloS One, 7(2), e doi: /journal.pone Hemelaar, J., Gouws, E., Ghys, P. D., & Osmanov, S. (2011). Global trends in molecular epidemiology of HIV-1 during AIDS (London, England), 25, doi: /qad.0b013e328342ff93. Hirsch, M. S., Günthard, H. F., Schapiro, J. M., Brun-Vézinet, F., Clotet, B., Hammer, S. M., Richman, D. D. (2008). Antiretroviral drug resistance testing in adult HIV-1 infection: 2008 recommendations of an International AIDS Society-USA panel. Clinical Infectious Diseases : An Official Publication of the Infectious Diseases Society of America, 47(2), doi: / Hocini, H., & Andreoletti, L. (2009). Méthodes d analyse et de suivi de l infection par les virus de l immunodéficience humaine. Revue Francophone Des Laboratoires, 2009(417), doi: /s x(09) Hoff, R., Berardi, V., Weiblen, B., Mahoney-Trout, L., Mitchell, M., & Grady, G. (1988). Seroprevalence of human immunodeficiency virus among childbearing women. 126

146 Liste bibliographique Estimation by testing samples of blood from newborns. New England Journal of Medicine, 318, (2014). Spot On Sciences Dried Blood Spot Technology and Solutions. Retrieved October 02, 2014, from Hyman, E. D. (1988). A new method of sequencing DNA. Analytical Biochemistry, 174(2), doi: / (88) INSEED. (2009). Deuxième Recensement Général de la Population et de l Habitat-Résutats globaux (RGPH2) (p. 89). Tchad. Retrieved from Globaux.pdf. J.-M.M. (2008). Raltégravir, premier inhibiteur d intégrase: feu vent en Europe. Revue Francophone Des Laboratoires, 2008(400), 10. doi:http://dx.doi.org/ /s x(08) Jackson, J. B., Becker-pergola, G., Guay, L. A., Musoke, P., Mracna, M., Glenn, M., Eshleman, S. H. (2000). Identi cation of the K103N resistance mutation in Ugandan women receiving nevirapine to prevent HIV-1 vertical transmission, (March), Javaugue, F.-C. (2014). Les Virus et le nouveau visage moléculaire de la pandémie (Hermann., p. 997). Paris. Johannessen, A., Garrido, C., Zahonero, N., Naman, E., de Mendoza, C., & Mendoza, C. De. (2011). HIV-1 drug resistance testing from dried blood spots collected in rural Tanzania using the ViroSeq HIV-1 Genotyping System. The Journal of Antimicrobial Chemotherapy, 66(2), doi: /jac/dkq433. Johannessen, A., Garrido, C., Zahonero, N., Sandvik, L., Naman, E., Kivuyo, S. L., de Mendoza, C. (2009). Dried blood spots perform well in viral load monitoring of patients who receive antiretroviral treatment in rural Tanzania. Clinical Infectious Diseases : An Official Publication of the Infectious Diseases Society of America, 49(6), doi: / Johnson, V. a, Brun-Vézinet, F., Clotet, B., Günthard, H. F., Kuritzkes, D. R., Pillay, D., Richman, D. D. (2010). Update of the drug resistance mutations in HIV-1: December Topics in HIV Medicine : A Publication of the International AIDS Society, USA, 18(5), Jourdain, G., Ngo-Giang-Huong, N., Le Coeur, S., Bowonwatanuwong, C., Kantipong, P., Leechanachai, P., Lallemant, M. (2004). Intrapartum exposure to nevirapine and subsequent maternal responses to nevirapine-based antiretroviral therapy. The New England journal of medicine (Vol. 351, pp ). doi: /01.sa

147 Liste bibliographique Kellam, P., Boucher, C. A., & Larder, B. A. (1992). Fifth mutation in human immunodeficiency virus type 1 reverse transcriptase contributes to the development of high-level resistance to zidovudine. Proceedings of the National Academy of Sciences of the United States of America, 89, doi: /pnas Kempf, D. J., Isaacson, J. D., King, M. S., Brun, S. C., Xu, Y., Real, K., Rode, R. A. (2001). Identification of genotypic changes in human immunodeficiency virus protease that correlate with reduced susceptibility to the protease inhibitor lopinavir among viral isolates from protease inhibitor-experienced patients. Journal of Virology, 75, doi: /jvi Koyalta, D., Charpentier, C., Beassamda, J., Rey, E., Si-Mohamed, A., Djemadji-Oudjeil, N., & Bélec, L. (2009). High frequency of antiretroviral drug resistance among HIV-infected adults receiving first-line highly active antiretroviral therapy in N Djamena, Chad. Clinical Infectious Diseases : An Official Publication of the Infectious Diseases Society of America, 49(1), doi: / Kuritzkes, D. R., Bassett, R. L., Hazelwood, J. D., Barrett, H., Rhodes, R. A., Young, R. K., & Johnson, V. A. (2004). Rate of thymidine analogue resistance mutation accumulation with zidovudine- or stavudine-based regimens. Journal of acquired immune deficiency syndromes (1999) (Vol. 36, pp ). doi: / Kuritzkes, D. R., Grant, R. M., Feorino, P., Griswold, M., Hoover, M., Young, R., Winslow, D. L. (2003). Performance characteristics of the TRUGENE HIV-1 Genotyping Kit and the OpenGene DNA Sequencing System. Journal of Clinical Microbiology, 41, doi: /jcm Lamoril, J., Ameziane, N., Deybach, J.-C., Bouizegarène, P., & Bogard, M. (2008). Les techniques de séquençage de l ADN : une révolution en marche. Première partie. Immuno-Analyse & Biologie Spécialisée, 23(5), doi: /j.immbio Lanier, E. R., Ait-Khaled, M., Scott, J., Stone, C., Melby, T., Sturge, G., Lafon, S. (2004). Antiviral efficacy of abacavir in antiretroviral therapy-experienced adults harbouring HIV-1 with specific patterns of resistance to nucleoside reverse transcriptase inhibitors. Antiviral Therapy, 9, Larder, B. A., & Kemp, S. D. (1989). Multiple mutations in HIV-1 reverse transcriptase confer high-level resistance to zidovudine (AZT). Science (New York, N.Y.), 246, doi: /science Larder B.A., H. K.. K. S. D. (2000). Quantitative prediction of HIV-1 Phenotypic drug resistance from genotypes: the virtual phenotype (virtual phenotype). Antiviral Therapy, 5(Abstract), 49. Laure, F., Rouzioux, C., Veber, F., Jacomet, C., Courgnaud, V., Blanche, S., Brechot, C. (1988). Detection of HIV1 DNA infants and children by means of the polymerase chain reaction. Lancet, 2(8610),

148 Liste bibliographique Laurent, C., Bourgeois, A., Faye, M. A., Mougnutou, R., Seydi, M., Gueye, M., Delaporte, E. (2002). No difference in clinical progression between patients infected with the predominant human immunodeficiency virus type 1 circulating recombinant form (CRF) 02_AG strain and patients not infected with CRF02_AG, in western and west-central Africa: A four-ye. Journal of Infectious Diseases, 186(4), Lecossier, D., Shulman, N. S., Morand-Joubert, L., Shafer, R. W., Joly, V., Zolopa, A. R., Hance, A. J. (2005). Detection of minority populations of HIV-1 expressing the K103N resistance mutation in patients failing nevirapine. Journal of acquired immune deficiency syndromes (1999) (Vol. 38, pp ). doi: / Leelawiwat, W., Young, N. L., Chaowanachan, T., Ou, C. Y., Culnane, M., Vanprapa, N., McNicholl, J. M. (2009). Dried blood spots for the diagnosis and quantitation of HIV-1: stability studies and evaluation of sensitivity and specificity for the diagnosis of infant HIV-1 infection in Thailand. Journal of Virological Methods, 155(2), doi: /j.jviromet Lihana, R. W., Ssemwanga, D., Abimiku, A., & Ndembi, N. (2012). Update on HIV-1 diversity in Africa: a decade in review. AIDS Reviews, 14(2), Malick, F.-Z. F., Tchiakpe, E., Sid Ahmed Ould Soufiane, Diop-ndiaye, H., Baye, A. M., Ould, A., Toure, C. (2014). Drug Resistance Mutations and Genetic Diversity in Adults Treated for HIV Type 1 Infection in Mauritania. Journal of Medical Virology, 410(November 2013), doi: /jmv. Manus, J.-M. (2013). Vaccin thérapeutique adjuvant contre VIH. Revue Francophone Des Laboratoires, 2013(450), 10. doi:http://dx.doi.org/ /s x(13) Marcelin, A., & Calvez, V. (2007). Résistance du VIH aux inhibiteurs d entrée. Virologie, 11, doi: /vir Marcelin, A.-G., Flandre, P., Pavie, J., Schmidely, N., Wirden, M., Lada, O., Calvez, V. (2005). Clinically relevant genotype interpretation of resistance to didanosine. Antimicrobial agents and chemotherapy (Vol. 49, pp ). doi: /aac Maxam, M., & Gilbert, W. (1977). A new method for sequencing DNA Biotechnology (Reading, Mass.), 24(2), Mbida, A. D., Sosso, S., Flori, P., Saoudin, H., Lawrence, P., Monny-Lobé, M., Bourlet, T. (2009). Measure of viral load by using the Abbott Real-Time HIV-1 assay on dried blood and plasma spot specimens collected in 2 rural dispensaries in Cameroon. Journal of Acquired Immune Deficiency Syndromes (1999), 52, doi: /qai.0b013e3181aeccbc. 129

149 Liste bibliographique McCabe, E., SZ, H., WK, S., & ML, L. (1987). DNA microextraction from dried blood spots on filter paper blotters: potential applications to newborn screening. Hum Genet, 75, Mee, P., Fielding, K. L., Charalambous, S., Churchyard, G. J., & Grant, A. D. (2008). Evaluation of the WHO criteria for antiretroviral treatment failure among adults in South Africa. AIDS (London, England), 22(15), doi: /qad.0b013e32830e4cd8. Mihailidis, C., Dunn, D., Pillay, D., & Pozniak, A. (2008). Effect of isolated V118I mutation in reverse transcriptase on response to first-line antiretroviral therapy. AIDS (London, England), 22, doi: /qad.0b013e3282f3744f. Molina, J. M., Marcelin, A. G., Pavie, J., Heripret, L., De Boever, C. M., Troccaz, M., Calvez, V. (2005). Didanosine in HIV-1-infected patients experiencing failure of antiretroviral therapy: a randomized placebo-controlled trial. J Infect Dis, 191, doi:jid33321 [pii]\r / Montavon, C., Toure-Kane, C., Liegeois, F., Mpoudi, E., Bourgeois, A., Vergne, L., Peeters, M. (2000). Most env and gag subtype A HIV-1 viruses circulating in west and West Central Africa are similar to the prototype AG recombinant virus IBNG. Journal of Acquired Immune Deficiency Syndromes, 23(5), Morand-joubert, L. (2009). Place du maraviroc dans la stratégie antirétrovirale : intérêt et faisabilité des tests génotypiques dans la détermination du tropisme viral. Virologie, 13(3), doi: /vir Naeth, G., Ehret, R., Wiesmann, F., Braun, P., Knechten, H., & Berger, A. (2013). Comparison of HIV-1 viral load assay performance in immunological stable patients with low or undetectable viremia. Medical Microbiology and Immunology, 202(1), doi: /s y. OMS. (2006). Traitement antirétroviral de l infection à VIH chez l'adulte et l'adolescent en situation de ressources limitées :Recommandations pour une approche de santé publique. Genève. OMS. (2009). Stratégie de la coopération de l OMS avec les pays (Tchad). Bibliothèque de l OMS/AFRO, WA 540 HG9. OMS. (2012). Rapport oms 2012 sur la résistance du vih aux antirétroviraux. Genève. doi:isbn OMS. (2013). Les nouvelles recommandations de l OMS concernant le VIH appellent à un traitement plus précoce de la maladie. Centres Des Médias de l Organisation Mondiale de La Santé. Onusida. (2013). Rapport sur l épidemie mondiale du Sida Retrieved from 130

150 Liste bibliographique Ou, C. Y., Kwok, S., Mitchell, S. W., Mack, D. H., Sninsky, J. J., Krebs, J. W., Schochetman, G. (1988). DNA amplification for direct detection of HIV-1 in DNA of peripheral blood mononuclear cells. Science (New York, N.Y.), 239, Ouagadjio, B., Nodjimadji, K., Bagamla, T., Riradjim Madnodji;, Tokindang, J. S., Ngakoutou, N., Barrère, M. (2005). Enquête Nationale de prévalence de l infection à VIH au Tchad. es Etudes Economiques et Démographiques (INSEED). Palella, F. J., M., K., Delaney, A. C., Moorman, M. O., Loveless, J. F., A.Satten, G., Holmberg, S. D. (1998). Declining morbidity and mortality among patients with advanced human immunodeficiency virus infection. The New England Journal of Medicine, 338(13), Palmer, S., Kearney, M., Maldarelli, F., Halvas, E. K., Bixby, C. J., Bazmi, H., Coffin, J. M. (2005). Multiple, linked human immunodeficiency virus type 1 drug resistance mutations in treatment-experienced patients are missed by standard genotype analysis. Journal of Clinical Microbiology, 43, doi: /jcm Pas, S., Rossen, J. W. A., Schoener, D., Thamke, D., Pettersson, A., Babiel, R., & Schutten, M. (2010). Performance evaluation of the new Roche Cobas AmpliPrep/Cobas TaqMan HIV-1 test version 2.0 for quantification of human immunodeficiency virus type 1 RNA. Journal of Clinical Microbiology, 48(4), doi: /jcm Peeters, M., Chaix, M., & Delaporte, E. (2008). Phylogénie des SIV et des VIH Mieux comprendre l origine des VIH. Medecine/Science, 24, Pillay, D., Walker, A. S., Gibb, D. M., de Rossi, A., Kaye, S., Ait-Khaled, M., Babiker, A. (2002). Impact of human immunodeficiency virus type 1 subtypes on virologic response and emergence of drug resistance among children in the Paediatric European Network for Treatment of AIDS (PENTA) 5 trial. The Journal of Infectious Diseases, 186(5), doi: / Pirillo, M. F., Recordon-Pinson, P., Andreotti, M., Mancini, M. G., Amici, R., & Giuliano, M. (2011). Quantification of HIV-RNA from dried blood spots using the siemens VERSANT?? HIV-1 RNA (kpcr) assay. Journal of Antimicrobial Chemotherapy, 66, doi: /jac/dkr383. Plantier, J.-C., Leoz, M., Dickerson, J. E., De Oliveira, F., Cordonnier, F., Lemée, V., Simon, F. (2009). A new human immunodeficiency virus derived from gorillas. Nature Medicine, 15(8), doi: /nm Rhee, S., Liu, T., Ravela, J., Gonzales, M. J., & Shafer, R. W. (2004). Distribution of Human Immunodeficiency Virus Type 1 Protease and Reverse Transcriptase Mutation Patterns in 4, 183 Persons Undergoing Genotypic Resistance Testing, 48(8), doi: /aac Rhee, S.-Y., Taylor, J., Wadhera, G., Ben-Hur, A., Brutlag, D. L., & Shafer, R. W. (2006). Genotypic predictors of human immunodeficiency virus type 1 drug resistance. 131

151 Liste bibliographique Proceedings of the National Academy of Sciences of the United States of America, 103(46), doi: /pnas Richman, D. D., Havlir, D., Corbeil, J., Looney, D., Ignacio, C., Spector, S. A., Pauletti, D. (1994). Nevirapine resistance mutations of human immunodeficiency virus type 1 selected during therapy. Journal of Virology, 68, Ronaghi, M. (2001). Pyrosequencing sheds light on DNA sequencing. Genome Research, 11(1), Roquebert, B., Damond, F., Brun-Vézinet, F., & Descamps, D. (2009). [HIV genetic diversity and its consequences]. Pathologie-Biologie, 57(2), doi: /j.patbio Rouet, F., Chaix, M.-L. M.-L., Nerrienet, E., Ngo-Giang-Huong, N., Plantier, J.-C. J.-C., Burgard, M., Rouzioux, C. (2007). Impact of HIV-1 genetic diversity on plasma HIV- 1 RNA quantification: Usefulness of the Agence Nationale de Recherches sur le SIDA second-generation long terminal repeat-based real-time reverse transcriptase polymerase chain reaction test. Journal of Acquired Immune Deficiency Syndromes, 45(4), doi: /qai.0b013e cf5. Rouet, F., Ekouevi, D. K., Chaix, M. M.-L., Burgard, M., Inwoley, A., Tony, T. D. A., Rouzioux, C. (2005). Transfer and Evaluation of an Automated, Low-Cost Real-Time Reverse Transcription-PCR Test for Diagnosis and Monitoring of Human Immunodeficiency Virus Type 1 Infection in a West African Resource-Limited Setting. Journal of Clinical Microbiology,, 43(6), doi: /jcm Rouet, F., & Rouzioux, C. (2007a). HIV-1 viral load testing cost in developing countries: What s new? Expert Review of Molecular Diagnostics, 7(6), Rouet, F., & Rouzioux, C. (2007b). The measurement of HIV-1 viral load in resource-limited settings: How and where? Clinical Laboratory, 53(3-4), Routy, J. P. (2009). La reconstitution du système immunitaire. Relais. Retrieved October 27, 2014, from Ruelle, J., Debaisieux, L., Vancutsem, E., De Bel, A., Delforge, M.-L., Piérard, D., & Goubau, P. (2012). HIV-1 low-level viraemia assessed with 3 commercial real-time PCR assays show high variability. BMC Infectious Diseases, 12(1), 100. doi: / S. Matheron, Barin, F., Brun-Vézinet, F., Chaix, M.-L., Damond, F., Delaporte, E., Simon, F. (2010). Infections par les VIH-1 sous-types non-b, les VIH-1 groupe O et les VIH-2. Prise En Charge Des Personnes Infectées Par Le VIH, 12,

152 Liste bibliographique Serge, P., Eholié, P., Bennaï, Y., Courpotin, C., Ekouevi, D., Gallet, B., Raguin, G. (2009). Mémento thérapeutique du VIH / SIDA en Afrique. (DOIn, Ed.) (2ième ed., Vol. 2009, pp ). Shafer, R. W., Rhee, S. Y., & Bennett, D. E. (2008). Consensus drug resistance mutations for epidemiological surveillance: Basic principles and potential controversies. Antiviral Therapy. Shafer, R. W., Rhee, S.-Y., Pillay, D., Miller, V., Sandstrom, P., Schapiro, J. M., Bennett, D. (2007). HIV-1 protease and reverse transcriptase mutations for drug resistance surveillance. AIDS (London, England), 21(2), doi: /qad.0b013e328011e691. Shafer, R. W., & Schapiro, J. M. (2008). HIV-1 drug resistance mutations: an updated framework for the second decade of HAART. AIDS Reviews, 10(2), Sheldon, J. G., & Condra, J. H. (1999). Genotypic analysis methods for detection of drug resistance mutations in the HIV-1 proteinase and reverse transcriptase genes. Antiviral Therapy, 4(3), Sloma, C. R., Germer, J. J., Gerads, T. M., Mandrekar, J. N., Mitchell, P. S., & Yao, J. D. C. (2009). Comparison of the Abbott realtime human immunodeficiency virus type 1 (HIV- 1) assay to the Cobas AmpliPrep/Cobas TaqMan HIV-1 test: workflow, reliability, and direct costs. Journal of Clinical Microbiology, 47(4), doi: /jcm Spira, S., Wainberg, M. A., Loemba, H., Turner, D., & Brenner, B. G. (2003). Impact of clade diversity on HIV-1 virulence, antiretroviral drug sensitivity and drug resistance. Journal of Antimicrobial Chemotherapy. doi: /jac/dkg079. Stevens, W., Erasmus, L., Moloi, M., Taleng, T., & S Sarang. (2008). Performance of a novel human immunodeficiency virus (HIV) type 1 total nucleic acid-based real-time PCR assay using whole blood and dried blood spots for diagnosis of HIV in infants. Journal of Clinical Microbiology, 46, Taylor, N., Schmid, I., Egle, A., Greil, R., Patsch, W., & Oberkofler, H. (2009). Initial evaluation of the Roche COBAS TaqMan HIV-1 v2.0 assay for determining viral load in HIV-infected individuals. Antiviral Therapy, 14, doi: /imp1427. Thompson, J. D., Higgins, D. G., & Gibson, T. J. (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research, 22, doi: /nar/ Torti, C., Pozniak, A., Nelson, M., Hertogs, K., & Gazzard, B. G. (2001). Distribution of K103N and/or Y181C HIV-1 mutations by exposure to zidovudine and non-nucleoside reverse transcriptase inhibitors. The Journal of Antimicrobial Chemotherapy, 48,

153 Liste bibliographique Triques, K., Bourgeois, A., Saragosti, S., Vidal, N., Mpoudi-Ngole, E., Nzilambi, N., Peeters, M. (1999). High diversity of HIV-1 subtype F strains in Central Africa. Virology, 259(1), Triques, K., Bourgeois, A., Vidal, N., Mpoudi-Ngole, E., Mulanga-Kabeya, C., Nzilambi, N., Peeters, M. (2000). Near-full-length genome sequencing of divergen African HIV type 1 subtype F viruses leads to the identification of a new HIV type 1 subtype designated K. AIDS Research and Human Retroviruses, 16(2), Troppan, K. T., Stelzl, E., Violan, D., Winkler, M., & Kessler, H. H. (2009). Evaluation of the new VERSANT HIV-1 RNA 1.0 Assay (kpcr) for quantitative detection of human immunodeficiency virus type 1 RNA. Journal of Clinical Virology : The Official Publication of the Pan American Society for Clinical Virology, 46(1), doi: /j.jcv Vergne, L., Peeters, M., Mpoudi-Ngole, E., Bourgeois, A., Liegeois, F., Toure-Kane, C., Delaporte, E. (2000). Genetic Diversity of Protease and Reverse Transcriptase Sequences in Non-Subtype-B Human Immunodeficiency Virus Type 1 Strains : Evidence of Many Minor Drug Resistance Mutations in Treatment-Naive Patients Genetic Diversity of Protease and Reverse Transcr. Journal of Clinical Microbiology, 38(11), Viard, J.-P. (2009). Surveillance biologique du patient sous traitement antirétroviral. Revue Francophone Des Laboratoires, 2009(409, Supplement 1), doi:http://dx.doi.org/ /s x(09) Vidal, N., Koyalta, D., Richard, V., Lechiche, C., Ndinaromtan, T., Djimasngar, A., Peeters, M. (2003). High genetic diversity of HIV-1 strains in Chad, West Central Africa. Journal of Acquired Immune Deficiency Syndromes, 33(2), Viljoen, J., Gampini, S., Danaviah, S., Valéa, D., Pillay, S., Kania, D., Rouet, F. (2010). Dried blood spot HIV-1 RNA quantification using open real-time systems in South Africa and Burkina Faso. Journal of Acquired Immune Deficiency Syndromes (1999), 55(3), doi: /qai.0b013e3181edaaf5. Villar Garcia, M., Mukeba-Tshialala, D., Vaira, D., & Moutschen, M. (2009). Triomune: La trithérapie du pauvre? Rev Med Liège, 64(1), Vingerhoets, J., Azijn, H., Fransen, E., De Baere, I., Smeulders, L., Jochmans, D., de Béthune, M.-P. (2005). TMC125 displays a high genetic barrier to the development of resistance: evidence from in vitro selection experiments. Journal of Virology, 79(20), doi: /jvi Vingerhoets, J., Buelens, A., Peeters, M., Picchio, G., Tambuyzer, L., Van, K. C., Bethune, M. de. (2007). Impact of baseline NNRTI mutations on the virological response to etravirine in the phase III clinical trials DUET-1 and DUET-2. Antivir Ther, 12(S34). 134

154 Liste bibliographique Wainberg, M. A. (2004). HIV-1 subtype distribution and the problem of drug resistance. AIDS (London, England), 18 Suppl 3, S63 S68. doi: / Wei, X., Liang, C., Götte, M., & Wainberg, M. A. (2002). The M184V mutation in HIV-1 reverse transcriptase reduces the restoration of wild-type replication by attenuated viruses. AIDS (London, England), 16, doi: / Wei, X., Liang, C., Götte, M., & Wainberg, M. A. (2003). Negative effect of the M184V mutation in HIV-1 reverse transcriptase on initiation of viral DNA synthesis. Virology, 311(1), doi: /s (03) Wei, X., Youngpairoj, A. S., Garrido, C., Zahonero, N., Corral, A., de Mendoza, C., Garcia-Lerma, J. G. (2011). Minority HIV mutation detection in dried blood spots indicates high specimen integrity and reveals hidden archived drug resistance. Journal of Clinical Virology : The Official Publication of the Pan American Society for Clinical Virology, 50(2), doi: /j.jcv Whitcomb, J. M., Parkin, N. T., Chappey, C., Hellmann, N. S., & Petropoulos, C. J. (2003). Broad nucleoside reverse-transcriptase inhibitor cross-resistance in human immunodeficiency virus type 1 clinical isolates. The Journal of Infectious Diseases, 188, doi: / Winters, M. A., Bosch, R. J., Albrecht, M. A., & Katzenstein, D. A. (2003). Clinical impact of the M184V mutation on switching to didanosine or maintaining lamivudine treatment in nucleoside reverse-transcriptase inhibitor-experienced patients. The Journal of infectious diseases (Vol. 188, pp ). doi:jid30964 [pii]\r / Wittek, M., Stürmer, M., Doerr, H. W., & Berger, A. (2007). Molecular assays for monitoring HIV infection and antiretroviral therapy. Expert Review of Molecular Diagnostics, 7, doi: / Wojewoda, C. M., Spahlinger, T., Harmon, M. L., Schnellinger, B., Li, Q., Dejelo, C., Zhou, L. (2013). Comparison of Roche Cobas AmpliPrep/Cobas TaqMan HIV-1 test version 2.0 (CAP/CTM v2.0) with other real-time PCR assays in HIV-1 monitoring and follow-up of low-level viral loads. Journal of Virological Methods, 187(1), 1 5. doi: /j.jviromet Yahi, N., Tamalet, C., Tourrès, C., Tivoli, N., & Fantini, J. (2000). Mutation L210W of HIV- 1 reverse transcriptase in patients receiving combination therapy. Incidence, association with other mutations, and effects on the structure of mutated reverse transcriptase. Journal of Biomedical Science, 7(6), doi: Yeni, P. (2008). Rapport du Groupe d Experts 2008 sur la prise en charge médicale des patients infectées par le VIH, sous la direction du Pr Patrick Yeni (pp. 1 32). Paris. 135

155 Liste bibliographique Yeni, P. (2010). Prise en charge médicale des personnes infectées par le V I H. Retrieved from Youngpairoj, A. S., Masciotra, S., Garrido, C., Zahonero, N., de Mendoza, C., & García- Lerma, J. G. (2008). HIV-1 drug resistance genotyping from dried blood spots stored for 1 year at 4 degrees C. The Journal of Antimicrobial Chemotherapy, 61(6), doi: /jac/dkn

156 Annnexes ANNEXES 137

157 Annnexes Les annexes Annexe 1 Implementation of an In-House Quantitative Real-Time PCR for Determination of HIV Viral Load in Kinshasa Kamangu Ntambwe Erick, Chatté Adawaye, Boreux Raphael, Kalala Lunganza Richard, Mvumbi Lelo Georges, Demol Patrick, Vaira Dolores, Hayette Marie Pierre Open Access Library Journal, 1: e

158 Annnexes 139

159 Annnexes 140

160 Annnexes 141

161 Annnexes 142

162 Annnexes 143

163 Annnexes Annexe 2: Primers utilisés pour la technique ASPCR 144

Virologie en Pédiatrie

Virologie en Pédiatrie Virologie en Pédiatrie Pr Coumba Touré Kane ANRS-SENEGAL Introduc3on 3,4 millions d enfants en 2010 (OMS 2011) 90% de ces enfants en Afrique sub- saharienne 260 000 enfants infectés en 2012 Baisse de 52

Plus en détail

Virus: Virus: Diversité génétique. Diversité génétique et variation antigénique. Virus: Conséquences épidémiologiques et thérapeutiques

Virus: Virus: Diversité génétique. Diversité génétique et variation antigénique. Virus: Conséquences épidémiologiques et thérapeutiques Virus: Diversité génétique et variation antigénique Conséquences épidémiologiques et thérapeutiques M. Segondy Virus: Diversité génétique Virus: Génome + Capside ± Enveloppe 1 Virus: Diversité génétique

Plus en détail

Charges virales basses sous traitement: définition impact virologique. Laurence Bocket Virologie CHRU de Lille

Charges virales basses sous traitement: définition impact virologique. Laurence Bocket Virologie CHRU de Lille XVIIe Journée Régionale de Pathologie Infectieuse 12 octobre 2010 Charges virales basses sous traitement: définition impact virologique Laurence Bocket Virologie CHRU de Lille conflits d intérêts subventions,

Plus en détail

DÉTECTION DU GÉNOME DU VIH

DÉTECTION DU GÉNOME DU VIH DÉTECTION DU GÉNOME DU VIH AU SEIN DES FRACTIONS DU SPERME Classement NABM : 16-02 - code : non codé JUILLET 2006 Service évaluation des actes professionnels 2 avenue du Stade de France 93218 Saint-Denis

Plus en détail

Détection et prise en charge de la résistance aux antirétroviraux

Détection et prise en charge de la résistance aux antirétroviraux Détection et prise en charge de la résistance aux antirétroviraux Jean Ruelle, PhD AIDS Reference Laboratory, UCLouvain, Bruxelles Corata 2011, Namur, 10 juin 2011 Laboratoires de référence SIDA (Belgique)

Plus en détail

LE SIDA: UNE AFFECTION DU SYSTEME IMMUNITAIRE

LE SIDA: UNE AFFECTION DU SYSTEME IMMUNITAIRE LE SIDA: UNE AFFECTION DU SYSTEME IMMUNITAIRE Introduction: Le SIDA, ou syndrome immunodéficience acquise, est une maladie due à un virus, le virus de l'immunodéficience humaine ou VIH (HIV: Human Immunodeficiency

Plus en détail

Journées scientifiques du site ANRS Cameroun: 15-16 novembre 2011

Journées scientifiques du site ANRS Cameroun: 15-16 novembre 2011 Journées scientifiques du site ANRS Cameroun: 15-16 novembre 2011 Projet ANRS-12186 Évaluation de l échec virologique et résistance aux ARV chez des patients VIH positifs pris en charge dans les programmes

Plus en détail

INTÉRÊT DES PRÉLÈVEMENTS SUR BUVARD

INTÉRÊT DES PRÉLÈVEMENTS SUR BUVARD INTÉRÊT DES PRÉLÈVEMENTS SUR BUVARD 5 e réunion viro-clinique inter-corevih «VIH, cultures et thérapeutiques» Marie Leoz, 23 mars 2013 PRÉLÈVEMENT SUR BUVARD : C EST QUOI? POURQUOI? Mode alternatif de

Plus en détail

Restitution de l 'atelier 1 Protocoles thérapeutiques et aspects médicaux de la PTME

Restitution de l 'atelier 1 Protocoles thérapeutiques et aspects médicaux de la PTME Restitution de l 'atelier 1 Protocoles thérapeutiques et aspects médicaux de la PTME Modérateur : Dr Didier Koumavi Ekouevi INSERM U-897, Université Bordeaux Segalen, PACCI, Abidjan et Université de Lomé

Plus en détail

LE MALI L HÔPITAL GABRIEL TOURE L HÔPITAL DU POINT G INTRODUCTION 2 INTRODUCTION 1 DISPENSATION DES ARV DANS LES HÔPITAUX DU POINT G ET GABRIEL TOURE

LE MALI L HÔPITAL GABRIEL TOURE L HÔPITAL DU POINT G INTRODUCTION 2 INTRODUCTION 1 DISPENSATION DES ARV DANS LES HÔPITAUX DU POINT G ET GABRIEL TOURE DISPENSATION DES ARV DANS LES HÔPITAUX DU POINT G ET GABRIEL TOURE KALLE A.D A (1), BENGALY L (2)., KONE D ( 1), COULIBALY S.M (2). DIAKITE A.S. (2) DIAMOUTENE A (2) (1) Service de Pharmacie Hôpital Gabriel

Plus en détail

ONUSIDA 2013 Le sida en chiffres

ONUSIDA 2013 Le sida en chiffres ONUSIDA 2013 Le sida en chiffres 33 % de nouvelles infections à VIH en moins depuis 2001 29 % de décès liés au sida en moins (adultes et enfants) depuis 2005 52 % de nouvelles infections à VIH en moins

Plus en détail

infovihtal #6 hiver 2001

infovihtal #6 hiver 2001 infovihtal #6 Primo-infection Primo-infection Le stade qui suit l infection par le VIH est connu sous le nom de primo-infection ou phase aiguë de l infection à VIH. Quand le VIH entre dans l organisme

Plus en détail

Prévention de la transmission mère-enfant du VIH

Prévention de la transmission mère-enfant du VIH Prévention de la transmission mère-enfant du VIH Rapport Morlat2013 REUNION COREVIH - Vendredi 17 Janvier 2014 Docteur Yasmine DEBAB Service des Maladies Infectieuses et Tropicales CHU Rouen 1 I. Désir

Plus en détail

ÉPIDEMIOLOGIE DU SIDA ET DE L INFECTION À VIH EN BELGIQUE

ÉPIDEMIOLOGIE DU SIDA ET DE L INFECTION À VIH EN BELGIQUE Service maladies infectieuses dans la population générale ÉPIDEMIOLOGIE DU SIDA ET DE L INFECTION À VIH EN BELGIQUE Situation au 31 décembre ÉPIDEMIOLOGIE DU SIDA ET DE L INFECTION À VIH EN BELGIQUE Ce

Plus en détail

CENTRE HOSPITALIER LOUIS CONSTANT FLEMING. Projet :

CENTRE HOSPITALIER LOUIS CONSTANT FLEMING. Projet : CENTRE HOSPITALIER LOUIS CONSTANT FLEMING Projet : Mise en place d une unité de virologie à dominante VIH au Centre Hospitalier de Saint Martin dans le but de mettre en œuvre des actions bilatérales de

Plus en détail

Généralités sur les virus Structure, Réplication, Évolution

Généralités sur les virus Structure, Réplication, Évolution Généralités sur les virus Structure, Réplication, Évolution Les virus sont des microorganismes de très petite taille, 20 à 300 nanomètres, 100 fois plus petit qu une bactérie, non visibles en microscopie

Plus en détail

Lettre à l éditeur. Résistance du VIH aux Antirétroviraux : Quoi de neuf au Mali? Quelles. perspectives?

Lettre à l éditeur. Résistance du VIH aux Antirétroviraux : Quoi de neuf au Mali? Quelles. perspectives? Lettre à l éditeur Résistance du VIH aux Antirétroviraux : Quoi de neuf au Mali? Quelles perspectives? HIV Antiretroviral Drug Resistance: What s new in Mali? What is the future? Maiga AI 1,2, Sangare

Plus en détail

LE VIRUS DE L HEPATITE E O. ROUQUET

LE VIRUS DE L HEPATITE E O. ROUQUET LE VIRUS DE L HEPATITE E O. ROUQUET A Historique L analyse rétrospective de foyers épidémiques d hépatite aiguë non A, non B en Inde laisse supposer l existence d un autre type d hépatite virale. Le virus

Plus en détail

D A N S L E S PAY S F R A N C O P H O N E S

D A N S L E S PAY S F R A N C O P H O N E S REGARD SUR L EPIDEMIE DU VIH D A N S L E S PAY S F R A N C O P H O N E S Photo: ONUSIDA Levier de la riposte au sida, l ONUSIDA s emploie à bâtir l action politique et à promouvoir les droits de tous les

Plus en détail

LIGNES DIRECTRICES CLINIQUES TOUT AU LONG DU CONTINUUM DE SOINS : Objectif de ce chapitre. 6.1 Introduction 86

LIGNES DIRECTRICES CLINIQUES TOUT AU LONG DU CONTINUUM DE SOINS : Objectif de ce chapitre. 6.1 Introduction 86 LIGNES DIRECTRICES CLINIQUES TOUT AU LONG DU CONTINUUM DE SOINS : ÉTABLISSEMENT DE LIENS ENTRE LES PERSONNES CHEZ QUI UN DIAGNOSTIC D INFECTION À VIH A ÉTÉ POSÉ ET LES SERVICES DE SOINS ET DE TRAITEMENT

Plus en détail

Résistance du VIH-1 aux antirétroviraux dans les compartiments anatomiques et cellulaires

Résistance du VIH-1 aux antirétroviraux dans les compartiments anatomiques et cellulaires Résistance du VIH-1 aux antirétroviraux dans les compartiments anatomiques et cellulaires Jade GHOSN Laboratoire de Virologie CHU Necker-Enfants Malades EA MRT 3620 Paris 5 Réservoirs anatomiques du VIH:

Plus en détail

Comment se manifeste cette maladie? Comment repérer la séropositivité au SIDA? -> Discussion préparatoire.

Comment se manifeste cette maladie? Comment repérer la séropositivité au SIDA? -> Discussion préparatoire. I.7 Immunologie 1/4. Le SIDA Le système immunitaire est l ensemble des cellules et tissus d un individu pouvant s opposer à la pénétration et à l infection par des micro-organismes. Les moyens «de défense»

Plus en détail

UTILISATION DES ANTIRÉTROVIRAUX POUR TRAITER LA FEMME ENCEINTE ET PRÉVENIR L INFECTION À VIH CHEZ LE NOURRISSON

UTILISATION DES ANTIRÉTROVIRAUX POUR TRAITER LA FEMME ENCEINTE ET PRÉVENIR L INFECTION À VIH CHEZ LE NOURRISSON Programme VIH/sida MISE À JOUR PROGRAMMATIQUE UTILISATION DES ANTIRÉTROVIRAUX POUR TRAITER LA FEMME ENCEINTE ET PRÉVENIR L INFECTION À VIH CHEZ LE NOURRISSON RÉSUMÉ ANALYTIQUE AVRIL 2012 WHO/HIV/2012.8

Plus en détail

Les charges virales basses: constat et gestion

Les charges virales basses: constat et gestion Les charges virales basses: constat et gestion Symposium inter-régional viro-clinique Hardelot 25-26 Mai 2011 Laurence Bocket --- Laboratoire de Virologie --- CHRU Lille conflits d intérêts subventions,

Plus en détail

Objet : Changements importants relatifs aux épreuves de détection qualitative et quantitative de l ARN du virus de l hépatite C (VHC)

Objet : Changements importants relatifs aux épreuves de détection qualitative et quantitative de l ARN du virus de l hépatite C (VHC) PAR COURRIER ÉLECTRONIQUE Le 29 juillet 203 Aux responsables des laboratoires de microbiologie Aux médecins microbiologistes-infectiologues Aux médecins gastroentérologues et hépatologues Aux assistants-chefs

Plus en détail

TERMES DE REFERENCE Mission n 13INI142

TERMES DE REFERENCE Mission n 13INI142 TERMES DE REFERENCE Mission n 13INI142 I. Informations générales Intitulé de la mission Composante Thématique(s) Bénéficiaire(s) Pays Subventions FM concernées Montant de la subvention Durée totale des

Plus en détail

Cycle de réplication. Webinaire présenté par : Michael Bailey, directeur, Réalisation des programmes Date : 6 février 2014, de 13 h à 14 h (HNE)

Cycle de réplication. Webinaire présenté par : Michael Bailey, directeur, Réalisation des programmes Date : 6 février 2014, de 13 h à 14 h (HNE) Cycle de réplication virale du VIH Webinaire présenté par : Michael Bailey, directeur, Réalisation des programmes Date : 6 février 2014, de 13 h à 14 h (HNE) Pourquoi est-ce important de comprendre le

Plus en détail

ÉPIDEMIOLOGIE DU SIDA ET DE L INFECTION À VIH EN BELGIQUE

ÉPIDEMIOLOGIE DU SIDA ET DE L INFECTION À VIH EN BELGIQUE Service maladies infectieuses au sein de la population générale ÉPIDEMIOLOGIE DU SIDA ET DE L INFECTION À VIH EN BELGIQUE Situation au 31 décembre 2011 ÉPIDEMIOLOGIE DU SIDA ET DE L INFECTION À VIH EN

Plus en détail

TECHNIQUES DE NUMÉRATION DES LYMPHOCYTES T CD4 INFORMATION TECHNIQUE ORGANISATION MONDIALE DE LA SANTÉ

TECHNIQUES DE NUMÉRATION DES LYMPHOCYTES T CD4 INFORMATION TECHNIQUE ORGANISATION MONDIALE DE LA SANTÉ TECHNIQUES DE NUMÉRATION DES LYMPHOCYTES T CD4 INFORMATION TECHNIQUE ORGANISATION MONDIALE DE LA SANTÉ Organisation mondiale de la Santé 2004 Tous droits réservés. Il est possible de se procurer les publications

Plus en détail

En partenariat avec l association «Dessine-moi un mouton» Adolescence & VIH

En partenariat avec l association «Dessine-moi un mouton» Adolescence & VIH En partenariat avec l association «Dessine-moi un mouton» Adolescence & VIH En tant qu adolescents ou jeunes adultes, vous pouvez avoir besoin d informations spécifiques sur votre maladie et sa prise en

Plus en détail

TERMES DE REFERENCE. I- Contexte et justification

TERMES DE REFERENCE. I- Contexte et justification TERMES DE REFERENCE Recrutement d un/e Consultant/e National/e pour la réalisation d une analyse des barrières à l accès au dispositif national de conseil et de dépistage anonyme et gratuit du VIH existant

Plus en détail

Table des matières. Chapitre IV. Cycle de réplication virale et thérapeutiques antirétrovirales (1)... 29

Table des matières. Chapitre IV. Cycle de réplication virale et thérapeutiques antirétrovirales (1)... 29 1441 Table des matières Préface...7 Introduction...9 PREMIÈRE PARTIE : LES VIRUS Chapitre I. Historique de la découverte du VIH... 13 Chapitre II. Classification des rétrovirus... 19 Chapitre III. Structure

Plus en détail

Les virus dans les aliments : un nouveau défi pour les laboratoires de microbiologie

Les virus dans les aliments : un nouveau défi pour les laboratoires de microbiologie : un nouveau défi pour les laboratoires de microbiologie Véronique ZULIANI, Institut de la Filière Porcine Jean Christophe Augustin, ENVA, ASA Qu est ce qu un virus? Microorganisme de 15 à 40 nm Environ

Plus en détail

Sélection et Évaluation Quantitative des Médicaments pour la Prise en Charge du VIH/SIDA. Sophie Logez, OMS/PSM Addis Abeba, Ethiopie, Février 2005

Sélection et Évaluation Quantitative des Médicaments pour la Prise en Charge du VIH/SIDA. Sophie Logez, OMS/PSM Addis Abeba, Ethiopie, Février 2005 Sélection et Évaluation Quantitative des Médicaments pour la Prise en Charge du VIH/SIDA Sophie Logez, OMS/PSM Addis Abeba, Ethiopie, Février 2005 Sélection et Évaluation Quantitative Références Sélection

Plus en détail

Dépistage VIH. Témoignages des usagers Auprès de Sida Info Service LE DEPISTAGE DU VIH EN FRANCE. Quelques données épidémiologiques

Dépistage VIH. Témoignages des usagers Auprès de Sida Info Service LE DEPISTAGE DU VIH EN FRANCE. Quelques données épidémiologiques Dépistage VIH Témoignages des usagers Auprès de Sida Info Service LE DEPISTAGE DU VIH EN FRANCE Quelques données épidémiologiques Selon l Institut de Veille Sanitaire (InVS) 1, en 2007 cinq millions de

Plus en détail

brochure papamamanbebe.net Comment faire un bébé? Des parents concernés par le VIH vous expliquent

brochure papamamanbebe.net Comment faire un bébé? Des parents concernés par le VIH vous expliquent 1 brochure Comment faire un bébé? Des parents concernés par le VIH vous expliquent OUI c est possible de faire un bébé quand on a le VIH! Alors, comment faire? Vous devez protéger votre partenaire et votre

Plus en détail

Données épidémiologiques sur l infection à VIH/sida 1 er décembre 2009 Institut de Veille Sanitaire

Données épidémiologiques sur l infection à VIH/sida 1 er décembre 2009 Institut de Veille Sanitaire Données épidémiologiques sur l infection à VIH/sida 1 er décembre 2009 Institut de Veille Sanitaire Dossier de presse du 27 novembre 2009 En plus des données concernant les découvertes de séropositivité

Plus en détail

Dr Pantxika BELLECAVE MFP- UMR 5234 Laboratoire de virologie du Pr. Fleury

Dr Pantxika BELLECAVE MFP- UMR 5234 Laboratoire de virologie du Pr. Fleury Dr Pantxika BELLECAVE MFP- UMR 5234 Laboratoire de virologie du Pr. Fleury 1 er cas SIDA MONO BI HAART (TRITHERAPIE) 1981 1987 1991 1992 1991 1994 1995 1996 1997 1998 1999 2000 2001 2002 2003 2004 2005

Plus en détail

Diagnostic des Hépatites virales B et C. P. Trimoulet Laboratoire de Virologie, CHU de Bordeaux

Diagnostic des Hépatites virales B et C. P. Trimoulet Laboratoire de Virologie, CHU de Bordeaux Diagnostic des Hépatites virales B et C P. Trimoulet Laboratoire de Virologie, CHU de Bordeaux Diagnostic VHC Dépistage: pourquoi? Maladie fréquente (Ac anti VHC chez 0,84% de la population soit 367 055

Plus en détail

GUIDE NATIONAL SUR LE DIAGNOSTIC BIOLOGIQUE DE L INFECTION A VIH/sida

GUIDE NATIONAL SUR LE DIAGNOSTIC BIOLOGIQUE DE L INFECTION A VIH/sida REPUBLIQUE ALGERIENNE DEMOCRATIQUE ET POPULAIRE Ministère de la Santé, de la Population et de la Réforme Hospitalière Direction Générale de la Prévention et de la Promotion de la Santé GUIDE NATIONAL SUR

Plus en détail

C N (1,2), MA (1), X (1), G (1), M (1), T (1), C (2), P (3), M (4), V (1,5), JP (1,5), PN. (1), E

C N (1,2), MA (1), X (1), G (1), M (1), T (1), C (2), P (3), M (4), V (1,5), JP (1,5), PN. (1), E Caractérisation phénotypique et rôle des lymphocytes T régulateurs intra- hépatiques au cours de l hépatite chronique virale C N Sturm (1,2), MA Thélu (1), X Camous (1), G Dimitrov (1), M Ramzan (1), T

Plus en détail

Un nouveau cadre d investissement pour la riposte

Un nouveau cadre d investissement pour la riposte ONUSIDA Note d information 2011 Un nouveau cadre d investissement pour la riposte mondiale au VIH Version originale anglaise, UNAIDS / JC2244F, novembre 2011 : A new investment framework for the global

Plus en détail

Prévalence des génotypes du HPV à HR oncogènes dans les échantillons cervicaux analysés au Centre Pasteur du Cameroun

Prévalence des génotypes du HPV à HR oncogènes dans les échantillons cervicaux analysés au Centre Pasteur du Cameroun Prévalence des génotypes du HPV à HR oncogènes dans les échantillons cervicaux analysés au Centre Pasteur du Cameroun Richard Njouom Chef du Service de Virologie Centre Pasteur Cameroun Worshop on HPV/Cervical

Plus en détail

LA RÉSISTANCE DU VIH AUX ANTIRÉTROVIRAUX DOCUMENT ANALYTIQUE

LA RÉSISTANCE DU VIH AUX ANTIRÉTROVIRAUX DOCUMENT ANALYTIQUE LA RÉSISTANCE DU VIH AUX ANTIRÉTROVIRAUX DOCUMENT ANALYTIQUE SURVEILLANCE DE LA RÉSISTANCE DU VIH AUX ANTIRÉTROVIRAUX CHEZ LES ADULTES QUI COMMENCENT UN TRAITEMENT ANTIRÉTROVIRAL (RÉSISTANCE DU VIH AUX

Plus en détail

Hiver 2013. Tests associés... Comment savoir s ils sont sécuritaires et efficaces?

Hiver 2013. Tests associés... Comment savoir s ils sont sécuritaires et efficaces? Hiver 2013 Tests associés... Comment savoir s ils sont sécuritaires et efficaces? Tests associés... Comment savoir s ils sont sécuritaires et efficaces? Notre article précédent, Médecines personnalisées,

Plus en détail

TEST DE DÉPISTAGE DE L IMMUNITÉ CONTRE LE

TEST DE DÉPISTAGE DE L IMMUNITÉ CONTRE LE TEST DE DÉPISTAGE DE L IMMUNITÉ CONTRE LE 14 TÉTANOS ET LA ROUGEOLE 14.1 INTRODUCTION Soumaïla MARIKO Comme on l a déjà précisé au chapitre 1, des tests de dépistage de l immunité contre le tétanos et

Plus en détail

RÉSUMÉ. Mots-clés: méthodes de diagnostic, réaction de polymérisation en chaîne (PCR) optimisation, viroses des animaux de compagnie.

RÉSUMÉ. Mots-clés: méthodes de diagnostic, réaction de polymérisation en chaîne (PCR) optimisation, viroses des animaux de compagnie. RÉSUMÉ Mots-clés: méthodes de diagnostic, réaction de polymérisation en chaîne (PCR) optimisation, viroses des animaux de compagnie. 1. L'importance de la thèse Actuellement, la pathologie infectieuse/contagieuse

Plus en détail

Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013

Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013 Sélectionner les propositions exactes Université Bordeaux Segalen - PACES 2012-2013 ED UE9s Avril 2013 QCM 1 La plupart des techniques de biologie moléculaire repose sur le principe de complémentarité

Plus en détail

Cible 5.A. Afrique subsaharienne. Asie du Sud. Océanie. Caraïbes. Asie du Sud-Est

Cible 5.A. Afrique subsaharienne. Asie du Sud. Océanie. Caraïbes. Asie du Sud-Est 28 Objectifs du millénaire pour le développement : rapport de 2013 Objectif 5 Améliorer la santé maternelle Faits en bref XX En Asie de l Est, en Afrique du Nord et en, la mortalité maternelle a diminué

Plus en détail

57 ème Répi. Les résistances virales aux traitements anti-vih

57 ème Répi. Les résistances virales aux traitements anti-vih 57 ème Répi Les résistances virales aux traitements anti-vih Le virus du sida est considéré comme le plus variable des agents viraux, à l origine d une maladie humaine ; cela est dû à son haut niveau de

Plus en détail

Prévention de la transmission du VIH en Afrique Subsaharienne, expérience eu Burundi.

Prévention de la transmission du VIH en Afrique Subsaharienne, expérience eu Burundi. Prévention de la transmission du VIH en Afrique Subsaharienne, expérience eu Burundi. W E B I N A R D U 2 4 AV R I L 2 0 1 4 U N I C E F, E S T H E R, S F L S, C H U D E R E N N E S D R C É D R I C A R

Plus en détail

[ENFANTS NON SCOLARISÉS : DE

[ENFANTS NON SCOLARISÉS : DE [ENFANTS NON SCOLARISÉS : DE NOUVELLES DONNÉES SOULIGNENT LES DÉFIS PERSISTANTS Cette fiche d information présente de nouvelles données relatives à l année scolaire qui s est achevée en sur le nombre d

Plus en détail

Perspectives en sciences sociales et santé publique. Bernard Taverne (CRCF/IRD)

Perspectives en sciences sociales et santé publique. Bernard Taverne (CRCF/IRD) Perspectives en sciences sociales et santé publique Bernard Taverne (CRCF/IRD) Journée scientifique ANRS, Dakar 25 juin 2010 Le devenir des patients au delà d un processus de recherche clinique, Organisation

Plus en détail

Dépistage et diagnostic de l infection VIH: place des autotests. Véronique Lemée Virologie CHU Rouen

Dépistage et diagnostic de l infection VIH: place des autotests. Véronique Lemée Virologie CHU Rouen Dépistage et diagnostic de l infection VIH: place des autotests Véronique Lemée Virologie CHU Rouen Diversité génétique des VIH SIVsm SIVgor SIVcpz I Au moins 13 transmissions du singe à l Homme 2 types

Plus en détail

Laboratoire Cerba. Congrès SHIP Marseille 15 Octobre 2010

Laboratoire Cerba. Congrès SHIP Marseille 15 Octobre 2010 Diagnostic prénatal non invasif à partir du sang maternel > J.M. COSTA Laboratoire Cerba Congrès SHIP Marseille 15 Octobre 2010 Diagnostic prénatal in utero en France : quelques chiffres clés Toutes indications

Plus en détail

2-1- Modalités de la trithérapie antirétrovirale chez la femme enceinte

2-1- Modalités de la trithérapie antirétrovirale chez la femme enceinte PRÉVENTION DE LA TRANSMISSION MÈRE-ENFANT 2-1- Modalités de la trithérapie antirétrovirale chez la femme enceinte 2-1-1- Objectif du traitement L objectif du traitement antirétroviral est l obtention d

Plus en détail

Etude APROVIR: Résumé du protocole

Etude APROVIR: Résumé du protocole AntiPROtéases COhorte Résumé Objectif principal Etudier l'évolution clinique et biologique des patients infectés par le VIH débutant un traitement avec antiprotéase dans le contexte de la pratique actuelle

Plus en détail

Prévention de la transmission mère enfant (PTME) Comité de liaison NIGER Octobre 2009 Dr gilles Raguin, GIP ESTHER

Prévention de la transmission mère enfant (PTME) Comité de liaison NIGER Octobre 2009 Dr gilles Raguin, GIP ESTHER Prévention de la transmission mère enfant (PTME) Etat des lieux Comité de liaison NIGER Octobre 2009 Dr gilles Raguin, GIP ESTHER Pourcentage de femmes enceintes HIV-positive ayant reçu une PTME, 2007

Plus en détail

Annales du Contrôle National de Qualité des Analyses de Biologie Médicale

Annales du Contrôle National de Qualité des Analyses de Biologie Médicale Annales du Contrôle National de Qualité des Analyses de Biologie Médicale ARN du virus de l hépatite C : ARN-VHC ARN-VHC 03VHC1 Novembre 2003 Edité : mars 2006 Annales ARN-VHC 03VHC1 1 / 8 ARN-VHC 03VHC1

Plus en détail

Myron S. Cohen, MD (Président) Ouverture de la séance

Myron S. Cohen, MD (Président) Ouverture de la séance Myron S. Cohen, MD (Président) Ouverture de la séance Bienvenue à tous, je m appelle Myron (Mike) Cohen; je suis le directeur du centre des maladies infectieuses à l Université de Caroline du Nord à Chapel

Plus en détail

LA TUBERCULOSE DANS LE MONDE, 2007

LA TUBERCULOSE DANS LE MONDE, 2007 LA SITUATION DE LA TUBERCULOSE DANS LE MONDE ET EN AFRIQUE Par le Professeur Pierre Chaulet Alger 29 Novembre 2009 LA TUBERCULOSE DANS LE MONDE, 2007 En millions Taux Population mondiale 6.668 100% Personnes

Plus en détail

Réalisation d une étude épidémiologique

Réalisation d une étude épidémiologique Réalisation d une étude épidémiologique Dr A.TIBICHE, Médecin Epidémiologiste, Service d Epidémiologie et de Médecine Préventive, CHU de Tizi-Ouzou. Introduction La réalisation d une étude épidémiologique

Plus en détail

Avis 6 novembre 2013

Avis 6 novembre 2013 COMMISSION DE LA TRANSPARENCE Avis 6 novembre 2013 VIREAD 245 mg, comprimés pelliculés Boîte de 1 flacon de 30 comprimés (CIP : 34009 358 500 1 0) VIREAD 33 mg/g, granulés pour administration orale Boîte

Plus en détail

TEST DE DÉTECTION DE LA PRODUCTION D INTERFÉRON γ POUR LE DIAGNOSTIC DES INFECTIONS TUBERCULEUSES

TEST DE DÉTECTION DE LA PRODUCTION D INTERFÉRON γ POUR LE DIAGNOSTIC DES INFECTIONS TUBERCULEUSES TEST DE DÉTECTION DE LA PRODUCTION D INTERFÉRON γ POUR LE DIAGNOSTIC DES INFECTIONS TUBERCULEUSES Classement NABM : non inscrit code : non codé DÉCEMBRE 2006 Service évaluation des actes professionnels

Plus en détail

Item 169 : Évaluation thérapeutique et niveau de preuve

Item 169 : Évaluation thérapeutique et niveau de preuve Item 169 : Évaluation thérapeutique et niveau de preuve COFER, Collège Français des Enseignants en Rhumatologie Date de création du document 2010-2011 Table des matières ENC :...3 SPECIFIQUE :...3 I Différentes

Plus en détail

La cytométrie de flux

La cytométrie de flux TD5 La cytométrie de flux Air sous-pression Signal de formation des gouttes Signal de charge des gouttes Cellules en suspension Liquide de Gaine Vibrateur Ultrason Dˇtecteur de Lumi re Arrt du Faisceau

Plus en détail

La Grippe en questions

La Grippe en questions 1 La Grippe en questions Qu est ce que la grippe? Que sont les virus grippaux? La grippe est une infection virale respiratoire aiguë contagieuse. Les virus grippaux se répartissent entre différents types

Plus en détail

MALI MEDICAL. Echec virologique aux antirétroviraux

MALI MEDICAL. Echec virologique aux antirétroviraux ETUDE DE DEUX CAS D ECHEC VIROLOGIQUE AUX ANTIRETROVIRAUX A L INSTITUT D HYGIENE SOCIALE (IHS) DE DAKAR Study of two cases of virological failure of the antiretroviral in the Institute of Social Hygiene(ISH)

Plus en détail

Lecture historique et prospective du rôle de la barrière génétique

Lecture historique et prospective du rôle de la barrière génétique Lecture historique et prospective du rôle de la barrière génétique Clotilde Allavena NANTES Symposium JANSSEN JNI 2011, Toulouse Jusqu en 1996, la montée en puissance Bithérapie 2 NUCs Trithérapie 2 NUCs

Plus en détail

Hépatite chronique B Moyens thérapeutiques

Hépatite chronique B Moyens thérapeutiques Hépatite chronique B Moyens thérapeutiques Dr Olfa BAHRI Laboratoire de Virologie Clinique Institut Pasteur de Tunis INTRODUCTION Plus de 300. 10 6 porteurs chroniques de VHB dans le monde Hépatite chronique

Plus en détail

Résistance aux antirétroviraux chez les enfants et adolescents infectés par le VIH, suivis au service de pédiatrie du CHU GABRIEL TOURE.

Résistance aux antirétroviraux chez les enfants et adolescents infectés par le VIH, suivis au service de pédiatrie du CHU GABRIEL TOURE. Ministère de l Enseignement Supérieur, Et de la Recherche Scientifique République du Mali Un Peuple Un But Une Foi ***************** ***************** Année Universitaire 2013 2014 ****************** Thèse

Plus en détail

Charte de la Banque ADN et de Cellules de Généthon

Charte de la Banque ADN et de Cellules de Généthon Sommaire 1. PREAMBULE... 2 2. DEFINITIONS... 2 3. CADRE LEGAL... 3 4. ORGANISATION DE LA BACG... 4 5. PRESTATIONS DE LA BACG... 5 6. MODALITES DE CONTRIBUTION ET D UTILISATION DES SERVICES... 5 7. REGLES

Plus en détail

IMMUNOLOGIE - EXERCICES TYPE II-2 OBLIGATOIRE

IMMUNOLOGIE - EXERCICES TYPE II-2 OBLIGATOIRE IMMUNOLOGIE - EXERCICES TYPE II-2 OBLIGATOIRE SUJET 1 La phase symptomatique du sida est caractérisée par un taux très faible de lymphocytes T cytotoxiques et de lymphocytes T4. Les patients qui rentrent

Plus en détail

QU EST-CE QUE LA PROPHYLAXIE?

QU EST-CE QUE LA PROPHYLAXIE? QU EST-CE QUE LA PROPHYLAXIE? TABLES DES MATIÈRES Publié par la Fédération mondiale de l hémophilie (FMH) Fédération mondiale de l hémophilie, 2014 La FMH encourage la traduction et la redistribution de

Plus en détail

JNI. Pr B Lina. Les tests rapides grippe : leur utilisation en pratique de ville

JNI. Pr B Lina. Les tests rapides grippe : leur utilisation en pratique de ville Les tests rapides grippe : leur utilisation en pratique de ville Pr B Lina Hospices Civils de Lyon, CNR des virus influenza (Sud), F69677, Bron Université de Lyon, Université Lyon 1, F69372, Lyon JNI 15

Plus en détail

Maladies àprévention vaccinale chez les personnes vivant avec le VIH VACCINATION CONTRE LA FIÈVRE JAUNE

Maladies àprévention vaccinale chez les personnes vivant avec le VIH VACCINATION CONTRE LA FIÈVRE JAUNE Maladies àprévention vaccinale chez les personnes vivant avec le VIH VACCINATION CONTRE LA FIÈVRE JAUNE Nathalie Colin de Verdière CVI SMIT Hôpital Saint-Louis Une maladie toujours d actualité Données

Plus en détail

Avis 6 novembre 2013

Avis 6 novembre 2013 COMMISSION DE LA TRANSPARENCE Avis 6 novembre 2013 ISENTRESS, comprimé à croquer 25 mg Flacon de 60 comprimés (CIP : 3400926992408) ISENTRESS, comprimé à croquer sécable 100 mg Flacon de 60 comprimés (CIP

Plus en détail

Suivi de la grossesse d une femme infectée par le VIH et modalités d accouchement. Dr Nicolas Sananès

Suivi de la grossesse d une femme infectée par le VIH et modalités d accouchement. Dr Nicolas Sananès Suivi de la grossesse d une femme infectée par le VIH et modalités d accouchement Dr Nicolas Sananès 27 novembre 2012 Plan Problématique Dépistage pendant la grossesse Suivi de la grossesse Modalités d

Plus en détail

Situation du VIH-sida en France

Situation du VIH-sida en France Situation du VIH-sida en France Données du 3 juin 27 Unité VIH/Sida-IST-VHC Département des Maladies Infectieuses Institut de Veille Sanitaire 1 Sommaire I - Découvertes de séropositivité VIH diapositive

Plus en détail

Vademecum du doctorant en sciences politiques et sociales

Vademecum du doctorant en sciences politiques et sociales Vademecum du doctorant en sciences politiques et sociales (année académique 2007-2008) Le cursus doctoral en sciences politiques et sociales est une formation de 3 e cycle qui débouche sur le grade de

Plus en détail

ACCÉLÉRER METTRE FIN À L ÉPIDÉMIE DE SIDA D ICI À 2030

ACCÉLÉRER METTRE FIN À L ÉPIDÉMIE DE SIDA D ICI À 2030 ACCÉLÉRER METTRE FIN À L ÉPIDÉMIE DE SIDA D ICI À 2030 Mettre fin à l épidémie de sida ces mots renferment de tels espoirs et de telles promesses. Grâce à des engagements mondiaux et à des objectifs précis,

Plus en détail

IMMUNOLOGIE. La spécificité des immunoglobulines et des récepteurs T. Informations scientifiques

IMMUNOLOGIE. La spécificité des immunoglobulines et des récepteurs T. Informations scientifiques IMMUNOLOGIE La spécificité des immunoglobulines et des récepteurs T Informations scientifiques L infection par le VIH entraîne des réactions immunitaires de l organisme qui se traduisent par la production

Plus en détail

Infections aiguës respiratoires

Infections aiguës respiratoires Infections aiguës respiratoires Apport de la biologie moléculaire Marie-Claude Bernard D I symposium infections aiguës respiratoires 29/03/05 - p.1 Le diagnostic Culture EIA ICT (immunochromato) Immuno

Plus en détail

Analyses dans les essais thérapeutiques :

Analyses dans les essais thérapeutiques : 6ème Université d été Recherche et Evaluation en Cancérologie Analyses dans les essais thérapeutiques : analyses intermédiaires, finale et cross-over. M. Bouziani (Oran) 1 Laboratoire de biostatistique

Plus en détail

GINGIVO-STOMATITES HERPETIQUES: Quels prélèvements et quelles techniques?

GINGIVO-STOMATITES HERPETIQUES: Quels prélèvements et quelles techniques? GINGIVO-STOMATITES HERPETIQUES: Quels prélèvements et quelles techniques? Dr C. ZANDOTTI Laboratoire de Virologie du Pr D. Raoult CHU Timone, Marseille. Virus herpes simplex (HSV) Virus strictement humain,

Plus en détail

Cours d introduction à la génétique de la souris Notion de Souche

Cours d introduction à la génétique de la souris Notion de Souche Cours d introduction à la génétique de la souris Notion de Souche Introduction: - Réponse d un animal à l expérimentation (diapo 1) Facteurs environnementaux et propres à l animal - Notion d animal standardisé

Plus en détail

L investigation chez la personne infectée par le VIH

L investigation chez la personne infectée par le VIH P O U R Q U O I P A R L E R D U V I H E N 2 0 0 4? 2 L investigation chez la personne infectée par le VIH quand et comment utiliser les différents tests de laboratoire? par Harold Dion Paul, un homme de

Plus en détail

Les souches VIH-1 et la pharmacorésistance primaire au Canada

Les souches VIH-1 et la pharmacorésistance primaire au Canada Agence de santé publique du Canada Public Health Agency of Canada Les souches VIH-1 et la pharmacorésistance primaire au Canada Rapport de surveillance en date du 31 mars 2004 mai 2005 Les souches VIH-1

Plus en détail

Le don de moelle osseuse :

Le don de moelle osseuse : DON DE MOELLE OSSEUSE Le don de moelle osseuse : se décider aujourd hui, s engager pour longtemps LA MOELLE OSSEUSE ET SA GREFFE La moelle osseuse C est le tissu mou dans le centre du corps des os qui

Plus en détail

Université Pierre et Marie Curie Master BMC Immunotechnologie. Module Immunothérapie Cellulaire et Génique Bertrand Bellier / François Lemoine

Université Pierre et Marie Curie Master BMC Immunotechnologie. Module Immunothérapie Cellulaire et Génique Bertrand Bellier / François Lemoine Université Pierre et Marie Curie Master BMC Immunotechnologie Module Immunothérapie Cellulaire et Génique Bertrand Bellier / François Lemoine Examen Janvier 2008 Introduction (à lire attentivement) L actualité

Plus en détail

brochure papamamanbebe.net COMMENT FAIRE UN BÉBÉ? Des parents concernés par le VIH vous expliquent

brochure papamamanbebe.net COMMENT FAIRE UN BÉBÉ? Des parents concernés par le VIH vous expliquent 1 brochure papamamanbebe.net COMMENT FAIRE UN BÉBÉ? Des parents concernés par le VIH vous expliquent OUI c est possible de faire un bébé quand on a le VIH! Alors, comment faire? Vous devez protéger votre

Plus en détail

22 Nous Reconnaissons la force du pardon

22 Nous Reconnaissons la force du pardon 22 Nous Reconnaissons la force du pardon 23 Par le rite pénitentiel, les chrétiens se tournent vers Dieu pour lui demander son pardon. Dieu nous reçoit tels que nous sommes et nous pardonne pour que nous

Plus en détail

Diagnostic biologique de l infection par le VIH La place des Tests Rapides d Orientation Diagnostique (TROD)

Diagnostic biologique de l infection par le VIH La place des Tests Rapides d Orientation Diagnostique (TROD) Diagnostic biologique de l infection par le VIH La place des Tests Rapides d Orientation Diagnostique (TROD) Séminaire de Formation Jeudi 13 et Vendredi 14 décembre 2012 Dr A.Maillard, unité de Rétrovirologie,

Plus en détail

Evaluation de la Dissémination du Niger. d amélioration des soins obstétricaux et

Evaluation de la Dissémination du Niger. d amélioration des soins obstétricaux et URC/HCI : PROTOCOLE DE RECHERCHE ET D EVALUATION Evaluation de la Dissémination du Niger au Mali des meilleures pratiques de la mise en œuvre du collaboratif d amélioration des soins obstétricaux et néonataux

Plus en détail

Annales du Contrôle National de Qualité des Analyses de Biologie Médicale

Annales du Contrôle National de Qualité des Analyses de Biologie Médicale Annales du Contrôle National de Qualité des Analyses de Biologie Médicale Charge virale de l Hépatite C : ARN-VHC ARN-VHC 05VHC1 mars 2005 Edition : novembre 2006 Annales ARN-VHC 05VHC1 1 / 14 ARN-VHC

Plus en détail

Nouvelles stratégies de dépistage du VIH. Dr Laurent Malato Laboratoire de Virologie CHU Bordeaux Pellegrin 12 Décembre 2011

Nouvelles stratégies de dépistage du VIH. Dr Laurent Malato Laboratoire de Virologie CHU Bordeaux Pellegrin 12 Décembre 2011 Nouvelles stratégies de dépistage du VIH Dr Laurent Malato Laboratoire de Virologie CHU Bordeaux Pellegrin 12 Décembre 2011 Point épidémiologique sur le VIH Dépistage du VIH en France 5 millions de sérologies

Plus en détail

Transmission nosocomiale des entérovirus :

Transmission nosocomiale des entérovirus : Transmission nosocomiale des entérovirus : Intérêt du diagnostic moléculaire rapide associé au génotypage prospectif Enseignement à propos d une observation Audrey MIRAND EA3843 Laboratoire de Virologie

Plus en détail

Réglementation européenne. enne des dispositifs médicaux m diagnostic in vitro. E. LAFORGERIE 19 juillet 2006

Réglementation européenne. enne des dispositifs médicaux m diagnostic in vitro. E. LAFORGERIE 19 juillet 2006 Réglementation européenne enne des dispositifs médicaux m de diagnostic in vitro E. LAFORGERIE 19 juillet 2006 Historique des réglementationsr Décret du 19 avril 1996 relatif à l enregistrement des réactifsr

Plus en détail

Série : STL Spécialité biotechnologies SESSION 2014 BACCALAURÉAT TECHNOLOGIQUE

Série : STL Spécialité biotechnologies SESSION 2014 BACCALAURÉAT TECHNOLOGIQUE BACCALAURÉAT TECHNLGIQUE Série : STL Spécialité biotechnologies SESSIN 2014 CBSV : sous épreuve coefficient 4 Biotechnologies : sous épreuve coefficient 4 Durée totale de l épreuve: 4 heures Les sujets

Plus en détail

INFECTIONS NOSOCOMIALES

INFECTIONS NOSOCOMIALES INFECTIONS NOSOCOMIALES I - Définitions La définition générale d une infection nososcomiale est la suivante : infection contractée au cours d un séjour dans un établissement de soins. Un délai de 48h au

Plus en détail